Alenquer is once again organizing one of the biggest Christmas celebrations around Lisbon also known at this time of year as Vila Presépio is once again celebrating the Christmas season in a big way as well as the traditional competitions for Christmas tickets Less than an hour from Lisbon is one of the most incredible Christmas events we know especially known for its giant nativity scene undoubtedly one of the largest in Portugal and certainly the largest around Lisbon It’s no coincidence that they call it Vila Presépio where every year they show a nativity scene on a scale rarely seen in Portugal or anywhere else in the world the organization has once again created a program that pays special attention to children through a theme park at the gates of Lisbon which will open its doors with the lighting of the nativity scene and a pyromusical show on November 30 at 22:30 Considered the Christmas park with the largest covered area in Portugal Presépio de Portugal” event will be open to the public until January 6 including the return of the Christmas train which will travel through the streets of the town accompanied by Christmas music Kids will also love skating on the indoor ice rink which is sure to bring fun moments to the whole family Other attractions this Christmas in Alenquer include the circus all of which you can enjoy until January 6th All you have to do is shop at the local stores where So don’t forget to make a wish to Santa Claus He’ll be there to take all your requests Argophilia The page you are looking for no longer exists. Perhaps you can return back to the homepage and see if you can find what you are looking for you can try finding it by using the search form below 2025-05-05 By Crete promoted its tourist attractions to the Arabian Gulf at the Arabian Travel Market in Dubai (April 28 – May 1 2025-05-05 By The Greek Ministry of Culture rolled out major Knossos fire protection and lightning defense systems funded by the Crete Regional Operational Program 2025-05-05 By Agios Nikolaos’ animal welfare advisor urges all local pet owners to clean up after their dogs in public spaces This direct appeal calls for community respect and upper hygiene standards outlining the reasons for responsibility and the 100€ fines for ignoring city regulations 2025-05-05 By Why is Heraklion Cleaning Service running with just a third of its staff in 2024 Find out what happened and what everyone should know about waste collection in the city 2025-04-23 By a paradise for sun-seekers and selfie enthusiasts has become the battleground for Greece’s latest episode of “Who can break the law while admiring nature.” For those who skipped the fanfare the region’s Monitoring and Implementation Committee held their fourth meeting on April 15 To check if the Elafonisi environmental protection plan—announced […] More Crete travel news COPYRIGHT © 2025 · ARGOPHILIA TRAVEL NEWS Alenquer and his connections in the winner's enclosure at The Curragh On a day when Alenquer's trainer, William Haggas, added a third German Two Thousand Guineas (G2) to his illustrious CV, the son of Adlerflug  responded to every urging of Marquand who lifted his mount in the closing strides to prevail by a neck in a tremendous battle Although the market had Alenquer as the 7-2 third favorite the form book provided plenty of pointers to suggest he could land a big blow in the €400,000 contest and he became the fifth British-trained winner of this contest since 2013 Alenquer had not been beaten far in the Dubai Sheema Classic (G1) and he certainly made amends here with a performance that saw him cut to around 6-1 for the Prince of Wales's Stakes (G1) at Royal Ascot next month Sign up for BloodHorse Daily representing winning trainer and husband William said: "He was ridden beautifully by Tom I think a bit of dig in the ground is important His top-class form is over a mile and a quarter and today has proved it's his best trip." The race took shape in the early exchanges as Ryan Moore set a blistering pace in front aboard High Definition  and with two furlongs to go many began to think it was another piece of riding genius as they were still in front Marquand got to work on Alenquer at the two-furlong pole coming out of the pack alongside Frankie Dettori on Lord North and the more questions he asked of his mount Shane Crosse and State of Rest  began to loom on the outside but the Irish pair could not quite deal with the British raider said: "It was great to get this lad in a scrap at the two pole because there was only one way he was going to come out Sometimes at home it's a bit of a pain that he loves a fight because he thinks it's all a game an hour ago I didn't even know my way down to the start." For more European racing, sales, and bloodstock news, visit RacingPost.com prized by Michelin chefs as one of the world’s foremost ­delicacies gourmets may be able to breathe a small sigh of relief: a 12-year-old boy has discovered the species for the first time in Portugal Scientists have confirmed the discovery near Lisbon and are conducting studies to ascertain if it constitutes a species unique to the country found Portugal’s first black truffle in Alenquer a Nepalese chef known to be hunting for them in the country Metrics details Influenza A virus has an eight-partite RNA genome that during viral assembly forms a complex containing one copy of each RNA Genome assembly is a selective process driven by RNA-RNA interactions and is hypothesized to lead to discrete punctate structures scattered through the cytosol we show that contrary to the accepted view formation of these structures precedes RNA-RNA interactions among distinct viral ribonucleoproteins (vRNPs) as they assemble in cells expressing only one vRNP type We demonstrate that these viral inclusions display characteristics of liquid organelles segregating from the cytosol without a delimitating membrane dynamically exchanging material and adapting fast to environmental changes We provide evidence that viral inclusions develop close to endoplasmic reticulum (ER) exit sites depend on continuous ER-Golgi vesicular cycling and do not promote escape to interferon response We propose that viral inclusions segregate vRNPs from the cytosol and facilitate selected RNA-RNA interactions in a liquid environment it is under debate whether vRNPs reach the plasma membrane already as complete genome bundles several questions remain unclear relative to the internal organization and biophysical properties of these cellular condensates Resolving these questions for IAV will help to understand how viruses organize matter into membraneless organelles and identify their functions we disclose that vRNP/Rab11 hotspots constitute viral inclusions that are not delimited by membranes and display characteristics of liquid organelles Liquid properties include dynamic change of components and fast adaptation to physiological changes We also show that viral inclusion formation is spatially regulated assembling in the vicinity of the Endoplasmic Reticulum Exit Sites (ERES) and depends on continuous ER-Golgi vesicular cycling We demonstrate that viral inclusions are formed when a single vRNP type is expressed in a cell these sites are not formed by established intersegments interactions we show that viral inclusions accommodate segments from different parental strains in a co-infection system and do not promote escape from the interferon (IFN) antiviral response We propose that viral inclusion formation precedes and facilitates stochastic vRNP–vRNP interactions in a liquid environment of crowded vRNPs Viral inclusions form in the absence of intersegment RNA–RNA interactions 293 T cells were transfected for 16 h with the minimal protein components of an influenza vRNP: the three polymerase proteins (3P) (or two polymerase proteins lacking PB2 - 2P) and NP as well as with plasmids expressing GFP-NP and a a luciferase reporter plasmid cloned in negative sense and flanked by influenza promoter mCherry-NP was also used instead of GFP-NP Luminescence was determined for luciferase expression and the values plotted as mean ± standard error of the mean (SEM) Results are a pool of 2 independent experiments; or b–e 293 T cells were further transfected with plasmids expressing vRNA from segments 7 and 8 and a plasmid encoding NS2 when segment 7 was expressed alone b Cells were lysed and the indicated proteins were detected by western blotting c Cells were fixed and stained for Rab11 (red) White boxes show areas of co-localization between NP and Rab11 Nuclei are delineated by yellow dashed lines d The frequency distribution of Rab11 inclusions within the three area categories (in μm2) was plotted for each condition Statistical analysis of data was performed using a non-parametric Kruskal–Wallis test followed by Dunn’s multiple comparisons test (***p < 0.001) Between 30 and 70 cells were analyzed per condition and 3 independent experiments were performed e Duplicate samples were processed to detect segment 7 (red) and segment 8 (gray) RNA by FISH White boxes show areas of co-localization between NP and viral segments the results obtained demonstrate that viral inclusions assemble in the presence of a single vRNP type The data also indicate that formation of Rab11 enlarged puncta is dependent on vRNPs reaching the cytosol but precedes and does not require RNA–RNA intersegment interactions and it was postulated that other