This article was published more than 6 months ago Wanze Song in her Toronto studio on June 19th designer Wanze Song invites a small group of friends and customers to her studio located near the University of Toronto and above one of the city’s perennially favourite Italian restaurants They’re there to look at the next season’s collection and for a chance to preorder their favourite pieces Photos are taken of willing shoppers in full looks and Wanze Song fall 2024 lookbook imageSUPPLIED/Supplied This isn’t the traditional way a fashion business operates But when it came to launching her WANZE brand’s luxuriously minimalist workwear in 2022 Song didn’t really intend on following in anyone’s footsteps cherry picking from her experience (stints sharpening her patternmaking skills at the labels Kiko Kostadinov and ASAI in London; assisting with sales alongside designer Xiao Li in Shanghai) to create something special on her own terms “I wanted people to have the experience of trying it but things just started to grow,” she says “People started seeing real people wearing my pieces around the city and that really sold the brand,” Song says The crescent shaped style made of ultra fine nylon that’s been padded and pleated was introduced a year earlier To this day I’m shocked by how well it did.” Song says “It just existed as something I made for myself ‘where can I buy this,’ and it took off from there.” It’s now available in four sizes (mini to large) and a range of neutral hues and bolder colours To create her clothing collection for women and men (available directly online and through boutiques Neighbours in Vancouver as well as Lost and Found Grays and River Crossing in Toronto) Song’s inspirations often start with the best materials she can find usually something familiar such as nylon or cotton twill she sets out to create something that often feels a bit foreign to her customers it was a quilted nylon that caught her eye a technical fabric often used to make puffer jackets Song has used it to craft a puffy gathered skirt Equally inspirational was a crinkled metallic cotton in “Kelp” green or black that elevates an often-straightforward chore jacket and a coordinating pair of pants building a collection boils down to these types of basics “I’m observing what people wear day to day and for men’s wear guys just want a shirt and a pant,” she says I just want to make wearable things that feel modern refined and smart so that people feel good and can stand a little taller.” For more information, visit wanzesong.com Editor’s note: An earlier version of this story incorrectly identified Toronto boutique Grays as "Grace." This version has been corrected Report an editorial error Report a technical issue Editorial code of conduct Welcome to The Globe and Mail’s comment community. This is a space where subscribers can engage with each other and Globe staff. Non-subscribers can read and sort comments but will not be able to engage with them in any way. Click here to subscribe If you would like to write a letter to the editor, please forward it to letters@globeandmail.com. Readers can also interact with The Globe on Facebook and Twitter Welcome to The Globe and Mail’s comment community This is a space where subscribers can engage with each other and Globe staff We aim to create a safe and valuable space for discussion and debate If you do not see your comment posted immediately it is being reviewed by the moderation team and may appear shortly We aim to have all comments reviewed in a timely manner Comments that violate our community guidelines will not be posted UPDATED: Read our community guidelines here We have closed comments on this story for legal reasons or for abuse. For more information on our commenting policies and how our community-based moderation works, please read our Community Guidelines and our Terms and Conditions "Vance" and "vants" are not necessarily pronounced the same After former U.S. President Donald Trump announced Ohio Sen. JD Vance as his running mate in the 2024 presidential election online users researched Vance's political positions and background theorizing on the potential impact he could have on the race During that research, a few people commented on a purported linguistic coincidence: The senator's last name apparently means "bedbug" in Yiddish we confirmed Vance's last name indeed sounds similar Yiddish is written in the Hebrew script, not the Latin alphabet. As such, we needed a dictionary to provide transliterated Yiddish in order to compare the two words. Many online Yiddish-English dictionaries we found only provided Yiddish written in the Hebrew script, complicating our research. However, we eventually found a dictionary administered by the University of Kentucky that provides transliterated Yiddish By searching it for "bedbug," results displayed the Yiddish word "vants." since the word "vants" likely came from German that language's translation of "bedbug" ("die Wanze") is further evidence to corroborate the claim The Forward an English-language publication for Jewish readers they're close enough to homonyms that anyone trying to make an easy joke can consider the claim at least partly factual Jack Izzo is a Chicago-based journalist and two-time "Jeopardy!" alumnus This material may not be reproduced without permission Snopes and the Snopes.com logo are registered service marks of Snopes.com She studied fashion design at Toronto Metropolitan University before stints in Berlin and London where she worked part time as a design assistant at Kiko Kostadinov She wanted to design something “that gives the same feeling as a dumpling”—one of comfort and coziness Fall/winter 2023 is a cohesive collection of rigorous tailoring crafted from luxurious fabrics with unexpected technical flourishes the side seams replaced with elongated front darts that lead into side pockets for a fluid silhouette Or a zip blouson made from Italian technica radzimir a lustrous silk—a customer favourite now carried by the influential Toronto menswear shop Lost & Found Wanze Song is chiefly concerned with the craft of clothes-making and connecting with her customers “I get the most fulfillment doing the patterns,” she says Her process as a designer produces “three serotonin doses”—idea development and seeing her customers in her clothes—that make the taxing sometimes lonely work of a designer worthwhile “It just feels like you’re able to build from zero to this vision,” Song says of seeing her ideas come to life “I think that’s why all the designers struggle and do this because that feeling cannot be replaced by anything else.” Adidas All Saints Balenciaga Brunello Cucinelli Canada Goose COACH COS Dior Fendi Giorgio Armani Givenchy Harry Rosen Hermes Hugo Boss Louis Vuitton Montblanc Paco Rabanne Prada Saint Laurent Salvatore Ferragamo Strellson Timberland Tommy Hilfiger Acura Audi Bentley BMW Cadillac Chevrolet Ferrari Genesis INFINITI Jaguar KIA Lamborghini Land Rover  Lexus McLaren Mercedes-Benz Nissan Porsche Range Rover Rolls-Royce Volkswagen Mercedes-Benz A. Lange & Söhne Accutron Alpina Audemars Piguet Baume & Mercier Bell & Ross Blancpain Breitling Bulova Cartier Chopard Citizen Frederique Constant Glashütte Original Grand Seiko Harry Winston Hermès Hublot IWC Jaeger-LeCoultre Longines Nomos Glashütte Omega Panerai Patek Philippe Piaget Rado Raymond Weil Richard Mille Roger Dubuis Rolex Seiko TAG Heuer Tudor Vacheron Constantin Victorinox Zenith Angel’s Envy Balvenie Belvedere Bombay Sapphire Bowmore Casamigos Glenfiddich Glenlivet Glenmorangie Grey Goose Hennessy Jefferson’s Ocean JP Wisers Jura Patron Redbreast Suntory Tanqueray The Dalmore March 6 “Buy Canadian” is the thème du jour — and given the wealth of talent on hand it’s not hard to persuade us to make a patriotic purchase As myriad pastoral patterns and quality materials will show you the sweeping landscapes are both muse and canvas for Canadian designers river-like curves of Libero-made lapels; maybe you’ll find it on a shelf by Objects & Ideas Whether you refresh your wardrobe or your living room take one tip from us: Canadian designers are ever-in-vogue and sleek dining sets line the Montauk Sofa showrooms Filled with plush blend of goose down and latex foam (in a 9-1 ratio) Montauk sofas offers a host of customizable options to tailor each piece for every client After graduating from the Fashion Design program at Toronto Metropolitan University Wanze Song founded her eponymous label to take “a patient approach to design.” Her patience is clear chore coat charm of a Wanze Poplin shirt to the many cozily-wrapped collars on cashmere jackets Every object starts with an idea. For a few particularly-skilled crafters, that transition is a smooth one — sleek and seamless as the swirling contour of the aptly-named Beaver Tail Chair “The best products in the world are different a voice that speaks to us all,” says the Toronto-based studio Objects & Ideas The studio’s offerings speak clearly blurring the line between sculpture and shelf Mindful and meticulous designs radically reshape every interior adding playful pops to each living room and kitchen SECTION 35 tells a stylish story. Founded by Indigenous designer Justin Jacob Louis the young label has flourished — even amidst of a crowded streetwear scene Pixelated graphics punctuate the collection alongside flashes of syllabic patterns and cotton-twill carpenter pants Characterized by its straight lines, low-rise forms, and negative space, JDH Projects walks along a few tightropes: it’s subtle Balancing the tension between complex engineering and simple subjects Composed of luxe materials like white oak wood Founded in 2014 on the streets of Montreal, École de Pensée sought to revisit and reimagine traditional masculine attire these Canadian designers led a ‘new wave’ of men’s tailoring combining a modern nonchalance with rigorous attention to detail; taken together these approaches culminate in a menswear collection that radiates an effortless That’s the philosophy behind Ecologyst a ‘clean-production’ couturier based in Victoria Founder René Gauthier Ecologyst to promote slow fashion with unprecedented transparency: at ‘The Factory’ — a studio for clothing design and repair — visitors enjoy an intimate look at the entire process the garments reflect our contemporary need for environmental and economic responsibility Seth Cosmo Burton works in a studio on the shores of Salt Spring Island to create intricate patterns on bespoke steel knives and wedding rings “COSMO is about contributing to a better more sustainable and pleasurable way of life,” writes Burton in a mission statement COSMO works with sustainably-sourced materials fashioning blades of artisan Damascus steel and smooth handles with local wood “It is about balance,” Burton finishes “Whether it be the way a knife rests in the palm of your hand a ring sits on your finger or the dance between work and life.” the collective aims to enrich the fashion industry through collaboration Le Cartel has grown to include over fifty artists from photographers and painters to tattoo artists and graphic designers prioritizing local materials and fair pricing These are the hallmarks of Montreal’s Alphabet a furniture specialist that’s laden with intrigue-sparking fixtures for your interior Highlights include the creatively-elegant Storage Ladder and the whimsical Dimanche Table both of which capture the je ne sais quoi charm of their native city Unlike our other fashion-focused favourites Good for Sunday thrives in the realm of casual comfort and the occasional bit of linen round out the portfolio of this fully made-in-Canada operation They’re one of the last fully Canadian clothing makers that mills With sustainability and ethical manufacturing as key pillars of operations the brand has has developed a devout following amongst those who value where and how their garments are made Web Design & Development by Viuu Media Group Subscribe to S Magazine Sign up for the Newsletter S Magazine Canada's leading luxury lifestyle magazine for sophisticated women Chinese-Canadian designer Wanze Song steps into the accessory scene with her signature Dumpling Bag Named for its resemblance to Chinese dumplings the bag is padded with batting to create a stuffed appearance