43,000+ global companies doing business in the region.
102,000+ key contacts related to companies and projects
Analysis, reports, news and interviews about your industry in English, Spanish and Portuguese.
ProductionTax breaks of 75% | Brazilian government grants special status to 3GW green hydrogen and ammonia projectSolatio aims to take FID on the export-oriented facility in the first half of this year
You are using an outdated browser. Please upgrade your browser or activate Google Chrome Frame to improve your experience
Spanish solar developer Solatio says that it plans 4 GW of solar to support hydrogen production in Brazil
under a $1.94 billion agreement with the state government of Piauí
From pv magazine LatAm
Solatio CEO Pedro Vaquer and Rafael Fonteles
the governor of the Brazilian state of Piauí
have agreed to build what has been billed as the largest PV project in the country
The 4 GW solar project will be built in the Exportation Free Zone of Parnaíba
The $1.98 billion plant will produce hydrogen for the ammonia industry in Parnaíba
with the first 3 GW phase expected to be completed between mid-2025 and 2028
Solatio said in a press release that it has an environmental license to produce 11.4 GW of green hydrogen and ammonia in Piauí
with a particular focus on supplying the European market
the government of Piauí announced an agreement to produce and export 5 GW of green ammonia
More articles from Luis Ini
Please be mindful of our community standards
and website in this browser for the next time I comment
Δdocument.getElementById( "ak_js_1" ).setAttribute( "value"
By submitting this form you agree to pv magazine using your data for the purposes of publishing your comment
Your personal data will only be disclosed or otherwise transmitted to third parties for the purposes of spam filtering or if this is necessary for technical maintenance of the website
Any other transfer to third parties will not take place unless this is justified on the basis of applicable data protection regulations or if pv magazine is legally obliged to do so
You may revoke this consent at any time with effect for the future
in which case your personal data will be deleted immediately
your data will be deleted if pv magazine has processed your request or the purpose of data storage is fulfilled
Further information on data privacy can be found in our Data Protection Policy
Δdocument.getElementById( "ak_js_2" ).setAttribute( "value"
This website uses cookies to anonymously count visitor numbers. View our privacy policy. ×
The cookie settings on this website are set to "allow cookies" to give you the best browsing experience possible
If you continue to use this website without changing your cookie settings or you click "Accept" below then you are consenting to this
Close
A 53-year-old man has been arrested in connection with the deaths of his wife
stepchildren and brother-in-law after they were poisoned by a New Year's Day meal
Francisco Pereira was taken into custody Wednesday morning in the northeastern city of Parnaíba, Brazil, just one week after he allegedly contaminated the rice in the family's lunch
Cops also revealed the suspected chilling motivation for his crime
stating that Pereira was driven by anger at his wife and her two children
that the relationship between them was troubled
He did not speak to any of his wife's children and had a specific feeling of hatred towards Francisca Maria
the children's mother,' Piauí Civil Police chief Abimael Silva said at a press conference following the arrest
'This feeling of hatred was so great that even with her on her deathbed
he couldn't hide it in his statement,' Silva added
'He said that when he looked at her he felt disgust and anger
Eight family members and a neighbor fell ill after consuming the rice
beans and fish meal and were rushed to area hospitals
including Pereira's wife's four-year-old daughter
She remains hospitalized and in critical condition
In his statement Pereira told investigators that he hated Francisca's children
Silva added the arrest was made as possible due to the varying accounts that Pereira provided
which were different from what was provided by the rest of the people who live at the home
but we should not anticipate the judgment," Silva said
Pereira was led into a local police station in handcuffs and told reporters that the court would be who determines who was responsible for the New Year's Day tragedy
Pereira was placed in pretrial detention for 30 days
Authorities said the family gathered for dinner on December 31 and had rice
They met the afternoon of January 1 and reheated the rice and beans and served with it fish that had been donated by a couple
told Fantastico news magazine that it was likely that a person entered the home and added the poison to the rice while everyone was asleep
Authorities initially thought the family was poisoned by the fish before investigators analyzed leftover portions and blood from the victims and discovered traces of terbufos
a substance found in pesticides and agriculture chemicals
Its sale for residential use is banned under Brazilian law
who oversees the Piauí Institute of Legal Medicine
told G1 that there were 'visible granules' of terbufos in the rice
The tragedy comes months after da Silva's two oldest children died after eating poisoned cashews
João died five days later and Ulisses spent nearly three months hospitalized and died November 11
The Piauí Civil Police said that the two incidents are not related
The New Year's Day family tragedy comes as Brazilian authorities were also tied up with the investigation surrounding a poisoned Christmas cake and the deaths of three family members in the southern state of Rio Grande do Sul on December 23.
Major terror attack 'was just HOURS away' before it was foiled by the special forces and police:...
Victim of acid attack 'plotted by his ex-partner who teamed up with a gang' dies in hospital six...
We are trapped in unsellable newbuild homes after a £52m dual carriageway was built on our...
Horror as $4.5M influencer-laden yacht SINKS off Miami... after glam women made a rookie maritime...
How Meghan's biggest cheerleader brokered Harry's disastrous BBC interview - three months after...
Woman dead and three others including a child injured after car ploughed into pedestrians: Man, 49,...
Pub is forced to pay family £75,000 after wrongly accusing them of 'dine and dash' over £150...
Woman who was missing for more than 60 years is found 'alive and well' decades after vanishing...
American tourist suffers horrific fate while attempting to capture selfie at Rome's Colosseum
'It's a rather giant f*** you.' Royal insider's furious reaction to Meghan's Instagram salvo as...
Revealed: The reason behind Fred & Rose West kids' bitter family rift as siblings have 'nothing to...