viral factories or viral inclusions would assemble by liquid–liquid phase separation which indicates constant exchange of material and deformability these inclusions appear to be constantly exchanging material amongst them an essential trait if these were sites devoted to viral genome assembly or transfected with a plasmid encoding GFP-NP and infected with PR8 as above Percentage of cells with undissolved viral inclusions under the indicated treatments was calculated and plotted followed by Dunn’s multiple comparisons test (**p < 0.05; ***p < 0.001) At least 10 cells were analyzed per individual dot and 10 panels per condition the data indicate that cytosolic viral inclusions react quickly to stress we treated cells only for 30 min with 5% hexanediol before fixing them for quantifications or before allowing cells to recover by washing out hexanediol and replacing with media and results show that hexanediol treatment dissolved inclusions although less efficiently than the hypotonic shock (from 88.1 ± 5.0% to 37.7 ± 14.4% for PR8; 82.0 ± 32.8% to 17.0 ± 12.6% for PA-GFP; 80.6 ± 5.8% to 30.3 ± 15.9% for GFP-NP/PR8 Recovery from both treatments was equally effective (92.6 ± 2.9% for PR8; 81.4 ± 8.2% for PA-GFP; 83.0 ± 3.4% for % for GFP-NP/PR8) can respond to changes in the cellular environment and their constituents can self-organize into fluxional structures in live cells the data convincingly show that cytosolic viral inclusions are similar for PR8 confirming that these systems can be used interchangeably was plotted as a function of time for the means of 25 FRAP events (left graph) The means are shown (black) with error bars representing the standard deviation (gray) The percentage of recovery of each photobleached region is shown for specific times (right graph) A single experiment representative of two independent experiments is shown were imaged by confocal and electron microscopy and the resultant images were superimposed are delineated by a dashed line in the upper panel and shown in greater detail in the lower panel Progeny virions budding at the surface (black arrows) show that the cell is infected Black delimited arrowheads show individual vesicles within the inclusion e GFP-Rab11 WT cells were infected with PR8 virus (MOI = 5) for 16 h and then stained for GFP (18 nm gold particles) and viral NP (6 nm gold particles) Inclusion areas are highlighted by black boxes Black arrowheads indicate ER structures in the vicinity of viral inclusions Black arrows show progeny virions budding at the cell surface White arrowheads show electron-dense vRNPs these data suggest that vRNP/Rab11 inclusions are liquid membraneless organelles arising from phase separation Images are representative of at least 15 cells and are representative of 9 videos from 2 independent experiments Disruption of ER exit sites dissolves viral inclusions HeLa cells were transfected with plasmids encoding GFP SAR1 WT-GFP (SAR1) or SAR1-GTP-GFP (SAR1-GTP) and cells were fixed and processed for immunofluorescence a Cells were stained for the viral protein NP (in red) and for the ER protein PDI (in gray) Areas highlighted by the white box are shown on the right of each panel the percentage of NP staining that is inside inclusions and the frequency distribution of NP inclusions within the three area categories (in μm2) were plotted for each condition More than 40 cells from 2 independent experiments were analyzed per condition c Infected cells were stained for the viral protein HA and imaged by confocal microscopy Interferon response is not affected by the formation of viral inclusions a Stable cell lines expressing GFP-Rab11 WT or GFP-Rab11 DN were infected or mock-infected (M) a Cells were fixed at 8 and 16 hpi and stained for NP (in red) b The frequency distribution of NP inclusions within the three area categories (in μm2) was plotted for each cell line followed by Dunn’s multiple comparisons test (*** p < 0.001 for GFP-Rab11 WT cells; no statistical significance found for GFP-Rab11 DN cells) Statistical analysis compares the area of all inclusions between conditions An average of 30 cells was analyzed per condition IL-29 and viperin was evaluated at the level of transcription by RT-qPCR in relation to GAPDH Poly(I:C) was used as a positive control for maximum expression of these transcripts Statistical analysis of data was performed using two-way ANOVA test followed by Sidak multiple comparisons test (no statistical significance between conditions found) Data represents the average of three independent experiments and GAPDH was evaluated at the protein level by western blotting e The levels of secreted IFN-β were quantified by ELISA in cell supernatants at 24 hpi Poly(I:C) was used as a positive control for maximum expression of IFN-β protein The limit of detection of this method is 30 pg mL−1 (dashed line) Data represent the average of three independent experiments supernatants were collected and viral production was evaluated by plaque assays using MDCK cells Statistical analysis of data was performed using Holm–Sidak multiple comparisons test (**p < 0.01 Data correspond to one representative experiment out of three independent experiments the results obtained were identical for both cell lines all results point towards innate immune responses not being affected by biological phase transitions of vRNPs the data also indicate that above an optimal range even Rab11 WT has a detrimental effect in viral replication Future work should investigate if this is related with viral inclusions Viral inclusions harbor vRNPs of two parental viruses in co-infections A549 cells were mock infected or infected with PR8 and/or Eng2009 cells were fixed and processed for FISH to detect segments 4 of both viruses and segment 6 of PR8 Inlets show magnifications with all segments colocalizing in co-infections Viral inclusions (in red) have properties of liquid organelles Viral inclusions exchange material dynamically (1) and deform easily exhibiting fission (2) and fusion (3) events Viral inclusions can travel long distances before and after fusion/fission events (4) These organelles are formed in the vicinity of ERES (in blue) and their assembly is dependent on continuous ER-Golgi vesicular cycling We propose that viral inclusions trigger nucleation of vRNP–vRNP interactions among the eight different segments to assemble a complete IAV genome Inlet shows composition of viral inclusions close to ERES the two biological assemblages have been treated as unrelated phenomena and the link between them is still missing Whether Rab11 is involved in material exchange among inclusions remains to be evaluated Compelling evidence to validate a model in which upon nuclear export vRNPs move using the ER and concentrate near the ERES to assemble viral genomes for posterior delivery to the plasma membrane by Rab11 vesicles is still needed Unresolved questions include: (1) routing of Rab11 to the ER; (2) binding of vRNPs to the ER; (3) selection of the ERES as scaffolds for viral inclusions (4) formation of a supra-molecular complex inside these structures and in the case that occurs (5) sensing and transport of fully assembled genomes to the plasma membrane Despite lack of mechanistic insight, formation and maintenance of viral inclusions is likely a conserved and robust process. Co-infection with two distinct human IAV strains resulted in the co-lodging of their vRNPs in the same inclusions (Fig. 9) Formation of viruses with mixed genomes from human and avian adapted strains (reassortant viruses) has been associated with pandemic viruses and excess mortality development of viral inclusions should be analyzed in more detail to unravel their contribution to production of reassortant strains identifying the key features of viral inclusions could provide means to control their formation and maintenance during IAV infection We are just beginning to understand the involvement of phase separation in virology given the ancient co-evolution between viruses and eukaryotic cells and the diversity of host strategies used by viruses the next years will provide an interesting overlap between the two fields and PR8 PA-GFP viruses were rescued in HEK293T cells using Lipofectamine 2000 (ThermoFisher) and amplified in MDCKs or embryonated eggs The circulating virus influenza A/England/195/2009 (Eng2009) was also used in this work (kind gift from Prof A549 cells were seeded in poly-d-lysine coated wells and infected at a multiplicity of infection (MOI) of 0.001 in DMEM supplemented with 2 mM L-glutamine 1% penicillin/streptomycin for 1 h at 37 °C and 5% CO2 Virus were then removed and cells were grown in DMEM supplemented with 2 mM L-glutamine 1 μg mL−1 TPCK-trypsin (PAA) and 0.14% BSA (Sigma) until the supernatants were collected at different time points The supernatants were subjected to a plaque assay to calculate the virus titres All other virus infections were performed at an MOI of 3–10 cells were overlaid with complete culture media The drug brefeldin A (Sigma) was dissolved in ethanol and used at final concentration of 2 μg mL−1 Nocodazole (Sigma) and latrunculin A (Sigma) were dissolved in DMSO and used at a final concentration of 10 µg mL−1 and 1 µM Plasmids used to synthesize FISH probes to detect vRNA from PR8 segments 4 and 6 and from Eng2009 segment 4 in co-infection experiments were constructed by PCR-amplifying nt 533 to 910 of PR8 HA sequence Sec61β