with adjustable straps to accommodate both shoulder and crossbody options A graduate of Toronto Metropolitan University based in Toronto Song has worked globally under the brands Beaufille Her brand values quality and functionality while taking a patient approach to design Wanze Song’s Dumpling Bag is available at wanzesong.com Metrics details thus allowing to couple a cell’s ground-state transcriptome to its downstream molecular or phenotypic behaviour functional responses and whole-cell transcriptome read-outs to demonstrate that Live-seq can accurately stratify diverse cell types and states without inducing major cellular perturbations we show that Live-seq can be used to directly map a cell’s trajectory by sequentially profiling the transcriptomes of individual macrophages before and after lipopolysaccharide (LPS) stimulation and of adipose stromal cells pre- and post-differentiation we demonstrate that Live-seq can function as a transcriptomic recorder by preregistering the transcriptomes of individual macrophages that were subsequently monitored by time-lapse imaging after LPS exposure genome-wide ranking of genes on the basis of their ability to affect macrophage LPS response heterogeneity revealing basal Nfkbia expression level and cell cycle state as important phenotypic determinants Live-seq can address a broad range of biological questions by transforming scRNA-seq from an end-point to a temporal analysis approach The main obstacle is that most genome-wide profiling methods destroy the cell which makes follow-up molecular or phenotypic experiments on this same cell impossible cytoplasmic mRNA can be withdrawn from live single cells in an amount that is compatible with transcriptome profiling As this procedure can be performed while keeping the cells alive it allows to directly couple the current state of a cell to its downstream molecular and phenotypic properties We demonstrate how Live-seq can be used to perform sequential molecular profiling of the same cells we show that Live-seq can function as a transcriptomic recorder by preregistering the transcriptomes of individual macrophages to subsequently identify factors underlying macrophage lipopolysaccharide (LPS) response heterogeneity uncovering basal Nfkbia expression level and cell cycle state as important phenotypic determinants Illustration and representative images of the Live-seq sampling procedure using FluidFM (here The white arrows indicate the application of under- or overpressure The black arrows indicate the amount of buffer and extract in the probe Quality control of Live-seq applied on IBA cells based on the parameters that are listed above each panel percentage of counts from mitochondrial genes these technological advances constitute the methodological foundation of Live-seq for transcriptome profiling using cytoplasmic biopsies t-SNE projection of the integrated Live-seq and scRNA-seq data according to cell type and state (treatment) (f) and approach (g) these results demonstrate that Live-seq enables the stratification of cell types and states similar to conventional scRNA-seq these results indicate that Live-seq and scRNA-seq may be subject to comparable technical constraints linked to limited RNA input our results indicate that cells quickly recover their volume and still progress through their cell cycle even after having been subjected to a cytoplasmic biopsy Schematic of the experimental design to evaluate putative transcriptomic changes after Live-seq extraction IBA cells were first extracted after which they were collected and subjected to scRNA-seq 1 h and 4 h postextraction Cells that were not extracted were included as controls All of the genes (12) that were found DE between the control and Live-seq-sampled IBA cells from a we conclude that Live-seq enables the profiling of cell transcriptomes without imposing major perturbations on a cell’s basic properties such as viability This in turn opens a new avenue to link a cell’s state directly to its present and future molecular and phenotypic properties paving the way to directly map a cell’s trajectory or to record molecular events that are predictive of a cell’s downstream phenotype Even a limited number of Live-seq sampled cells might thus provide a reference coordinate system to map cell trajectories of existing and future scRNA-seq datasets sequential sampling with Live-seq allows the acquisition of transcriptomic dynamics from the same cell thus providing a direct read-out of both rapid and slower cell state transitions n = 32 cells over two independent experiments and P values were determined by a two-sided Wilcoxon rank-sum test the transcriptome-wide read-out enabled by Live-seq points to Nfkbia expression as the strongest predictor of LPS-induced Tnf expression although Live-seq sampling is currently throughput-limited with 4–5 extractions per hour due to downstream processing and following the fate of individual cells by live imaging it still provided sufficient data to generate testable hypotheses cells in S phase responded significantly weaker (two-sided Wilcoxon rank-sum test P = 0.001 for both) to LPS stimulation (rate of Tnf-mCherry intensity increase) compared to their G1 and G2M phase counterparts these findings underscore the power of Live-seq to act as a recording tool for the transcriptomes of individual cells and predict their phenotypic behaviour we established Live-seq by coupling an enhanced FluidFM-based live-cell biopsy technology to a highly sensitive RNA-seq approach We showed that Live-seq is capable of distinguishing cell types and states This conclusion is based on the fact that cells proceeded in their cell cycle remained LPS-responsive similar to control cells preserved adipogenic differentiation capacity and showed only minor transcriptomic changes after cytoplasmic sampling In summary, Live-seq enables single-cell transcriptome profiling as well as downstream molecular and functional analyses on the same cell at distinct time points (Figs. 4 and 5) providing opportunities to address some of the long-standing biological questions pertaining to cell dynamics or cellular phenotypic variation We thereby expect the next generation of the Live-seq approach to allow for sampling of many more cells aiming to alleviate relevant statistical power and cellular resolution concerns we anticipate that Live-seq will transform single-cell transcriptomics and possibly other omics technologies such as single-cell proteomics and metabolomics from the current end-point type assay into a temporal analysis workflow The cell lines have not been authenticated or tested for mycoplasma contamination All these cells were cultured in high-glucose DMEM medium (Life Technologies) supplemented with 10% foetal bovine serum (FBS) (Gibco) and 1× penicillin/streptomycin solution (Life Technologies) in a 5% CO2 humidified atmosphere at 37 °C and maintained at less than 80% confluence before passaging /5Biosg/AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN TSO (Exiqon): AAGCAGTGGTATCAACGCAGAGTACATrGrG+G Iso-TSO (Exiqon): iCiGiCAAGCAGTGGTATCAACGCAGAGTrGrG+G Biotinylated-TSO (Exiqon): /5Biosg/AAGCAGTGGTATCAACGCAGAGTACATrGrG+G GGCGGCGCGCGCGCGCCGCCAAGCAGTGGTATCAACGCAGAGTACATrGrG+G Biotinylated-ISPCR oligo (IDT): /5Biosg/AAGCAGTGGTATCAACGCAGAGT Hairpin-TSO was annealed in IDT Duplex Buffer before use The FluidFM scan head was mounted on an inverted AxioObserver microscope equipped with a temperature-controlled incubation chamber (Zeiss) and coupled to a spinning disc confocal microscope (Visitron) with a Yokogawa CSU-W1 confocal unit and an EMCCD camera system (Andor) Phase-contrast and fluorescence images were acquired using ×10 and ×40 (0.6 numerical aperture NA) objectives and a ×2 lens switcher using VisiView software (Visitron) Microscopy images were analysed using the AxioVision and ImageJ softwares Sampling buffer for preloading was prepared by supplementing a 0.2% solution of Triton-X 100 in nuclease-free water with 2 U μl−1 recombinant RNase inhibitors (Clonetech) Lysis buffer for extract transfer was prepared as that used in the enhanced Smart-seq2 protocol Whereas cells were maintained at 37 °C for time-lapse microscopy before and after extractions the extraction procedures were all performed at room temperature The probe reservoir was loaded with 10 µl of mineral oil (Sigma-Aldrich) and a pressure of Δ + 1,000 mbar was applied to flow the oil into the microchannel the probe was shortly immersed in nuclease-free water and then kept in air with the residual water carefully blotted off the probe holder with a kimwipe tissue A 1.0-μl drop of sampling buffer was deposited onto an AG480F AmpliGrid (LTF Labortechnik) The cantilever was introduced into the drop using the micrometre screws to displace the atomic force microscope Once the cantilever was located inside the drop underpressure (−800 mbar) was applied for the suction of roughly 0.5 pl of sampling buffer into the probe The cantilever was then withdrawn from the drop using the micrometre screws the preloaded probe was immersed in the cell sample experimental medium the cell to be extracted was visualized by light microscopy and the tip of the FluidFM probe was placed above the cytoplasm of the selected cell The tip of the probe was then inserted into the cytoplasm through a forward force spectroscopy routine driven by the Z-piezo The probe was then maintained inside the cell at constant force a force setpoint of 500 nN was used to ensure the full insertion of the probe aperture into all the cell types Underpressure larger than −800 mbar was applied to aspirate the cellular content into the probe whereby the harvested cytoplasmic fluid immediately mixed with the preloaded sampling buffer The pressure-assisted flow of the intracellular content into the FluidFM probe was interrupted by switching the pressure back to zero We collected cytoplasmic extracts of 1.1 pl on average The probe was then retracted out of the cell shortly immersed in nuclease-free water and then kept in air with the residual water carefully blotted off the probe holder with a kimwipe tissue A 1.0-μl drop of lysis buffer was deposited onto an AG480F AmpliGrid (LTF Labortechnik) The cantilever was introduced into the drop and overpressure (more than 1,000 mbar) was applied to release the extract The microchannel was then rinsed three times by suction and release of lysis buffer into the probe The 1.0-μl drop was then pipetted into a PCR tube containing an additional 3.2 μl of lysis buffer and the solution was briefly centrifuged and stored at −80 °C until further processing All steps were monitored in real time by optical microscopy in brightfield The entire procedure took roughly 15 min per sample with around 5 min for loading the sampling buffer and approaching a selected cell 5 min to extract the cytoplasmic biopsy and 5 min to transfer the extract into the lysis buffer and then to the PCR tube collecting 10 to 20 biopsies per experiment For the assessment of cross-contamination between samples that were extracted sequentially with the same probe alternated human/mouse cell sampling was conducted with HeLa and IBA cells seeded on separate dishes The cells were extracted alternatively from one or the other cell type as described above For the sequential sampling of the same RAW cell up to 24 cells were extracted as described above with all the cells monitored within one vision field The first extractions were performed within a 1 h time window The cells were then incubated at 37 °C under time-lapse monitoring with intervals of 5 min LPS was added to the dish for stimulation and the cells were further monitored at 5 min intervals for another 30 min The time-lapse intervals were then increased to 30 min and the cells were further monitored for 3.5 h The temperature was then switched back to room temperature and the same cells were extracted a second time in a time interval of 4 to 5 h after the addition of LPS and the cells were incubated for 2 days in a 5% CO2 humidified atmosphere at 37 °C The medium was then exchanged for complete culture medium and the cells were incubated for another 3 to 5 days with the medium exchanged every 2 days Lipid staining was then performed using 5 μg ml−1 BODIPY 558/568 (Invitrogen) for 20 min