The towns being ruined by day-tripper invasions. Selfie-loving tourists cause traffic hell and the...
Hamas hostage, 23, 'raped by personal trainer influencer in her own home after being released'
Where 'soft-touch' Britain's asylum seekers are REALLY coming from
M&S cyber attack could take 'months' to fully recover from as 'paranoid' staff resort to sleeping in...
Husband of British mother, 65, who was knifed to death in French village says her affair is a...
No one seems to have shared their thoughts on this topic yetLeave a comment so your voice will be heard first.
{{message}}
The ad-free version is ready for purchase on iOS mobile app today
we couldn't find that page";var n=e.querySelector("h2");return n&&n.remove(),{staticContent:e,title:t}},d=function(e){var t=document.createElement("button");return t.innerText=e,t.classList.add("error-page-button"),t},f=function(e){var t=document.createElement("div");t.id="recirculation-404",t.classList.add("brand-hint-bg");var n="\n \n \n
\n \n \n '.concat(e,'
Tick here if you would like us to send you the author’s response
Volume 11 - 2023 | https://doi.org/10.3389/fevo.2023.1117947
Trilobites inhabited all environments of Paleozoic seas
ranging from estuaries to continental slopes
Although their functional morphology and phylogenetic relations are established by well-preserved body fossils
the behavior of trilobites has received less attention
Three well-known trace fossils are interpreted to be produced by trilobitomorphs when preserved in Paleozoic rocks
Those trace fossils unveil some aspects of trilobite behavior
but they were not investigated to test paleoecologic strategies based on morphometric parameters
This study uses Rusophycus to access the paleoecologic strategies of trilobites in storm-dominated shallow marine deposits of the Pimenteira and Cabeças formations (Middle to Upper Devonian
It was conducted a detailed analysis of the Rusophycus specimens in a section that represents the transition between the Pimenteira and Cabeças formations (Parnaíba Basin)
The width and length of the Rusophycus were measured
and statistical analyses were performed to understand the population characteristics
Relatively small-sized Rusophycus are dominant in such deposits
suggesting the dominance of young tracemakers and inferred r-strategist populations
The here reported multiple-Rusophycus assemblage reveals paleoecologic strategies of the population
and tiers relationship (cross-cutting epistratal and shallow-tier trace fossils such as Bergaueria
and Protopaleodictyon) indicate deep Rusophycus
The main reason for those burrowing activities deep in the substrate might be protection during ecdysis
and depth of Rusophycus suggest molting activity as the trigger for their production in storm-influenced beds of the Pimenteira Formation
Trilobites have been reported in Devonian strata of the Parnaíba Basin (Kegel, 1953; Castro, 1968; Carvalho et al., 1997; Meira et al., 2016); however, there has been a lack of ethological studies based on their trace fossils. Considering that Rusophycus dimensions might evidence ontogenetic phases and paleoecologic strategies of trilobites (Levi-Setti, 1995)
this study aims to (i) discuss the preservational bias represented by multiple-Rusophycus assemblages in a storm-dominated setting
and (ii) infer the paleoecological strategies of trilobites in this context
(B) Position of Picos at Piauí state
(C) Location of study area at Picos City (adapted from Google Earth)
In the studied section it was recognized eight sedimentary facies (Table 1; Figure 2)
from proximal (ME1) to distal (ME6) marine environments: (M1) Facies Sh and Sl are represented by stratified (horizontal stratification or low angle cross-stratification)
deposited in shoreface settings; (ME2) facies Sw
represented by very fine- to fine-grained sandstone with wave cross-lamination locally with asymmetric ripples
deposited in shoreface settings; (ME3) facies St and Sp characterized by fine- to medium-grained sandstone bearing trough or planar cross-stratification
representing deposition in shoreface settings; (ME4) facies Shcs characterized by interbedded
very fine-grained sandstone with hummocky cross-stratification and siltstone
reflecting a mix of suspension and tractive processes and indicating transitional offshore settings; (ME5) facies F characterized by moderately bioturbated heterolithic deposits alternating siltstone and fine-grained sandstone showing parallel lamination and locally lenticular to wavy bedding
reflecting deposition in upper offshore settings close to storm-wave base; and (ME6) facies M represented by parallel-laminated siltstone with low to locally high bioturbation
reflecting deposition in relatively quiet environments in offshore settings
Sedimentary facies and geologic context of studies section
(A) Geologic section and ichnofacies distribution of studied section
(B) General view of fine-grained sandstone with hummocky cross-stratification from the topmost section
(C) Detail of interbedded siltstones and fine-grained sandstone in wavy bedding
(D) Erosive contact between fine-grained sandstone and siltstones
All Rusophycus specimens used for statistical analysis came from the same bed
(I) Suite C represented by Phycosiphon (Ph)
Details of Rusophycus from the studied section
(A–C,A′–C′) Rusophycus (highlighted in red) in association with Protopaleodyction (highlighted in yellow)
(D,D′) Rusophycus (highlighted in red) in association with Bergaueria and Palaeophycus (highlighted in yellow)
(E–G,E′–G′) Detail of the morphology of Rusophycus
Rusophycus also overlaps Palaeophycus (white arrow) in (E,G)
(H,H′) Rusophycus (highlighted in red) in association with Cruziana (highlighted in yellow)
(A) Histogram of the length of the Rusophycus ichnospecimens
with the inclusion of the Gaussian fit model (density line)