Fw: 5′-TAGAAAGCTTCATGCCTGGTCCGACCC-3′ Sec61β Rv: 5’-TCGAGGTACCCTACGAACGAGTGTACTTGCCC-3′ SAR1 WT Fw: 5′- TCGACTCGAGATGTCTTTCATCTTTGAGTGGATCT- 3′ SAR1 WT Rv: 5′- TCGAGGATCCCGGTCAATATACTGGGAGAGCCAGC- 3′ SAR1 H79G FW: 5′- TTTTGATCTTGGTGGGGGCGAGCAAGCACGTCGC - 3′ SAR1 H79G RV: 5′- GCGACGTGCTTGCTCGCCCCCACCAAGATCAAAA - 3′ KDEL Fw: 5′-TGGACGAGCTGTACAAGGACGAGCTGTAATCCGGCCGGACT-3′ KDEL Rv: 5′- AGTCCGGCCGGATTACAGCTCGTCCTTGTACAGCTCGTCCA-3′ Calreticulin tag up: 5′- CTAGCATGCTGCTATCCGTGCCGTTGCTGCTCGGCCTCCTCGGCCTGGCCGTCGCA-3′ Calreticulin tag down: 5′- CCGGTGCGACGGCCAGGCCGAGGAGGCCGAGCAGCAACGGCACGGATAGCAGCATG-3′ NS2 Fw: 5′-CGTAGCGAATTCATGGATCCAAACACTG-3′ NS2 Rv: 5′-GCTAAGACGCGGCCGCTTAAATAAGCTGAAAC-3′ GFP NotI Fw: 5′-GTCAGAATGCGGCCGCcATGGTGAGCAAGGGCGAGGAG-3′ GFP XbaI Rv: 5′-TCAGTCTAGATTACTTGTACAGCTCGTCCATGC-3′ PA pCDNA3 EcoRI_Fw: 5′-CGACGAATTCATGGAAGATTTTGTGCG-3′ PA pCDNA3 NotI Linker Rv: 5′-GTCGTCGCGGCCGCACTCAATGCATGTGTAAGGAATGAG-3′ pDual Seg3 SDM Fw: 5′-CTAGAAGGATTTTCAGCTGAATCTAGAAAACTGCTTCTTATCGTTC-3′ pDual Seg3 SDM Rv: 5′-GAACGATAAGAAGCAGTTTTCTAGATTCAGCTGAAAATCCTTCTAG-3′ PR8 HA probe Fw: 5′-GCGTAAGCTTGACGGAGAAGGAGGGCTCAT-3′ PR8 HA probe Rv: 5′-GCGTTCTAGAGTGTTACACTCATGCATTGATGCG-3′ PR8 NA probe Fw: 5′-GCGTAAGCTTCAATCTGTCTGGTAGTCGGA-3′ PR8 NA probe Rv: 5′-GCGTTCTAGACCGGTTAATATCACTGAAGTTG-3′ Eng HA probe Fw: 5′-GCGTAAGCTTGCTCAGCAAATCCTACATTAATG-3′ Eng HA probe Rv: 5′-GCGTTCTAGACGTGGACTGGTGTATCTGAA-3′ were transfected with 250 ng of indicated plasmids or 100 ng of the synthetic dsRNA polyinosinic:polycytidylic acid [poly(I:C); Calbiochem] using Lipofectamine LTX (Life Technologies) and Opti-MEM (Life Technologies) Cells were infected or mock-infected 16 h post-transfection or simultaneously with transfection (live-cell imaging) at indicated MOI 293 T cells grown to 70% confluency in 24-well plates were transfected with plasmids pcDNA PB1 using Lipofectamine 2000 (Life Technologies) according to the manufacturer’s instructions cells were fixed for 15 min with 4% formaldehyde and permeabilized for 7 min with 0.2% (v/v) Triton-X-100 in PBS Cells were incubated with the indicated primary antibodies for 1 h at RT washed and incubated for 45 min with Alexa fluor conjugated secondary antibodies and Hoechst Antibodies used were: rabbit polyclonal against Rab11a (1:100; Life Technologies and NP (1:1000; gift from Prof Paul Digard); mouse monoclonal against NP (1:1000; Abcam virus HA (neat; gift from Prof Paul Digard) MA3-019) and Sec31A (1:100; BD Biosciences 612350); and goat polyclonal against ERp57 (1:200; Sicgen Secondary antibodies were all from the Alexa Fluor range (1:1000; Life Technologies) cells were mounted with Dako Faramount Aqueous Mounting Medium and single optical sections were imaged with a Leica SP5 live confocal microscope threshold adjusted and “analyze particle” function was used to determine the area of each vesicle inside selected cells Frequency distributions were calculated and plotted with GraphPad Prism using intervals of 0–0.15 Images were post-processed using Adobe Photoshop CS5 and ImageJ (NIH) Cells were grown in chambered glass-bottomed dishes (Lab-Tek) and maintained at 37 °C in Leibovitz L-15 CO2-independent medium (Gibco) during imaging Samples were imaged using Leica SP5 Inverted or Roper TIRF Spinning Disk (Yokogawa CSU-X1) and post-processed using Adobe Photoshop CS5 and ImageJ (NIH) FRAP curves were fitted following the exponential function: Y = Y0 + (Plateau-Y0)*(1-exp(-D*x)) Plateau (must be less than one): Y value at infinite times expressed in reciprocal of the x axis time units Span (mobile phase): difference between Y0 and Plateau expressed in the same units as your Y values were fixed in suspension using 2% (v/v) formaldehyde (EMS) and 0.2% (v/v) glutaraldehyde (Polysciences) in 0.1 M Phosphate buffer (PB) The aldehydes were quenched using 0.15% (w/v) glycine (VWR) in 0.1 M PB for 10 min at RT Cells were infiltrated in 12% (w/v) gelatin (Royal) for 30 min at 37 °C and centrifuged cut into 1 mm3 cubes and placed in 2.3 M sucrose (Alfa Aesar) in 0.1 M PB The cubes were mounted onto specimen holders and frozen at −196 °C by immersion into liquid nitrogen Samples were trimmed and cut into 50-nm-thick sections (in a Leica EM-FC7 at −110 °C) and laid onto formvar-carbon coated 100-mesh grids sections were blocked with PBS/1% BSA for 20 min at RT Antibody staining was done sequentially in PBS/1% BSA at RT: rabbit anti-GFP (1:500 goat anti-rabbit IgG conjugated to 18 nm gold (1:20 and goat anti-mouse IgG conjugated with 6 nm gold (1:20 Gold particles were fixed by applying 1% (v/v) formaldehyde in PBS for 5 min at RT Blocking and extensive washing were performed in-between stainings gold particles were fixed using 1% (v/v) glutaraldehyde (Polysciences) for 5 min RT Grids were washed in distilled H2O and counterstained using methyl-cellulose–uranyl acetate solution for 5 min on ice EM images were acquired on a Hitachi H-7650 operating at 100 keV equipped with a XR41M mid mount AMT digital camera Sections of 70 nm thickness were cut using a Leica EM-FC7 Ultramicrotome The regions of interest were acquired with a Hitachi H-7650 operating at 100 keV equipped with a XR41M mid mount AMT digital camera Detection of IFN-β in the cell supernatants was done using the VerikineTM Human IFN Beta ELISA kit (PBL Assay Science Extraction of RNA from samples in NZYol (NZYtech MB18501) was achieved by using the Direct-zol RNA minipreps (Zymo Research Reverse transcription (RT) was performed using the transcriptor first strand cDNA kit (Roche Real-time RT-PCR to detect GAPDH and IFN- β HSP3805) by using SYBR Green Supermix (Biorad 10% (v/v) of cDNA and 0.4 µM of each primer The reaction was performed on a CFX 384 Touch Real-Time PCR Detection System machine (Biorad) under the following PCR conditions: Cycle 1 (1 repeat): 95 °C for 2 min; Cycle 2 (40 repeats): 95 °C for 5 s and 60 °C for 30 s; Cycle 3: 95 °C for 5 s and melt curve 65 °C to 95 °C (increment 0.05 °C each 5 s) Data were analyzed using the CFX manager software (Biorad) Primer sequences used for real-time RT-qPCR were the following: Further information on experimental design is available in the Nature Research Reporting Summary linked to this article The authors declare that the data supporting the findings of this study are available within the paper and its Supplementary Information files The emerging influenza virus threat: status and new prospects for its therapy and control Genome-wide analysis of influenza viral RNA and nucleoprotein association and implications of influenza A virus reassortment Pacing a small cage: mutation and RNA viruses Structural and functional motifs in influenza virus RNAs Complete and Incomplete Genome Packaging of Influenza A and B Viruses Influenza defective interfering viral RNA is formed by internal deletion of genomic RNA Heterologous protection of mice from a lethal human H1N1 influenza A virus infection by H3N8 equine defective interfering virus: comparison of defective RNA sequences isolated from the DI inoculum and mouse lung Defective RNAs inhibit the assembly of influenza virus genome segments in a segment-specific manner A Rab11- and microtubule-dependent mechanism for cytoplasmic transport of influenza A virus viral RNA Colocalization of different influenza viral RNA segments in the cytoplasm before viral budding as shown by single-molecule sensitivity FISH analysis RAB11A is essential for transport of the influenza virus genome to the plasma membrane Influenza A virus ribonucleoproteins modulate host recycling by competing with Rab11 effectors Influenza a virus assembly intermediates fuse in the cytoplasm Clustering of Rab11 vesicles in influenza A virus infected cells creates hotspots containing the eight viral ribonucleoproteins.Small GTPases 8 Influenza virus genome reaches the plasma membrane via a modified endoplasmic reticulum and Rab11-dependent vesicles Apical transport of influenza A virus ribonucleoprotein requires Rab11-positive recycling endosome Replication-competent influenza A virus that encodes a split-green fluorescent protein-tagged PB2 polymerase subunit allows live-cell imaging of the virus life cycle Influenza virus induces cholesterol-enriched endocytic recycling compartments for budozone formation via cell cycle-independent centrosome maturation and viroplasm produced during virus replication Aggresomes and pericentriolar sites of virus assembly: cellular defense or viral design Negri bodies are viral factories with properties of liquid organelles Structure and development of viruses observed in the electron microscope At the centre: influenza A virus ribonucleoproteins Segment self-repulsion is the major driving force of influenza genome packaging Competitive incorporation of homologous gene segments of influenza A virus into virions Germline P granules are liquid droplets that localize by controlled dissolution/condensation Phase Transitions Drive the Formation of Vesicular Stomatitis Virus Replication Compartments Live imaging of influenza viral ribonucleoproteins using light-sheet microscopy Nucleozin targets cytoplasmic trafficking of viral ribonucleoprotein-rab11 complexes in influenza a virus infection Hexanediol: a chemical probe to investigate the material properties of membrane-less compartments Phase transition of a disordered nuage protein generates environmentally responsive membraneless organelles Increased spatiotemporal resolution reveals