Nucleus staining with 5 μg ml−1 4,6-diamidino-2-phenylindole (DAPI) was performed at the same time The entire culture area was then imaged to create the map before imaging individual barcoded cells in brightfield For the molecular recording to predict a cell’s downstream phenotype RAW cells within one vision field were extracted as described above The cells were then monitored at 37 °C under time-lapse imaging with intervals of 5 min LPS was added to the dish for stimulation (0.5 to 1.5 h after extraction) and the cells were further monitored with 5 min intervals for another 30 min and the cells were further monitored for at least 8 h L4391-1MG) was prepared in PBS at 100 μg ml−1 as a stock solution LPS solution was added to the 5 ml of CO2-independent medium to reach a final concentration of 100 ng ml−1 The genetic barcoding of ASPCs was performed using the pLARRY system51 LARRY Barcode Library v.1 was a gift from F The DNA was prepared directly by collecting cells directly from a Luria–Bertani agar plate rather than from a liquid culture to maximally preserve the overall library complexity which was further confirmed by next-generation sequencing Barcode-bearing lentivirus was produced in 293T cells using the third-generation lentivirus packing system The virus-containing medium was collected 48 h posttransfection ASPCs were transduced by the virus-containing medium and fresh medium with Polybrene (final concentration at 10 μg ml−1) followed by centrifugation at 1,500g for 30 min after which cells were returned to the cell incubator The medium was exchanged 12 h later and cells were maintained at a density lower than 80% confluency confluent cells were exposed to adipogenic induction medium (complete culture medium supplemented with 1 μM dexamethasone 167 nM insulin and 1 μM rosiglitazone (DMIR) the induction medium was removed and the maintenance medium (the complete culture medium supplemented with 167 nM insulin) added the maintenance medium was removed and complete culture medium was added Lipid droplets were stained using BODIPY 558/568 (Invitrogen) at 5 μg ml−1 for 20 min after which cells were subjected to imaging The barcodes were retrieved from the cDNA of Live-seq samples The barcode region was enriched from 1 ng cDNA by PCR using the primers BC-FOR1 (5′-ctgagcaaagaccccaacgagaa-3′) and BC-REV1 primers (5′-gctggcaactagaaggcacag-3′) and using the following program: (1) 98 °C for 30 s; (2) 98 °C for 10 s; (3) 63 °C for 30 s; (4) 72 °C for 1 min go to step (2) for 15 cycles; (5) 72 °C for 5 min and (6) end Then 1 μl of PCR product was subjected to a second round of PCR with For-MEDS-A (5′-tcgtcggcagcgtcagatgtgtataagagacagcgttgctaggagagaccatatg-3′) and Rev-MEDS-B primers (5′-gtctcgtgggctcggagatgtgtataagagacaggtcgacaccagtctcattcagc-3′) and using the following program: (1) 98 °C for 30 s; (2) 98 °C for 10 s; (3) 63 °C for 30 s; (4) 72 °C for 1 min The result PCR product was purified with AMPure XP beads (Beckman) using a 2.5 volume of beads per 1 volume of PCR product ratio and eluted with 20 μl of nuclease-free water Then 10 μl of the purified product was indexed using the Nextera index kit (Illumina) using the following program: (1) 98 °C for 30 s; (2) 98 °C for 10 s; (3) 63 °C for 30 s; (4) 72 °C for 1 min go to step (2) for four cycles; (5) 72 °C for 5 min and (6) end The resulting product was purified with AMPure XP beads (Beckman) using a 2.5 volume of beads per 1 volume of PCR product ratio The concentration was then measured using a Qubit dsDNA HS Assay Kit and subjected to sequencing in the Gene Expression Core facility at the EPFL the volume of preloaded sampling buffer and the volume of cytoplasmic extract mixed with the sampling buffer were measured on brightfield images using the AxioVision software The area occupied by the aqueous solutions confined in the cantilever was multiplied by the channel height of 0.8 μm and the volume of the hollow pyramidal tip (90 fl) was added To determine the volume of extracted cytoplasmic fluid the volume of preloaded sampling buffer (FluidFM probe before extraction) was subtracted to the volume of mixed sampling buffer and extract (FluidFM probe after extraction) IBA and ASPC cells were dissociated by trypsinization and RAW264.7 cells with a cell scraper The dissociated cells were then imaged in brightfield with the ×40 objective and the ×2 lens switcher and the diameter of the rounded cells was measured from the micrographs using the AxioVision software Three diameters were measured and averaged for each cell (n = 277 for ASPC and n = 500 for IBA and RAW) The volumes were calculated using the formula for a sphere For the longitudinal measurements of RAW cell volumes the areas of selected semi-adherent cells were measured on brightfield images acquired with the ×40 objective and the ×2 lens switcher at several time points before and after extraction and cell volumes were calculated assuming a spherical cell shape For live imaging of RAW-G9 cells expressing mCherry the Ibidi dish was covered and the temperature was maintained at 37 °C Time-lapse images were acquired at 5 min intervals for 1 h in brightfield and for mCherry (561 nm laser and 609/54 nm emission filter) using the ×40 objective and the ×2 lens switcher 2 µl of tricolour calibration beads (Invitrogen MultiSpeck Multispectral Fluorescence Microscopy Standards Kit Life Technologies Europe B.V.) was added to the sample and at least 30 individual beads were imaged with the 561 laser all the cells that moved out of view or focus died or overlapped with other cells were excluded from analysis in each time-lapse frame Cell boundaries were all manually defined in Fiji and background intensities were measured for each time point and subtracted from all intensity values 122 LPS-stimulated cells that were not extracted and 23 cells that were not extracted and not stimulated with LPS The fluorescence intensity of the calibration beads with subtracted background intensity was measured using Fiji and the average of the 30 bead intensities was used to normalize the fluorescence measurements of the cells acquired in different experiments The area under a curve was calculated from 3 to 7.5 h post-LPS treatment A two-sided Wilcoxon rank-sum test was used to examine the differences between conditions To evaluate the postextraction viability of ASPC (n = 33) and IBA (n = 37) cells the cells were stained between 2 and 4 h after extraction using a LIVE/DEAD Cell Imaging Kit 488/570 (Invitrogen) To evaluate the postextraction viability of RAW264.7 cells the extracted cells (n = 72) were monitored by time-lapse microscopy during around 10 h at 30 min intervals Cells were evaluated as dead or alive on the basis of their morphology movements and expression of mCherry in response to LPS stimulation The postextraction viability was assessed for 42 cells extracted once before stimulation 30 cells extracted once after LPS stimulation and ten cells extracted twice The volumes that were extracted ranged between 0.7 and 3.3 pl (mean 1.4 pl) for ASPCs between 0.4 and 2.9 pl (mean 1.0 pl) for IBA cells and between 0.2 and 3.5 pl (mean 1.1 pl) for RAW cells The viability of all the cell types was calculated as an absolute value without normalization To perform scRNA-seq on cells post-Live-seq extraction cells were first cultured in a dish containing a silicone micro-insert (Ibidi 80409) at a density of around 20 cells per well The insert was then removed just before Live-seq sampling and all the cells were subjected to Live-seq extraction as described above Then 1 and 4 h after the middle of the extraction time window (that is along with the control cells not extracted were collected on ice and single cells were picked using a serial dilution approach The downstream processing followed a similar workflow as the Smart-seq2 method The mCherry intensities were further normalized using the beads calibration The mouse Nfkbia promotor (+1,606 to −121) fragment was obtained by PCR (forward primer ttcaaaattttatcgatcagtgaaatccagaccagccgggcctac reverse primer ggctgtgcggggctgagcgg) from mouse genomic DNA The TagBFP CDS fragment was obtained by PCR (forward primer tgcagcctgcacccgctcagccccgcacagccACCatgagcgagctgattaaggagaac reverse primer tgtaatccagaggttgattgtcgacgcggccgcttaattaagcttgtgccccagtttgc) from a TagBFP-bearing plasmid A linearized lentivirus vector devoid of the EF1a promoter was obtained by PCR (forward primer gcggccgcgtcgacaatcaac reverse primer cccggctggtctggatttcactgatcgataaaattttgaattttgtaatttgtttttgtaattc) using the pLV-vector as template (kindly provided by J All three fragments were then assembled using a Gibson Assembly Master Mix (NEB) according to the manufacturer’s instructions The mCherry and BFP intensities were further normalized using the beads calibration The basal BFP intensity was averaged from the three first time-frames to evaluate the potential molecular perturbation of cytoplasmic sampling scRNA-seq data of IBA cells 1 h (49 cells) and 4 h (43 cells) postextraction were generated using cells (70 cells) that were not subjected to such sampling as control The counts of all samples were merged into a single gene expression matrix with genes in rows and samples in columns (Gene Expression Omnibus (GEO) accession number GSE141064 To evaluate the cross-sample contamination we sampled human and mouse cells alternatively Reads were aligned to the mixed human: mouse reference genome (hg38 and mm10) using STAR and the number of reads per feature was counted by HTseq using the same settings as mentioned above Digital gene expression matrices were generated for each species We analysed the downstream data using R (v.3.5.0) plots generated using the R package ggplot2 (v.3.2.1) The downstream analysis followed the procedures of the Seurat R package (v.3.0) Samples showing low quality were filtered out with quality cut-offs being: (1) the number of genes fewer than 1,000 (2) the mitochondrial read ratio more than >30% or (3) the uniquely mapped rate fewer than <30% the data were normalized to the total expression after which a pseudo-count was added and the data were log transformed To evaluate the effect of varying sequencing depth on the clustering of Live-seq data we down-sampled the raw counts to the desired number The down-sampled matrices were analysed in the same way as described above The clusters were consistent with the original analysis indicating that the clusters were not driven by sequencing depth Both wikipathways-20200810-gmt-Mus_musculus.gmt and the Gene Ontology terms obtained from the R database org.Mm.eg.db (v.3.10.0) were used as reference the CCA and mutual nearest neighbours (MNNs)-based approaches embedded in Seurat v3 were used the top 500 highly variable genes of both datasets were chosen for PCA analysis independently The first ten principal components of each were used to identify the anchors and for data integration data stemming from cells belonging to each cluster in both Live-seq and scRNA-seq analyses were collapsed into a ‘bulk’ RNA-seq dataset after which the Pearson’s correlation between the bulk Live-seq and the bulk scRNA-seq datasets was determined To evaluate the effect of varying sequencing depth on data integration The down-sampled matrices were then analysed in the same way as described above The cells sampled with Live-seq or scRNA-seq from the two cell types were analysed on a cell type-by-cell-type basis following Seurat's pipeline the only batch containing both DMIR-treated and non-treated cells Live-seq the scRNA-seq were selected The cells were filtered using the same filtering as previously described then the data normalized and scaled for nCounts nFeatures and batch (if more than one batch) were used to compute the PCA the first ten principal components were used to compute the t-SNE with perplexity set to 10 Differential gene expression analysis was conducted using edgeR60 v.3.34.0 Only genes expressed in at least 5% of the data with a minimal count of 2 (filterByExpr() min.count = 2 min.prop = 0.05) and in at least 15% of the cells of one of the categories with a minimal count of 2 in the scRNA-seq data were considered The dispersions and negative binomial glm were fitted (glmQLFit and glmQLFTest functions) for the model roughly 0 + categories + batch the categories being