with three groupings of components (ml1–3)
(B) Histogram and density plot of the width (mm) of Rusophycus specimens
(C) Scatterplot with linear regression (red line)
showing a high correlation between length and width of the ichnospecimens
(D) Density plot of the length/width ratio
It is possible to observe a population trend of smaller organisms in (A) and (B)
and the accumulation of smaller specimens in the scatterplot
The positive skewness visually corroborates the a and b density plots
mean length of the Gaussian components; μ
We used a density estimate of the Gaussian mixture model to observe the multi-distribution in the length of the ichnospecimens
and the analysis suggested three main components (ml1−3) with means of 34.70 mm (ml1)
The length/width ratio was also examined to determine if it could be used to distinguish between different animal groups producing the same ichnogenus (Figure 5D). According to the results, the data follow a normal distribution (W = 0.971, p = 0.104). There is a small peak related to specimens with a greater length/width ratio (Figure 5D)
but there is no statistical basis for attesting that there is more than one mode in the data (Dip = 0.036
and no skewness was observed (skew = 0.198
and the prevalence of a 1.5:1 length/width ratio (μ = 1.52 ± 0.22) in the majority of Rusophycus specimens suggest that these traces were most likely produced by the same trilobite species
A strong linear correlation was found between the length and width of the specimens (R2 = 0.8988
in the transition between the Pimenteira and Cabeças formations
the Cruziana ichnofacies dominate in a lower shoreface to offshore setting
and the trilobites had their trace fossils preferentially preserved in an offshore transition zone
Considering that not all observed Rusophycus in this study bear a clear pattern of scratches
leading to slightly greater growth in length than in width
Trilobites are generally considered marine organisms, although some trace fossils attributed to trilobites were found in estuarine settings (Mángano et al., 2021)
the Rusophycus occur at the bottom of a storm-influenced bed but were generated in the fine-grained deposits of facies F and M
characterizing pre-depositional colonization
Reconstitution of the molting strategy of trilobites while producing Rusophycus
and tier relation of commonly associated trace fossils
the spawning of trilobites was seasonal (once a year)
resulting in populations of high rates of small organisms compared to holaspis individuals
Although the spawning behavior of trilobites could explain the record of a population with a higher number of young adults compared with the mature ones
there is no evidence of seasonal events in the studied deposits
The erosive nature of the sandy beds that preserved the trilobite burrows suggests episodic storm events
The presence of sedimentary structures that suggest continental input
reinforces the hypothesis of sporadic salinity stress as the most parsimonious cause of stress for the studied section
homalonotids occur associated with shallow
sandy subaquatic deposits accumulated just in and/or above the fair-weather wave base zone and calmoniids are more common in muddy facies (flooding surfaces) generated below the storm wave base zone
considering this paleoenvironmental distribution
calmoniids might be considered as the main potential tracemaker of the studied Rusophycus specimens
it is possible that both calmoniids and homalonotids have produced the Rusophycus traces reported in this study
The trace fossil suites in the studied section are an expression of proximal
and distal Cruziana ichnofacies in lower shoreface to offshore settings
The suite with multiple Rusophycus can be interpreted as a pre-depositional suite
and cast by the sandy sediments carried by storm-generated and combined current flows in transitional offshore to offshore settings
Most Rusophycus can be attributed to a tracemaker in meraspis and few holaspids stages
This distribution suggests an r-strategist population
The random distribution in low energy depositional setting
and high deep of Rusophycus allowed the assumption that a molting activity is the triggered behavior to the production of Rusophycus in those storm-influenced beds from Pimenteira Formation
while Cruziana represents detritus-feeding strategy
The original contributions presented in the study are included in the article/Supplementary material
further inquiries can be directed to the corresponding author
CM: visualization and writing—original draft
All authors contributed to the article and approved the submitted version
This work was supported by Brazilian Scientific and Technological Research Council—CNPq (159548/2018-7
Coordination of Superior Level Staff Improvement—CAPES (master’s grant Finance Code 1
88887.569703/2020-00 and doctorate grant 88887.799772/2022-00)
and the reviewers for valuable discussions which greatly improved the paper
The authors would like to express their gratitude to Fernanda Quaglio and editorial board for the assistance with the entire editing process
We would also like to thank the financial support of the Brazilian Scientific and Technological Research Council—CNPq (159548/2018-7
the Coordination of Superior Level Staff Improvement—CAPES (master's grant Finance Code 1
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations
Any product that may be evaluated in this article
or claim that may be made by its manufacturer
is not guaranteed or endorsed by the publisher
The Supplementary material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fevo.2023.1117947/full#supplementary-material
Duas novas icnoespécies de Bifungites Desio
1940 na Formação Pimenteira
Google Scholar
Ameijeiras-Alonso
multimode: An R Package for Mode Assessment