highly dynamic dense tubular matrices in the peripheral ER Urban planning of the endoplasmic reticulum (ER): how diverse mechanisms segregate the many functions of the ER Cargo capture and bulk flow in the early secretory pathway COPII-coated vesicle formation reconstituted with purified coat proteins and chemically defined liposomes The Sar1 GTPase coordinates biosynthetic cargo selection with endoplasmic reticulum export site assembly Evasion of antiviral immunity through sequestering of TBK1/IKKepsilon/IRF3 into viral inclusion bodies Rabies virus infection induces the formation of stress granules closely connected to the viral factories Influenza A Virus NS1 Protein Promotes Efficient Nuclear Export of Unspliced Viral M1 mRNA The Rab11 pathway is required for influenza A virus budding and filament formation Influenza A virus lacking the NS1 gene replicates in interferon-deficient systems Selective incorporation of influenza virus RNA segments into virions Biomolecular condensates: organizers of cellular biochemistry Amyloid-like self-assembly of a cellular compartment Phase transitions in the assembly of multivalent signalling proteins Intrinsically disordered region of influenza A NP regulates viral genome packaging via interactions with viral RNA and host PI(4,5)P2 Oligomerization of the influenza virus nucleoprotein: identification of positive and negative sequence elements A liquid phase of synapsin and lipid vesicles A Membraneless organelle associated with the endoplasmic reticulum enables 3′UTR-mediated protein–protein interactions Influenza A virus progeny vRNP trafficking in live infected cells studied with the virus-encoded fluorescently tagged PB2 protein Visualization of microtubule-mediated transport of influenza viral progeny ribonucleoprotein ER sliding dynamics and ER-mitochondrial contacts occur on acetylated microtubules Intracellular Colocalization of Influenza Viral RNA and Rab11A Is Dependent upon Microtubule Filaments Glycolytic enzymes coalesce in g bodies under hypoxic stress Phase separation of C9orf72 dipeptide repeats perturbs stress granule dynamics Reentrant phase transition drives dynamic substructure formation in ribonucleoprotein droplets RNA buffers the phase separation behavior of prion-like RNA binding proteins Phase separation of signaling molecules promotes T cell receptor signal transduction mTORC1 controls phase separation and the biophysical properties of the cytoplasm by tuning crowding 3D correlative electron microscopy reveals continuity of Brucella-containing vacuoles with the endoplasmic reticulum Influence of PB2 host-range determinants on the intranuclear mobility of the influenza A virus polymerase Measurement of dynamic protein binding to chromatin in vivo Download references This project is supported by the grant PTDC/BIA-CEL/32211/2017 awarded by the Fundação para a Ciência e a Tecnologia (FCT Portugal) and also by Fundação Calouste Gulbenkian-Instituto Gulbenkian de Ciência (FCG-IGC All other authors are supported by FCT: S.V.-C are funded by post-doctoral working contracts; T.A.E is supported by the PhD fellowship PD/BD/128436/2017 and M.J.A is funded by the FCT investigator contract IF/00899/2013 The authors acknowledge Prof Paul Digard (Roslin Institute Switzerland) for providing cells and reagents We are grateful to the Unit of Imaging and Cytometry at the Instituto Gulbenkian de Ciência for technical support Fabrice Cordelières from the Bordeaux Imaging Center (INSERM and S.V.-C.: designed the experiments; M.J.A. and A.L.S.: carried out experiments and analyzed the data; M.J.A conceived and supervised the research; M.J.A. and S.V.-C.: wrote the manuscript; and all authors contributed to editing the manuscript The authors declare no competing interests Journal peer review information: Nature Communications thanks the anonymous reviewers for their contribution to the peer review of this work Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations Download citation DOI: https://doi.org/10.1038/s41467-019-09549-4 Anyone you share the following link with will be able to read this content: Sorry, a shareable link is not currently available for this article. Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily. Our Standards: The Thomson Reuters Trust Principles., opens new tab , opens new tab Browse an unrivalled portfolio of real-time and historical market data and insights from worldwide sources and experts. , opens new tabScreen for heightened risk individual and entities globally to help uncover hidden risks in business relationships and human networks. © 2025 Reuters. All rights reserved the new circular hiking route will be the world's largest Its first section will open in Alenquer (just north of Lisbon) in July and it will welcome visitors ready to explore by foot or bike another 15 sections should open by the end of 2024 the path will reportedly span 90-100 districts.In addition to being a unique attraction that draws tourists to the country the project is also a way to deter tourists from crowding Portugal's most iconic cities (including Lisbon and Porto) and direct them off the beaten path instead The path will allow outdoors enthusiasts to discover Portugal from its most iconic cities and known locales This way, Portugal hopes to grow the tourism industry in the country without burdening its most famous destinations with the price of overtourism. As Thrillist previously reported including damage to the environment and landmarks and negative repercussions on the locals' quality of life Portugal aims at boosting the local economy by bringing tourists to new By encouraging visitors to discover more rural and niche cities and regions through the new path the country is envisioning steadfast growth in the local economy of those areas If you're worried about navigating the route There will be a dedicated app available for visitors you'll even be given a physical passport to stamp along your way Legendary jockey Damien Oliver might not get the chance to ride in his final Melbourne Cup after Alenquer suffered a minor injury on Sunday morning The $101 outsider is set to be Oliver's final ride in Tuesday's Group 1 3200-metre classic but the gelding has suffered a stone bruise while doing trackwork A hoof pad will be applied for the next 24-hours and the horse will be examined again by vets on Monday as a part of mandatory pre-race inspections Trainer Mike Moroney faces a race against time but is confident Alenquer will come good in time 'It just depends on how long the bruise takes to come out is determined to cap off an ­incredible career with his final Melbourne Cup on Alenquer - and Moroney is also exceited at the prospect 'It'll be great to be a part of his fairy tale He's had 31 rides and I've had 24 runners so we're both seasoned.' After announcing his retirement earlier in the year, Oliver told the Herald Sun this week that he's daring to dream. 'It's good to get one on my last dance, you might call it,' he said. 'It's much better to be a part of it than watching on the sidelines. You've got more chance of winning it if you're in it ... so it will be great to be a part of it.' 'Obviously, winning the Lexus Melbourne Cup is quite life changing and to win it three times is very special to me,' he said. 'They are all favourites, it's a bit like your kids, it's hard to separate them. They have all provided great memories for different reasons. 'The last one a decade ago on Fiorente was obviously memorable, riding Gai's first Cup winner. 'But the win on Media Puzzle will always be exceptionally special to me, it was a very emotional time. 'And of course, Doriemus, he was an amazing horse who gave me both the Melbourne Cup and the Caulfield Cup in one year.' Oliver has faced more than his fair share of tragedy in the sport, with both his father and brother dying in race falls while riding horses. Oliver lost his brother just days before the 2002 Melbourne Cup, which Oliver astonishingly won on Irish stayer Media Puzzle. In one of the most memorable moments in Aussie sporting history, Oliver blew a kiss to his late brother after he crossed the line. 'You just couldn't script that sort of thing,' Oliver told Nine's The Heart of Racing podcast of the incredible win. 'It was really a sad time for me firstly, losing your brother, and that's my main memory of it, more so the sadness of losing my brother rather than winning the Cup. 