Australia's BIGGEST New Car WebsiteAustralia's BIGGEST New Car WebsiteNews Reviews Research Buy SellGuest User S5: Simplified lineup brings range-wide price hikeAudi has announced pricing for its new A5 range and it's considerably more expensive than some of the models replaced Audi Australia has announced pricing for its new A5 and S5 lineup with the model’s entry point up by nearly $15,000 over the A4 it replaces The new A5 and S5 range, arriving in showrooms “soon”, is a consolidated lineup that entirely replaces the previous-generation A4, S4 Audi’s new A5 Sedan S line – which features a liftback tailgate – opens the range at $79,900 before on-road costs up $13,600 on the defunct A4 35 TFSI S line Sedan at $66,300 before on-roads Hundreds of new car deals are available through CarExpert right now. Get the experts on your side and score a great deal. Browse now. as the outgoing A5 Sportback 40 TFSI S line was priced at $78,500 before on-roads – marking an increase of $1400 The more performance-oriented S5 Sedan now costs $114,900 before on-roads up from $106,200 before on-roads for the previous S4 quattro Sedan or from $113,200 before on-roads for the S5 quattro Audi has introduced a special “edition one” version of the S5 priced at $99,900 before on-roads and kitted out with blacked-out trim pieces though missing some of the niceties of the S5 It’s $3000 more expensive than its Sedan counterpart and $9200 more expensive than the old S4 Avant quattro Audi has an “edition one” version of the S5 Avant that commands a more competitive price of $102,900 before on-roads the A4/S4 and A5/S5 range has been consolidated from 14 variants – excluding RS performance models – to just five at launch or three when the introductory special edition models are excluded It’s expected the new-generation A5 won’t spawn coupe or convertible body styles like the outgoing A5 while the A4 Sedan and A5 Sportback have been replaced by the A5 Sedan There’s no official information on full-fat replacements for the RS4 Avant quattro, RS5 quattro, or RS5 Sportback quattro as yet. A new RS5 has been spied testing in the past and will likely be powered by a twin-turbo V6 with plug-in hybrid (PHEV) assistance Powering the new A5 sedan is a 2.0-litre turbocharged four-cylinder petrol engine producing 150kW of power and 340Nm of torque Power is sent to the front wheels only through a seven-speed S tronic dual-clutch automatic transmission The S5 Sedan and Avant jump to a 3.0-litre turbocharged six-sylinder petrol engine with Audi’s mild-hybrid plus technology These cars benefit from the German brand’s quattro all-wheel drive system and all utilise a seven-speed dual-clutch automatic Equipment on the A5 includes Matrix LED headlights; 19-inch alloy wheels; power-adjustable and heated front sports seats; a 14.5-inch touchscreen infotainment system; and a 11.9-inch digital instrument cluster S5 models upgrade to 20-inch wheels; Nappa leather upholstery; front sports seats with heating and massage functionality; a Bang & Olufsen sound system; and a 10.9-inch entertainment display for the front passenger All specifications and standard equipment for the new A5 range will be outlined in a full price and specs article MORE: Here’s what you need to know about Audi’s new hybrid techMORE: 2026 Audi RS5 – Next-gen BMW M3 rival spiedMORE: Everything Audi A5 • S5 Max Davies is an automotive journalist based in Melbourne Max studied journalism at La Trobe University and stepped into the automotive world after graduating in late 2023 and with a passion for everything motorsport is a fan of Fernando Alonso The page you are looking for cannot be found Zwilling debuts the XTEND collection with clever battery system a three appliance collection which uses a clever battery system for consistent charge all of which use the same battery system to charge them all Zwilling has just launched its new cordless collection and it’s got a clever battery system The XTEND range features three handheld appliances all of which are powered by the same battery – and the pricing is seriously affordable The battery offers the appliances 120 minutes of runtime on a single charge which takes approximately 90 minutes to charge fully the Zwilling XTEND battery means you don’t constantly need to swap out batteries to keep them working It also gives users the freedom to use their appliances wherever they are in the kitchen the XTEND line-up has three products – the XTEND Hand Mixer the XTEND Hand Blender and the XTEND Handheld Vacuum Cleaner The battery system easily slots into the top/bottom of the appliances and the battery itself has LED lights to show the charging status so you don’t run out of charge The Zwilling XTEND range is very similar to the KitchenAid Go Cordless range which debuted last year The KitchenAid Go Cordless also comes with one rechargeable battery which powers six kitchen appliances It’s unclear whether Zwilling took inspiration from the KitchenAid Go range but having one battery system for multiple appliances is definitely something I’m looking forward to seeing more of this year I also hope that Zwilling will add more appliances to the XTEND range especially if Matteo Thun and Antonio Rodriguez will continue to design the products as the sleek black matte finishes are truly beautiful home and active products from the T3 experts From the comfiest mattresses to strange things you can cook in an air fryer chances are Beth knows about it and has the latest reviews and recommendations She's also in the know about the latest deals and discount codes from top brands and retailers Having always been passionate about writing newspapers and magazines on a variety of topics You can find her work across numerous sites baking and attempting craft projects that will probably end in disaster you will then be prompted to enter your display name Get the latest news to your email inbox FREE Cass unlocked the doors to Hilltop Blooms just as the sun crested the hill casting a golden light over the […] Get an all ACCESS PASS to the News and your Digital Edition with an online subscription Get an all access pass to the News and your Digital Edition with an online subscription Opinion | May 2 a company called Colossal Biosciences now claims to have produced three genetically engineered pups of the long-extinct dire wolf The company’s press release claimed the pups to be “the world’s first de-extinct animals … brought back from extinction using genetic edits derived from a complete dire wolf genome meticulously reconstructed by Colossal from ancient DNA.” Experts in paleogenetics pointed out that only 14 genes with 20 differences between living gray wolves and extinct dire wolves were involved in the “edits.” Pontus Skoglund head of the Ancient Genomics Laboratory at Britain’s Francis Crick Institute posted on BlueSky: “Would a chimpanzee with 20 gene edits be human … These individuals seem optimistically 1/100,000th dire wolf.” What is the plan for dire wolves and other “de-extinct” species? Where is the habitat for an animal that was adapted for preying on now-extinct megafauna like ground sloths and giant bison? How might dire wolves and gray wolves co-exist And the real question: Wouldn’t Colossal’s enormous financial resources be better used to conserve existing species?  the company has been valued at $10.2 billion and has raised $435 million in funding; billionaire and conservative mega-donor Peter Thiel is an investor there is one place where the scientifically dubious and ethically problematic goal of “de-extinction” has been embraced without reservation: the Trump Administration.  Interior Secretary Doug Burgum claimed that most species listed under the Endangered Species Act (ESA) have not recovered “because the status quo is focused on regulation more than innovation,” and went on to hail Colossal’s announcement: “The revival of the Dire Wolf heralds the advent of a thrilling new era of scientific wonder showcasing how the concept of de-extinction can serve as a bedrock for modern species conservation.” Burgum’s endorsement of Colossal went even farther during a meeting with Interior Department employees: “If we’re going to be in anguish about losing a species now we have an opportunity to bring them back Pick your favorite species and call Colossal.” The Endangered Species Act has produced some spectacular recovery successes And the law has succeeded in preventing the extinction of over 99% of listed species Burgum is correct that most ESA-listed species have not recovered sufficiently to be “delisted,” declared no longer at risk of extinction But the reason is not excessive regulation A peer-reviewed analysis of species listed by the law from 1992 through 2020 concluded that the reasons for the low rate of delisting were “small population sizes at time of listing coupled with delayed protection and insufficient funding.” To this can be added the fact that by the time many species are listed their suitable habitat has dwindled too much to support robust recovered populations The “innovation” needed to protect America’s biodiversity is not the high-tech resurrection of extinct species It is simply to list declining species earlier when their populations are still large enough to benefit from the protections that the law provides And funding must be sufficient to support scientifically sound recovery plans The paper cited above found that spending per listed species declined by nearly 50% from 1985 to 2020 Burgum’s statements ignore the most basic goal of conservation it is to help populations sustain themselves in their native habitats fulfilling their ecological roles and exhibiting the full range of their natural behaviors.  The idea that species can be conserved by picking up the phone to “call Colossal” and order up a few genetically engineered survivors is a delusional and disingenuous fantasy Burgum has made clear that his management of the more than 500 million acres of public land under his authority will be all about energy extraction all of which were focused on increasing fossil fuel production None mentioned the words “wildlife” or “conservation,” much less endangered species and grizzly bears are inconvenient obstacles to “unleashing” fossil fuel extraction everywhere across the public lands of the West We can expect many attacks on the Endangered Species Act from this administration But none is more wrong-headed — or cynical — than using those cute genetically engineered “dire wolf” pups to distract from the urgent needs of actual endangered species Kentucky Derby Parties The 151st Kentucky Derby is set for Saturday at 4:57 p.m and here are a few places you can go for watch parties: Lookout Bar at Westin Riverfront in Avon Celebrate the Kentucky.. Easter events in the Vail Valley Church services An Easter tradition that’s been going on for over 30 years is the Vail Mountain Easter Sunrise Service bright and early on Sunday morning Après Madness Championship Party at Avanti F&B The NCAA College Basketball Tournament may have crowned a champion on Monday but Friday is when you can congratulate this year’s winner of Vail’s own form of competition:.. Après at The Amp For its third year in a row Ford Amphitheater has proven that it’s not just a summer venue the Swedish pop band that took the world by storm in the 1970s and early 1980s with its hits “Waterloo,” “Take a Chance on Me” and “Dancing Queen,” will virtually.. The 2025 lineup of TVs from Samsung is the company’s biggest yet It is likely a surprise to nobody that Samsung has integrated AI in it’s TVs expanding it’s use of Vision AI across its wide range of Neo QLED 8K & 4K Samsung Vision AI pairs AI-enhanced picture and sound for maximised performance with personalised experiences designed to help Australians engage more deeply with content and enjoy a viewing experience catered to them Backed by 7 years of One UI Tizen upgrades Samsung’s Vision AI devices autonomously enhance entertainment and simplify interactions based on user preferences getting smarter and more personalised over time “Great picture and immersive sound are just the beginning of what Australians are looking for when choosing a TV today The ability to access and add a full suite of apps and ease of use are more important than ever Samsung Vision AI brings all of those requirements together delivering autonomous and adaptable functions that reinvent what’s possible from your Samsung TV.”  the Neo QLED 8K series delivers an exceptional picture the 2025 Neo QLED 8K series integrates Samsung’s award-winning Glare-Free certified technology maintaining stunning Pantone-validated visuals across dark and bright rooms The Neo QLED 8K series brings Samsung’s Art Store to 8K displays for the first time alongside Vision AI’s new Generative Wallpaper feature enabling Australians to create their own on-screen art pieces based on their preferences 65”) provides a premium viewing experience without boundaries its all-new Wireless One Connect Box makes installation and connectivity easy wirelessly transmitting up to an 8K 120Hz signal up to 10 meters from the TV to keep living spaces clutter free Built with Samsung’s most advanced NQ8 AI Gen3 Processor the QN990F series leverages 8K AI Upscaling Pro to transform SD and 4K content into the sharpest and smoothest picture of any Samsung TV Motion Xcelerator 240Hz ensures blazing fast motion clarity for gaming and sports while AI Motion Enhancer Pro smooths the motion of fast-moving visuals and text so Australians can always keep their eye on the ball 65”) features a Metal Frame that can be mounted near-flush against the wall to elevate home décor Motion Xcelerator 165Hz offers smooth visuals and blistering speeds Dedicated top-channel speakers power Dolby Atmos sound while Object Tracking Sound+ provides dynamic realistic audio that follows the movements on screen The following are now available from leading retailers and www.samsung.com/au The premium pricing reflects their flagship displays however compared to just a couple of years ago these are amazingly affordable by comparison Now available exclusively at Harvey Norman:  55”) – all featuring Quantum Matrix Mini LEDs for stellar brightness and accurate colour across every scene.  The flagship QN90F features an upgraded NQ4 AI Gen3 Processor which ensures that content looks its best – improving picture and sound as it plays The processor upscales older content into 4K resolution while Neo Quantum HDR+ analyses each scene to boost brightness and make visuals appear even more realistic Motion Xcelerator 165Hz ensures ultra-smooth motion at blazing fast speeds while Samsung’s Glare-Free technology helps limits distractions while viewing any content Both the QN80F and QN70F feature the NQ4 AI Gen2 Processor for an AI-enhanced 4K picture and optimised sound tear-free gaming with Motion Xcelerator 144Hz the QN80F’s 100-inch model and the QN90F’s 98-inch model will leverage Samsung’s Supersize Picture Enhancer which uses AI to help ensure no detail is lost as content is stretched across a larger screen These are also now available from leading TV retailers and from Samsung Directly at samsung.com/au  Available from leading retailers and www.samsung.com/au from June is the 100-inch Neo QLED 4K QN80F From the newest gadgets to the latest software releases we've got you covered with up-to-date information and expert analysis Stay ahead of the curve and explore the world of technology with us today Contact us: jason@techAU.com.au “It was the smallest team at the time and the one that nobody cared about especially when Elon [Musk] appeared and started talking about ‘autopilot’ Müller ended up as vice president for R&D at the Volkswagen Group’s controversial software subsidiary ADAS and autonomous functionality were top of the priority list but he’s got his eyes on a different prize at JLR where he’s been executive director for product engineering since 2022 “The biggest challenge we face is that you can’t do everything It’s unaffordable and it’s wrong,” he tells TopGear.com “There’s a consistent strategy. Range Rover isn’t just a vehicle, it’s also a brand,” Müller says. “Defender is in that space, too: the way it looks, how you sit in it, how it drives. When you spend so many years really defining a product, you wouldn’t make the next generation completely different.”  