CrossRef Full Text | Google Scholar
Famennian glaciation in the eastern side of Parnaíba Basin
Brazil: evidence of advance and retreat of glacier in Cabeças Formation
Multiple-Rusophycus (arthropod ichnofossil) assemblages and their significance
CrossRef Full Text | Google Scholar
Isotelus (trilobita) “hunting burrow” from Upper Ordovician strata
CrossRef Full Text | Google Scholar
An opportunistic Upper Ordovician trilobite assemblage from Missouri
CrossRef Full Text | Google Scholar
Google Scholar
Ichnology: Organism-substrate interactions in space and time
Google Scholar
Inferring ancestral range reconstruction based on trilobite records: a study-case on Metacryphaeus (Phacopida
Devonian Calmoniid Trilobites from the Parnaiba Basin
Google Scholar
The Devonian trilobites of Brazil: A summary
CrossRef Full Text | Google Scholar
Trilobitas da Formação Pimenteiras
Google Scholar
Life History of an Ordovican Trilobite Triarthrus eatoni
CrossRef Full Text | Google Scholar
Icnofósseis da Formação Pimenteira (Devoniano da Bacia do Parnaíba)
Google Scholar
Trilobite tracks and other trace fossils from the Upper Cambrian of North Wales
Google Scholar
Crônier
Systematic relationships of the blind phacopine trilobite Trimerocephalus
Google Scholar
Developmental traits and life strategy of redlichiid trilobites
PubMed Abstract | CrossRef Full Text | Google Scholar
PubMed Abstract | CrossRef Full Text | Google Scholar
PubMed Abstract | CrossRef Full Text | Google Scholar
“History and Development of Trilobite Research in Brazil Paleontologists” in Fabulous Fossils—300 Years of Worldwide Research on Trilobites
Google Scholar
Góes
Boletim de Geociências da Petrobras 8
Google Scholar
The formation of the trace fossil Cruziana
PubMed Abstract | CrossRef Full Text | Google Scholar
Icnofósseis de invertebrados da Formação Pimenteira (Devoniano) na borda leste da Bacia do Parnaíba
Brazil: Universidade Federal do Rio de Janeiro
Google Scholar
Middle Devonian chitinozoan biostratigraphy and sedimentology in the eastern outcrop belt of the Parnaíba Basin
Pyritized in situ trilobite eggs from the Ordovician of New York (Lorraine Group): Implications for trilobite reproductive biology
CrossRef Full Text | Google Scholar
Ontogeny of the articulated yiliangellinine trilobite Zhangshania typica from the lower Cambrian (Series 2
The representation of animal behaviour in the fossil record
PubMed Abstract | CrossRef Full Text | Google Scholar
Trilobite body patterning and the evolution of arthropod tagmosis
PubMed Abstract | CrossRef Full Text | Google Scholar
The ontogeny of trilobite segmentation: a comparative approach
CrossRef Full Text | Google Scholar
Evaluating hypotheses of instar-grouping in arthropods: a maximum likelihood approach
doi: 10.1666/0094-8373(2001)027<0466:EHOIGI>2.0.CO;2
Predation by early Cambrian trilobites on infaunal worms-evidence from the Swedish Mickwitzia Sandstone
CrossRef Full Text | Google Scholar
Kassambara, A. (2020). ggpubr: 'ggplot2' Based Publication Ready Plots. R package version 0.4.0. Available at: https://CRAN.R-project.org/package=ggpubr
Google Scholar
Contribuição para o estudo do Devoniano da Bacia do Parnaíba
Google Scholar
and related ichnotaxa from eastern Canada: The nomenclatural debate and systematic ichnology
CrossRef Full Text | Google Scholar
Morphometric analysis of ontogeny and allometry of the Middle Ordovician trilobite Triarthrus becki
doi: 10.1666/0094-8373(2002)028<0364:MAOOAA>2.0.CO;2
Komsta, L., and Novomestky, F. (2022). moments: Moments, Cumulants, Skewness, Kurtosis and Related Tests. R package version 0.14.1. Available at: https://CRAN.R-project.org/package=moments
Google Scholar
The occurrence of Phacopida trilobites from Pimenteira Formation at João Costa
Geologia USP Série Científica 13
Google Scholar
“The Ichnofacies paradigm: High-resolution paleoenvironmental interpretation of the rock record” in Applied Ichnology
Society for Sedimentary Geology Short Course Notes
USA: SEPM (Society for Sedimentary Geology)) 52
Google Scholar
Mángano
Trilobite expansion into brackish water during the early Palaeozoic
Revisão Sistemática e Paleobiogeográfica de Trilobitas Phacopida (Homalonotidae e Calmoniidae) do Devoniano das Bacias do Parnaíba e Amazonas
Google Scholar
The “Metacryphaeus tuberculatus Group” (Trilobita
Calmoniidae) from the Devonian of the Parnaíba Basin
An outline of the geology and petroleum systems of the Paleozoic interior basins of South America
CrossRef Full Text | Google Scholar
“Ichnofósseis Devonianos da Formação Longá
no Estado do Piauí” in Congresso Brasileiro de Geologia (Salvador Brazil: Sociedade Brasileira de Geologia)
Google Scholar
Neto de Carvalho
Roller coaster behavior in the Cruziana rugosa group from Penha Garcia (Portugal): Implications for the feeding program of trilobites
CrossRef Full Text | Google Scholar
Post-embryonic development of the Furongian (late Cambrian) trilobite Tsinania canens: implications for life mode and phylogeny
Reassessing growth and mortality estimates for the Ordovician trilobite Triarthrus eatoni
CrossRef Full Text | Google Scholar
CrossRef Full Text | Google Scholar
Deep-water marine Rusophycus and Cruziana from the Ordovician Lotbiniere Formation of Quebec
CrossRef Full Text | Google Scholar
A predatory Rusophycus burrow from the Cambrian of southern New Brunswick
Google Scholar
Ichnofabrics containing Ophiomorpha: their significance in shallow-water facies interpretation
CrossRef Full Text | Google Scholar
Flood-dominated fluvio-deltaic system: a new depositional model to Cabeças Formation
R Core Team (2013). R: a language and environment for statistical computing. R Foundation for Statistical Computing. Available at: https://www.R-project.org
Google Scholar
RStudio Team (2022). RStudio: Integrated Development Environment for R. RStudio, PBC, Boston, MA. Available at: http://www.rstudio.com/