'That was a tribute to him and something I'm glad I was able to pull off, particularly looking back on it now. At the time it was full of sadness, losing him in that week leading up to the Cup.' Champion jockey Damien Oliver in doubt for farewell Melbourne Cup rideCommenting on this article has endedNewest{{#isModerationStatus}}{{moderationStatus}} Continuing to focus on mono-crystalline technology The Danish clean energy project developer Eurowind Energy has connected its new 22 MWp Triana Solar Power Park to the Portuguese grid the 30-hectare plant features just over 41,000 bifacial photovoltaic modules from LONGi Triana will provide electricity to 14,100 households reducing the region’s carbon dioxide emissions by an estimated 19,000 tons The park’s total energy yield is expected to average 41.5 GWh annually Speaking to the process of bringing such a utility project to fruition Eurowind Managing Director Southern Europe Pedro Pereira pointed to the importance of their choice of partners: “Having LONGi on board as a supplier was very helpful in financing the project since the company is known as a highly reliable partner But through the stages of development and construction working with LONGi meant we had a transparent communicative partner and always knew where we stood.” Changing Portuguese solar market poised to explode which began at the end of 2021 following a five-year development period While the early years of the project’s development presented challenges typical to the Portuguese market at the time the country has recently made strides in simplifying its permitting and connection processes By mid-2022 Portugal had already seen more new photovoltaic capacity installed than the total amount in 2021 The government has set a target of 9 GW total capacity by the year 2026 Eurowind Energy is planning to begin construction on a further 50MW of solar capacity later this year LONGi is committed to being the world’s leading solar technology company focusing on customer-driven value creation for full scenario energy transformation Alenquer wins King Edward VII Stakes at Ascot Racecourse Alenquer  winner of the King Edward VII Stakes (G2) at Royal Ascot and the favorite for the Aug will instead contest the Juddmonte International (G1) Aug The 3-year-old had been the 4-1 favorite for the Great Voltigeur said: "The plan is to run Alenquer in the Juddmonte International We had originally considered the Great Voltigeur but as we have decided against running him in the St but we're very happy with him and he deserves to take his chance." Mohaafeth finished third in the Sky Bet York Stakes (G2) last time out having landed the Hampton Court Stakes (G3) at Royal Ascot the time before and connections are keen to try him at the top level assistant racing manager to owner Shadwell Estates said on Thursday: "Mohaafeth worked nicely this morning on the Al Bahathri Polytrack and the plan is to run him in the Juddmonte International He's not tested his ability at group 1 level yet but we're keen to have a crack at it and hopefully the rain stays away as he needs it quick "Obviously it looks a tough race with St Mark's Basilica in there who has already won a Two Thousand Guineas and a Derby in France and this will tell us whether our horse is a group 1 horse or not."  Aidan O'Brien has four of the nine horses remaining One Ballydoyle contender set to bypass an upcoming top-level target is Prix Rothschild (G1) heroine Mother Earth  with O'Brien signalling she is likely to sidestep the Aug "We were thinking about running her but she probably won't go there," said her trainer after ten runners stood their ground on Thursday for the Deauville group 1 "It's just coming up a little bit too quick for her so we'll probably give her a bit more time." O'Brien added: "Order Of Australia  is likely to run Ryan (Moore) should be back from America to ride him on Sunday." It looks like JavaScript is not enabled in your browser your new go-to podcast to spice up your weekday mornings with relevant news and behind-the-scenes from Brussels and beyond From the economy to the climate and the EU's role in world affairs this talk show sheds light on European affairs and the issues that impact on our daily lives as Europeans Tune in to understand the ins and outs of European politics Dare to imagine the future with business and tech visionaries Deep dive conversations with business leaders Euronews Tech Talks goes beyond discussions to explore the impact of new technologies on our lives the podcast provides valuable insights into the intersection of technology and society Europe's water is under increasing pressure floods are taking their toll on our drinking water Join us on a journey around Europe to see why protecting ecosystems matters and to discover some of the best water solutions an animated explainer series and live debate - find out why Water Matters We give you the latest climate facts from the world’s leading source analyse the trends and explain how our planet is changing We meet the experts on the front line of climate change who explore new strategies to mitigate and adapt Plans are afoot to create the world’s longest circular hiking route the 3,000 km Palmilhar Portugal (Walking Portugal) Developed to encourage tourists off the beaten track and away from familiar (and oversubscribed) destinations such as Lisbon and the Algarve, the route will ultimately cross through 100 lesser-known beauty spots up the inaugural section of the loop will open in tiny Alenquer The next section will be created in coastal Alentejo in the south of Portugal followed by mountainous Trás-os-Montes in the north with 15 routes expected to be open by the end of the year and the trail completed within three years The ‘360-degree’ route is the brainchild of walking enthusiast and communication design consultant Ricardo Bernardes who hopes the loop will “redistribute tourism to parts of Portugal that are currently little known” Though it won’t be the world’s longest trail - that honour goes to Canada’s 24,000 km Great Trail - Palmilhar Portugal will be the world’s longest circular walk. It will be roughly the length of Europe’s Via Francigena (the ancient pilgrimage from Canterbury to Rome) “The idea came to me when I was walking along a trail and wondered what if this trail went round the whole country and returned to the same point without interruption?” Though it’s dubbed Walking Portugal, the €3.5 million project - which pledges to always be on public land, predominantly pedestrianised and without tarmac - will also be open to cyclists in some parts and aims to include trails accessible to people with reduced mobility The trail will be complemented by an app offering current information about the next location along the route and opportunities to book accommodation and tickets to sporting and cultural events The full-service trail requires participation and investment from local councils and businesses so nothing is guaranteed, but a digital and physical ‘passport’ Known locally as ‘crib town’, amphitheatre-shaped Alenquer, where Walking Portugal will open in July, is all about archaeology, palaeontology and history - with a side of wine tastings from the local vineyards. Its main tourist event Later in the year the route will extend to the rural and sparsely populated southern coastal region of Alentejo. Here, you’ll find 100 km of national parks protecting the unspoiled coastline, natural harbours, dolphin watching, wild horses and some of the world’s largest cork oak tree forests Joining the route later in 2024 is the remote Trás-os-Montes region in the northeast. The locally dubbed Hot Land area, which boasts a UNESCO World Heritage Site and a biosphere reserve orchards and vineyards for thirsty walkers The TimesThe hills and plains of Portugal are criss-crossed by walking paths most famously by those that lead to the Roman Catholic shrine of Fátima But an ambitious plan is afoot for the country to host the longest circular walking route in the world linking the border and the coast for walkers The first section will be inaugurated in Alenquer the project envisages “the creation of a circular route that crosses between 90 and 100 districts” passing along the coast and the northern and southern border lines Vadeni wins the Prix du Jockey Club at Chantilly The top six in the market have all stood their ground and are among 11 runners in contention, with Irish Two Thousand Guineas (G1) hero Native Trail  set to step up to a mile and a quarter for the first time Jean-Claude Rouget and the Aga Khan confirmed Vadeni's Eclipse participation to the Racing Post after he came through his final piece of work on Monday morning in Deauville A five-length winner of the French Derby at the start of the month Vadeni was supplemented at a cost of £50,000 who worked well this morning," said Georges Rimaud "It wasn't an extravagant piece of work because he is already in top form and didn't need anything too searching "But the gallop went well and Jean-Claude Rouget is satisfied with the horse He has been supplemented this morning as per the plan." The homebred son of Churchill  was well-supported when news that he was likely to head to Sandown emerged a little over a week ago and he is 9-4 favorite with sponsors Coral Cooper eased the going at Sandown to good all-round on Monday after two showers totaling four millimeters of rain although the outlook for the rest of the week is largely dry with the chance of a couple of light At the same stage last year only five horses were in contention for the Eclipse and Cooper welcomed both the size and quality of the five-day acceptors "We can all look at those 11 and anticipate that they might not all run but hopefully we'd be looking at eight runners and three each-way places," said Cooper who has overseen every Eclipse going back to 1994 "The Coral-Eclipse is a race that in terms of make-up and volume will always vary from year to year Most of the time it doesn't get a huge field although in Falbrav's year I think we had 15 runners is the three-year-olds taking on their elders and here and now Cooper added: "To have a Classic winner in Native Trail stepping up in trip is great and the French Derby winner was a superb and thrilling story for us when the news broke It's really very sporting and a decision to be applauded." Two top-class older horses who have yet to win at the highest level are