Thomas Müller: The first time I went into the design studio to see it, I said, “it’s the same thing”. The guys said, “yes, it’s a Range Rover". People love this car, so why would we make it different? It’s difficult to make something better that’s already timeless. The Porsche 911 is another example. It’s not about the next generation of adaptive cruise control, it’s about how we integrate it with camera ultrasonics, how we start building more intelligent features. The focus is on what really matters and then doing it right. That’s an important strategic discussion. Our products are timeless. We don’t want to change everything. It’s important to remain flexible in terms of powertrain. For example, Dubai isn’t going to go electric in the next few years. Some territories will be faster adopters than others. Brazil is another interesting example [where Müller was born – he holds dual German and Brazilian citizenship]. A lot of people are getting into BEVs in the cities, but there’s such a big distance between them that it’s going to take time for the infrastructure to catch up. Our cars have a specific feel. We’re not going to copy anyone, or do everything that you can possibly do. We’re going to remain precise and true to the genetics of a Range Rover. The car will have a soul. It’s not a car that’s extremely direct or responsive. I wouldn’t say it’s disconnected; I’d say there’s a luxurious level of isolation. That’s deliberate and the Range Rover-ness is quite special. It’s in everything, including the steering, the seats, how you sit in them, the pedal feel and the calibration of the controls. There’s something about electric propulsion and luxury that fits extremely well in my head. I’d never thought about that before driving the electric Range Rover. And I should add that I’m a huge fan of V8s - I bought a Jaguar F-Type R75 and I’m currently running an F-Pace SVR. I love them both. But then you jump into the Range Rover electric. Thank you for subscribing to our newsletter. Look out for your regular round-up of news, reviews and offers in your inbox. Get all the latest news, reviews and exclusives, direct to your inbox. SuccessYour Email*You know how it is driving on a surface like ice in a combustion car. The wheels spin, then you have oversteer and a brake intervention, you get strange noises as the systems go to work. On this car you use the torque distribution and vectoring and it’s so quiet and so precise. And in the luxury space this level of isolation for the customer is really special. From a chassis and propulsion perspective, the hardware enables much more software. You can do much more than you would with a traditional combustion engine. But the software can’t fix the hardware if it’s not good enough. The basic set-up needs to be right. A software-defined vehicle has greater bandwidth and can do more, but there’s also more room to improve over time, too. In terms of chassis, propulsion and in the digital space. But we’re not going to copy the Chinese manufacturers, it’s not just about adding more features. We have intense discussions about what a Range Rover should look like and how it should be. It’s equally important to understand what it shouldn’t be. You need to work out what you want to be and then be the very best at it. Look out for your regular round-up of news No money from the licence fee was used to create this website The profits we make from it go back to BBC programme-makers to help fund great new BBC programmes BBC is a trademark of the British Broadcasting Corporation The original Range Rover made a name for itself as a very capable car and one that looked the part when it was first put on the road in 1969 And although it has strayed from its rather basic origins and has become a symbol of luxury and status there’s still a lot of love from the classic car community for the stout off-roader So much so that Vinile has drawn up a remastered Range Rover Classic So far, the most we have are renderings from Vinile on what their vision of a remastered classic Range Rover will look like, but it’s a very good start on paper! Surely, with the hype for restomods still going strong it will find its audience among the wealthy as prices for the Vinile Range Rover Classic start at around the EUR 300,000 mark Vinile is an upstart company based in Maranello the heart of Italian sports car manufacturing a new company doesn’t necessarily mean zero experience Vinile is headed by three entrepreneurs with over 30 years of experience in the automotive industry complemented by expertise in aerospace engineering Vinile also has the support of a specialised supercar manufacturing company with the workforce and all the assets needed to develop a car or a restomod like this So I’d say it looks bright from the get-go The lineage of the original Range Rover dates back to 1955, when the Rover company, the same one that built the Land Rover sought a larger model than the Land Rover itself It experimented with a few models under the name Road Rover before sidelining the project for several years The first prototype of what would become the Range Rover was constructed in 1967 following the revival of the Road Rover project by Rover engineers Spen King and Gordon Bashford The first generation entered production in 1970 and it was far from the luxury machine we know it to be today rather simple styling and only three doors A five-door model wasn’t added to the line-up until 1981 it was a step up from the Land Rover series of the time disc brakes all around and coil springs instead of leaf springs It was fitted with a Rover V8 that produced about 130bhp and although the design was updated slightly over the years the first-gen Range Rover was in production until 1996 The replacement second-gen model hit the road in 1994 which slowly saw it move away from the utilitarian off-roader it was set out to be which elevated it into the realm of luxury SUVS This was also the time when Range Rover began experimenting with and adding new lines to its portfolio introducing cars like the sleeker Range Rover Sport and the smaller Range Rover Evoque and it yet again moved further upstream as a premium luxury SUV; more creature comforts Another expansion of the Range Rover world came in 2017 with the Velar is aptly named after the original engineering development prototypes built between 1969 and 1970 The final update to the Range Rover came in 2022 and that is pretty much where we are right now in the Range Rover’s lifecycle It’s no coincidence that the remastered Range Rover Classic is made by a company named Vinile which immediately answers why Vinile calls it a remaster and not a restomod a cleaned and tuned iteration of a hit song What it comes down to is a Range Rover Classic that has been updated and perfected on all fronts and improved where needed for structural and safety purposes while also receiving modern components where necessary yet retaining its characteristic design elements you can see details such as tighter shut lines The work also encompasses flush-mounted door handles and a rear spoiler that partially hides the rear window wiper allowing you to independently open the window and tailgate The interior is upholstered in the finest leathers wherever you look poplar burl wood trim elements on the door panel and the central transmission tunnel It even extends to the outside of the Range Rover Classic as it peeks out from underneath the tailgate Everything is redesigned and finished with individuality it now comes with amenities such as wireless mobile connectivity This also captures the feed from the parking cameras to help you keep your Vinile Range Rover Classic dent and scratch-free Also note the U-Boat wristwatch mounted in the centre of the dash 15 will be built at a starting price of around EUR 300,000 each The debut car is finished in a deep green paint you can work with the Vinyl team to have it tailored to your exact desires It’s also worth mentioning that a remastered follow-up icon is already in development For more information, please visit VinileOfficial.it or check out Vinile on Instagram. So you spend at least €300,000 to have an old Range Rover worked on to look like a brand new Range Rover that costs, er, €200,000. Kia Australia has held its nerve in the face of growing competition in the congested ute space releasing pricing for its new Tasman ute that is more expensive than the incumbent market leader in some cases Kia Australia’s new Tasman Dual Cab Pick-Up range will start from a competitive $42,990 (MRLP) for the entry-level S 4x2 trim topping out at $74,990 (MRLP) for the upmarket X-Pro 4x4 flagship with enhanced off-road performance characteristics Set to launch in July, Kia’s much-vaunted new ute will be available in five trimlines – S, SX, SX+, X-Line, and X-Pro, across 4x2 and 4x4 layouts – with pricing designed to challenge rivals including the segment-leading Ford Ranger and Toyota HiLux Initially available only in Dual Cab Pick-Up the Tasman range will be expanded with the addition of a Dual Cab Chassis in August followed by a Single Cab Chassis in late 2025 The Single Cab Chassis will be offered in either S 4x2 while the Dual Cab Chassis can be chosen as either S 4x4 or SX 4x4 Pricing for these later arriving variants has not yet been announced but at $42,990 (MRLP) the entry-level Tasman S 4x2 Dual Cab Pick-Up just undercuts its rival the Ford Ranger Double Cab Pick-Up ($43,280) Meanwhile, at the other end of the Tasman range the Tasman X-Pro 4x4 Dual Cab Pick-Up at $74,990 (MRLP) is slightly more expensive than a Ford Ranger Wildtrak Double Cab Pick-Up ($74,840), but several thousand more than the equivalent Toyota HiLux Rogue ($71,430) and Isuzu D-Max X-Terrain ($70,500) That sort of pricing might be seen as ambitious given Kia has no track record in the ute segment but the Korean car maker is backing the Tasman’s generous equipment list including its hi-tech interior to give it the showroom cred to go head-to-head with the big boys Kia Australia Chief Executive Officer Damien Meredith said: “We are confident the input from Kia Australia at each stage of (the Tasman’s) development along with its competitive value and versatility will make it a very strong contender in the local market.” Kia’s interest in the segment is fuelled by a rampant ute market that last year was worth a combined 239,830 sales 4x4 and the big American pickups priced over $100k The three best-selling vehicles in the country in 2024 were all utes Based on an all-new ladder chassis platform the Tasman is available with a single 2.2-litre four-cylinder turbo-diesel powertrain across the range a strategy that gives Kia an advantage versus rival entry-level offerings but puts the upmarket Tasman X-Pro 4x4 at a relative disadvantage in the cubic capacity stakes Ford offers a smaller 2.0-litre bi-turbo four-cylinder across most of its Ranger lineup but equips the Tasman X-Pro rivalling Wildtrak with a muscular 3.0-litre six-cylinder turbo-diesel while Toyota’s HiLux Rogue gets a 2.8-litre four-cylinder turbo-diesel enhanced with mild-hybrid technology and Isuzu’s D-Max X-Terrain gets a gutsy 3.0-litre four-cylinder turbo-diesel In addition to boasting the same 154kW/441Nm 2.2-litre four-cylinder turbo-diesel across the range where rivals typically offer smaller and less powerful engines on entry level variants all five Tasman variants get an eight-speed automatic transmission the equivalent Isuzu and Toyota rivals come with six-speed units while the Ford Ranger offers more cogs with its 10-speed ’box All Tasmans will be available with payload ratings exceeding 1,000kg with the heaviest and best equipped X-Pro 4x4 capable of carrying 1,013kg while the S 4x2 Single Cab Chassis offers the maximum payload capability of 1,124kg All Dual Cab Pick-Up variants are also available with a reduced payload option aimed specifically at meeting the criteria for novated leases which often require a payload of under 1,000kg Aside from those vehicles intended for novated leasing all Tasman payload ratings exceed 1,000kg based on a gross vehicle mass (GVM) rating of 3,250kg across all variants contributing to a gross combination mass (GCM) rating of 6,200kg The GCM figure is based on a braked tow rating of 3,500kg which matches the industry benchmark for light commercial utes while unbraked towing is also set to the industry standard of 750kg Kia says an Integrated Trailer Brake Controller (ITBC) is fitted as standard to the Tasman enabling electronic trailer brakes to be calibrated for optimal stability The ITBC integrates with Towing Mode (TBC) allowing the driver to set up specific towed loads and optimise other towing related functions including Trailer Sway Control Kia claims the Tasman Dual Cab Pick-Up also sets a new benchmark for tub size with the ability to fit an Australian pallet within the tub along with an overall capacity of 1,173 litres (VDA) There’s good storage on offer inside as well with Dual Cab variants boasting 45 litres of storage under the second-row seat base The second-row seat also offers a slide and recline function for improved passenger comfort Also claimed as a segment first is a folding console table on X-Line and X-Pro models where the centre console lid folds out to form a table The X-Line and X-Pro models also get dual wireless smartphone charging capability enabling the charging of two phones at once all Tasmans feature Kia’s latest integrated panoramic display Wireless Apple CarPlay and Android Auto are standard as is Kia Connect with remote control functions and Over-The-Air (OTA) update capability There are eight exterior colours across the line-up with three two-tone interior trim varieties while SX+ steps up to a combination of cloth and artificial leather and the X-Line and X-Pro grades get artificial leather throughout Pre-orders for the Kia Tasman are now open ahead of the arrival of the first Dual Cab Pick-Up variants into Kia dealerships in July The information in this article has been prepared for general information purposes only and is not intended as legal advice or specific advice to any particular person Any advice contained in the document is general advice not intended as legal advice or professional advice and does not take into account any person’s particular circumstances Before acting on anything based on this advice you should consider its appropriateness to you having regard to your objectives and needs Insurance products (excluding Travel Insurance) are issued by RACQ Insurance Limited ABN 50 009 704 152 (RACQ). Conditions, limits and exclusions apply. This is general advice only and may not be right for you. This information does not take your personal objectives, circumstances or needs into account. Read the Product Disclosure Statement (PDS) and any applicable Supplementary PDS before making a purchase decision on this product You can also access our Target Market Determinations on this website Banking and loan products issued by Members Banking Group Limited ABN 83 087 651 054 AFSL/Australian credit licence 241195 trading as RACQ Bank. Terms, conditions, fees, charges