the different groups to be tested The quasi-likelihood F-tests were calculated for each group with the null hypothesis being that there is no difference between the mean in the group of interest and the average over all the remaining categories (clusters) The P values were corrected using the Benjamini–Hochberg procedure and expressed in at least 15% of one of the two groups were considered DE the differential expression analyses were performed separately for the two techniques the log fold-expression changes of each gene were plotted against each other The DE genes were highlighted (Bonferroni adjusted P value < 0.05 and an absolute logFC > 1) A linear model was fitted using lm() over (1) all the genes (2) only the genes detected as DE in the scRNA-seq datasets or (3) the genes defined as DE in both the Live-seq and scRNA-seq datasets Similar analyses were also applied per cell type basis that is in RAW cells before and after LPS treatment and ASPC before and after differentiation Differential expression analysis per cell type was performed using edgeR package by contrasting between non-treated versus treated cells in the same fashion as described above absolute logFC > 1 and expressed in at least 15% of one of the two groups of cells with at least two counts were considered DE cells of the scRNA-seq datasets were randomly selected to match the number of cells of the Live-seq data The count matrices were then down-sampled per cell to have the same density distribution of the number of features as the corresponding Live-seq data the cells were ordered by the number of features in the scRNA-seq and Live-seq datasets and paired on the basis of this metric The number of sampled reads (with replacement) of the scRNA-seq cells were defined so that the down-sampled data reached a similar number of features (absolute difference below 5) compared to its paired Live-seq cell The down-sampled data were then (up-)sampled with replacement to match the library size of their paired Live-seq cell Differential expression analysis was then performed as described above we then constructed a linear model that predicts the intercept or slope of the mCherry response using the expression of a gene measured by Live-seq before treatment with LPS Given the limited number of cells and thus to increase the statistical power of the models only the 500 most variable genes from both the RAW-G9 Live-seq and scRNA-seq data were used but removing genes with a dispersion lower than 0.1 The genes were then ranked on the basis of their respective R2 values We used two tests to assess the significance of each gene: an F-test on the overall model as implemented using R’s lm function and a bootstrapping approach in which we randomly sampled cells with replacement to calculate an empirical P value P values were corrected for multiple testing using the Benjamini–Hochberg procedure as implemented using the R’s p.adjust function with function ‘gene.relative.velocity.estimates(deltaT = 1 (2) relative gamma fit without cell kNN smoothing fit.quantile = fit.quantile)’ and (3) velocity estimate based on gene structure the unfiltered intronic and spanning expression matrix was used to include more genes for the genome-wide model fit We retrieved single-cell expression data of five macrophage subsets from the GEO database (GSE117081)67 We calculated for each gene a standardized variance by modelling the relationship between the observed mean expression and variance using local polynomial regression as implemented in the Seurat (v.3.1.4) FindVariableFeatures function Genes of the KEGG NF-κB signalling pathway downstream TLR4 receptor were highlighted All mouse experiments were conducted in strict accordance with the Swiss law and all experiments were approved by the ethics commission of the state veterinary office (licence number VD 3406 valid from 14 October 2018 to 14 January 2022) Mice were housed under specific pathogen-free conditions at 20–24 °C with 45–65% humidity and a 12 light/12 dark cycle Further information on research design is available in the Nature Research Reporting Summary linked to this paper All Live-seq and scRNA-seq data are available in the GEO with accession number GSE141064 The codes used to analyse the Live-seq and scRNA-seq data are incorporated into the Methods sections listed above, shared at https://github.com/DeplanckeLab/Live-seq and archived at https://doi.org/10.5281/zenodo.6611232 The technology and biology of single-cell RNA sequencing FluidFM: combining atomic force microscopy and nanofluidics in a universal liquid delivery system for single cell applications and beyond Tunable single-cell extraction for molecular analyses Stochastic state transitions give rise to phenotypic equilibrium in populations of cancer cells Challenges in measuring and understanding biological noise Rare cell variability and drug-induced reprogramming as a mode of cancer drug resistance Early myeloid lineage choice is not initiated by random PU.1 to GATA1 protein ratios Variability within rare cell states enables multiple paths toward drug resistance Transition states and cell fate decisions in epigenetic landscapes A comparison of single-cell trajectory inference methods The emergence and promise of single-cell temporal-omics approaches Concepts and limitations for learning developmental trajectories from single cell genomics Sci-fate characterizes the dynamics of gene expression in single cells NASC-seq monitors RNA synthesis in single cells scSLAM-seq reveals core features of transcription dynamics in single cells Transcriptional recording by CRISPR spacer acquisition from RNA Rewritable multi-event analog recording in bacterial and mammalian cells Synthetic recording and in situ readout of lineage information in single cells Genomically encoded analog memory with precise in vivo DNA writing in living cell populations Metabolic labeling of RNA uncovers principles of RNA production and degradation dynamics in mammalian cells Force-controlled manipulation of single cells: from AFM to FluidFM Smart-seq2 for sensitive full-length transcriptome profiling in single cells Strategies for microarray analysis of limiting amounts of RNA Comparative analysis of single-cell RNA sequencing methods Incorporation of non-natural nucleotides into template-switching oligonucleotides reduces background and improves cDNA synthesis from very small RNA samples Highly multiplexed and strand-specific single-cell RNA 5′ end sequencing Dissecting the brown adipogenic regulatory network using integrative genomics Switching of the relative dominance between feedback mechanisms in lipopolysaccharide-induced NF-κB signaling Enrichr: a comprehensive gene set enrichment analysis web server 2016 update Comprehensive integration of single-cell data Benchmarking single-cell RNA-sequencing protocols for cell atlas projects Interferon γ induces the expression of p21waf-1 and arrests macrophage cell cycle Cell growth and size homeostasis in proliferating animal cells Fundamental limits on dynamic inference from single-cell snapshots Gelsolin inhibits the inflammatory process induced by LPS Inactivation of endotoxin by human plasma gelsolin Bright monomeric near-infrared fluorescent proteins as tags and biosensors for multiscale imaging Unravelling cellular relationships during development and regeneration using genetic lineage tracing Single-cell transcriptomics meets lineage tracing Jovanovic, M. et al. Dynamic profiling of the protein life cycle in response to pathogens. Science https://doi.org/10.1126/science.1259038 (2015) Transcription–replication conflicts: how they occur and how they are resolved The prevention and resolution of DNA replication–transcription conflicts in eukaryotic cells Single-cell RNA counting at allele and isoform resolution using Smart-seq3 Cancer stem cells and cell size: a causal link A stromal cell population that inhibits adipogenesis in mammalian fat depots Lineage tracing on transcriptional landscapes links state to fate during differentiation DescTools: Tools for Descriptive Statistics (R-Project HTSeq—a Python framework to work with high-throughput sequencing data A single-cell transcriptional atlas of the developing murine cerebellum clusterProfiler: an R package for comparing biological themes among gene clusters Single-cell RNA-seq reveals changes in cell cycle and differentiation programs upon aging of hematopoietic stem cells Differential expression analysis of multifactor RNA-Seq experiments with respect to biological variation Slingshot: cell lineage and pseudotime inference for single-cell transcriptomics TSCAN: Pseudo-time reconstruction and evaluation in single-cell RNA-seq analysis nonlinear cellular trajectories from single cell RNA-seq data PAGA: graph abstraction reconciles clustering with trajectory inference through a topology preserving map of single cells Cannoodt, R. et al. SCORPIUS improves trajectory inference and identifies novel modules in dendritic cell development. Preprint at bioRxiv https://doi.org/10.1101/079509 (2016) The dynamics and regulators of cell fate decisions are revealed by pseudotemporal ordering of single cells The transcription factor ZEB2 is required to maintain the tissue-specific identities of macrophages Download references Kribelbauer for reviewing the manuscript and data analysis Fraser (National Institutes of Health) for kindly providing the RAW-G9 cells EPFL) core facilities for technical support This work was supported by a Swiss National Science Foundation grant (no a Precision Health & Related Technologies grant (no PHRT-502) and institutional funding (EPFL) to B.D. a National Key R&D Program of China (grant no and by a grant from the Volkswagen foundation (Initiative ‘Life’) a European Research Council Advanced grant (no 883077) and institutional funding (ETH Zurich) to J.A.V These authors contributed equally: Wanze Chen Laboratory of Systems Biology and Genetics Institute of Bio-engineering and Global Health Institute Swiss Federal Institute of Technology (EPFL) CAS Key Laboratory of Quantitative Engineering Biology Laboratory of Biosensors and Bioelectronics designed the study and wrote the manuscript performed experiments and data analysis with the support of C.G.G. All authors read and approved the final manuscript The authors declare no competing interests Nature thanks the anonymous reviewers for their contribution to the peer review of this work. Peer reviewer reports are available Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations (a) cDNA yields of different amounts of total RNA input using Smart-seq2 10/10: 10% of the material reverse transcribed from 10 pg total RNA was used for PCR amplification P values determined by two-sided t-tests comparing each condition to 0 pg input RNA (b) Enhanced Smart-seq2 is more sensitive than the original Smart-seq2 in the low input range (0.5–2 pg) Two and three distinct experiments were performed in a) and b) (c) Quality control of enhanced Smart-seq2 based on the parameters listed above each panel Percent MT: percentage of counts from mitochondrial genes (d) Cumulative proportion of each library (y axis) assigned to the top-expressed genes (x axis) The top 20 genes absorb around 95% of all the reads in the negative control (N = 4 replicates) while the ~700 top genes take that same portion of reads in samples with 1 pg input RNA (N = 3 replicates) The dashed line indicates the 95% proportion (e) Overview of the sequences overrepresented in the negative control (f) Proportion of reads mapped to each gene in negative control samples The top 20 genes account for more than 90% of all reads (g) Human (HeLa) and mouse (IBA) cells were sampled alternatively with the same probe The number of reads mapped to the human and mouse genomes were determined for each sample to assess potential cross-sample contamination (d) Barplot showing the overlap in number of cells between the clustering (x-axis) and the ground truth (e-f) tSNE-based visualization of cell type/state nCount and batch for (e) ASPCs and (f) RAW cells (a) Heatmap showing the top 20 differentially expressed genes of each cluster of the Live-seq data (b) GO term enrichment of each cluster using the top 100 marker genes (c) Mouse gene atlas-based prediction of cell type/state of each