Bay Bridge, who chased home State Of Rest in the Prince of Wales's Stakes, and Real World, who has twice run into Baaeed  over a mile this season a dual winner of the Dubai Turf Sponsored by DP World (G1) whose blindfold remained stuck over his head for the opening strides of the Prince of Wales's Stakes (G1) under a luckless Frankie Dettori who also holds an entry in the Grand Prix de Saint-Cloud (G1) over a mile and a half on Sunday Add articles to your saved list and come back to them any time Damien Oliver faces a nervous wait to find out if the horse he is booked to ride in his final Melbourne Cup Alenquer faces a vet inspection on Monday after the farrier found he had a stone bruise following track work on Sunday Trainer Mike Moroney’s stable will apply a hoof pad to the quirky six-year-old before stewards check on him as part of their mandatory pre-race veterinary inspections for the Melbourne Cup Kalapour won the Lexus Archer Stakes on Derby Day with Damien Oliver on board to claim his Melbourne Cup spot.Credit: Racing Photos Although the group 1 winner in the United Kingdom is considered a 100-1 chance in the race his run was certain to be closely monitored as Oliver took the mount as part of his Cup week farewell The three-time Melbourne Cup winning jockey, who is likely to ride for the final time in Victoria in a fortnight at Caulfield was optimistic last Monday about Alenquer’s chances after he ran an improved race in the Moonee Valley Cup I’ve got a great trainer who knows how to win the Cup and seems to be finding form at the right time,” Oliver said riding a double on Derby Day as he showed he had lost none of his skill or competitive spirit He put in a masterful front-running ride to help Kalapour win the Archer Stakes and a place in the Melbourne Cup who was one of only a few options for Oliver as the horse will carry 56.5 kilograms seemed to be timing his run well and drew barrier nine the gate from which the most Cup winners have jumped Moroney said the gelding was beginning to improve his racing having come to Australia with a big reputation as a group 1 winner at Curragh who ran ninth in the Prix de l’Arc de Triomphe in October last year Moroney said he had seen the horse’s talent during track work and although he hadn’t yet replicated that in a race he was confident Australia would see him at his best eventually he admitted give in the ground would help as the forecast is for hot weather and racing on a good 4 track “We are still finding out about him,” Moroney said “We’re thinking maybe a little of give in the ground might help He obviously needs to find a little bit of cover in races because he can over race at times.” He was rapt to have Oliver on board as he aimed at a fairytale win “It would be a fairytale and I’d love to be a part of it,” Moroney said Stewards put out a tweet on Sunday confirming the stable’s report and an inspection on Monday There are no emergencies in the Melbourne Cup with the field merely reduced by any withdrawals Trainer Mike Moroney\\u2019s stable will apply a hoof pad to the quirky six-year-old before stewards check on him as part of their mandatory pre-race veterinary inspections for the Melbourne Cup was optimistic last Monday about Alenquer\\u2019s chances after he ran an improved race in the Moonee Valley Cup I\\u2019ve got a great trainer who knows how to win the Cup and seems to be finding form at the right time,\\u201D Oliver said having come to Australia with a big reputation as a group 1 winner at Curragh who ran ninth in the Prix de l\\u2019Arc de Triomphe in October last year Moroney said he had seen the horse\\u2019s talent during track work and although he hadn\\u2019t yet replicated that in a race he was confident Australia would see him at his best eventually \\u201CWe are still finding out about him,\\u201D Moroney said \\u201CWe\\u2019re thinking maybe a little of give in the ground might help He obviously needs to find a little bit of cover in races because he can over race at times.\\u201D \\u201CIt would be a fairytale and I\\u2019d love to be a part of it,\\u201D Moroney said Stewards put out a tweet on Sunday confirming the stable\\u2019s report and an inspection on Monday “To win the Eclipse for me was a real challenge” In a race that will live long in the memory the Aga Khan’s French raider Vadeni came out on top in a thrilling finish to the Eclipse Stakes at Sandown Park on Saturday Only six runners went to post but it was a cast of the highest quality featuring a mouth-watering clash between the older horses Bay Bridge Mishriff and Alenquer and three-year-olds Native Trail and Vadeni – in receipt of a handy weight for age allowance – to set the scene for a memorable renewal closely attended by the 9/4 favourite Bay Bridge As the tightly packed field entered the home straight Alenquer attempted to slip the field with Bay Bridge in pursuit Native Trail was being wound up by William Buick on his outer as Vadeni started to stay on for pressure under Christophe Soumillon from his position at the back of the field Mishriff was still travelling well just off the leaders but was in a pocket under David Egan something that was to cost him dearly at the finish A furlong and a half out and there were still five stretched across the track before Alenquer began to weaken leaving Vadeni on the outer to seemingly fight it out with Native Trail and Lord North who was making his move between horses under new pilot James Doyle Vadeni had wrestled the lead off Native Trail only for him to then face a strong challenge from Mishriff who had been extricated for his run on the outside Mishriff closed the deficit in game fashion but it wasn’t enough with a head verdict allowing Vadeni to become the first French-trained winner of the race in 62 years Vadeni (green) sticks his neck out to deny Mishriff (far right) Vadeni had been supplemented into the race by his owner-breeder at a cost of £50,000 following his wide-margin win in the Prix du Jockey Club and his trainer Jean-Claude Rouget was quick to compare the colt with another former star “If I decide to supplement a horse like that “I have 43 years of training in my legs so I know it’s always difficult to win “To win the Eclipse for me was a real challenge like when Almanzor won the Irish Champion Stakes I hope this horse will also win the Irish Champion and that will be his next race The change of foot of this one is terribly good and what we saw in the Prix du Jockey Club.” Vadeni boasts the distinction of being the star performer from Churchill’s first crop himself the winner of four Group 1 races including the Newmarket and Irish 2,000 Guineas is the sire of five stakes winners overall The colt is out of the winning Monsun mare Vaderana and a grandson of the Aga Khan’s Prix Saint-Alary heroine Vadawina This is a family that has served the breeder well over the past 15 years notably as the source of another Prix Saint-Alary winner in Vazira (a half-sister to Vadawina) and Group 2 scorer Vadamar (out of Vadawina) it also owes much of its success to the cultivation of Jean-Luc Lagardere whose stock was incorporated into the Aga Khan’s fold in March 2005 Christope Soumillon and Jean Claude-Rouget (left) Keep in touch with The Owner Breeder for exclusive stories Essential cookies enable basic functions and are necessary for the proper function of the website Statistics cookies collect information anonymously This information helps us to understand how our visitors use our website Content from video platforms and social media platforms is blocked by default access to those contents no longer requires manual consent We use cookies to improve your experience on our site. Learn more. This is probably not the page you’re looking for Picture by Colin BullChampion jockey Damien Oliver faces an anxious wait to see if he has one last ride in a Melbourne Cup All articles from our website & appThe digital version of Today's PaperBreaking news alerts direct to your inboxInteractive Crosswords Sudoku and TriviaAll articles from the other regional websites in your areaContinueOliver who is riding at his last VRC Spring Carnival is booked to take the reins on the Michael Moroney-trained Alenquer in the $8 million cup on Tuesday But Moroney informed Racing Victoria vets on Sunday the horse was showing signs of a stone bruise to his near fore front Vets inspected Alenquer on Sunday and Monday before announcing a final examination of the horse would happen on Tuesday morning before the 7.30am scratching deadline who has won three of his 31 rides in the iconic race said he hoped the import would start in the cup "It's all out of my hands," the veteran jockey told The Standard "The final decision is up to the vets on Tuesday morning Mike thinks Alenquer will be right when the vets inspect the horse again "Feet issues often arise with horses - one day they're not good and the next day they are OK I'm sure if the vets let Alenquer run he'll be right "I want to know I'm riding a fit and healthy horse I fully understand it's my last chance of a ride in the Melbourne Cup but the horse has to be fit and well." said he was looking forward to the second day of the four-day carnival "I had a bit of luck on Saturday riding the two winners," he said "I've got my fingers crossed I might ride another one or two before the carnival ends "I've tried not to get caught up in all the hype that it's my last carnival