and lending policies apply. This is general advice only and may not be right for you. This information does not take your personal objectives, circumstances or needs into account. Read the disclosure documents for your selected product or service including the Financial Services Guide and the Terms and Conditions and consider if appropriate for you before deciding any RACQ entity referred to on this page is not an authorised deposit-taking institution for the purposes of the Banking Act 1959 (Cth) That entity’s obligations do not represent deposits or other liabilities of RACQ Bank RACQ Bank does not guarantee or otherwise provide assurance in respect of the obligations of that entity RACQ Bank subscribes to the Customer Owned Banking Code of Practice which establishes higher standards than the law requires. The Code reflects modern consumer expectations and developments in approaches to issues such as consumer vulnerability, guarantors, and supporting customers through financial hardship. Please read our Customer Owned Banking Code of Practice page for more information RACQ acknowledges the Traditional Custodians of Country throughout Australia and their connections to land We pay our respects to Elders past and present and extend that respect to all Aboriginal and Torres Strait Islander peoples today New Study Forecasts How Softened Tariffs Will Affect Car Prices Mercedes-AMG Announces Limited-Production Special Edition GT 63 in Honor of Upcoming 'F1' Movie Home/FeaturesWhat Could the Range Rover Electric Look Like?With a fully-electric Range Rover well on its way we imagine what it could look like inside and out With a steady aim focused towards the Mercedes-Benz G580 with EQ Technology and the Cadillac Escalade IQ, Land Rover's upcoming Range Rover Electric will need to dress to impress it mustn't stray too far from current Range Rover styling or else it risks alienating the brand's loyal portfolio of clientele the upcoming Range Rover Electric will need to finely tether the line between signalling its battery-powered uniqueness through its design while simultaneously staying true to the Range Rover brand image with a distinguished sense of class and elegance Using generative text-to-image artificial intelligence and Adobe Photoshop over official Range Rover press images we take an imagined look at what the upcoming Range Rover Electric could look like incorporating current Range Rover design elements and styling cues while simultaneously integrating electric-specific fixtures These images are for speculation purposes only and in no way depict any actual Land Rover or Range Rover products when it seemed like almost every L322 Range Rover in California had an Asanti chrome grille the Range Rover's iconic horizontally-slatted grille style has been a touchstone of the model since the early 1990s Although battery-powered vehicles don't require traditional grilles in the same way that combustion-powered vehicles do confident grille is synonymous with the Range Rover image we anticipate that while the Range Rover Electric may not have an entirely functional grille on its forward fascia it'll still possess a styling element that heavily resembles such a fixture likely continuing the Range Rover's tradition of handsome horizontal slats that set Range Rovers apart from copycats Other notable styling elements we anticipate will be altered for the Range Rover Electric include the wheels and charging port In keeping with the Range Rover Electric's intended essence of retaining its well-known aura we wouldn't be surprised to see an NACS charge port integrated in a similar location to the combustion-powered variant's fuel filler cap albeit slightly enlarged to accommodate EV chargers it's important for EVs to protect their in-wheel motors with wheels that allow for very little debris to pass through their spokes while also being aerodynamic which is why many EVs have wheels with very few holes it's vital for EV wheels to direct what airflow they can towards their brakes and motors for cooling purposes This all poses a tremendous task for EV wheel designers who must balance protection and aerodynamics with cooling functions and aesthetic style featuring gloss-black painted inserts to improve aerodynamics and protection The polished spokes would allow the Range Rover Electric's wheels to retain their iconic style while simultaneously possessing their necessary functionality but they also don't need exhaust pipes makes a serious effort to conceal its tailpipes as much as possible the fully-electric version will be rid of them entirely even though the recently refreshed big body Range has a seriously modern tail light design some minor adjustments to distinguish itself from its combustion-powered counterpart would be welcome here as Mercedes-Benz has done with its electric G580 It has become trendier than ever for EVs to use sustainable materials like sugar cane materials and mushroom-based upholstery enhancing their market appeal as eco-friendly bastions of a progressive and eco-focused future these kinds of materials don't always fare well with buyers of luxury EVs who have come to expect the finest natural leathers and the most well-aged forest wood trims auto manufacturers have to offer Yet another balancing act the Range Rover Electric will have to perform for its buyers the battery-powered Range's interior must strike a careful balance between old-money's traditional excess and new-money's want for progressive sustainability we're looking for an interior that incorporates materials somewhere between illegally-harvested ivory tusks and organically-harvested free-range mushroom fabrics yet somehow still screams “Range Rover” at the end of the day because automakers seem to have come to the conclusion that every EV must pack at least three flat-screen TVs each throughout their dashboards but we'd like to think that Range Rover is capable of forming an ambient interior environment that impresses the same traditional ethos of class and elegance as Range Rovers of yore while integrating upholstery materials that don't contribute to animal torture Sustainable materials in cars are nothing new, even for luxury vehicles, as brands like BMW and Mercedes-Benz have been experimenting with them for years now so we're certainly intrigued by a hypothetical possibility for Range Rover to start playing with similar creative ideas The upcoming Range Rover Electric offers the brand's design team an interesting opportunity to make the differences where they really count–in the details The overall look of the EV model shouldn't stray too far its combustion-powered counterpart but the smaller details–like the slatted grille and cabin materials–can make the difference to set apart the EV Range Rover from the rest of its lineup especially when buyers are comparing models in the showroom We can't wait to see what the brand has to offer when the time comes for the model to debut LLC and respective content providers on this website Other product and company names shown may be trademarks of their respective owners LLC and respective content providers to this website may receive compensation for some links to products and services on this website Metrics details Large terrestrial mammals have generally declined due to human activity but the recovery of some populations poses new issues for coexistence Few studies to date have investigated drivers of this recovery and its impacts on human societies at the national scale Here we assessed the range expansion of six large terrestrial mammal species over 40 years—sika deer and brown bear—by comparing newly occupied and unoccupied areas using distribution data in Japan We found evidence that increased agricultural abandonment and decreased snowfall drove these range expansions The range of all six species expanded from mountainous landscapes to those closer to human settlements leading to increased conflicts that threaten people’s property and safety We predict that accelerating depopulation and climate warming could further expand the range of these species and call for measures to mitigate conflicts and achieve coexistence with them few long-term and large-scale datasets exist to understand the recovery of large terrestrial mammal populations the effects of societal changes on this recovery as well as its impact on human societies are rarely evaluated or often remain speculative large terrestrial mammals are more likely to occupy habitats with relatively higher quality among all available areas b As they repeatedly select areas with relatively higher quality at a local scale long-term expansion of their range limits the availability of remaining high-quality habitats gradually driving them to occupy lower-quality habitats in absolute terms at a regional scale the range of large mammal species is likely to expand closer to human-dominated landscapes potentially increasing conflicts between these species and humans Cumulative number of 5 × 5 km grid cells (3′45′′ × 2′30′′) occupied by a sika deer and f brown bear based on distribution surveys conducted in 1978 and Japanese macaques were more likely to expand into areas with lower levels of artificial light at night and more agricultural land wild boars and Asiatic black bears were more likely to expand into areas with more abandoned agricultural land Terrain ruggedness was positively associated only with the expansion of Sika deer in Honshu All six species were more likely to expand into areas with less snow and areas surrounded by more previously occupied areas during this period Mean proportion of three major land cover (forest and developed areas) and elevation for occupied grid cells in 1978 and those newly occupied in 2003 and in after 2003 (2014 for sika deer and wild boar; 2017 for Asiatic black bear Japanese macaque and brown bear) by six large terrestrial mammal species in Japan Combining these results with the identified drivers of range expansions our findings indicate that large terrestrial mammals have selected adjacent unoccupied areas with relatively less human activity for new colonization at a local scale continuous range expansion from mountainous landscapes has led them to occur closer to human-dominated landscapes Example of increasing conflicts between humans and large terrestrial mammals across Japan This expansion may be due to the reduction of limiting factors allowing them to occupy habitats that were previously inaccessible or unsuitable This suggests that their range is likely to continue to expand Although we were unable to test the effects of interspecific interactions such as species competition and predator-prey dynamics due to the insufficient spatiotemporal resolution of the species distribution data future research should aim to evaluate the influence of such interactions on range expansion dynamics it will be necessary to implement proactive education and conflict mitigation measures for people especially in areas where the new colonisation of these species may lead to conflicts costly and labour-intensive measures (e.g. retaliatory killing and culling) have often been employed to mitigate conflicts with large terrestrial mammals Our finding that similar environmental factors explain the range expansion of large terrestrial mammals despite their different ecological characteristics such as reducing abandoned agricultural land may effectively contribute to mitigating conflicts with multiple species on a large scale These cases indicate that the range expansion of large terrestrial mammals is a challenge not only for rural communities with declining populations but also for urban communities Our findings provide unique and important insights into the dynamics and societal impacts of range expansion of large terrestrial mammals which can inform practices and policies to conserve those species while mitigating human conflicts around the world making them harder to perceive compared to conflicts elucidating changes in ecosystem functions and services resulting from the recovery of these species can also contribute to the success of coexistence between humans and large terrestrial mammals Sika deer inhabits all four main islands in Japan The population of sika deer in Hokkaido was distinguished from those of the other three islands from the statistical analysis due to differences in vegetation zones Asiatic black bear inhabits Honshu and Shikoku but their populations on Shikoku are endangered; hence Shikoku populations were excluded from the statistical analysis The presence and absence of species were determined based on systematic nationwide surveys conducted across multiple time periods under the supervision of national and prefectural authorities and trained surveyors (see Supplementary Methods for specific information on survey methods) These surveys employed standardized methodologies including structured interviews with local experts and verification through supplementary surveys Presence was recorded based on direct sightings or reliable signs such as tracks and carcasses all survey areas were systematically examined and only areas where no evidence of the species’ presence we examined the effects of both habitat quality and dispersal from colonized areas which are expected to affect the range expansion of large terrestrial mammals in different periods: 1978–2003 for all six species; 2003–2014 for sika deer and wild boar; 2003–2017 for Asiatic black bear areas of oceans or lakes within each cell were excluded from the calculation of predictor variables The originally occupied cell adjacent to newly occupied cells were classified as the source of expansion (hereafter referred to as source cell) Newly occupied cells adjacent to these source cells were then classified as first-stage expansion cells newly occupied cells adjacent to the first-stage expansion cells but not yet categorized were classified as second-stage expansion cells The first-stage expansion cells adjacent to the second-stage expansion cells were subsequently classified as the source cells for the second stage of expansion with each new stage of expansion identifying source cells from the previous stage until no further cells could be classified as newly occupied Among the cells adjacent to each stage’s source cell those that were newly occupied were defined as “used” while those that remained unoccupied were defined as “available” The data can be found in a Github repository (https://github.com/seungyun100/Expansion-mammals/tree/main) A portion of the data that support the findings of this study specifically the data of agricultural abandonment areas provided by the Ministry of Agriculture is not publicly available to protect private property information available from the authors upon request and with permission from the Ministry of Agriculture The processing codes for the analyses are available at GitHub (https://github.com/seungyun100/Expansion-mammals/tree/main) Human–Wildlife Interactions: Turning Conflict into Coexistence 1st edn Collapse of the world’s largest herbivores Megafauna and ecosystem function from the Pleistocene to the Anthropocene Impacts of large herbivores on terrestrial ecosystems Recovery of large carnivores in Europe’s modern human-dominated landscapes The impact of human-wildlife conflict on natural systems Bringing large mammals back: large carnivores in Europe M.) 67–84 (Springer International Publishing A strategy for wildlife management in depopulating rural areas of Japan Distribution Patterns of Five Mammals in the Jomon Period Ministry of Education, Science, Sports, and Culture & Japan Meteorological Agency. Climate Change in Japan https://www.data.jma.go.jp/cpdinfo/ccj/index.html (2020) Ministry of