Google Scholar
Google Scholar
Trace fossil associations in the Swedish Mickwitzia sandstone (Lower Cambrian): did trilobites really hunt for worms
CrossRef Full Text | Google Scholar
classification and density estimation using Gaussian finite mixture models
An integrative ichnological and taphonomic approach in a transgressive-regressive cycle: a case study from Devonian of Paraná Basin
CrossRef Full Text | Google Scholar
A Zoophycos carnival in Devonian beds: paleoecological
Ichnology applied to sequence stratigraphic analysis of Siluro-Devonian mud-dominated shelf deposits
“Cruziana stratigraphy of "nonfossiliferous" Palaeozoic sandstones” in Trace Fossils
Google Scholar
Trilobite palaeobiology and substrate relationships
Google Scholar
Google Scholar
CrossRef Full Text | Google Scholar
Development and trunk segmentation of early instars of a ptychopariid trilobite from Cambrian Stage 5 of China
Novos registros e aspectos paleoambientais dos icnofósseis da Formação Pimenteira
Simões
taphonomy and paleoecology of Homalonotid trilobites (Phacopida) from the Ponta Grossa Formation (Devonian)
Boletim de Geociências da Petrobras 15
Google Scholar
Caracterização sedimentológica dos arenitos da Formação Cabeças (Devoniano) na borda leste da Bacia do Parnaíba
Google Scholar
Whittington
and habits of the Middle Cambrian trilobite Olenoides serratus
Google Scholar
ggplot2: Elegant Graphics for Data Analysis
Google Scholar
Google Scholar
Wickham, H., François, R., Henry, L., and Müller, K. (2022). dplyr: A Grammar of Data Manipulation. R package version 1.0.10, Available at: https://CRAN.R-project.org/package=dplyr
Google Scholar
Contribuição à análise Estratigráfica da Formação Pimenteira (Devoniano
bacia do Parnaíba): caracterização de um potencial intervalo de rochas-reservatório
Google Scholar
Moreira Junior CA and Borghi L (2023) Multiple-Rusophycus assemblage from the Parnaíba Basin (NE Brazil) reflects trilobites as tracemakers and molting behavior
Received: 07 December 2022; Accepted: 12 May 2023; Published: 16 June 2023
Copyright © 2023 Sedorko, de Barros, Netto, Ghilardi, Agostinho, Ramos, Neto, Moreira Junior and Borghi. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY)
distribution or reproduction in other forums is permitted
provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited
in accordance with accepted academic practice
distribution or reproduction is permitted which does not comply with these terms
*Correspondence: Daniel Sedorko, c2Vkb3Jrb0Btbi51ZnJqLmJy
Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations
Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher
94% of researchers rate our articles as excellent or goodLearn more about the work of our research integrity team to safeguard the quality of each article we publish
Metrics details
Deltas are dynamic and productive systems of enormous ecological significance
encompassing unique and biologically diverse wetland habitats
we present the first data on the molecular diversity of the fish fauna of the Parnaíba Delta
the largest deltaic formation of the Americas
Partial sequences (626 bp) of the mitochondrial COI gene (Cytochrome c oxidase subunit I) were used to barcode 402 individuals
The most abundant orders were the Perciformes
and BIN analyses produced 103 molecular clusters
while the Automatic Barcode Gap Discovery (ABGD) and Maximum Likelihood (ML) approaches revealed 102 clusters
congeneric and confamilial genetic distances were 0.33%
Intraspecific divergence ranged from 0.0% to 1.4%
with the exception of two clusters of Cathorops spixii (OTU 96 and OTU 103)
which were separated by a low interspecific distance (1.2%)
which overlaps the maximum intraspecific genetic distance (1.4%)
The barcode data provide new insights into the fish diversity of the Parnaíba Delta
which will be important for the development of further research on this fauna
the composition of the fish fauna of the Parnaíba Delta was diagnosed by DNA Barcoding
providing new insights into the local fish diversity in this important coastal complex
while also expanding the global barcoding database
with five of these species being identified only to the genus level (Pomadasys sp.
Even though they were identified by both morphological and barcoding analyses
and Gymnura sp.) were assigned only to genus because they lack comparable sequences in the BOLD system
The most abundant orders were the Perciformes (43.8%)
All other orders contributed less than 3.9% of the total abundance
The Sciaenidae was the most diverse family
is classified as vulnerable by the IUCN (International Union for Conservation of Nature)
and two others (Lutjanus analis and Lutjanus synagris) are classified as near-threatened (1.8% of the total)
while the vast majority (76.4%) are least concern
although 15.5% of the species have yet to be evaluated
while Mugil curema is widely distributed in the Atlantic and eastern Pacific oceans
Neighbor-Joining tree based on the fish COI barcodes obtained from the Parnaíba Delta
The values at the nodes are the bootstrap values
Barcoding gap: Maximum intraspecific Kimura 2-parameter (K2P) distances compared with the minimum interspecific K2P distances recorded in fish from the Parnaíba Delta
The graphs show the overlap of the maximum and mean intra-specific distances with the inter-specific (NN = nearest neighbor) distances
The NJ topology indicated a lack of monophyly in eight families (Eleotridae, Gobiidae, Sciaenidae, Gerreidae, Carangidae, Ariidae, Loricariidae, and Paralichthyidae). The ML and BI topologies nevertheless recovered monophyletic clusters for all families represented by more than a single genus, except the Gobiidae in the Bayesian Inference (Fig. S2)
This study of the ichthyofauna of the Parnaíba Delta is the first to compile the data in a sequence library