cluster using the top 100 marker genes (c) Barplot showing the overlap in number of cells between the clustering (x-axis) and the ground truth (d) Heatmap showing the top differentially expressed genes stratified according to the five scRNA-seq clusters (e) GO term enrichment analysis of the five scRNA-seq clusters using the top 100 differentially expressed genes (f) Mouse gene atlas-based prediction of cell type/state of each cluster using the top 100 marker genes (f) Plotted correlations between the number of detected genes on the one hand and respectively the total count of all genes (nCount upper panel) and the cDNA yield (lower panel) were indistinguishable between the respective cell categories (g) A tSNE projection of control IBA cell scRNA-seq (Smart-seq2) data (Ctrl 70 cells) as well as 1 h (49 cells) and 4 h (43 cells) post Live-seq extraction scRNA-seq (Smart-seq2) data does not reveal clearly distinct clusters based on the top 500 most variable genes (a) Cell state transition trajectories as measured by sequential Live-seq The two red dots in each panel represent the same cell The arrow defines the respective cell state transition The left panels provide an overview of the entire cell culture area The right panels show three representative cells (out of 42 in 5 independent experiments) undergoing extraction at day 0 and day 2 and after nuclear (blue) and lipid staining (red) at day 7 The localization of each cell within the culture area (map) is indicated with a dashed square (c) Trajectory predictions based on conventional scRNA-seq data using distinct approaches with default settings as contained in the dynverse package (d) Trajectory prediction using the RNA velocity approach Different strategies including “kNN pooling with gamma fit on extreme quantiles” The time of LPS treatment is defined here as 0 Black dots indicate the mitosis time point The curves of Fucci reporter after LPS treatment are not considered and are therefore shown in a lighter color The G1/S boundary is inferred from the time point at which the Fucci reporter intensity drops Cells that underwent mitosis but did not yet reach the G1/S boundary were annotated as G1 cells Given the lack of a clearly discernable S/G2M boundary cells were assigned to either the S or G2M phase based on the post G1/S boundary timing (c) The rate of Tnf-mCherry fluorescence intensity increase (slope) between 3 to 7.5 h post-LPS treatment was calculated based on profiles in (b) The Fucci reporter was used to time cells based on the G1/S boundary mitosis was used to specifically time G1 cells as the latter did not yet reach the G1/S boundary (which can be detected using the Fucci reporter) Two-sided Wilcoxon rank-sum test was performed with Bonferroni correction Linear regression model predicting the basal Tnf-mCherry intensity using Live-seq data Linear regression model predicting the rate in Tnf-mCherry fluorescence intensity increase using Live-seq data Download citation DOI: https://doi.org/10.1038/s41586-022-05046-9 Anyone you share the following link with will be able to read this content: a shareable link is not currently available for this article Sign up for the Nature Briefing newsletter — what matters in science The dates displayed for an article provide information on when various publication milestones were reached at the journal that has published the article activities on preceding journals at which the article was previously under consideration are not shown (for instance submission ChemosphereCitation Excerpt :Comprehensively a plausible explanation for the lower TMF values of THg and MeHg in the Jiaozhou Bay was the disturbance of anthropogenic activities and the small samples collected while the low TMF values may reflected overfishing less enrichment and amplification of Hg in aquatic ecosystem of the Jiaozhou Bay (Pan et al. The ecosystem scale model was developed to comprehensively explain the transfer of heavy metal in the ecosystem (Presser and Luoma linking the Hg levels in filtered seawater which indicated the amplification and trophic transfer of Hg in the food web All content on this site: Copyright © 2025 Elsevier B.V., its licensors, and contributors. All rights are reserved, including those for text and data mining, AI training, and similar technologies. For all open access content, the relevant licensing terms apply. This website is using a security service to protect itself from online attacks. The action you just performed triggered the security solution. There are several actions that could trigger this block including submitting a certain word or phrase, a SQL command or malformed data. You can email the site owner to let them know you were blocked. Please include what you were doing when this page came up and the Cloudflare Ray ID found at the bottom of this page. Volume 8 - 2014 | https://doi.org/10.3389/fnsys.2014.00249 This current study investigated brain development of Chinese and American children and adolescents from 8 to 16 years of age using structural magnetic resonance imaging (MRI) techniques children brain/head MR images were performed to explore similarities and differences in the trajectory of brain development between these two groups Our results revealed regional and age differences in both brain/head morphological and tissue level development between Chinese and U.S Chinese children's brains and heads were shorter There were significant differences in the gray matter (GM) and white matter (WM) intensity between the two nationalities Development trajectories for cerebral volume and several key brain structures were also distinct between these two populations and no study has directly compared the brain development patterns and brain anatomical features between Asian and American child populations To bridge this important gap in the literature we investigated the brain development of Chinese children and adolescents from 8 to 16 years and explored differences in developmental trajectories and anatomical features between Chinese and U.S The researchers quantified and compared the head shape and size between Chinese and Caucasians Results demonstrated that Chinese heads are generally rounder than Caucasian counterparts and smaller in height than Caucasian heads No specific comparisons for GM and WM intensity were conducted Very few studies have examined the brain development of Chinese children and adolescents, and little is known about how it might differ from North American age-related populations. Guo et al. (2007, 2008) conducted the only systematic studies of Chinese children's brain development MRIs for 158 healthy 7- to 23-year-old Chinese children No North American participants were included in their studies Their results revealed that overall GM volume decreased linearly with age while overall WM volume increased linearly with age Effects of age on the regional variations were also found in their studies positive correlations between GM volume and age were observed in subcortical (e.g. left fusiform gyrus) while negative correlations were found in many other regions (e.g. age-related linear increases were found in some brain regions (e.g. Some of the findings were consistent with previous studies on U.S reductions in GM volume in parietal lobe) while some were different with previous volumetric studies (e.g. Whereas Guo and colleagues' work provides information about the developmental trajectory of a non-Western group several limitations still exist in the literature The current study addressed several issues by making the following improvements direct comparisons between age-related Chinese and U.S children and adolescents were conducted to ascertain whether the similarities and differences reported in the existing studies are genuine cross-ethnic differences which was necessary as Guo and her colleague only scanned 158 subjects morphometric analysis were added to test brain/head shape and size changes GM development was not only studied for the global volume but also for different major brain lobes (e.g. The MRIs for Chinese participants were collected from 133 children and adolescents ranging from 8 through 16 years of age (50 F/83 M). These participants were recruited from a local community in Sichuan province, China. The gender and number of subjects within each age group are listed in Table 1 Demographic Information for Chinese and US participants There were 149 (66 F/83 M) healthy, age-related participants of U.S. nationality. The MR images for the U.S. children and adolescents were collected from (1) participants at the University of South Carolina McCausland Center for Brain Imaging (USC-MCBI) (Sanchez et al., 2012b), and (2) normal controls from the Autism Brain Imaging Data Exchange (ABIDE) (Di Martino et al., 2014) The Institutional Review Boards (IRBs) of the West China Hospital in Sichuan University and the University of South Carolina approved this study All participants' parent(s) signed a written consent form on behalf of the children and adolescents enrolled in the study The Chinese children's MRI scans were collected with two MRI scanners in the Huaxi MR Research Center of the West China Hospital of Sichuan University in Chengdu The majority of the subjects (N = 108) were scanned using a 3.0T Siemens Trio Scanner These high-resolution 3-dimensional T1-weighted images were acquired using a MPRAGE sequence with the following parameters: TR/TE/TI = 1900/2.26/900 ms axial FOV = 25.6 × 25.6 cm2 and data matrix = 256 × 256 The remaining 22 subjects were scanned with a 3.0T GE SIGNA MRI scanner High-resolution 3-dimensional T1-weighted images were acquired using a spoiled gradient recalled (SPGR) sequence with the following parameters: TR/TE = 8.5/3.4 ms axial FoV = 24 × 24 cm2 and data matrix = 512 × 512 The ABIDE files came from the LONI site (loni.UCLA.edu) in compressed NIFTI format This was completed with the FSL FAST program without prior classification volumes and resulted in a set of partial volume estimates (PVE) for GM External scalp and internal anatomical locations were manually marked on individual MRIs. The MRIcron program (Rorden, http://www.mccauslandcenter.sc.edu/mricro/mricron/) was used to display the MRI and create individual masks on these locations Two locations were identified inside the head including the anterior commissure and posterior commissure Several locations were identified on the scalp and left and right pre-auricular skull locations Brain and head morphological features were calculated from these markers and AC and PC were assessed as head length The distances from the front of the brain to the back of the brain on the AC-PC line was measured as the brain length The brain width was measured as the distance between the left edge and the right edge of the brain on the line normal to the AC-PC The distance between the top of brain and the PC was measured as the brain height on a line normal to the AC-PC line Brain, skull, and head volume were calculated. The brain volume was calculated based on the number of non-zero voxels in the extracted brain. Inner skull volume was calculated as the number of non-zero voxels in the “inner skull mask” created with the betsurf tool (Jenkinson et al., 2005) The “scalp mask” created with the betsurf tool was used to calculate head volume One semi-circumference reference plane was drawn from the left preauricular point through the nasion to the right preauricular point and a second was drawn from the left preauricular point through the inion to the right preauricular point (MATLAB) and the MRI voxels in the scalp mask above these planes were defined as the head volume Volumes of the global and local brain features were calculated from the segmented GM/WM PVE files and the participant's atlas The global GM or WM volume was calculated from the sum of the PVE values multiplied by the number of voxels in the brain we first masked the GM or WM PVE files with the segmented atlas section and then calculated the volume of each brain lobe a similar procedure was completed for the LPBA40 atlas we examined the morphological differences in head and brain MR images between Chinese and U.S children and adolescents with MANOVA and univariate analyses These analyses were performed using the SAS program (SAS Institute Inc. The