Agriculture, Forestry and Fisheries. Statistical Data on Crop Damage by Wildlife. https://www.maff.go.jp/j/seisan/tyozyu/higai/hogai_zyoukyou/index.html (2025) The role of propagule pressure in explaining species invasions The Second National Survey on the Natural Environment: Report of the Distribution Survey of Japanese Animals (Mammals) The Sixth National Survey on the Natural Environment: Report of the Distribution Survey of Japanese Animals (Mammals) Ministry of the Environment. Report on the Distribution of Medium-Large Mammals in 2018: Bears (Brown bear・Asian Black Bear)・Japanese Serow. https://www.biodic.go.jp/youchui/reports/h30_chuogata_houkoku.pdf (2019) Report on conservation and management of specified mammal species Development of an agent-based model for estimation of agricultural land preservation in rural Japan What is the future of abandoned agricultural lands A systematic review of alternative trajectories in Europe in Sverdlovsk oblast and its relation to climatic factors Northward bound: the distribution of white-tailed deer in Ontario under a changing climate Determining puma habitat suitability in the Eastern USA Influence of Field Water Management by Land Consolidation in Paddy Field Zone in Hokkaido Ministry of the Environment. Human-Bear Conflict. https://www.env.go.jp/nature/choju/effort/effort12/injury-qe.pdf (2024) Japan Bear Network. Report on the Compilation of Personal Injury Accident Information by Bears. https://www.japanbear.org/report/report-1911.html (2011) Hokkaido Railway Company. Impact of Wild Animals (Deer and Bears) on Train Operations. https://www.jrhokkaido.co.jp/CM/Info/press/pdf/210616_KO_Animal2.pdf (2021) Hokkaido Prefectural Police. Status of Traffic Accidents Involving Ezo Deer. https://www.police.pref.hokkaido.lg.jp/info/koutuu/sika_jiko/sika_jiko.pdf (2024) Seasonal changes in the amount of litter layer and soil erosion in the forest floor: an impoverished understory by deer impact at Doudaira Importance of Host Abundance and Microhabitat in Tick Abundance National Institute of Population and Social Security Research. Population Projections for Japan: 2021–2070. https://www.ipss.go.jp/pp-zenkoku/j/zenkoku2023/pp_zenkoku2023.asp (2023) Ministry of Land, Infrastructure, Transport and Tourism. Grand Design of National Spatial Development towards 2050. https://www.mlit.go.jp/kokudoseisaku/kokudoseisaku_tk3_000043.html (2014) Future Migration Intention of Young Japanese in the Context of Rural Depopulation High-resolution national land use scenarios under a shrinking population in Japan Co-Adaptation Is Key to Coexisting with Large Carnivores Affairs, U. N. D. of E. and S. World Urbanization Prospects: The 2018 Revision. (United Nations, 2019). https://doi.org/10.18356/b9e995fe-en Ageing and population shrinking: implications for sustainability in the urban century European human-dominated landscapes provide ample space for the recolonization of large carnivore populations under future land change scenarios Exploring the ecology of suburban wildlife The role of large wild animals in climate change mitigation and adaptation Socioeconomic Benefits of Large Carnivore Recolonization Through Reduced Wildlife-Vehicle Collisions Ministry of the Environment. Report on the Conservation and Management of Japanese Macaque in 2018. https://www.env.go.jp/nature/choju/plan/plan3-report/h30report_saru.pdf (2019) Ministry of the Environment. Survey on the Expansion of Habitat Distribution of Sika Deer and Wild Boar in Japan. http://www.env.go.jp/press/100922.html (2015) Development of grid square air temperature and precipitation data compiled from observed Resource Selection by Animals: Statistical Design and Analysis for Field Studies (Springer Science & Business Media Patterns and drivers of wild boar population expansion into Belgian agroecosystems Understanding habitat selection of range-expanding populations of large carnivores: 20 years of grey wolves (Canis lupus) recolonizing Germany Mixed Effects Models and Extensions in Ecology with R Data reduction: Factor analysis and cluster analysis Download references The information used in the analysis was provided by Ministry of the Environment: Biodiversity Center of Japan and National Agriculture and Food Research Organization This work was partly supported by a Grant-in-Aid for JSPS Fellows (Nos 24H01429) and the Institute of Global Innovation Research at Tokyo University of Agriculture and Technology United Graduate School of Agricultural Science Tokyo University of Agriculture and Technology Center for Biodiversity and Conservation Science All authors conceived the study and designed the research received permission from the Ministry of Agriculture Japan to use the data of agricultural abandonment areas and all authors revised and edited the manuscript and agreed with the final version of the paper The authors declare no competing interests Communications Earth & Environment thanks the anonymous reviewers for their contribution to the peer review of this work Primary Handling Editors: Heike Langenberg and Aliénor Lavergne Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations Download citation DOI: https://doi.org/10.1038/s43247-025-02261-w Anyone you share the following link with will be able to read this content: a shareable link is not currently available for this article Sign up for the Nature Briefing: Anthropocene newsletter — what matters in anthropocene research ShareSaveCommentForbes Digital AssetsEthereum’s 2025 Price Outlook: Drivers, Risks And The Range Of PossibilitiesByZennon Kapron Forbes contributors publish independent expert analyses and insights I write about how fintech is disrupting the financial industry in Asia.Follow AuthorApr 27 09:00am EDTShareSaveCommentEthereum has had a rocky couple of years What's ahead for the world's second largest crypto .. down 40% year‑to‑date but still 70% higher than a year ago That volatility keeps investors asking a simple question that has a complicated answer: Where will ETH trade by December 2025 the forces poised to move its price over the next 20 months expert forecasts from the wildly bullish to the decidedly bearish and the on‑chain metrics worth tracking along the way Beyond price action, two structural shifts defined 2024: the explosion of Layer‑2 (L2) roll‑ups and the emergence of “re-staking” as a new source of yield Optimism and Base now settle a combined 62 networks that collectively secure about $45 billion of value and routinely process more than 70 transactions per second (TPS) — five times the main‑chain average Meanwhile EigenLayer’s restaking market surpassed $15 billion in TVL by the end of April allowing ETH holders to pledge already‑staked coins to secure external services and stack multiple revenue streams on one asset Critics warn that re-hypothecating Ether’s security budget could amplify systemic risk The July 2024 launch of U.S spot ETFs added another catalyst: nine funds now hold roughly $33 billion in AUM a faster trajectory than Bitcoin benchmarks achieved in their first year Not everything is rosy. Solana has occasionally overtaken Ethereum in daily transactions and DEX volumes as meme‑coin mania migrates to cheaper chains and sporadic gas‑fee spikes above $20 remind users that Ethereum’s scaling story is still in progress regulatory and macro currents will intersect next year Network researchers at VanEck argue those changes could lift daily active addresses 30% and justify an $800 billion valuation Nine U.S. spot ETFs plus Hong Kong’s dual‑currency products funnel regulated capital into ETH Early flows rival Bitcoin’s first‑year pace and CME has hinted at physically settled Ether futures critical for treasury desks that need hedging tools Europe’s MiCA “stablecoin” framework is already in place requiring any exchange servicing EU residents obtain a CASP license This brings licensing clarity but also higher compliance costs staking’s legal status remains murky even after the ETF nod President Donald Trump has vowed to make America “the crypto capital of the planet,” could swing sentiment overnight Ethereum still anchors DeFi with roughly $47 billion TVL NFT volumes tell a different story: down 24% year‑to‑date as “utility fatigue” sets in though Nike’s .SWOOSH and Yuga Labs’ Otherside continue to build on‑chain Solana now frequently leads in daily active addresses and raw transaction counts buoyed by sub‑second finality and negligible fees If its Firedancer upgrade (targeting 100,000 TPS) lands in H2 2025 Ethereum could lose the “default smart‑contract” crown — unless roll‑ups bridge the UX divide first a one‑percentage‑point drop in the 10‑year has coincided with a 60‑day +35 % ETH rally; an equal rise shaved 28% off prices Rate trajectories may sway crypto more than any code push implying mid‑2025 levels near $6,000 if momentum holds CoinPedia’s bearish scenario warns of a retreat to $2,917 should regulatory setbacks or developer delays dent confidence and several bank research desks place fair‑value floors near $1,500 Strip out the extremes and most sell‑side houses cluster around $4,000‑4,500—a 150 % gain from today yet still below 2021’s all‑time high ETF rails plus MiCA compliance make it easier for wealth managers to allocate 1‑2 % of balanced portfolios to ETH A mere one‑percentage‑point shift by OECD pension funds could unleash $150 billion of incremental demand Account abstraction (EIP‑4337) enables smart wallets that auto‑rebalance gas tokens across L2s while restaking‑powered Actively Validated Services (AVSs) could add US $20 billion in annual fees by 2026 Roll‑ups are also experimenting with encrypted mempools and MEV‑burn designs to cut toxic order‑flow slippage February’s Bybit bridge hack stole $1.5 billion and reminded markets that cross‑chain bridges remain the soft underbelly of Web3 Restaking compounds the risk: if a major AVS implodes and slashes collateral forced withdrawals could snowball through DeFi lending pools Rising yields and tariff shocks compress risk‑asset multiples If Solana sustains superior throughput at comparable security — and if L2 fragmentation keeps Ethereum UX complex — the “network‑effect” moat may erode faster than bulls expect Monitoring data often reveals turning points before price does Whether ETH finishes 2025 nearer $2,500 or $6,000 will hinge on execution and exogenous shocks continued ETF inflows and a gentle Fed easing cycle would bolster the bullish case move to label staking a securities activity or a sustained 5 %+ 10‑year yield could drag ETH toward 2022 lows the weight of evidence is cautiously constructive: the demand pipeline is clearer than a year ago and Ethereum’s developer community still outnumbers the next five smart‑contract platforms combined but prudent investors should size positions for three‑digit drawdowns Ethereum enters 2025 with powerful tailwinds including scaling upgrades regulatory clarity in Europe; yet also faces stiff headwinds from faster rivals hack‑induced trust gaps and macro uncertainty Expect narrative whiplash and a wide trading range Keeping one eye on Pectra’s GitHub commits and the other on 10‑year yields may prove the smartest trade of all Bitcoin’s “digital‑gold” narrative and deeper ETF liquidity still command the lion’s share of institutional inflows ETH offers outsized upside tied to network upgrades and ETF growth — but with commensurate regulatory and security risk Allocate only capital you can afford to see halve in value This is not investment advice — do your own research Successful completion of the Pectra upgrade and sustained ETF inflows are the biggest near‑term catalysts Buy ETH directly on major exchanges or gain exposure via U.S.‑listed spot ETFs—ideal for investors who prefer regulated custody over self‑managed wallets ‘roll‑ups’ are Layer‑2 solutions that bundle hundreds of off‑chain transactions into a single slashing fees and congestion while inheriting the main chain’s security ‘Validiums’ are Layer‑2 networks that verify batches of transactions with zero‑knowledge proofs, just like zk‑rollups trading some on‑chain data availability for lower fees and higher throughput arriving in the first half of the year with a potent twin-turbo six-cylinder engine All articles from our websiteThe digital version of Today's PaperBreaking news alerts direct to your inboxAll articles from the other regional websites in your areaContinueUPDATE 10/04/2025 – Mercedes-AMG has now announced pricing for the CLE53 4Matic+ Cabriolet after announcing coupe pricing in February Launched in 2023, the Mercedes-Benz CLE Coupe is a replacement for the C-Class and E-Class coupes while the CLE Cabriolet followed in 2024 to replace the C-Class and E-Class convertibles Hundreds of new car deals are available through CarExpert right now. Get the experts on your side and score a great deal. Browse now 2025 Mercedes-AMG CLE53 price and specs: Convertible joins the rangeThe AMG-fettled CLE53 follows the performance arm's formula of more power the CLE53 4Matic+ Coupe is more than $35,000 dearer than the turbocharged four-cylinder CLE300 coupe is priced at $175,600 before on-road costs or around $38,000 more than the CLE300 Cabriolet 2025 Mercedes-AMG CLE53 price and specs: Convertible joins the rangeFor context the last AMG C43 4Matic coupe – which also featured a twin-turbo inline six-cylinder engine – was priced from $131,770 before on-road costs while the AMG E53 4Matic+ was $177,670 plus on-roads Customer deliveries of the AMG CLE53 Coupe commenced in February with Cabriolet deliveries to begin this week the AMG CLE53 has a six-cylinder powerplant 2025 Mercedes-AMG CLE53 price and specs: Convertible joins the rangeMercedes-AMG quotes a kerb weight of 2000kg for the CLE53 4Matic+ Coupe which includes a 90 per cent full fuel tank and a 75kg driver 2025 Mercedes-AMG CLE53 price and specs: Convertible joins the range2025 Mercedes-AMG CLE53 price and specs: Convertible joins the rangeServicing and WarrantySafetyThe Mercedes-Benz CLE has yet to be tested by ANCAP or Euro NCAP 2025 Mercedes-AMG CLE53 price and specs: Convertible joins the rangeStandard safety equipment includes: The CLE53 4Matic+ is available in one level of specification though there are various option packages available 2025 Mercedes-AMG CLE53 price and specs: Convertible joins the rangeStandard equipment includes: The Cabriolet also features the Aircap electric wind deflector system and Airscarf neck-level heating and ventilation while also featuring a multi-layer fabric folding roof that can open and close within 20 seconds while driving at speeds of up to 60km/h A handful of option packages are available for the CLE53 4Matic+ AMG Performance seats are also available for an additional $5400 MORE: Everything Mercedes-AMG CLE Content originally sourced from: CarExpert.com.au Sign up for our newsletter to stay up to date We care about the protection of your data. Read our Privacy Policy. Ethereum is holding firm above critical support levels as bulls attempt to reclaim the $1,850 zone as global trade conflicts and deteriorating macroeconomic conditions continue to weigh on investor sentiment across all markets The ongoing trade tensions between the US and China have created a challenging environment for risk assets like crypto Some analysts interpret the recent surge in ETH price as a positive shift that could lead to sustained upward momentum if key resistance levels are breached Ethereum is beginning to show early signs of a bullish structure forming on the lower time frames giving hope to investors after weeks of uncertainty Bulls are steadily working to reclaim higher resistance levels although selling pressure remains a real threat with analysts split between two scenarios: a massive breakout toward much higher targets or a failed breakout that could send ETH below the critical $1,300 support zone Daan shared a technical view suggesting that Ethereum had a strong start last week This move was significant because it immediately triggered strength across many altcoins a classic signal that sentiment could be shifting across the broader crypto market Daan explains that Ethereum has retaken its local range The next objective for bulls is to push ETH toward the range high and reclaim the 4-hour 200 MA and EMA Accomplishing this would mark the beginning of a potential higher timeframe reversal Daan also highlights that if ETH can continue to build momentum from here it could ignite another strong altcoin rally amplifying the impact across the entire market Ethereum is currently trading at $1,800 after spending several hours ranging tightly between $1,850 and $1,725 Despite the uncertain macroeconomic backdrop ETH has managed to maintain short-term strength by holding above the 4-hour 200 MA and EMA two critical technical indicators that have acted as dynamic support throughout the recent price action The consolidation within this range signals that bulls are defending key levels effectively but they still need a catalyst to trigger the next significant move Holding above the 4-hour 200 MA and EMA suggests that momentum remains in favor of buyers for now and any push above $1,850 could open the door for a larger rally global tensions and weakening economic indicators continue to weigh on sentiment If broader markets stabilize or Bitcoin continues its push toward new highs Ethereum could benefit and extend its recovery a failure to hold above $1,725 would expose ETH to renewed selling pressure and a potential retest of lower demand zones but vigilance is key as Ethereum approaches a pivotal moment is considered as general advice only.  