which contributes to the Fish Barcode of Life (FISH-BOL) in the Barcode of Life Data (BOLD) Systems
Relationships among the species are shown in the topology of the NJ tree
in which each terminal node represents an OTU
The BIN analysis found a maximum intraspecific distance of 1.40%
while the minimum interspecific distance was 1.22%
recorded between Cathorops spixii (OTU 96) and Cathorops spixii (OTU 103)
There is thus no absolute gap between the maximum intraspecific distance and the minimum interspecific distance if C
spixii is considered to be two distinct clusters
mean genetic distances between congeners are three and a half times greater than those between individuals of the same species when C
given that the next largest interspecific distance is 4.9%
which indicates the COI was reliable for the precise delimitation of the species of the Parnaíba Delta
in particular for the groups that are difficult to diagnose due to their considerable morphological similarities
and these findings were attributed to a possible recent process of sympatric speciation
a similar situation may account for the closely-related C
spixii clusters identified in the BIN analysis
although this can only be confirmed through a more detailed analysis of the population-level differentiation between the two clusters
which is widely distributed in the river systems of the Amazon
Such initiatives are important mainly because these fish (tarpon and snapper) are targeted by commercial fisheries
and many other species are being overfished
The findings of the present study thus represent an important first step toward the implementation of effective measures for the conservation and sustainable use of the region’s biodiversity and aquatic resources
Study area, the Parnaíba Delta, in northeastern Brazil. The yellow dots indicate the fish sampling sites. Landscapes: (A) Aquatic macrophytes in Araioses, (B) Barra Grande, (C) Grass banking in Araioses, (D) Confluence with the Iguaraçú River, and (E) Channels near Canárias Islands. Map created using QGIS 3.4.0 (Geographic Information System. Open Source Geospatial Foundation) software (https://qgis.org/en/site/)
The DNA was extracted using a Wizard Genomic DNA Purification Kit (Promega Corporation
A 626 bp fragment of the mitochondrial COI gene region was amplified using the primers COI 5′ TCAACCAACCACAAAGACATTGGCAC 3′ and COI 5′ TAGACTTCTGGGTGGCCAAAGAATCA 3′
The samples were amplified in a final volume of 25 μL
and purified water to complete the final reaction volume
The Polymerase Chain Reactions (PCRs) were run in a thermocycler (Applied Biosystems) under the following thermal protocol: initial denaturation at 93 °C for 3 min; 35 cycles of denaturation at 94 °C for 30 s
All positive reactions were sequenced in an ABI 3500 automatic sequencer (Applied Biosystems)
and was based on the K2P distance matrix in the MEGA format
which has an X value (relative gap width) of 1.2
The maximum intraspecific divergence was plotted against the minimum interspecific divergence
Climate change: protect the world’s deltas
Liangqing, X. & Galloway, W. Fan-Delta, Braid Delta and the Classification of Delta Systems. Acta. Geol. Sin-Engl. 4(4), 387–400, https://doi.org/10.1111/j.1755-6724.1991.mp4004004.x (1991)
Morphodynamics of deltas under the influence of humans
Ichthyofauna of coastal lakes and the Igaraçu River in Ilha Grande
Szczygielski, A. et al. Evolution of the Parnaíba Delta (NE Brazil) during the late Holocene. Geo-Mar. Lett. 35(2), 105–117, https://doi.org/10.1007/s00367-014-0395-x (2015)
Classificação climática e regionalização do semi-árido do Estado do Piauí sob cenários pluviométricos distintos
Silva, A. G. A., Stattegger, K., Schwarzer, K., Vital, H. & Heise, B. The Influence of Climatic Variations on River Delta Hydrodynamics and Morphodynamics in the Parnaíba Delta, Brazil. J. Coast. Res. 31(4), 930–940, https://doi.org/10.2112/JCOASTRES-D-14-00078.1 (2014)
Fish Fauna of the lower course of the Parnaíba river
Ictiofauna das águas estuarinas do rio Parnaíba (Brasil)
Ramos, T. P. A., Ramos, R. T. da. C. & Ramos, S. A. Q. Ichthyofauna of the Parnaíba river basin, northeastern Brazil. Biota Neotrop. 14(1), https://doi.org/10.1590/S1676-06020140039 (2014)
Peixes Comerciais in Guia ilustrado: Biodiversidade do litoral do Piauí (eds Mai
padrões de distribuição e conservação dos peixes da Caatinga
Ictiofauna das ecorregiões de água doce e marinhas do nordeste brasileiro
Boletim Sociedade Brasileira de Ictiologia
Betancur-R, R. et al. The Tree of Life and a New Classification of Bony Fishes. PLoS Currents. 5, https://doi.org/10.1371/currents.tol.53ba26640df0ccaee75bb165c8c26288 (2013)
Hou, G., Chen, W.-T., Lu, H.-S., Cheng, F. & Xie, S.-G. Developing a DNA barcode library for perciform fishes in the South China Sea: Species identification, accuracy and cryptic diversity. Mol. Ecol. 18(1), 137–146, https://doi.org/10.1111/1755-0998.12718. (2018)
Bert, T. M., Seyoum, S., Tringali, M. D. & McMillen-Jackson, A. Methodologies for conservation assessments of the genetic biodiversity of aquatic macro-organisms. Braz. J. Biol. 62(3), 387–408, https://doi.org/10.1590/S1519-69842002000300002 (2002)
Biological identifications through DNA barcodes
Valentini, A., Pompanon, F. & Taberlet, P. DNA barcoding for ecologists. Trends Ecol. Evolut. 24(2), 110–117, https://doi.org/10.1016/j.tree.2008.09.011. (2009)
MtDNA barcode identification of fish larvae in the southern Great Barrier Reef–Australia
DNA barcoding of Cuban freshwater fishes: evidence for cryptic species and taxonomic conflicts
Zhang, J. B. & Hanner, R. DNA barcoding is a useful tool for the identification of marine fishes from Japan. Biochem. Syst. Ecol. 39(1), 31–42, https://doi.org/10.1016/j.bse.2010.12.017 (2011)