MANOVA was examined the effects of age and nationality on children's global brain and head shape as a composite of several morphological features Four dependent variables that represent brain morphological features were tested as a group in the MANOVA ANOVAs) were conducted to examine differences in specific brain features Age and nationality were examined as independent variables in order to determine how the brain morphology changes as a function of age and nationality groups Age was tested as a categorical variable to analyze differences between specific age groups (e.g. Age was analyzed as a categorical variable and participants were grouped in one-year increments Our third hypothesis tested regional GM and volume development and differences between Chinese children and adolescents' brains and U.S the effects of age and nationality on GM intensity and regional volume in major brain lobes (e.g. temporal lobe) and 50 cortical brain structures (LPBA40) were examined using GLM analyses Analyses were expected to be more vulnerable to the effects of outliers when looking at regional structural volumes than overall brain volumes Participants were grouped in 2-year increments which increased the number of subjects in each age group The focus of the current study was on the effects of nationality and its interaction with age on brain development We had limited numbers female Chinese subjects in the young age groups so we added gender as a factor to control for its effects but do not report the results of the gender effect from the analyses examining the third hypothesis The development of brain morphology in Chinese and U.S children was examined first using multivariate analyses A MANOVA was conducted to analyze the composite of brain anatomical features (brain length and ac-pc distance) as a function of age and nationality The multivariate result was significant for both age The interaction between age and nationality was not significant Figures 1A–D shows the effects of age and nationality on the development of the four brain morphological features. The univariate ANOVAs for age and nationality are shown in Table 2. In summary, the Chinese children's brains were significantly shorter, wider, and taller than the U.S. children's brains (Figures 1A–C). There was no difference in the AC-PC distance (Figure 1D) children showed increases over these ages in brain length but no significant change over age in brain width Brain morphology develops as a function of age and nationality (A) Brain length changes over ages for Chinese and U.S (B) Brain width changes over ages between Chinese and U.S (C) Brain height changes over ages between Chinese and U.S (D) AC-PC distance changes over ages for both Chinese and U.S Note that brain length of Chinese children is smaller than that of U.S but brain width and height of Chinese children are greater than those of their U.S Hypothesis I: Morphological features development for Chinese and US children brain and head Head morphology develops as a function of age and nationality (A) Head length development for the two nationalities (B) Head width development for two nationalities (C) Head height development for two nationalities Morphological features of Chinese children' head also differ from their U.S Chinese children's head is shorter Global head and intracranial volume development (A) MRI head volume development for Chinese and U.S (B) The Intracranial volume development for the two nationalities Note that (A,B) show the effects of age and nationality on MRI head and intracranial volume changes (C,D) also show the MRI head and intracranial volume development but the factor of gender is included Figure 3A–D shows the global head and intracranial volume changes for Chinese and U.S Results showed that (1) the development of MRI head volume showed different patterns between the Chinese and U.S which leads to a significant interaction between nationality and age; (2) differences were also found in the intracranial volume changes between Chinese and U.S and Chinese children's intracranial volume was shown to be larger than U.S cohorts; (3) the head and intracranial volumes were larger for males than for females There were also significant gender differences male children showed larger intracranial volume than females; whereas Chinese male children showed larger GM volume than females and WM volumes change as the function of age (A) Global brain volume development for Chinese and U.S (B) The global brain volume development for Chinese and U.S (C) Global GM volume development for Chinese and U.S (D) Global GM volume development for Chinese and U.S (E) Global WM volume development over ages for Chinese and U.S (F) Global WM volume development over ages for Chinese and U.S (A) Cortical GM volume development for Chinese and U.S (B) Cortical GM volume development for Chinese and U.S (C) Cortical WM volume development for Chinese and U.S (D) Cortical WM volume development for Chinese and U.S Note that Chinese children show higher cortical GM volume but lower WM volume compared to their U.S and the patterns of cortical GM and WM development for the two nationalities are in line with those of their global GM and WM development Frontal and temporal GM changes as a function of age and nationality (A,B) Frontal GM development over ages for Chinese and U.S (C,D) Temporal GM development over ages for Chinese and U.S The top panel (A,C) shows the regression lines with 95% confidence intervals (CIs) for the development of GM while the bottom panel (B,D) shows the GM development patterns with average and standard errors for each age group Occipital and parietal GM changes as a function of age and nationality (A,B) Occipital GM development over ages for Chinese and U.S (C,D) Parietal GM development over ages for Chinese and U.S Figure 9. The GM intensity comparisons of 50 brain cortical structures between Chinese and U.S. children brains. Analyses used to make this figure were similar to those making Figure 8 Hypothesis III: Regional GM intensity and volume changes Temporal structures showed similar developmental patterns for American and Chinese cohorts A majority of these cortical structures showed a significant nationality effect (p < 0.01) between Chinese and U.S No results from the adult literature were included because no comparable analyses were established for Chinese and U.S the differences found between Chinese and US participants are not expected to result from different scanners but are due to real differences between the two nationalities Figure 10. Comparisons of the global (A) brain volume and the (B) GM volume between three different scanners including the GE scanner at China, the Siemens scanner at China, and the Siemens scanner at U.S. (USC-MCBI). Note that the Chinese scanners produced equivalent results. In addition, patterns of comparison between data from the US Siemens scanner and either of the two Chinese scanners were consistent with the results shown in Figures 4A,C This study compared head and structural brain development of Chinese children and adolescents with American age-related children and adolescents The brains and heads of Chinese participants showed differences in morphological features (e.g. and height) compared with their American counterparts and cerebral volumes showed different patterns of change over age for the Chinese and U.S Total head volume showed a linear increase with age for both Chinese and U.S children revealed a steeper slope than Chinese children Intracranial and total brain volume showed an inverted U-shaped pattern for Chinese and U.S The overall volume of both GM and WM had similar developmental trajectories for Chinese and U.S with some differences in the peak of the inverted-U function for the two nationalities Regional GM comparisons showed differences in developmental patterns and volume between the two nationalities for the temporal and occipital lobes while those for the frontal and parietal lobes were more similar between the nationalities our detailed comparisons of 50 LPBA40 cortical structures between Chinese and U.S children showed regional differences in both brain volume and developmental patterns Perhaps the developmental patterns of the AC-PC distance in the two populations diverge after adolescence The developmental trajectory of brain height was different between these two nationalities while brain and head length and width showed similar developmental patterns Future studies may investigate these features in younger children or even infants to better understand when these trajectories start to diverge Differences in brain and head morphological features and developmental patterns between Chinese and U.S children may be due to tissue level differences inside the brain Our results showed that global head volume increased linearly for both Chinese and U.S. children, but at different rates. The patterns of head volume development (Figure 3) were quite similar with those of head length development (Figure 2) children might be due to their longer head length Gender was also a factor: both Chinese and U.S males showed greater head volumes than females Chinese and American children showed different patterns of intracranial volume development; however these patterns differed with those of head volume development Chinese children showed larger intracranial volumes than U.S and males showed larger volumes than females This dissociation may be caused by differences in the developmental trajectories of brain tissue (GM Since head volume includes other tissues (e.g. intracranial volume may be more informative in predicting brain development GM development has a stronger influence on children's brain developmental patterns This may also explain why Chinese children had larger GM but smaller WM volumes than U.S children and had larger intracranial volumes than U.S participants failed to show clear patterns of temporal and parietal lobe GM development A possible cause for this is the uneven number of male and female participants The finding that Chinese children have higher levels of GM in temporal and occipital regions than American children may be the reason why Chinese children were found to have greater total brain volume and cortical GM volume than U.S The inverted U-shaped developmental patterns and different ages of peak volume for most of these brain structures are in accord with the differences seen in global GM and intracranial development between Chinese and U.S Nationality had a significant effect on most of the GM volume comparisons for these 50 brain structures These volumetric findings suggest that there is a need for population-specific (e.g. Chinese/Asian children) atlases in both structural and functional neuroimaging studies of brain structures We were unable to conduct an extensive examination of gender differences due to the unequal distribution of gender across age in the data of Chinese children. In the current study, we had limited numbers of female Chinese subjects for the first several age groups. Gender is an important factor in the delineation of brain structures for children and adolescents (Giedd et al., 1999; Sowell et al., 2004; Lenroot et al., 2007) Previous studies have shown that there are gender differences in brain development of U.S we would expect that future research with even number of males and females in each age might find interaction between gender these anatomical differences detected between Chinese and U.S children might lead to functional differences as well Future research may investigate the effects of differences in brain anatomy on cognitive development (e.g. and memory development) in Chinese and American children and adolescents Because Chinese children's brain structures mature at different rates than their American peers' they may have a different cognitive developmental trajectory which would be an important consideration for East Asian educational systems These anatomical differences between Chinese and U.S children suggest the necessity for population-specific brain/head templates and atlas and data processing and analyzing for neuroimaging research with Chinese/Asian children and adolescents The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest This work was supported by the