This article should not be construed as containing investment advice an offer of or solicitation for any transactions in financial instruments and trading strategies are provided by the third-party provider and the point of view is based on the independent assessment and judgement of the analyst without considering the investment objectives and financial situation of the investors Risk Warning: CFDs are complex instruments and come with a high risk of losing money rapidly due to leverage The vast majority of retail investor accounts lose money when trading CFDs You should consider whether you understand how CFDs work and whether you can afford to take the high risk of losing your money Please refer to our Risk Disclosure Statement and Terms & Conditions so as to have a better understanding over the risks involved before you start trading Mitrade is the brand name of Mitrade EU Limited (the “Company”) an investment firm authorised and regulated by the Cyprus Securities and Exchange Commission with license number 438/23 and situated at Spyrou Kyprianou 79 The content of this website is not intended for residents of Belgium the United States or any person in any country outside the EEA or a jurisdiction where its distribution or use would contravene with local laws and regulations The Bonneville range is one of Triumph’s most iconic it remains a legend and one of the most sought-after ranges from the British manufacturer the Bonneville is regarded by many as the ultimate British classic Here’s a look at the key contemporary models the Bonneville T100 features a 900cc engine and modern classic styling the Bud Ekins Bonneville T100 Special Edition was introduced in 2020 The T120 shares the modern classic DNA of the T100 but is powered by a 1,200cc engine for more performance a year after the limited-edition Black DGR The last standard T120 base model dates back to 2016 Other editions include the Diamond Edition (2019) and the Gold Line and Black Gold Line (2021) The T120 Black shares most features with the T120 but sports a blacked-out finish and spoked wheels The Scrambler 900 is marked by its high-mounted exhausts and urban classic style It features a 900cc engine with ride-by-wire throttle The bike rides on spoked wheels – 19 inches at the front and 17 inches at the rear the Orange Stealth edition joined the range These bikes bring more Scrambler spirit with a 1,200cc engine offering exciting performance The Scrambler 1200 X is agile and approachable The 1200 XE is built for tougher terrain with a 21-inch off-road front wheel and premium finishes the Bonneville Bobber quickly became a best-seller in the bobber segment Inspired by post-war American custom culture stripped-back design – even lacking a windshield the Bonneville Speedmaster brings a relaxed riding style with modern performance It’s powered by a 1,200cc engine and blends practicality with style The Speedmaster got its Gold Line edition in 2021 and Red Stealth in 2024 The Speed Twin range includes three models The 900cc version pairs retro style with nimble handling and a low seat height making it ideal for both weekend rides and daily city commutes Triumph expanded the lineup with the new Speed Twin 1200 and 1200RS these models bring sportier retro performance and modern tech aimed at riders seeking a more dynamic experience the creditors of KTM AG approved a restructuring plan – which now has to be implemented before it yields results The winner of the 5th edition of the Iberian Honda Garage Dreams Contest is about to be revealed — a competition that challenges official Honda dealerships in Portugal.. Suzuki has announced a series of new colour schemes for its adventure-focused V-Strom 800 range while the V-Strom 1050 line-up and V-Strom 650 models remain unchanged for now... One of FB Mondial’s new models for 2025 is the SMX 125 – an enduro motorcycle that presents itself as a versatile option for far more than just.. will host another edition of the Biker Fest International – which has now announced a media partnership with Lulop © 2025 M Sports - Premium news & magazine M Sports Please enter your username or email address to reset your password © 2025 M Sports - Premium news & magazine M Sports Sonic has been trapped within a tight range for the past 48 days showing no real signs of breakout strength With resistance mounting and volume fading price action remains stuck in a rotational environment A breakout or breakdown will set the tone for the next major move Sonic (S) token’s price action has been confined within a clearly defined range with a steady lack of momentum keeping traders cautious and key resistances continue to suppress any breakout attempts This article will explore the current technical structure and the potential scenarios that could trigger the next trend Price remains suppressed below these resistances reinforcing the likelihood of continued range-bound action another critical factor suggesting prolonged consolidation price is unlikely to escape the current range Sonic is hovering around the midpoint of the range Losing this midpoint would significantly increase the chances of a cascading move downward targeting untapped liquidity pools and lower support levels The bearish scenario centers around this potential cascade: a break below the midpoint could trigger sharp downside moves as liquidity is swept the bullish case would require a strong reclaim of the VWAP SR resistance This would likely spark a move back toward the range highs Sonic is likely to remain trapped within its 48-day range unless major volume enters the market A strong reclaim of the VWAP SR would strengthen the bullish case a failure to hold the midpoint will likely trigger a liquidity hunt and deeper downside targets expect more rotational price action within the established boundaries The community around Morinish last week got a huge win on the Moonlight Range Wind Farm May is a fantastic time to sow and plant vegetables – here are my top picks for the month May offers huge opportunities for planting vegetables as many popular crops can be added to any productive garden this month so here are my picks for the best vegetables to plant in May I am an experienced vegetable gardener and have grown crops for over a decade Whether on my home plots or in the walled kitchen gardens I worked in as a professional gardener I have always sown lots of seeds in May - both indoors and outdoors while heat-loving crops can be sown indoors to plant outside in the weeks ahead which are all suitable for planting this month too To help you plan your vegetable garden here are my choices for some of the best vegetables to plant in May Butternut squash is now regularly seen in stores with its distinctive bulbous-ended shape and light yellow color. It is worth considering growing butternut squash as they have a nutty flavor Where you start the seeds this month may depend on your climate or preferences. You can sow seeds indoors early in May into large modules or small pots filled with seed starting compost Plant the seed on its side an inch deep in the soil and place the container where it can enjoy temperatures of 65-70°F for good germination and the seedlings are at risk of being nibbled by slugs and snails when they appear Once the frosts have passed and the soil warms to at least 50°F in spring, you can plant Swiss chard seeds directly into the vegetable garden The large seeds should be planted 2-4 inches apart in one-inch deep drills with 12 inches between rows Keep the soil moist and thin the seedlings to at least six inches apart as they develop Keep plants well-watered and weed-free and you can expect to start harvesting Swiss chard after around 35-40 days for baby leaves French beans come in either climbing or dwarf varieties and different types produce green The earliest sowings are made indoors and seedlings transplanted outdoors in May or sowing can be done directly into the growing position this month Plant the beans two inches deep in the soil either two per cane for climbing varieties or four inches apart in rows spaced 18 inches apart for dwarf ones Cover the beans with soil and keep moist for good germination with plants transplanted to their final position there may be two different stages of planting leeks to get done this month Early and mid varieties sown earlier can be transplanted into deep holes in the ground this month Make each hole six inches deep and six inches apart from the other Trim the roots of the small leek and place it in the hole before filling with water This planting method blanches the stems for a sweeter taste Late varieties can be sown in May to give harvests throughout winter and spring Sow the seeds into half-inch deep drills and thin to an inch apart once they germinate These seedlings can be transplanted once they reach 6-8 inches tall These traditional winter crops have a long growing season, so if you do want to grow parsnips for sweet roots in the colder months then May is a perfect time to do so - if you haven’t sown them already Parsnips are renowned for being tricky to germinate. However, if you use fresh seeds (the viability of seeds is short so fresh is always best for parsnips) and wait until the soil has warmed to a steady 50-55˚F it will improve your chances either into half-inch drills or individual planting holes placing three seeds every six inches and thinning the clusters once the seeds germinate but it may take a few weeks to see the first signs of growth popping through the soil they can be sown indoors or outdoors this month Plant your pumpkin seeds indoors in individual pots to germinate somewhere warm and plant out next month sow the seeds outdoors in warmer climates with temperatures above 68˚F in May Place two or three seeds into holes at least an inch deep in the soil and cover with a cloche to protect the seedlings from cold temperatures or pests Pumpkins need space to grow and tend to germinate quickly Sow the clumps of seeds at least six feet apart and keep only the strongest seedling once they emerge Rutabaga, also known as swede or Swedish turnip, is an easy vegetable to grow and you should plant it from late May to harvest in the fall They have a longer growing season than turnips (which they are related to) and the roots do best when they mature in the cooler fall temperatures sowing a half-inch deep into rows spaced 15-18 inches apart Don’t sow the seeds too thickly and then thin the seedlings to a spacing of eight inches when they develop as irregular irrigation can cause the rutabaga roots to split and impact your harvest Waltham is a very popular variety of butternut squash to grow It produces uniformly shaped fruits and is ready to harvest around 85 days after sowing French Garden is a bush type of French beans It is high-yielding and grows 5-6 inches long American Purple Top is a reliable variety of rutabaga that produces 3-6 inch long roots that are yellow with purple shoulders and start them somewhere warm and bright to get plants off to the best start Design expertise in your inbox – from inspiring decorating ideas and beautiful celebrity homes to practical gardening advice and shopping round-ups He has worked as a professional gardener in historic gardens and specialises in growing vegetables That passion for growing extends to being an allotmenteer and producing how-to gardening guides for websites Drew was shortlisted for the New Talent of the Year award at the 2023 Garden Media Guild Awards Fabulous digital writerPublished: Invalid Date THE Range has announced a huge sale just in time for the bank holiday weekend with loads of summer staples slashed in price The retailer is known for its incredible deals on everything from bedding to toys but it's their garden essentials that has shoppers rushing to get their hands on The shop took to TikTok to share some of the deals, including a camping cart for just £24.99 the cart could still be used for picnics or park visits "This heavy-duty foldable wagon is designed with 360-rotation wheels making it easy to manoeuvre on any terrain "With the added convenience of drink holders or any other outdoor activity," the product description reads online there's also an adorable woodland cubby house down to just £99.99 And for the current hot spell, you could snap up the Inflatable water fun pool, which comes with a slide and inflatable sea-creatures for little ones to play with all summer long The best part is the pool has been reduced to £34.99 "Ideal for countless summer fun, this pool makes a great addition to your backyard. Boasting an amazing design, it is perfect for sea lovers and is sure to add a splay of fun and water to any outdoor area," The Range bosses said. with a stunning five piece table and chairs set now available for half price the set is currently available for £199.99 - that's a huge saving of £200 the zero gravity chairs and table might be for you this inviting set includes two comfortable camping loungers with multi-position reclining mechanisms and soft headrests so you can find the perfect position to set up camp for the day the handy side table is ideal for holding drinks snacks and suncream," the product description notes online There's even garden ornaments for those looking to spruce up their outside space The solar prince frog ornament will add the perfect amount of fun to your garden - and it's currently half price which would be perfect for evenings spent outside You'll have to be quick if you want to get your hands on any of the deals though they're sure to sell out quickly this weekend A well-kept garden can add anywhere between 5-20% to the value of a property Sellhousefast.uk carried out a study and consulted 36 estate agents garden designers and property professionals from across the UK And the experts revealed the garden feature which adds the most value to a property is a shed Our