Ribeiro, A. D. O. et al. DNA barcodes identify marine fishes of Sao Paulo State, Brazil. Mol. Ecol. Resours. 12(6), 1012–1020, https://doi.org/10.1111/1755-0998.12007 (2012)
DNA barcoding N eotropical fishes: recent advances from the P ampa P lain
Using DNA barcoding to assess Caribbean reef fish biodiversity: expanding taxonomic and geographic coverage
Mejía, O., León-Romero, Y. & Soto-Galera, E. DNA barcoding of the ichthyofauna of Pánuco–Tamesí complex: Evidence for taxonomic conflicts in some groups. Mitochondrial. DNA. 23(6), 471–476, https://doi.org/10.3109/19401736.2012.710207 (2012)
Barcoding Atlantic Canada’s commonly encountered marine fishes
Hebert, P. D. N., Penton, E. H., Burns, J. M., Janzen, D. H. & Hallwachs, W. Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proc. Natl. Acad. Sci. USA 101(41), 14812–14817, https://doi.org/10.1073/pnas.0406166101 (2004a)
Hebert, P. D. N., Stoeckle, M. Y., Zemlak, T. S. & Francis, C. M. Identification of birds through DNA barcodes. Plos Biology. 2(10), 1657–1663, https://doi.org/10.1371/journal.pbio.0020312 (2004b)
Ward, R. D., Zemlak, T. S., Innes, B. H., Last, P. R. & Hebert, P. D. DNA barcoding Australia’s fish species. Philos. Trans. R. Soc. Lond. B Biol. Sci. 360(1462), 1847–1857, https://doi.org/10.1098/rstb.2005.1716 (2005)
Morphological and molecular evidence for a new species of longnose skate (Rajiformes: Rajidae: Dipturus) from Argentinean waters based on DNA barcoding
Exploring the diversity of western Atlantic Bathygobius (Teleostei: Gobiidae) with cytochrome c oxidase-I
Amaral, C. R., Brito, P. M., Silva, D. A. & Carvalho, E. F. A new cryptic species of South American freshwater pufferfish of the genus Colomesus (Tetraodontidae) based on both morphology and DNA data. PLoS One. 8, e74397, https://doi.org/10.1371/journal.pone.0074397 (2013)
Bhattacharjee, M. J., Laskar, B. A., Dhar, B. & Ghosh, S. K. Identification and Re-Evaluation of Freshwater Catfishes through DNA Barcoding. PLoS One. 7(11), e49950, https://doi.org/10.1371/journal.pone.0049950 (2012)
Guimarães-Costa, A. et al. Molecular evidence of two new species of Eleotris (Gobiiformes: Eleotridae) in the western Atlantic. Mol. Phylogenetics. Evol. 98, 52–56, https://doi.org/10.1016/j.ympev.2016.01.014 (2016)
Guimarães-Costa, A. et al. Exploring the molecular diversity of Eleotridae (Gobiiformes) using mitochondrial DNA. J. Appl. Ichthyol. 33(3), 572–578, https://doi.org/10.1111/jai.13266 (2017)
The mud sleeper Butis koilomatodon (Pisces: Eleotridae): first record from the Western Central Atlantic
Geographic expansion of the invasive mud sleeper Butis koilomatodon (Perciformes: Eleotridae) in the western Atlantic Ocean
Lakra, W. S. et al. DNA barcoding Indian marine fishes. Mol. Ecol. Resour. 11(1), 60–71, https://doi.org/10.1111/j.1755-0998.2010.02894.x (2011)
Cryptic diversity in Indo-Pacific coral-reef fishes revealed by DNA-barcoding provides new support to the centre-of-overlap hypothesis
Molecular approach to the identification of fish in the South China Sea
Meyer, C. P. & Paulay, G. DNA barcoding: error rates based on comprehensive sampling. PLoS Biology. 3(12), e422, https://doi.org/10.1371/journal.pbio.0030422 (2005)
Puillandre, N., Lambert, A., Brouillet, S. & Achaz, G. ABGD, Automatic Barcode Gap Discovery for primary species delimitation. Mol. Ecol. 21(8), 1864–1877, https://doi.org/10.1111/j.1365-294X.2011.05239.x (2012)
Oliveira, J. N. et al. Molecular data indicate the presence of a novel species of Centropomus (Centropomidae – Perciformes) in the Western Atlantic. Mol. Phylogenetics. Evol. 77, 275–280, https://doi.org/10.1016/j.ympev.2014.04.019 (2014)
Status of Gobiosoma (Teleostei: Gobiidae) from Brazil: description of a new species
A realignment of marine biogeographic provinces with particular reference to fish distributions
Effects of reduced hydrological connectivity on the nursery use of shallow estuarine habitats within a river delta
Biodiversidade do Delta do Parnaíba: litoral piauiense
Conhecimento e conservação dos peixes marinhos e estuarinos (Chondrichthyes e Teleostei) da costa Norte do Brasil
The IUCN Red List of Threatened Species 2016: e.T194344A2317059
The IUCN Red List of Threatened Species 2016: e.T12416A506350
Zoneamento Ecológico-Econômico do Baixo Rio Parnaíba: Subsídios técnicos
BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT
MUSCLE: multiple sequence alignment with high accuracy and high throughput
A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences
Ratnasingham, S. & Hebert, P. D. A DNA-based registry for all animal species: the Barcode Index Number (BIN) system. PloS one. 8(7), e66213, https://doi.org/10.1371/journal.pone.0066213 (2013)
MrBayes 3: Bayesian phylogenetic inference under mixed models
RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models
PartitionFinder: combined selection of partitioning schemes and substitution models for phylogenetic analyses
Download references
passed away during the publication of this paper
is not with us to appreciate the results of his work
We would like to thank him for his dedication to teaching
and for the legacy he has left to Science and humanity
We would like to thank the Brazilian National Council for Scientific and Technological Development (CNPq) and the Coordination for Higher Education Personnel Training (CAPES) for financial support
We would like to thank also to ZMT for taking over the publication fees
was supported by the project Meros do Brasil
and a productivity grant from CNPq (# 310299/2016-0)
we are also grateful to the local fishermen of the Parnaíba Delta for their help with the collection of the fish specimens
Núcleo de Ecologia Aquática e Pesca da Amazônia
Design and conception of the experiments: T.G.
and U.S.P.; data collection and specimen processing: A.G.C.
and V.S.C.; production and review of the manuscript: A.G.C.