following grants: the NIH grant Richards; the National Natural Science Foundation (Nos and 81220108013) and National Key Technologies R&D Program (No 2012BAI01B03) of China to Qiyong Gong; and the NIH grant A comparison between Chinese and Caucasian head shapes and time machines [and comments and reply] The human brain age 7–11 years: a volumetric analysis based on magnetic resonance images Normal brain development and aging: quantitative analysis at in vivo MR imaging in healthy volunteers 1 A developmental study of sex and age interactions in the human corpus callosum Changes in brain weights during the span of human life: relation of brain weights to body heights and body weights The autism brain imaging data exchange: towards a large-scale evaluation of the intrinsic brain architecture in autism “Anthropometry of the attractive North American Caucasian face,” in Anthropometry of the Head and Face Brain development during childhood and adolescence: a longitudinal MRI study Quantitative magnetic resonance imaging of human brain development: ages 4–18 and hippocampus in normal human development: ages 4–18 years Google Scholar Automatic segmentation of brain MRIs of 2-year-olds into 83 regions of interest Brain development in Chinese children and adolescents: a structural MRI study “Gender differences in brain development in Chinese children and adolescents: a structural MRI study,” in Medical Imaging eds X CA: International Society for Optics and Photonics) “BET2: MR-based estimation of brain skull and scalp surfaces,” in Eleventh Annual Meeting of the Organization for Human Brain Mapping Google Scholar Part I: localization of age-related changes Late childhood changes in brain morphology observable with MRI Localized morphological brain differences between English-speaking Caucasians and Chinese-speaking Asians: new evidence of anatomical plasticity Frequency effects of Chinese character processing in the brain: an event-related fMRI study Development of Korean standard brain templates Sexual dimorphism of brain developmental trajectories during childhood and adolescence A probabilistic atlas and reference system for the human brain: International Consortium for Brain Mapping (ICBM) A quantitative magnetic resonance imaging study of changes in brain morphology from infancy to late adulthood “A stereotaxic MRI brain atlas for infant participants,” in Society for Research in Child Development SRCD (Seattle Google Scholar Regional MRI measurements of the corpus callosum: a methodological and developmental study gender and IQ in children A volumetric imaging study Neurodevelopmental MRI brain templates for children from 2 weeks to 4 years of age Age-specific MRI templates for pediatric neuroimaging Construction of a 3D probabilistic atlas of human cortical structures Advances in functional and structural MR image analysis and implementation as FSL Further MRI evidence of late brain maturation: limbic volume increases and changing asymmetries during childhood and adolescence CrossRef Full Text | Google Scholar Mapping changes in the human cortex throughout the span of life Development of cortical and subcortical brain structures in childhood and adolescence: a structural MRI study The construction of a Chinese MRI brain atlas: a morphometric comparison study between Chinese and Caucasian cohorts Bayesian analysis of neuroimaging data in FSL Segmentation of brain MR images through a hidden Markov random field model and the expectation-maximization algorithm Keywords: Chinese children and adolescents Lee K and Gong Q (2015) Comparison of the brain development trajectory between Chinese and U.S Received: 16 October 2014; Accepted: 19 December 2014; Published online: 02 February 2015 Copyright © 2015 Xie, Richards, Lei, Lee and Gong. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) distribution or reproduction in other forums is permitted provided the original author(s) or licensor are credited and that the original publication in this journal is cited in accordance with accepted academic practice distribution or reproduction is permitted which does not comply with these terms *Correspondence: Qiyong Gong, Department of Radiology, Huaxi MR Research Center, West China Hospital of Sichuan University, The First In-Patient Building, 37# Guoxue Street, Chengdu 610041, PR China e-mail:cWl5b25nZ29uZ0BobXJyYy5vcmcuY24=; Wanze Xie, Department of Psychology, University of South Carolina, 1800 Gervais Street, Columbia, SC 29208, USA e-mail:eGlld0BtYWlsYm94LnNjLmVkdQ== Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher 94% of researchers rate our articles as excellent or goodLearn more about the work of our research integrity team to safeguard the quality of each article we publish France — Lance Armstrong's hopes for victory in his final Tour de France hit a setback Tuesday when a burst tire cost him time during a jarring stage over cobblestones that was won by Norway's Thor Hushovd "Our chances took a knock today," Armstrong said we'll stay in the race and keep trying." Fabian Cancellara finished the third stage in a five-man group behind Hushovd but he regained the yellow jersey he ceded a day earlier to Sylvain Chavanel of France Hushovd was ahead of Geraint Thomas of Britain and world champion Cadel Evans of Australia in a sprint finish among the leading riders The 132-mile ride from Belgium to France was the most dreaded stage of week one — with seven sections of jarring cobblestones that threatened injury referring to his mishap in the fifth patch Some had worse luck: Frank Schleck of Luxembourg who won the Tour of Switzerland last month crashed on the fourth section and was out of the race and taken to hospital Armstrong noted there's still a lot of racing left in the three-week race which now heads toward the Alps and later the Pyrenees before the Paris finish on July 25 "It's the nature of the sport," he said I have 20 days now to be the hammer." Armstrong had predicted "carnage" during the stage one that many riders thought could damage plenty of title hopes The seven-time champion and Schleck were the day's most prominent losers whose abilities on cobblestones had been in doubt and last year's runner-up Andy Schleck were among contenders who gained time on Armstrong Cancellara leads second-place Thomas by 23 seconds and two-time Tour runner-up Evans by 39 a teammate of the Schlecks who won the opening-day prologue expressed "mixed feeling" about the day but was delighted to retrieve the leader's jersey "We can call it a good day for Saxo Bank despite the loss of Frank Getting out front in such a stage doesn't just improve chances for a stage victory it also can help avoid crashes — which are more likely in the frenzied pack several riders collided near the 70-mile mark after one rider bumped into the curb and fell France's David Le Lay was forced out the race Armstrong's RadioShack team led the pack over the first bumps with crowds getting up close but respecting a safe enough distance for the riders to get through Simon Gerrans of Team Sky bloodied his right cheek in what appeared to be a solo spill but he got back on his bike and returned to the race dust flew as some riders sought to evade the cobblestones by riding on the dry dirt on the side — but again in the middle of the Sars-et-Rosieres patch — the fourth run of cobbles — hurtled off his bike and onto the side of the road Armstrong had a small lead over Contador after the fifth section but then he got a flat tire in the sixth and the Spaniard's group rumbled by him until the Texan got a replacement "It was bad luck," Armstrong said acknowledging that the result has dented his hopes for an eighth Tour victory Chavanel wore the yellow jersey for Tuesday's ride into his home country I just didn't have the legs," said Chavanel He won Monday's stage in a breakaway that took a lot out of him The pack could get a more restful day Wednesday with a mostly flat 95-mile trip from Cambrai to Reims followed two straight days marred by crashes on slick roads that ensnared Contador American Christian Vande Velde was one of two riders who crashed out The Garmin-Transitions team leader broke two ribs in a spill during Monday's ride from Brussels to Spa were bumpy...they need to set aside some funds over here for road work @levileipheimer: It was an epic stage today Klodi & I all flatted but that's bike racing @ghincapie: In perfect position with cadel when move was going then flatted But more importantly cadel gained time on rivals and finished safely A new generation of designers are injecting fresh energy and creativity into the constantly evolving landscape of fashion From sustainable handbags to provocative lingerie these up-and-coming designers are challenging the way we think about fashion Discover four emerging designers that are pushing the boundaries with their innovative designs and unique perspectives Consume with intention. That’s the guiding principle that shapes the development of Wanze Song’s pieces The Chinese-Canadian womenswear designer started her career working globally with Canadian fashion label Beaufille Bulgarian menswear designer Kiko Kostadinov “I’ve always enjoyed working with my hands and I’ve always been curious to learn about the making and construction element of garments,” explains Song Song’s label directly opposes the fads of fast fashion she hopes to help reframe how society consumes fashion while shifting purchasing behaviours to become more thoughtful Song’s brand is built on the belief that formal and casual wear can exist in cohesion she unearths a style that is both seasonless and current Song explored the intimate relationship between her Looking at the complexity of the multiple roles she embodies at home—maintaining a sister-like relationship with her mother and a motherly relationship with her sister—she discovered her identity through polarity: mature and immature The garments she created reflected these juxtapositions by pairing well-tailored attire with playful accents Song continues to explore the fluidity of dualities this time focusing on the modern individual and the balance of work and play London-based body-morphing artist and couturier Michaela Stark has been quietly making waves in the fashion industry for years with her provocative one-of-a-kind lingerie and corsetry Stark first sparked her interest in fashion by playing with tutus Now she uses that same sense of whimsy and fun to create garments that feel both playful and sensual Often self-modelled and working with hand-dyed fabrics Stark’s pieces sculpt the body to create the illusion of imperfection Each of her pieces are meant to celebrate the female form in its entirety while simultaneously challenging the ideals that typically dictate what is considered sexy or desirable in society and quality craftsmanship has led to collaborations with luxury houses like Marni Stark has also designed custom pieces for Swedish singer-songwriter Tove Lo and worked as a costume designer for Beyonce’s award-winning visual album Black is King Her spring 2023 collection features a range of vibrant colours with accents of French lingerie this collection features a series of soft flowing garments: bloomers The collection is available on a made-to-measure basis to best honour each individual’s body and figure It’s an ethos she hopes to carry through to future collections and commercial ventures Founded in 2018, Amir Taghi is an eponymous women’s luxury ready-to-wear brand produced in New York City Taghi was captivated by fashion at a very young age and presented his first womenswear collection of made-to-measure pieces at just 15-years-old Taghi went on to study design at Central Saint Martins in London he grew his skills working at some of luxury fashion’s biggest houses Taghi’s work accentuates the beauty in clean sculptural lines; creative draping; and custom prints Doused with classical Persian references and tailored with southern charm Taghi produces sophisticated designs for women who are unabashedly bold His pieces have been worn by the likes of Empress Farah Pahlavi His Spring 2023 collection was inspired by the colours and culture of the Qashqa’i Nomads in the highlands of Iran and accented his pieces with layers of macrame and gold beads Fane is the brainchild of