I've just tried to stay focused on riding the horses the best I can." Damien Oliver celebrates after riding Bermadez to victory during the 2022 Warrnambool May Racing Carnival File pictureOliver's wife Trish and their three children were trackside on Saturday and will be there for the last three days Trish said the family had been trying to keep a lid on things since Oliver announced his plans to retire "There's been a lot going on over the last few months regarding Damien's retirement," she said "We've tried to keep things as normal as possible at home but I must admit it's been a bit tricky It was a fairytale on Saturday that Damien could ride two winners at his last Derby meeting "I'm just hoping the dream can continue over the last three days of the carnival and he may ride another few winners." Bookmakers rate Alenquer a $26 chance in the early betting markets Our journalists work hard to provide local This is how you can access our trusted content: Today's top stories curated by our news team Grab a quick bite of today's latest news from around the region and the nation Catch up on the news of the day and unwind with great reading for your evening Get the editor's insights: what's happening & why it matters Keep up with netball news from across the region tips & travel writing to transport you around the globe Your weekday morning newsletter on national affairs Your essential national news digest: all the big issues on Wednesday and great reading every Saturday Let the ACM network's editors and journalists bring you news and views from all over reviews and expert insights every Thursday from CarExpert Your digital replica of Today's Paper Test your skills with interactive crosswords Alenquer capped a key week for Cieren Fallon as he smashed the track record in sinking classy Lord North in the Group 3 Betway Winter Derby The 11-4 chance had the perfect position throughout off a soft pace set by his former stablemate Al Zaraqaan before powering clear in the straight to give William Haggas a first win in the track's all-weather highlight A Group 2 winner and twice Group 1 placed last year Alenquer could be in line for a trip abroad for the Dubai Sheema Classic at Meydan next month for which he is a 6-1 chance with the Lingfield race sponsors who was confirmed acting number one rider for Qatar Racing earlier in the week said: "I got a nice tow into the first bend off Hollie Doyle and had a nice position throughout He was a bit disorganised around the bend but when he hit the straight it was game over he'll tighten up for that and it's nice to get the call-up for the ride with Tom Marquand riding in Saudi Arabia." racing manager to winning owners M M Stables said: "He'll improve massively for this race as he was only 80 per cent fit and hopefully this will set him up nicely for the Group 1 targets such as Dubai Sheema Classic or maybe the Prix Ganay "Cieren gave him a perfect ride from a perfect position throughout and I think Alenquer is a Group 1 horse in the making." said: "He needed the run and will come on a good bit for that He didn't handle the bend that well but he ran on well again in the straight That will have blown the cobwebs away for the year." Scott Dixon enjoyed a memorable day at the Surrey track when One Night Stand gave him his first black-type win in the Listed Hever Sprint Stakes The 17-2 chance got to the front from flagfall under Hollie Doyle in the five-furlong speed test and did not see another rival to give Dixon a landmark win One Night Stand was unlucky on his previous visit to Lingfield in a Listed contest over six furlongs but he is likely to be kept to the minimum after this Dixon said: "Fair play to the owners Simon Chappell who decided to have a crack at the big pot rather than run in the handicap on this card "I'm thrilled to have my first stakes winner and we'll stick to five furlongs after this I don't know that all-weather finals at Newcastle would be his gig but we could freshen him up for the turf." Apprentice Harry Burns has recently started another chapter of his career by joining the stable of Simon and Ed Crisford and continued in the ascendency when Aljaryaal landed the 2m handicap The 5lb claimer was linking up with his old mentor Joe Parr with the 5-2 chance who got first run on market leader Phoenix Aquilus to win handily Burns said: "I joined Simon and Ed Crisford at the beginning of the month and hopefully that will open other doors for me." Richard Kingscote is preparing to resume riding out for Sir Michael Stoute next month and got his eye in when steering Hafeet Alain home in the mile handicap for Ed Walker The former Hong Kong trainee got the splits when it mattered to account for Imperial Sands The jockey said: "I'm due to go in and start riding work for Sir Michael next month Other than that I'll probably ride out for Tom Dascombe when he sorts out where he's going." Results, replays and analysis Published on 26 February 2022inReports Copyright © 2025 Spotlight Sports Group Limited or its licensors This website is using a security service to protect itself from online attacks The action you just performed triggered the security solution There are several actions that could trigger this block including submitting a certain word or phrase You can email the site owner to let them know you were blocked Please include what you were doing when this page came up and the Cloudflare Ray ID found at the bottom of this page Damien Oliver will ride in his final Melbourne Cup on Tuesday after his mount was passed fit to run The horse had been battling a stone bruise and soreness in the near fore Veterinary Update - Alenquer pic.twitter.com/vv1FUjqXFG Alenquer is rated a better chance than when markets first opened and has been backed into $41 with bookmakers He’s yet to finish better than 5th in five Australian starts since being imported from France Cleveland remains the only late scratching for the race that stops a nation The 2023 Melbourne Cup carnival will be Oliver’s last with Australia’s greatest ever jockey finishing up in the summer’s Perth carnival You can now click/tap WATCH to start the live stream You can now click/tap LISTEN to start the live stream You can now click/tap LATEST NEWS to start the live stream Champion jockey Damien Oliver has stated the two horses he would ride if he wasn’t on Alenquer in today’s Melbourne Cup Oliver sweated on the fitness of his horse ahead of the big race with Alenquer being assessed by vets for a stone bruise He also spoke on why he has decided to retire from racing Press PLAY to hear the full interview on 3AW The ice rinks are back in Lisbon and in places close to the capital Take a look at our guide to having a great time The Christmas season is here and there are more and more amusements on offer in the city of Lisbon and when it comes to ice rinks in and around Lisbon We’ve already shown you some of the various Christmas markets that are returning to the streets and squares of Greater Lisbon this year Oeiras Parque will be taking the magic of Christmas to a new level with a new experience in the mall: a 140m2 ice rink which will guarantee hours of entertainment laughter and memories for those who venture out to skate It will also have ambient music and seasonal decorations and will be available for adults and children at the main entrance Address: Avenida António Bernardo Cabral de Macedo (Oeiras) Opening hours: until December 15 on weekdays from 2pm to 9pm; weekends from 10am to 9pm; from December 16 to January 5 every day* from 10am to 9pm (*except on December 24 and 31 Tickets: adult: €4; child (up to 12 years old): €3; family (2 adults + 2 children + 2 belugas): €14; Daily Pass (Adult or Child): €11.50; Weekly Pass (Adult or Child): €20; Belugas (skating support): €2.50; Gloves: €2.50 The UBBO ice rink is located in the shopping center’s Central Square and will remain there, waiting for you, until January 12, 2025. To skate on this rink with your friends or family, you’ ll have to pay €5 to have fun for 20 minutes… or until you fall too many times to get up. Address: Avenida Cruzeiro Seixas 5 e 7 (Amadora) Opening hours: every day from 11am to 10pm Tickets: €5 for 20 minutes; €8 for 40 minutes; €16 for families (2 adults and 2 children) for 20 minutes View this post on Instagram A post shared by UBBO (@ubbo.pt) This edition will return to Parque Eduardo VII to the delight of many children and adults, and will remain there until January 5, 2025. As well as all the areas you can visit, from the Christmas Village to the slides and the Ferris wheel, it has an ice rink with capacity for more than 100 people to skate at the same time. Entry to Wonderland Lisboa is free and you can enjoy the ice rink for 20 minutes, also free of charge. Address: Parque Eduardo VII (Marquês de Pombal) Opening hours: November 29, 2024 to January 5, 2025 (Fridays from 1pm to midnight; Saturdays from 10am to midnight); December 2 to 20 (Monday to Thursday from 1pm to 10pm); December 1 to 8 (Sundays from 10am to 10pm); December 15, 22, 29 and January 5 (Sundays from 10am to 11pm); December 23 to January 3 (Monday to Thursday from 1pm to 11pm); December 24 and 31 from 10am to 4pm; December 25 and January 1 from 4pm to 10pm. Tickets: free View this post on Instagram A post shared by Wonderland Lisboa (@wonderlandlisboa) This year, the theme of the Christmas at the Enchanted Palace event in Oeiras is “Family