The authors declare no competing interests
Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations
Download citation
DOI: https://doi.org/10.1038/s41598-019-43930-z
Anyone you share the following link with will be able to read this content:
a shareable link is not currently available for this article
Sign up for the Nature Briefing newsletter — what matters in science
Hiking through dense vegetation in Brazil’s Parnaíba Delta
Flávia Miranda stops suddenly and plucks a wheat-colored ball of fur from the tangle of mangrove branches
the tennis ball–sized silky anteater raises its forepaws defensively like a boxer
a researcher in conservation medicine at the State University of Santa Cruz in Brazil
then releases the elusive animal back into the forest
Silky anteaters are the smallest anteaters and were the first to evolve
these fluffy little canopy dwellers inhabit low-altitude rainforests and mangroves from southern Mexico to northern Bolivia
When they’re not gorging on ants and termites
they spend much of their two-year life span sleeping
Until recently, scientists believed that all silky anteaters belonged to the same species. But in 2017, Miranda published an analysis of silky anteater DNA from across the Americas
“I always had this feeling that there was more than one species,” says Miranda
“I’d noticed differences in the fur color of populations in different regions.”
Miranda is investigating the possibility that the sleepy animal she sampled in the Parnaíba Delta
living thousands of kilometers from their nearest known kin in the Amazon Basin
and a swath of tropical rainforest to the southeast
may be a relic left over from 11,000 years ago
when the Amazon rainforest stretched to the Parnaíba Delta
Miranda’s genetic analysis indicates that the delta population has been diverging from other silky anteater species for roughly two million years
the DNA tests need to be corroborated with physical characteristics to confirm that the delta’s anteaters form a new species
That’s why Miranda and her field assistant Alexandre Martins are continuing to collect blood samples and take measurements of animals that they find in the mangroves
we’re certain that this population is evolutionarily distinct and in the process of becoming [a separate species],” she says
Scientists don’t know how many silky anteaters live in Brazil’s Parnaíba Delta
Densely vegetated mangroves make it difficult to count the elusive animals
who chairs the International Union for Conservation of Nature’s group of anteater experts
describes Miranda’s research as groundbreaking
“Silky anteaters are the most understudied of all the [sloths
The Parnaíba Delta’s dense mangroves make it almost impossible for Miranda and her colleagues to count how many delta anteaters there might be
it has become clear that the delta is not a safe refuge for anteaters
Local people harvest the mangroves for fencing
Farmers also let their cows and pigs range freely in the delta
where the livestock overgraze and trample young trees
Miranda began recruiting the community to reforest the mangroves
in a nursery for replanting in the delta and fenced these areas off from livestock
Although residents are mostly focused on protecting mangroves
their ongoing efforts are also benefitting the silky anteater and other wildlife
“Our community’s survival is threatened by climate change
the delta has sparked a bigger interest in yet-undiscovered silky anteaters
perhaps occupying the dry forests between the Parnaíba Delta and the distant rainforests
“I’ve got a feeling there are more ‘missing link’ populations,” she says
Part of the and family
We're sorry but the page you're looking for is not on our website
43,000+ global companies doing business in the region
news and interviews about your industry in English
On Sunday morning (10), about 300 women from the Terra Nossa encampment, organized by the Landless Workers’ Movement (MST, in Portuguese)
occupied an area controlled by the São Francisco and Parnaíba Valley Development Company (Codevasf
in Portuguese) in the rural area of Juazeiro
According to the movement, the occupation is a way to pressure the federal government and other authorities to regularize the situation of the encampment where families have been living
said the encampment has been without water for almost a year
The Terra Nossa encampment was installed in April last year and
according to the person Brasil de Fato talked with
while there is a 51 hectares private water reservoir in front of the encampment,” the person said regarding the Codevast area
The MST affirms that, since 2008, there has been an agreement signed between Codevasf, the National Institute for Colonization and Agrarian Reform (Incra
the federal government and the movement to settle 1,000 families
only 192 families were settled and not much more than 5,500 hectares of land were regularized
:: Women from the Landless Workers’ Movement hold a demonstration in front of Taurus arms company in São Paulo ::
“We are in Terra Nossa with more than 300 families without access to water to produce [food]
but we also want water to grow food,” said the leadership
“The production of healthy food is fundamental to satisfy the hunger of Brazil's population
our task here is to put this topic on the agenda
particularly the democratization of access to water
We will continue fighting for our bodies and territories,” the leader added
Brasil de Fato contacted Codevasf and Incra
Codevasf said "The water available in the Salitre Public Irrigation Project (Bahia state) is intended for farmers who are regularly installed in the project
Most of the producers served by the project are family farmers: 255 family producers and 68 business producers working on 5,100 hectares
The grant issued by the regulatory agency is specific to water use in the Salitre Project." Regarding the possible agreement signed in 2008 to settle the landless families
a dealer for Taurus and CBC arms and some cartridge companies
All original content produced and editorially authored by Brasil de Fato may be reproduced
provided it is not altered and proper credit is given
All original content produced and editorially authored by Brasil de Fato may be reproduced
O endereço abaixo não existe na globo.com