Laurie-Anne Braun and Margot Baudequin two friends who had no formal background in design “I’ve always felt attracted to art and creation but I was late to take an interest infashion,” says Baudequin but chose to study law and business instead they decided to venture into the world of fashion together “I was obsessed with bags since I was a teenager [so] we opted for a handbag brand,” explains Braun the idea of creating a handbag was an interesting challenge she never carried purses—she didn’t like them She would often sew additional pockets into her jackets and clothes to avoid using bags Braun and Baudequin describe Fane bags as pure the duo crafts each purse to be complementary to a wearer’s outfit Affectionately referred to by the co-founders as a brand for women who don’t like handbags Fane has captured the attention of celebrities like Kendall Jenner and Hailey Bieber who have each been spotted with Fane bags on their arms The Spring/Summer 2023 collection features some of their most popular bags released in brand new colourways Each bag is created sustainably and is produced in family-run ateliers in the Drôme region of France This website is using a security service to protect itself from online attacks The action you just performed triggered the security solution There are several actions that could trigger this block including submitting a certain word or phrase You can email the site owner to let them know you were blocked Please include what you were doing when this page came up and the Cloudflare Ray ID found at the bottom of this page Registration has been successfully completed Make a new account if you don't have one yet Puedes ver la versión Española de BeSoccer.com You can see the English version of BeSoccer.com Vous pouvez voir la version French de BeSoccer.com Puoi vedere la versione Italian su BeSoccer.com Você pode ver a versão Brasileira de BeSoccer.com Lance Armstrong grimaces prior to the start of the third stage of the Tour de France cycling race in Wanze Armstrong said Thursday he is finished fighting charges from the U.S Anti-Doping Agency that he used performance-enhancing drugs during his unprecedented cycling career Seven-time Tour de France winner Lance Armstrong says he won't fight accusations of doping from the U.S putting at risk his string of titles and his reputation as one of the world's great cyclists Here's part of Armstrong's statement: "There comes a point in every man's life when he has to say I have been dealing with claims that I cheated and had an unfair advantage in winning my seven Tours since 1999 I have been subjected to a two-year federal criminal investigation followed by Travis Tygart's unconstitutional witch hunt and my work for our foundation and on me leads me to where I am today – finished with this nonsense." The Associated Press says Armstrong's decision could lead to him being stripped of his Tour de France wins and hand him a lifetime ban from the sport "USADA will almost certainly treat Armstrong's decision as an admission of guilt and hang the label of drug cheat on an athlete who was a hero to thousands for overcoming life-threatening testicular cancer and for his foundation's support for cancer research." saying he was tired of fighting the accusations of drug use he said "there is zero physical evidence to support .. Armstrong won a string of Tour de France titles from 1999 to 2005 "The agency can impose a lifetime ban and recommend Armstrong be stripped of his titles That would put the question in the hands of the International Cycling Union which has disputed USADA's authority to pursue the investigation and Tour de France officials who have had a prickly relationship with Armstrong over the years." Armstrong's decision comes two days after a federal court in Austin, Texas, dismissed his lawsuit that sought to stop a USADA doping hearing. The judge ruled that while "there are troubling aspects" in this case "The court concludes Armstrong agreed to arbitrate with USADA and its arbitration rules are sufficient, if applied reasonably, to satisfy due process," U.S. District Judge Sam Sparks wrote in his decision The USADA says Armstrong has used banned substances since 1996 to boost his performance Here's Tygart on Armstrong's announcement: "It is a sad day for all of us who love sport and our athletic heroes This is a heartbreaking example of how the win-at-all-costs culture of sport it is a reassuring reminder that there is hope for future generations to compete on a level playing field without the use of performance-enhancing drugs." tells the AP his agency will ban Armstrong for life and strip him of his seven Tour de France titles Armstrong maintains that USADA doesn't have the authority to take away his wins Become an NPR sponsor By Les Clarke in Wanze Saunier Duval's Aaron Olson has been enjoying his first grand tour in the wet.. Saunier Duval's Aaron Olson has been enjoying his first grand tour in the wet of Belgium and as Cyclingnews caught up with the American before the fourth stage of the Giro in Wanze he explained that it's everything he thought it would be - including the weather it was great the couple of days before the race and the day of the prologue was alright," said Olson "but since then it's been wet and dangerous - but the team's had good luck to stay out of trouble," he added As one of five Americans riding this year's Giro Olson believes the increased interest in the 'Italian version of the Tour de France' from Americans can only benefit the strength of cycling in the States overall there's been a lot more Americans stepping up - I think there are five Americans in the Giro this year and quite a few Aussies; so there's quite a few English-speaking riders in the peloton," he said And the interest isn't just as a result of the increased numbers of US riders competing "I think there's a lot of interest in the Giro especially with all the top Italians going for it and for me it's great to be a part of it and riding for such a great leader [Gilberto Simoni]," he said Olson has achieved one of his big goals for the year just by being at the Giro something that brings a big smile to his face "One of my biggest goals was to make one of the grand tour teams and my number one choice this year was the Giro because of Simoni in his last year," he explained "Normally it would be to try and make the Tour [de France] team but I'll take everything I can get and go from there." "In terms of personal goals - it's my first year in the Pro Tour so I just want to improve throughout the year and for now Olson believes the best way to approach the killer final stretch of the race will be to go into it a little blind "I've just [seen the Giro's big climbs] on the map "[Viatcheslav] Ekimov told us before Paris-Roubaix one time that sometimes it's better not to know what's ahead of you because you might actually do better maybe you'll always have it in the back of your mind but it's going to be unbelievably challenging but I usually get better as the race goes on so if I don't die before then hopefully I'll be alright!" he said with a laugh the former Colavita rider is open to all suggestions "I definitely think it would be possible; at least it would give me time to rest during the Tour and try and build back up for the Vuelta," he said but with the Spanish team it's a bit difficult - so many Spanish guys [will be] going for it - but we'll see I wasn't originally planning on doing the Giro but who knows...I'm just really happy to be here," he said Abatuye mu murwa mukuru wa Cote d'ivoire, Yamassoukro, abaravuga ko ingabo zishyigikiye Alassana Ouarrara, wemewe n'amahanga ko ariwe watsinze amatora yo muri icyo gihugu, zinjiye muri uwo mujyi. Ingabo za Outtara ziraturuka mu majyaruguru, hari amakuru avuga ko zafashe n'umujyi ukomeye wa Soubre. Igice kinini cy'umujyi wa Abidjan, ukomeye muri icyo gihugu, kiracyagenzurwa na Laurent Gbagbo wanze kuva k'ubutegetsi kuva amatora yarangira mu kwezi kwa 11 umwaka ushize. Amakuru aravuga ko ingabo za Outtara zirimo kugana mu majyepfo y'uburasirazuba zigana ku cyambu cya Pedro, akarere gakomeye mu kohereza cacao mu mahanga. Two spectators have been killed at the Condroz Rally in Moha in Wanze (Liege Province) First reports speak of a driver crashing into a wall with spectators behind it The car was catapulted over the wall and landed on the spectators Liege public prosecutors have identified the victims as a 16-year-old girl from Hannut in Liege Province and an 18-year-old young man from Huy (Liege Province) says one official and one spectator have been taken to hospital with injuries but are not critically injured Firefighters from across the area have been dispatched to the scene It's not the first time the rally has claimed victims Two spectators were killed in 2011 and in 2018 a copilot died The Royal Motor Club of Huy from Liege Province and the RACB have sent their condolences to the stricken families A judicial investigation is now underway to establish the circumstances of the accident The race leadership cancelled the final test and neutralised the result of the race in which the accident occurred There are reports the spectators hit were standing in an unauthorised zone Eyewitnesses say spectators at the rally often don’t take too much heed of safety measures “People light fireworks and some people consume large quantities of alcohol” one spectator told VRT These are the first pictures of the accident scene Fri 11 May 2001 at 01:11Dundalk Shopping Centre is on the market again with offers in excess of £10 million being sought by Douglas Newman Good Commercial acting for Wanze Propertie.. Dundalk Shopping Centre is on the market again with offers in excess of £10 million being sought by Douglas Newman Good Commercial acting for Wanze Properties (Ireland) The property is being sold by private treaty but alternatively the owners will consider bringing in a joint venture partner to help fund an ambitious £25 million redevelopment of the centre Rental income at the centre is currently producing £763,000 which has been acquired by the owners with a view to facilitating the proposed upgrading a company controlled by developer Robert Neill bought the property in 1996 along with shopping centres in Athlone and Dublin for a combined total of under £8 million Athlone was later sold on to one of the anchor tenants and Janelle in Finglas was acquired two years ago by Tesco It is understood that Dundalk will need a substantial investment for the proposed increase of the retail areas from almost 100,000 sq which would involve the demolition of the anchor stores currently occupied by Tesco supermarket Tesco’s ten-year lease of it’s space there has a combined rent of £269,000 while Heatons have a 25-year lease of the other anchor unit at a current rent of £50,000 per annum There are 21 shops on the ground floor and 13 on the first floor While planning permission was granted more than two years ago for an additional 20,750 sq.ft since then Wanze have put together a much more adventurous proposal which is to go before the planners soon And part of this plan entails the building of an almost 1,000-space multi-storey car park of offices and showrooms on an adjoining site owned by Wanze Now that pay-parking has been introduced in Dundalk the proposal for such a large multi-storey car park in this area is an interesting one and it is estimated by the agents that it would bring in around £100,000 a year the big question mark will hang over the feasibility of almost trebling the size of what is Dundalk’s original shopping centre considering that permission has been granted for the re-development of the nearby former Bacon Factory and that a planning application has been lodged for a rival shopping complex not far away along The Ramparts Road by the McCann family and the Lagan Group shopping centres at The Long Walk and at Carroll Village have opened in the last decade once again leaving the planners with the dilemma has Dundalk already got enough retail space SoccerLack of goals a concern for Dundalk boss Kilduff following scoreless draw at AthloneDundalk boss Ciarán Kilduff admits his side need to up their quality in the final third after firing their first blank of the season in Friday’s 0-0 draw away to Athlone Town.