Magic” And what better way to have fun this Christmas than on ice skates The party will take place mainly inside the palace where the little ones will find plenty of reasons to extend their visit As well as all the entertainment you and your family can enjoy at the Cascais Christmas Village, there’s one that’s going to be a lot of fun: skating on the ice rink go to Parque Marechal Carmona to enjoy a skating session that we’re sure will be a lot of fun Address: Marechal Carmona Park Schedule: every day between November 23, 2024 and January 5, 2025 Tickets: on the website View this post on Instagram A post shared by Cascais Christmas Village (@cascaischristmasvillage) Address: Adão Barata Park (Loures) Opening hours: Monday to Friday from 5pm to 11pm; Saturdays and Sundays from 2pm to 11pm Tickets: free It’s also where you’ll find one of the most incredible ice rinks much to the delight of children and adults alike As well as the fireworks, the Christmas train, the giant nativity scene and the shopping market, at Christmas in Alenquer you’ll also be able to skate on these ice rinks Address: Romeira Urban Park (Alenquer) Hours: November 30, 2024 to January 6, 2025 Tickets: on the website (Joel Carrett/AAP PHOTOS)Retiring great Damien Oliver is relying on a frisky Frenchman to give him a special send-off with a record-equalling fourth Melbourne Cup victory All articles from our websiteThe digital version of Today's PaperBreaking news alerts direct to your inboxAll articles from the other regional websites in your areaContinueOliver will be on board Alenquer next Tuesday during his final Victorian spring carnival at Flemington The 51-year-old rode the French-bred gelding in Friday's Moonee Valley Gold Cup and had little luck But Oliver believes Alenquer can help him capture one last Cup a victory would put him equal with the record of four wins by a jockey Speaking at the Melbourne Cup carnival launch at Flemington on Monday Oliver said Alenquer was finding form a year after being imported from Europe to the Flemington stables of Mike Moronery "He's a French horse so he's a bit quirky but he's a Group 1 winner in Europe so he's got the ability," said Oliver who will retire after Perth's summer carnival "I think Mike Moroney is starting to unlock the key to that temperament so we think he's going to run a good race for us." Oliver said he had no regrets about calling time on a career that has yielded a record 129 Group 1 wins "I'm pretty happy this is my last one," he said "I've had a great career and I'm really looking forward to the next week and hopefully I can go out as a winner." Oliver's last Melbourne Cup triumph came 10 years ago aboard the Gai Waterhouse-trained Fiorente now preparing Cup hopefuls Serpentine and Military Mission with co-trainer Adrian Bott joked there was no room for sentimentality I'd punch him," she said when asked how she would feel should Oliver beat her horses to win the race the training great said it had been "fantastic" to team with Oliver to achieve her first and only Melbourne Cup victory so far "Fiorente was a beautiful horse who took us on a ride that culminated here on Cup day when Damien was able to lift him over the line English Derby winner Serpentine - who was last in the the Cup in 2022 - moved into the field for this year's edition after Monday's round of declarations "He's a pretty special horse - he came last year and ran in the Cup ingloriously but I think we've resurrected him," Waterhouse said Waterhouse said Military Mission may run in the Archer Stakes on Derby Day to secure entry to Australia's greatest race The gelding won Caulfield's Group 2 Herbert Power Stakes (2400m) last start after running fourth in Randwick's Group 1 The Metropolitan (2400m) "He's certainly the most exciting lightly-raced horse and his run in the Metropolitan was enormous and he came from almost second-last," Waterhouse said "Sometimes you see a horse and just know it's coming right Racing Victoria vets cleared 23 of the 24 runners to compete in Tuesday's $8.4 million Melbourne Cup before the news late Monday that Cleveland would be scratched due to an elevated temperature RV said: \"Veterinarians today completed their second round of pre-race physical veterinary inspections of all starters in tomorrow's $8.4 million Lexus Melbourne Cup (3200m) at Flemington when inspected today the Mike Moroney-trained Alenquer continued to show signs of soreness in the near fore foot as a result of the stone bruise reported yesterday \"The horse will be re-examined by RV veterinarians tomorrow morning prior to final scratching time (7.30am) to determine its suitability to race The remaining 23 horses have been passed as suitable to race tomorrow.\" • Melbourne Cup favourite backed to win more than $3 million Damien Oliver is set to have his last ride in the Melbourne Cup on Alenqeur so he will have to wait until Tuesday morning to know his fate one day they're not so good and next day they can be OK,\" Oliver said if I'm going to have a ride I want to be riding on a fit I've ridden in enough Melbourne Cups to not just have a ride for the sake of having a ride but you want the horse to be right if he's going to go there I've been in it long enough to see the ups and downs and what will be will be.\" • ‘He just wins': They may as well present the Melbourne Cup now French raider Lastotchka has firmed from $23 to $18 on Monday Melbourne Cup favourite Vauban drew barrier three for the $8.4 million 3200m Group 1 flanked by reigning champion Gold Trip (two) and Soulcombe (four) Without A Fight fared the worst of the main players • Racenet's Melbourne Cup Online Sweep Generator Champion Irish trainer Willie Mullins who only arrived in Melbourne on Saturday morning declared Vauban his \"strongest chance ever\" to win the Melbourne Cup • Expert tips for the 2023 Melbourne Cup Mullins placed twice in the Cup previously with Max Dynamite \"I think he's (Vauban) as good as Max Dynamite and maybe better we'll find that out on Tuesday,\" Mullins said \"We wouldn't want to forget Absurde either… he's quarantined very well and I think he's in great shape.\" • Melbourne Cup horses Willie Mullins says Vauban is his \"strongest chance ever\" to win the Melbourne Cup Mullins would not be drawn on tactics for Tuesday • How one awkward comment reunited Gai Waterhouse and Lloyd Williams Gold Trip's co-trainer Ciaron Maher said: \"I was hoping he'd be out in the middle (barriers) somewhere as he likes to get out a bit it.\" you never pass up a good gate and the horse is well… he's better than last year but I think he needs to be the track is going to be firmer and he's going to have a bit more weight \"He needs to be going better to win but I think he is.\" Gold Trip is shooting for back-to-back wins in the Melbourne Cup on Tuesday Emerging barrier rogue Soulcombe blew the start by four lengths in the Caulfield Cup \"We have taken the blinkers off … from that draw if he can begin he is going to be right in it,\" Chris Waller's assistant trainer Charlie Duckworth said of Soulcombe • Why owner of Vauban won't be watching the Melbourne Cup – additional reporting by Brad Waters and Glenn McFarlane ■ The Melbourne Cup is race 7 on Tuesday's program and the starter is set to let them fly at 3pm Here is the field and barrier draw for the 2023 Melbourne Cup Racing Victoria vets cleared 23 of the 24 runners to compete in Tuesday's $8.4 million Melbourne Cup before the news late Monday that Cleveland would be scratched due to an elevated temperature RV said: "Veterinarians today completed their second round of pre-race physical veterinary inspections of all starters in tomorrow's $8.4 million Lexus Melbourne Cup (3200m) at Flemington "The horse will be re-examined by RV veterinarians tomorrow morning prior to final scratching time (7.30am) to determine its suitability to race The remaining 23 horses have been passed as suitable to race tomorrow." • Melbourne Cup favourite backed to win more than $3 million one day they're not so good and next day they can be OK," Oliver said I've been in it long enough to see the ups and downs and what will be will be." • ‘He just wins': They may as well present the Melbourne Cup now • Racenet's Melbourne Cup Online Sweep Generator Champion Irish trainer Willie Mullins declared Vauban his "strongest chance ever" to win the Melbourne Cup • Expert tips for the 2023 Melbourne Cup "I think he's (Vauban) as good as Max Dynamite and maybe better we'll find that out on Tuesday," Mullins said "We wouldn't want to forget Absurde either… he's quarantined very well and I think he's in great shape." • Melbourne Cup horses Willie Mullins says Vauban is his "strongest chance ever" to win the Melbourne Cup • How one awkward comment reunited Gai Waterhouse and Lloyd Williams Gold Trip's co-trainer Ciaron Maher said: "I was hoping he'd be out in the middle (barriers) somewhere as he likes to get out a bit it." "He needs to be going better to win but I think he is." "We have taken the blinkers off … from that draw if he can begin he is going to be right in it," Chris Waller's assistant trainer Charlie Duckworth said of Soulcombe • Why owner of Vauban won't be watching the Melbourne Cup ■ The Melbourne Cup is race 7 on Tuesday's program and the starter is set to let them fly at 3pm. Here is the field and barrier draw for the 2023 Melbourne Cup. but the page you were trying to view does not exist