journalists strive for accuracy but on occasion we make mistakes. For further details of our complaints policy and to make a complaint please click this link: thesun.co.uk/editorial-complaints/ But having access to fast internet also matters less than half — 44% — of the world population was in the range of a 4G network you can see that this has increased quickly across many regions This data comes from the International Telecommunication Union Note that being in the range of a 4G network doesn’t mean that someone is using it they might be in the range of a network but not online Explore more charts on technological change across the world → Mobile phones have achieved what few technologies do: they’ve been adopted rapidly by people all over the world, in both rich and poor regions. The chart shows how mobile subscriptions grew between 2000 and 2023. This is given per 100 people in each world region. If the number is over 100, it means some people own more than one mobile device. (This data doesn’t tell us the percentage of people with a phone, as some individuals own multiple devices.) Mobile phone subscriptions have risen sharply everywhere in just a few decades. Even in the poorest parts of the world, like Sub-Saharan Africa, subscriptions grew from just 2 per 100 people to 89. In South Asia, they went from less than 1 to 84. Still, this rise matters because mobile phones allow people to learn, connect, and build, even in places without physical infrastructure (like roads or banks). For example, mobile money systems enable people to save, send, and receive money without needing a bank branch or an Internet connection. This has helped millions improve their financial security. Explore more data on mobile phone subscriptions → Three billion people worldwide cannot afford a healthy diet that gives them all the nutrients they need. Most of these people live in low- to middle-income countries, where people have less money to spend on food. You might rightly guess that people in richer countries tend to spend more on food — but they also spend a smaller share of overall spending on food. You can see this in the chart, where each dot represents one country in 2022. The average budget in Switzerland for food consumed at home was more than four times that of Kenya (when measured in US dollars). But food made up less than 10% of Swiss consumer spending, compared to almost 60% in Kenya. This means people in richer countries don’t only have more money to spend on food; they also have far more left to spend on other important resources, like housing, education, clothing, and health. Read more in my article “Engel's Law: Richer people spend more money on food, but it makes up a smaller share of their income” → Every twelfth person in the world still lives in extreme poverty. That means surviving on less than $2.15 per day (adjusted for differences in living costs between countries). For many, that means struggling to afford nutritious food, not being able to afford basic healthcare, safe sanitation, or electricity. So, where do most people in extreme poverty live? The chart shows that Sub-Saharan Africa, which is home to just 16% of the global population, now accounts for 67% of people living in extreme poverty. This distribution is very different from 25 years ago. In 2000, Asia was home to most of the world’s population living in extreme poverty. However, strong economic growth in recent decades has led to steep reductions in poverty. Progress in Sub-Saharan Africa has been much slower. If we're serious about ending extreme poverty worldwide, supporting economic development in Sub-Saharan Africa has to be a top priority. The recent progress achieved by some African countries reminds us that meaningful change is within reach. Many people are interested in how they can eat in a more climate-friendly way. I’m often asked about the most effective way to do so. While we might intuitively think that “food miles” — how far our food has traveled to reach us — play a big role, transport accounts for just 5% of the global emissions from our food system. This is because most of the world’s food comes by boat, and shipping is a relatively low-carbon mode of transport. The chart shows that transporting a kilogram of food by boat emits 50 times less carbon than by plane and about 20 times less than trucks on the road. So, food transport would be a much bigger emitter if all our food were flown across the world — but that’s only the case for highly perishable foods, like asparagus, green beans, some types of fish, and berries. This means that what you eat and how it is produced usually matters more than how far it’s traveled to reach you. Read my article “You want to reduce the carbon footprint of your food? Focus on what you eat, not whether your food is local” → For many readers in high-income countries, the Internet might no longer feel revolutionary. But when I was born in 1997, only 2% of the world's population used the Internet. By 2019, that number had risen to over 50%; today, two-thirds of the global population is online. It’s worth taking a moment to appreciate the novelty and speed of this change for two reasons. First, much of the potential progress enabled by the Internet is still unfolding, from expanding educational opportunities through free online resources to reducing the cost of sending money home for migrants. Second, it’s good to remember that in 2023, a third of people still didn’t use the Internet. Accelerating connectivity could give these individuals greater freedom and access to new opportunities. The United Nations aims to get more than 90% of people online by 2030. Some regions are still far from universal access, with just 43% of South Asia and 37% of Sub-Saharan Africa connected. Explore more data on Internet use, country by country → April 23 Describing someone as “young” or “old” is rather arbitrary. However, something we can quantify is whether a given person is “young” or “old” compared to the rest of the world. Imagine we sorted all 8 billion people alive today from youngest to oldest. The person standing right in the middle would be about 30 years old; that's the median age today. The chart shows the global median age and the UN’s projection to 2100. In 2025, if you are over 30, you are older than most people in the world. The chart also shows that if you were born in 1950, you stopped being “young” when you passed 20, as that was the median age in 1970. As birth rates decline and life expectancy increases, the median age is expected to keep rising until the end of the century. Whether you’re younger or older than most, the world is still relatively young, and this matters for many aspects of society, from the demand for resources and jobs to long-term planning for healthcare, education, and infrastructure. If you want to dig deeper into this data, have a look at our Population & Demography Data Explorer → Fifty years ago, almost half the adults in Great Britain smoked cigarettes, but this has become much less common. In the 1970s, half of men and 40% of women over the age of 16 reported smoking cigarettes. Since then, smoking rates have steadily fallen. By 2023, this was just 12% of men and 10% of women. This dramatic decline is the result of decades of public health efforts such as clear warnings on cigarette packs, bans on tobacco advertising, indoor smoking restrictions, and support to help people quit. Newer technologies — including vaping products, nicotine patches, and medications — have also helped many people quit. Despite this, smoking remains the leading risk factor for preventable death in the UK, raising the risk of many cancers, heart attacks, and strokes. Fewer smokers means fewer people suffering from these serious diseases. Read more about the global problem of smoking in an article by my colleague Max → Get Data Insights delivered to your inboxReceive an email from us when we publish a Data Insight (every few days) By subscribing you are agreeing to the terms of our privacy policy The dates displayed for an article provide information on when various publication milestones were reached at the journal that has published the article activities on preceding journals at which the article was previously under consideration are not shown (for instance submission All content on this site: Copyright © 2025 Elsevier B.V. the German supplier that’s probably best known for its six- and eight-speed automatic transmissions wants to upgrade the traditional generator that’s found in today’s extended-range electric vehicles a high-voltage battery and an electric motor the main difference between these two is that in an EREV the gas engine has no mechanical connection to the driven wheels its only purpose is to turn an electric generator that feeds power into the battery to increase the driving range ZF wants to add another layer to this layout by enabling the generator part of the system to also power a pair of wheels Dubbed the Electric Range Extender Plus (eRE+) it’s part of a new line of range extenders that support both 400-volt and 800-volt power systems and integrate an inverter a planetary gearset and the necessary software What makes ZF’s latest effort interesting is that the eRE+ also has a built-in clutch and differential so it can be used either as a current generator or as an additional secondary drive which saves time and money for the carmaker because it’s all integrated into one unit the gas engine attached to the electric generator still doesn’t physically drive the wheels and it’s the generator—which is essentially an electric motor—that can send power to the wheels the Electric Range Extender Plus can be configured to deliver between 70 and 150 kilowatts (94 to 201 horsepower) while the latest version of the more traditional Electric Range Extender (eRE) has an output between 70 and 110 kW (94 to 147 hp) The latter is more suited for use on the rear axle while the Extender Plus is likely to be under the hood So why go to the trouble of developing such a system when automakers could just stuff run a plug-in hybrid powertrain going down the EREV route is usually cheaper especially when a carmaker has invested considerable money into new electric vehicle platforms not designed for combustion powertrains "The new interest and the increased demand for range extenders show that the potential of this technology is far from exhausted in particular for model platforms that are already designed for battery-electric drivelines," said Dr senior vice president of R&D and electrified powertrain technology at ZF Toyota And Google's Waymo May Build An Autonomous Car Platform Together This Off-Road Toyota EV Feels Like It'd Be A Hit In The U.S Frontier PHEV Make Me Wish For A Different Reality Why Tesla's Large Drive Unit Is The V8 Engine Of EVs The New Hyundai Palisade Hybrid Drives Like An EV Watch A Chevy Blazer EV SS Crush A Mountain-Climbing Range Test The 2026 Kia EV4 Gets One Thing Very Right About EV Charging A/Prof Flavio Macau is affiliated with the Project Management Institute (PMI) Edith Cowan University provides funding as a member of The Conversation AU View all partners Coles is reducing its product range by at least 10%, a move that has sparked public backlash and renewed discussions about the role of supermarkets in the cost-of-living crisis In cutting the range of items on offer Coles is moving closer to Aldi and Costco’s strategy to grow exclusive brands and limit product range The goal is to boost profitability by reducing costs and increasing control over the supply chain Coles is unlikely to cut traditional brands especially those from companies with significant market power like Coca-Cola or Nestle Smaller suppliers are likely to bear the load as they struggle to renew contracts and face increased competition from home brands To fully understand the reasons behind this move and its impact on the cost of living Over the past decade, competition in the Australian supermarket sector has intensified. Coles’ market share declined from 31% to 25% between 2013 and 2023, while Woolworths’ share fell from 41% to 37% which now holds approximately 10% of the market and its strong position in the home brand space To boost profitability with a smaller customer base Coles needs to find ways to enhance its earnings or increasing the market share of its home brands as consumers are already struggling with high food prices inflation and the rising cost-of-living One approach is to squeeze suppliers, but again this is unlikely to be effective. The consumer watchdog, the Australian Competition and Consumer Commission (ACCC), is holding an inquiry into concerns that the supermarkets are using their market power to the disadvantage of their suppliers and consumers supermarkets risk supply chain disruptions due to increased market concentration among surviving suppliers the more complicated and expensive it becomes to manage and disposing of expired products all contribute to higher costs Anna Croft, Coles’ operations and sustainability officer, explained the strategy when telling investors in November that 13 basic table salts could be cut to five Simplifying the product range can also boost sales. When faced with too many options, consumers can experience “choice overload”. A widely recognised study in psychology found that people are more likely to make a purchase when presented with a limited selection rather than an extensive array of choices Simplifying the range will likely focus on items where Coles has a home brand. Home brands now account for 33.5% of Coles’ sales This move is a response to competitors like Aldi and Costco. While Coles and Woolworths manage over 25,000 items in their stores, Aldi limits its offering to about 1,800 products Coles is focusing on its home brands to better compete with non-branded offerings from Aldi. In its report to the ACCC, the supermarket highlights its investment in expanding its own-brand range to provide more affordable prices, up to 40% cheaper than similar proprietary brands it is expected that they will benefit from better prices Almost 10 years ago, Woolworths and Coles started a significant move to adjust their price positioning in response to the competition. Along with Metcash (IGA), they reduced product ranges in 2015–16 by 10% to 15% to simplify the weekly grocery shop for consumers At that time, the culling of products put suppliers under pressure (as now) while consumers were ambivalent: some wanted more brand variety and others preferred less. As history repeats itself, it will be interesting to see if Woolworths and Metcash will follow the latest move from Coles and how customers, suppliers, and the ACCC will react this time. Perhaps it would be harsh to describe the Ford Everest Tremor as a knee-jerk reaction. It’s better than that would suggest, but since the UB-generation Everest launched here in late 2022, it has enjoyed something of a free pass. Its key rival, the Toyota Landcruiser Prado has, until fairly recently, been on runout, a geriatric opponent that fell way short of the Ford’s ability. Knowing that the new Prado would be with customers in late 2024, Ford realised that it might need something extra to go into battle with Toyota’s Altitude version of the Prado, an off-road focused special that brought additional capability and attitude. The Tremor template had been used before, as a special edition version of the Ranger, designed in that instance to temporarily plug a gap between the Raptor and the Wildtrak X models. This time round, the Tremor becomes a permanent fixture in the Everest line up, so Ford is taking it a bit more seriously. Priced at $76,590 plus on roads, the Tremor sits near the top of the range, costing $2000 over a Sport trim and $4600 less than the flagship Platinum variant. Unlike the Ranger Tremor, it’s solely offered with the 3.0-litre V6 turbodiesel powerplant. It performs a subtly different role, largely due to the fact that aside from a single test mule, there’s no Everest Raptor in production guise. The key attractions will probably be the 29mm lift in ride height over the standard Everest and a toughened-up look. Even if you never plan to take the Tremor up anything more arduous than an unsealed road, these two attributes will be enough to win plenty of admirers who merely want the most macho Everest variant. Those who are about to test the Tremor’s chops a little more severely will note the new Bilstein position-sensitive dampers and the 285/65 R17 General Grabber AT3 all-terrain tyres. A word on this little combo: Ford claimed that these dampers would improve ability both on and off-road. I drove a selection of Tremor vehicles on the local press event and the ride was routinely wooden, stiff-legged and harsh, something I wouldn’t have expected in an Everest with this damper and tyre combination. Further investigation revealed that the tyres were typically inflated to a ruinous 13psi above the placarded pressures. I was fortunate enough to be able to take an Everest Tremor away from the launch, and once returned to the correct pressures, the ride was transformed to something even better than the Everest’s normal plushness. So if you see road tests elsewhere, criticising this vehicle’s ride quality or its unacceptable road noise, now you know why. In Ford’s defence, it was a seriously hot day, which would cause pressures to creep up, but I also wondered whether a few additional millimetres in ride height would have helped the vehicles tackle an incredibly arduous off-road route through Toolangi State Forest. Deep ruts were the order of that particular day, and there were certain routes where the Everest Sport vehicles we also had along just couldn’t negotiate sections that the Tremor barely squeaked through. The fuel tank is the same as the standard Everest range at 80 litres, although a 140-litre fuel tank is set to be offered. This will carry the same five-year warranty as the vehicle if fitted in factory and a two-year deal if retrofitted. Keep your eyes open for more news on that score. One thing to note is that because of the greater ride height and off-road detailing, the Tremor consumes fuel at a rate of 9.5L/100km, which is up a litre versus the Everest Sport. In many regards, the Everest Tremor brooks few surprises. We knew the 3.0-litre Lion V6 is a formidable engine, delivering 184kW and 600Nm, and it pairs well with the 10-speed auto. I’d still like to see a set of paddle shifters fitted to the Tremor, as this would improve the impression of control both on-road and off. As it stands, you’ll need to operate a fiddly set of smooth buttons on the side of the gear shifter if you want to dictate gears to the 10R80 transmission. The standard off-road screen is excellent, showing camera views or, if you prefer, roll and pitch angles. It also allows you to quickly engage hill descent or the rear diff lock. The Tremor uses a form of off-road traction control by braking up front which works reasonably well when low range and the rear diff lock is engaged, but the option of a front diff lock wouldn’t have gone amiss. Engine: 2993cc V6, 24v, dohc, turbodieselMax power: 184KW @ 3250rpmMax torque: 600Nm @ 1750-2250rpmTransmission: 10-speed autoWeight: 2550kgEconomy: 9.5L/100km0-100km/h: 9.2secPrice: $76,590On sale: Now Wheels' Road Test Editor brings 25 years of experience to the hot seat. Originally based in Europe, Enright has driven virtually everything and loves telling the stories behind both new and old metal. Now in his second stint at Wheels, Enright loves cars that retain a sense of fun and deliver functional ingenuity. Strangely hates convertibles and is befuddled by fine dining options. Turn on Javascript to see all the available pictures.1 / 14AdvertisementWhat’s this? Looks very much like a Range Rover…It is. But it’s actually the long, long awaited fully electric Range Rover. The fact that it looks largely identical to the existing car is deliberate and speaks volumes about JLR’s approach to the RR BEV. Because this thing makes the golden goose of lore look non-committal, and the company’s aim in going electric is to deliver a Range Rover, only more so. This is arguably the world’s premier luxury car, eclipsing even the Mercedes S-Class thanks to its commanding driving position and generally imperious manner. JLR sells 70,000 per year at an average transaction price of £136k, so it’s also a licence to print money. Mind you, just over a third of annual Range Rover production goes to the US, a market JLR recently paused exports to on account of self-styled ‘stable genius’ Donald Trump’s troublesome tariff adventures. According to JLR, there are 60,000 ‘expressions of interest’. The development team modelled all the dynamic responses of the Range Rover to match its character. There are actually some inherent advantages on the BEV, including a lower centre of gravity, better weight distribution between the axles, and no change in mass depending on fuel load. So the dynamics have actually been tuned with greater precision. A certain amount. TG has been to Arjeplog, 60 miles or so from the Arctic Circle in Swedish Lapland, to get an early look at the new car. The Range Rover BEV is powered by two permanently excited synchronous motors, one on each axle, with a silicon carbide inverter. They’re fed by a double stack 117kWh battery pack, containing 344 prismatic cells, a configuration made possible by the Range Rover’s height. It uses an 800V architecture so it can support charging up to 350kW. Rather than sourcing the hardware from an existing supplier, JLR has gone the proprietary route. “We could probably have brought the car to market a year earlier if we’d sourced the batteries externally,” a spokesman tells TG, “but we couldn’t find any that fitted the brief.” The Range Rover does have a pretty specific use case: it has to get properly down and dirty in temperatures ranging between -40 to +50°C. The car’s clever terrain response and hill descent systems also have to be fully networked into the mainframe. The battery packs will be manufactured at JLR’s facility in Hams Hall until the new gigafactory near Bridgwater in Somerset comes on line some time in 2026. JLR says it’s 100 times faster in terms of slip management than the ICE equivalent. The engineering team also insists that a dual motor set-up is better than a four motor one – as used by a certain key German rival and some chintzy Chinese newcomers – in terms of first principles of torque distribution, and for packaging and weight reasons. Torque distribution and vectoring is handled by the IDD software, which does the job of a conventional E-diff for eye-blink-rapid reactions off road. Despite the fragrant luxury and mosaic marquetry inside, full off-road capability remains a cherished Range Rover attribute. Although you won’t be able to do a tank turn in the BEV, which might hobble the Insta-likes a touch. The regular Range Rover is obviously a hefty beast and can be quite pitch sensitive under throttle load. It’s actually one of the car’s key characteristics, and the sensation is not dissimilar to the one you experience in a powerboat. Now imagine having to deal with 627 torques from standstill. The BEV uses twin rate air springs for more tightly controlled pitch and heave. “With damping there’s a soft curve and a firm curve,” Becker continues, “and the electric Range Rover goes between the two. There’s new software logic on the BEV which looks at the rate of acceleration and then applies the damping more quickly so that the car doesn’t pitch too much. That’s combined with dual rate springs. The bushes at the back have been altered to give the rear axle a bit more honesty.” There’s also a 60mm difference in the centre of mass, which helps tie the BEV down better. It’s as supremely comfortable as ever without feeling sloppy. “The handling is more linear than the regular car, some of which is down to physics and the difference in inertia,” Becker adds. “But it’s also because of the changes that have been made.” Enough. This is categorically not one of those EVs that pulverises your neck muscles, though it’s certainly brisk. ITM and IDD, says JLR, has opened up new vistas of chassis tuning. The body control has really been polished, and it feels it. Get brave with the drive modes and it’ll also drift, which is an unusual sensation in a Range Rover that’s pushing three tonnes (no confirmation on the exact weight yet). On a 28° incline, with a ‘split mu’ surface (frozen ice on one side and normal tarmac on the other), the thing just hauls itself up, magically conjuring traction out of a nightmarish scenario. There’s little sense of all that software code going berserk in the background, but it sure must be busy. The single pedal drive mode is novel, and you can adjust the level of braking regen via the main screen. But it’s not one of the car’s prime USPs. We did go off-piste. The key to progress here is low speed wheel control and how swiftly wheel slip can be detected. As already noted, the BEV’s ITM means this happens 100 times faster than on the combustion car. On rough terrain it’ll detect the slip within 50 milliseconds, and respond to it in one millisecond. From a driveability point of view, you barely even notice the throttle application. And the electric motors mean there’s loads of low end torque – and instantaneous control of it. It is. Obviously there’s a whole load more we need to determine when we get to drive the finished thing. But from this icy passenger-seated perspective, the Range Rover and electrification feel like they’re made for each other. It’s quieter, even smoother, better off-road, and more efficient. What’s not to love? Daily Mail journalists select and curate the products that feature on our site. If you make a purchase via links on this page we will earn commission - learn more Tesco shoppers have gone wild over a new range of Marmite products dubbed 'unreal' by fans of the spread The versatile yeast spread has collaborated with a number brands over the years creating peculiar innovations with everything from cheese to popcorn Now, the British supermarket giant has unveiled a new range of Marmite infused potato products debuting a total of four new potato-based dishes The range was spotted shelved in the chilled section at Tesco with eagle-eyed foodies taking to social media to spread the word to Marmite fanatics Food spotter page Food Finds UK Official posted pictures of the tasty new selection The final item on the new menu is a cheese and potato gratin made with sliced potatoes, sharp cheddar, crunchy breadcrumbs combined with Marmite.  Each of the chilled range costs £3.50 and is available for purchase both instore and online.    Taking to social media, devoted Marmite fans have hailed the new products, with one describing the delectable dishes as 'unreal' and 'banging'. 'Look at them bad boys. Mmmmmm,' one wrote. ‘Our world is better,' a second said, 'Tesco is killing it.'  'Oh yes please!!! I already do my own marmite roasters but these look unreal,' another said.  And it would appear the range has been popular, with other commenters saying they had seen the entire range already sold out in their local shops.  However, not everyone approved on the new products, with some Marmite sceptics writing in the comments it was the 'worst taste ever'.  'Love marmite but this sounds disgusting,' another unconvinced commenter wrote.    The new range is yet to be reviewed online.  The versatile yeast spread has collaborated with a number brands over the years, creating peculiar innovations with everything from cheese to popcorn, oatcakes and even sausages and butter The range was spotted shelved in the chilled section at Tesco, with eagle-eyed foodies taking to social media to spread the word to Marmite fanatics.  Included in the range is a packet of Marmite coated roast potatoes, as well as wedges and a creamy mash packing a delicious helping of the salty spread  The fourth and final on the new Marmite menu is a cheese potato gratin made with sliced potatoes, sharp cheddar, crunchy breadcrumbs, all combined with the tasty yeast condiment  The spread has become an increasingly popular – though no less divisive – addition to a number of dishes, with celebrity chef Nigella Lawson having raised eyebrows with a recipe for a Marmite-smeared spaghetti. Others curious cooks have used Marmite in a range of unique recipes, including adding it to cheese straws, glazing spuds and in sandwiches. Marmite has previously collaborated with a number of brands, including infusing the distinctive taste onto crackers, crisps and even cheeses. It comes after fans of the condiment were left devastated when it's manufacturer Unilever, revealed that it was discontinuing fan-favourite Marmite peanut butter. Upon its release five years ago, Unilever said it had been 'carefully crafted by the clever boffins in our Marmite lab to appeal to both Marmite fans and peanut butter lovers'. And after several Marmite lovers took to X to complain they were struggling to get hold of it, a Unilever spokesman confirmed the product would be leaving British supermarkets. One said: 'Not a single supermarket that I have been to in Kent has it,' while another moaned they'd searched the aisles of Tesco and Sainsbury's only to find 'nothing'. But a spokesperson at the time assured fans that Unilever was working on  a number of exciting new products. She said: 'Whilst we will no longer be making Marmite peanut butter, we are working on some new and exciting launches within our licensing range to bring our iconic Marmite flavour to shoppers in new ways and formats.' After realising the Marmite hybrid spread had gone for good, frustrated fans took to X to share their devastation. One wrote: 'So Unilever has confirmed that Marmite peanut butter has gone. This justification is typical of corporate-ese. This justification is typical of corporate-ese. "We're giving you other things to eat". Listen. I don't want other things. I want Marmite Peanut Butter. Boycotting from now on.' Tagging the manufacturer, a second complained: 'Peanut butter marmite discontinued shameful!' No one seems to have shared their thoughts on this topic yetLeave a comment so your voice will be heard first. {{message}} Metrics details The recent classification of the koala to endangered across most of its range has emphasised the urgent need for enhanced disease surveillance Little is known about the distribution and clinical significance of phascolarctid gammaherpesvirus 2 (PhaHV-2) outside the Australian states of Victoria and South Australia PhaHV-2 may have significant impacts on koala wellbeing justifying investigation into its distribution and impact To better characterise virus distribution and factors associated with infection we developed a novel quantitative polymerase chain reaction assay with a high sensitivity to facilitate rapid detection and quantification of PhaHV-2 We applied this assay to 157 predominantly clinically-derived Results indicated that the distribution of PhaHV-2 extends throughout the endangered New South Wales koala populations Frequency of detection of PhaHV-2 was highest in South Australia (25%) and lowest in northern Qld (0%) and was more likely in older koalas than younger koalas We corroborate previous findings of an association with presence of PhaHV-1 and find no evidence to support sex as a predictor for viral presence in clinically-derived samples The capacity to rapidly detect mucosal shedding of PhaHV-2 will enable rapid isolation of affected individuals and aid further research into the pathophysiological impacts of this virus in koalas and the influence of co-infections In this study we designed and optimised a qPCR assay with high analytical sensitivity and specificity as our sampling strategy largely utilises archived clinical samples with limited metadata we here focus on viral detection to extend our knowledge of the range of PhaHV-2 to the threatened koala populations of NSW We have also investigated correlations between PhaHV-2 and koala age using predominantly clinically-derived urogenital swab samples HV_230_Fwd and VK-PhaHV-2 Rev were selected as the optimal primer combination due to their agreement with the inclusion criteria listed in the Methods (see also Supplementary Table 1 All qPCRs for PhaHV-2 displayed congruous melt temperatures at 87–87.5 °C and standard curve efficiencies ranged from 88.7 to 110.1% The average 95% LOD for the assay was quantified as 132 copies/reaction (equating to a Ct value between 35 and 36; Supplementary Table 2 Specificity of the selected primers was corroborated using the NCBI BLAST function with all bidirectional sequences sent for sequencing (n = 12) exclusively matching with PhaHV-2 with sequence identity ranging between 95.77 and 100% displaying the geographical localities and sample sizes where urogenital swab samples were obtained between 2016–2022 Different biogeographical regions are represented by different colours: orange = Central Qld pink = Southern Qld/Northern NSW; blue = Mid-north NSW; green = Central NSW; red = South Australia All data used in models is provided in Supplementary Table 3 In this study we designed and optimised a novel PhaHV-2 qPCR assay with a high analytical sensitivity and specificity we discovered a more expansive distribution of PhaHV-2 to include Central NSW We explored relationships between koala age PhaHV-1 and PhaHV-2 presence by testing 157 predominantly clinically-derived urogenital swab samples We found no evidence of a sex-effect on active-shedding of PhaHV-2 In contrast to age groups of III or above (four years of age or above based on examination of dentition) PhaHV-2 was not detected in age class I or II Detection of PhaHV-2 was associated with detection of PhaHV-1 but was not associated with the detection of C pecorum (n = 157) or with clinical signs in a subset of koalas positive for C but this investigation was restricted by incomplete metadata in both field and clinical records Our assay has allowed the expansion of the known range of PhaHV-2 the optimal sample types for detecting lytic and latent infection need to be determined using a larger sample size and more sample types it is possible that the broader age groups used in those studies obscured findings specific to age classes I and II this has significant implications for biosecurity and quarantine design with isolation potentially required to prevent transmission in hospital or quarantine settings but further work should be done to clarify impacts and transmission routes of PhaHV-2 before recommendations can be made Further investigation on both free-living and clinically-derived koala samples is required to determine any potential associations between sex and PhaHV-2 presence Our analyses were limited to only 22 samples as recorded information on clinical signs was inconsistent across samples so associations between the severity in clinical signs and coinfection was not possible Potential associations between coinfections with the PhaHVs and C pecorum and clinical signs means careful sampling and standardised metadata record-keeping is required to bridge our understanding of potential coinfection dynamics The relatively few samples with PhaHV-2 detected in our study may have impacted our ability to identify any associations with clinical signs Future clinical studies can incorporate more samples health data and viral load to investigate the impacts of PhaHV-2 on koala health Assay performance and partial validation (Stage I) was consistent with assay development specifications outlined by the World Organisation for Animal Health (WOAH)25 To better understand sites of PhaHV-2 active shedding and latency the qPCR assay may be best combined with serological assays Sequence variation between positive PhaHV-2 samples emphasises the importance of further sequencing as the assay is applied to future samples across a wider geographic area our assay has expanded knowledge of PhaHV-2 distribution and offers the capacity to swiftly quantify viral load to progress exploration of PhaHV-2 pathogenesis and the influence of co-infection on chlamydial infertility The specificity of each primer was checked using the NCBI BLAST function Our final selected primers were HV2_230_Fwd (GGTGACGTGCAATTCAGTGT) and VK-PhaHV-2 Rev several samples that produced positive or discordant results between replicates (n = 12) were sent for Sanger bidirectional sequencing (Macrogen Forward and reverse sequences for each sample were analysed and used to construct a consensus sequence The consensus sequence was tested for percentage identity to the PhaHV-2 dpol gene using the NCBI BLAST function and to confirm there were no matches with PhaHV-1 Data is provided within the manuscript or supplementary information files National Koala Disease risk Analysis Report (University of Sydney Koalas: the little Australians we’d all hate to lose (Australian Government Publishing Service Beyer, H. L. et al. Management of multiple threats achieves meaningful koala conservation outcomes. J. Appl. Ecol. 55, 1966–1975. https://doi.org/10.1111/1365-2664.13127 (2018) Adams-Hosking, C. et al. Use of expert knowledge to elicit population trends for the koala (Phascolarctos cinereus). Divers. Distrib. 22, 249–262. https://doi.org/10.1111/ddi.12400 (2016) McAlpine, C. et al. Conserving koalas: a review of the contrasting regional trends, outlooks and policy challenges. Biol. Conserv. 192, 226–236. https://doi.org/10.1016/j.biocon.2015.09.020 (2015) Melzer, A., Carrick, F., Menkhorst, P., Lunney, D. & John, B. S. T. Overview, critical assessment, and conservation implications of koala distribution and abundance. Conserv. Biol. 14, 619–628. https://doi.org/10.1046/j.1523-1739.2000.99383.x (2000) Quigley, B. L. & Timms, P. Helping koalas battle disease – recent advances in chlamydia and koala retrovirus (KoRV) disease understanding and treatment in koalas. FEMS Microbiol. Rev. 44, 583–605. https://doi.org/10.1093/femsre/fuaa024 (2020) Robbins, A., Loader, J., Timms, P. & Hanger, J. Optimising the short and long-term clinical outcomes for koalas (Phascolarctos cinereus) during treatment for chlamydial infection and disease. PloS One. 13, e0209679–e0209679. https://doi.org/10.1371/journal.pone.0209679 (2018) Xu, W. et al. Exogenous retrovirus isolated from koalas with malignant neoplasias in a US zoo. Proc. Natl. Acad. Sci. - PNAS. 110, 11547–11552. https://doi.org/10.1073/pnas.1304704110 (2013) Kinney, M. E. & Pye, G. W. Koala retrovirus: a review. J. Zoo Wildl. Med. 47, 387–396. https://doi.org/10.1638/2015-0185.1 (2016) McCallum, H., Kerlin, D. H., Ellis, W. & Carrick, F. Assessing the significance of endemic disease in conservation—koalas, chlamydia, and koala retrovirus as a case study. Conserv. Lett. 11, e12425–n. https://doi.org/10.1111/conl.12425 (2018) Koala retrovirus (KoRV) Fact Sheet 1–7 (Wildlife Health Australia 2019) Detection of a novel gammaherpesvirus in koalas (Phascolarctos cinereus) Detection of a second novel gammaherpesvirus in a free-ranging koala (Phascolarctos cinereus) Cohen, J. I. Herpesvirus latency. J. Clin. Investig. 130, 3361–3369. https://doi.org/10.1172/JCI136225 (2020) Prusty, B. K. et al. Chlamydia trachomatis infection induces replication of latent HHV-6. PloS One. 8, e61400–e61400. https://doi.org/10.1371/journal.pone.0061400 (2013) Gulve, N. & Rudel, T. Chlamydia trachomatis and human herpesvirus 6 infections in ovarian cancer-casual or causal? PLoS Pathog. 15, e1008055–e1008055. https://doi.org/10.1371/journal.ppat.1008055 (2019) Wright, B. R. et al. Expanding the known distribution of phascolartid gammaherpesvirus 1 in koalas to populations across Queensland and New South Wales. Sci. Rep. 14, 1223. https://doi.org/10.1038/s41598-023-50496-4 (2024) Identification and prevalence of phascolarctid gammaherpesvirus types 1 and 2 in South Australian koala populations Stalder, K. et al. Prevalence and clinical significance of herpesvirus infection in populations of Australian marsupials. PLoS One. 10 https://doi.org/10.1371/journal.pone.0133807 (2015) Michel, A. L. et al. Pathogen detection and disease diagnosis in wildlife: challenges and opportunities. OIE Revue Scientifique et Technique. 40, 105–118. https://doi.org/10.20506/rst.40.1.3211 (2021) in Manual of Diagnostic Tests and Vaccines for Terrestrial Animals 2022 Chap Molecular Evolutionary Genetics Analysis Version 11 v Altschul, S. F., Gish, W., Miller, W., Meyers, E. W. & Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. https://doi.org/10.1006/jmbi.1990.9999 (1990) Untergasser, A. et al. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res. 35 https://doi.org/10.1093/nar/gkm306 (2007) Owczarzy, R. et al. IDT SciTools: a suite for analysis and design of nucleic acid oligomers. Nucleic Acids Res. 36 https://doi.org/10.1093/nar/gkn198 (2008) Pum, J. A practical guide to validation and verification of analytical methods in the clinical laboratory. Adv. Clin. Chem. 90, 215–281. https://doi.org/10.1016/bs.acc.2019.01.006 (2019) Genetic differences in Chlamydia pecorum between neighbouring sub-populations of koalas (Phascolarctos cinereus) Advancements in noninvasive koala monitoring through combining Chlamydia detection with a targeted koala genotyping assay Ellis, W. et al. Koalas of the Clarke Connors range. Australian Mammalogy. 45, 160–170. https://doi.org/10.1071/AM22026 (2023) Percie du Sert. Reporting animal research: explanation and elaboration for the ARRIVE guidelines 2.0. PLoS Biol. 18, e3000411. https://doi.org/10.1371/journal.pbio.3000411 (2020) Hulse, L. S. et al. Development and application of two multiplex real-time PCR assays for detection and speciation of bacterial pathogens in the koala. J. Vet. Diagn. Invest. 30, 523–529. https://doi.org/10.1177/1040638718770490 (2018) Hoorfar, J. et al. Practical considerations in design of internal amplification controls for diagnostic PCR assays. J. Clin. Microbiol. 42, 1863–1868. https://doi.org/10.1128/JCM.42.5.1863-1868.2004 (2004) Wright, B. R. et al. Development of diagnostic and point of care assays for a gammaherpesvirus infecting koalas. PLoS One. https://doi.org/10.1371/journal.pone.0286407 (2023) Johnson, R. N. et al. Adaptation and conservation insights from the koala genome. Nat. Genet. 50, 1102–1111. https://doi.org/10.1038/s41588-018-0153-5 (2018) Gordon, G. Estimation of the age of the koala, Phascolarctos cinereus (Marsupialia: Phascolarctidae), from tooth wear and growth. Australian Mammalogy. 14, 5. https://doi.org/10.1071/AM91001 (1991) R Core Team. R: A Language and Environment for Statistical Computing_. R Foundation for Statistical Computing, Vienna, Austria. https://www.R-project.org Fitting linear mixed-effects models using lme4 Grueber, C. E., Nakagawa, S., Laws, R. J. & Jamieson, I. G. Multimodel inference in ecology and evolution: challenges and solutions. J. Evol. Biol. 24, 699–711. https://doi.org/10.1111/j.1420-9101.2010.02210.x (2011) Scaling regression inputs by dividing by two standard deviations arm: Data analysis using regression and multilevel/hierarchical models Download references The authors would like to thank Lyndal Hulse for providing samples from Queensland as well Port Macquarie Koala Hospital UQ Koala Ecology Group and the many wildlife carers and veterinary clinics that submitted samples for diagnostics used in this study This study was funded by the Australian Department of Agriculture Water and the Environment Bushfire Recovery Multiregional Species Program BRW and AC are supported by the NSW Wildlife Information Rescue and Education Service (WIRES) conducted all laboratory work and data analysis; A.C contributed to laboratory work and data analysis; Y.M contributed to sampling and metadata collation contributed to interpretation and provided samples; P conceived and oversaw the project and contributed to interpretation of findings; B.R.W contributed to laboratory work and data analysis; all co-authors contributed to the final manuscript Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations Below is the link to the electronic supplementary material Download citation DOI: https://doi.org/10.1038/s41598-025-90626-8 Sign up for the Nature Briefing newsletter — what matters in science IT SEEMS THE PAGE YOU'RE LOOKING FOR HAS GONE ASTRAY GO BACK TO THE HOME PAGE THE RANGE has slashed the price of a summer essential to just £10 — and it’s perfect for garden parties this weekend Customers across the UK have been rushing to grab a stylish drinks dispenser The clear glass dispenser comes with a tap and sturdy stand, making it ideal for lemonade, punch or cocktails when hosting friends or family outdoors Shoppers say it’s the “ultimate garden essential” and a must-have for anyone planning to entertain this bank holiday The 4-litre dispenser was recently spotted on shelves and online with the price tag reduced from £14.99 to just £10 It’s part of The Range’s growing line of budget-friendly outdoor and hosting products as Brits gear up for warmer weather “Perfect for barbecues – looks great and no mess with pouring!” Another added: “Need one for when BBQ comes out." Some stores have already seen stock flying off shelves, so customers are being urged to grab one before they sell out. The Range is known for its seasonal deals, and this one’s landed just as garden party season begins. Poundland has also launched novelty garden décor from £6 and Aldi recently dropped prices on its patio furniture range Poundland has also launched outdoor décor from £6 and Aldi has dropped prices on patio sets starting at £39.99 Home Bargains is offering big savings on its Firefly Hanging Hot Air Balloon Solar Lights with larger models reduced to £3.99 from £5.99 Although the popular solar lights are currently out of stock online shoppers may still find them in selected stores where clearance deals are available A similar rainbow solar balloon light is available from The Range for £17.99 while B&M has reduced its Solar Living Hot Air Balloon from £6 to just £4 SUN Savers Editor Lana Clements explains how to find a cut-price item and bag a bargain… Sign up to loyalty schemes of the brands that you regularly shop with Big names regularly offer discounts or special lower prices for members Sales are when you can pick up a real steal Retailers usually have periodic promotions that tie into payday at the end of the month or Bank Holiday weekends so keep a lookout and shop when these deals are on Sign up to mailing lists and you’ll also be first to know of special offers It can be worth following retailers on social media too When buying online, always do a search for money off codes or vouchers that you can use vouchercodes.co.uk and myvouchercodes.co.uk are just two sites that round up promotions by retailer Scanner apps are useful to have on your phone. Trolley.co.uk app has a scanner that you can use to compare prices on branded items when out shopping Bargain hunters can also use B&M’s scanner in the app to find discounts in-store before staff have marked them out And always check if you can get cashback before paying which in effect means you’ll get some of your money back or a discount on the item