Our Standards: The Thomson Reuters Trust Principles., opens new tab , opens new tab Browse an unrivalled portfolio of real-time and historical market data and insights from worldwide sources and experts. , opens new tabScreen for heightened risk individual and entities globally to help uncover hidden risks in business relationships and human networks. © 2025 Reuters. All rights reserved Elizangela Dias Ferreira witnessed the changes at the Juscelino Kubitschek de Oliveira State School over the decades a resident of Paraiso do Tocantins in Brazil has a long-standing relationship with the Juscelino Kubitschek de Oliveira State School to accompanying her daughters in the classroom she has lived and witnessed the changes at the school over the decades The most significant change was a renovation that made teaching and learning more comfortable despite outdoor temperatures that sometimes reach 40ºC the environment was very basic and became unbearable on hot days," she says Many times teachers had to request the Department of Education to reduce class hours because no one could tolerate the heat after recess," recalls the teacher Indeed, rising temperatures negatively affect learning. According to the Choosing Our Future: Education for Climate Action report an average student in Brazil's poorest municipalities can lose up to half a year of learning overall due to rising temperatures JK students and teachers had to leave the school and occupy a rented building for the renovations to take place. The state government's Tocantins Integrated and Sustainable Regional Development Project (PDRIS) it was possible to demolish and rebuild the old classrooms to create new air-conditioned rooms All these facilities were ready in February 2021 In addition to making teaching and learning viable even on the hottest days the renovation allowed for expanded coverage the school serves 339 students from the 6th grade of primary school to the 2nd year of high school the JK school community encountered additional challenges "Children were the most affected in every way The students became more shy," says Elizangela Another challenge has been the intensification of climatic phenomena which has brought heavier rains to the region "There have been instances where the classrooms have flooded the school community at large shows gratitude there are private schools that do not have the structure that we see in JK which I was very afraid to do," says Joicy Machado owner of a digital marketing agency and mother of 11-year-old Laura passes through Tocantins and has heavy truck traffic a 6th grader at the Juscelino Kubitschek de Oliveira State School Teacher Nádia Bissoto in the new library of Conceição Brito State School "Most of the project's activities were related to roads and, around them, the vulnerability of children and adolescents was great. Investing in education was the way we found to reduce this problem," explains Mauricio Fregonesi manager of the PDRIS for the government of Tocantins The project recovered, expanded, and improved 10 educational institutions along the BR-153 highway. The renovated schools have become something of a beacon for the community such as the Conceição Brito State School in the city of Fátima Reopened in May 2022 after four years — renovation was halted for a year due to the pandemic — the school today has the capacity to serve 600 students and currently welcomes 398 students from the 6th year of primary to the 3rd year of secondary school The old school was made of concrete slabs with small windows Students ate lunch in the classroom because there was no cafeteria The new structure has 15 air-conditioned classrooms and an administrative block with space for teachers It makes them much more eager to learn," says teacher Nádia Bissoto Attracting and retaining these students required hard work when many left to help their families in the countryside but being in the new environment gave them all hope "The renovation brought our students to school I hear that some come because there is not even a fan in their homes," adds the teacher "Students and teachers need a welcoming and nurturing environment to realize their full potential especially after periods of pandemic or climate shocks," says Ildo Lautharte Senior Economist in the World Bank's Education Global Practice those at the Conceição Brito State School did not have the option of going to another building while the remodeling was being carried out we did all the logistics," recalls engineer Eliza Nunes Neta who described this job as one of the most challenging of her career then we released the students to study there The process required a great deal of dialogue and patience from the entire school community this project helped elevate the standards of state school construction overall "The fact that the work is monitored by the World Bank has led to improvements in the safety procedures of the contracted companies and in reducing the environmental impact," she notes STAY CURRENT WITH OUR LATEST DATA & INSIGHTS This site uses cookies to optimize functionality and give you the best possible experience. If you continue to navigate this website beyond this page, cookies will be placed on your browser. To learn more about cookies, click here SAO PAULO — A woman's body has been found after a bridge linking two northern states in Brazil collapsed Brazil's navy said on Friday that the body was found 3.7 miles from the Juscelino Kubitschek de Oliveira Bridge Another eight people remain unaccounted for Several cars and trucks plunged into the Tocantins River after a section of the bridge crumbled on Sunday Police operating on the border of the northern states of Maranhao and Tocantins said four trucks two cars and two motorcycles entered the river The 1,748-foot-long bridge between the cities of Estreito and Aguiarnopolis was built in the 1960s It is about 800 miles north of the capital Become an NPR sponsor Metrics details The field study aims to address identified research gaps by providing valuable information on the concentration and source apportionment of toxic and essential elements in sediment samples from four sampling sites (P1: Beira Rio (urban area) P4: Cidelândia (rural area) distributed along the middle Tocantins River Samples were collected in 2023 from river sections and analyzed using various contamination índices (geoaccumulation index Results indicated that the levels of aluminum and selenium exceeded legal standards in that year mainly in section P1 for aluminum and section P3 for nickel and lead The geoaccumulation index indicated low pollution levels with lead and nickel notably present near urban and industrial areas The enrichment factor highlighted elevated concentrations of lead and zinc in industrial areas Both PLI and SPI indices raise concerns regarding Pb (P4) and Zn (P3) concentrations at specific times of the year potential ecological risks were deemed low for most sites Continuous monitoring and interventions are crucial to preserve water and environmental quality in the region is a significant factor in degrading aquatic environments leading to the development of various monitoring and management methods Monitoring sediment quality is essential for assessing water pollution and it's imperative to share this information with the community and government to develop plans for safeguarding valuable freshwater resources Only through such measures can we effectively control and prevent damage to the balance of the aquatic ecosystem and the health of the population the Pollution Load Index (PLI) offers a comprehensive assessment of sediment quality regarding metal pollution aiding in categorizing pollution levels based on established criteria Spatial analyses of metal levels in sediments along with differentiation from natural backgrounds are essential and can help recognize the methods of accumulation and geochemical behavior of metals in aquatic ecosystems This is critical for residents who rely on untreated river water for recreational and domestic purposes and source apportionment of toxic and essential elements in sediment samples from sampling sites distributed along the middle Tocantins River contamination levels have been assessed using various indices such as the Geoaccumulation Index (Igeo) Potential Ecological Risk Coefficients (Er) The lack of studies and the environmental fragility of the middle Tocantins River highlight the urgent need for greater attention to environmental monitoring of this important water resource particularly urbanization and deforestation they lead to compromised water and sediment conditions posing risks to ecosystems and human health Geographic coordinates of sampling points in the middle Tocantins River It’s worth noting that the region faces several challenges intensive exploitation of fishery resources and direct disposal of waste and sewage into the water body all contributing to contamination of the river waters these activities lead to damage to the health of the Tocantins River ecosystem affecting both fauna and flora and negatively impacting the quality of life for the population relying on the river This site is potentially contaminated due to high vessel traffic P2 has a lower potential for contamination P3 is located upstream of a paper and cellulose manufacturing and processing industry while P4 is approximately 100 km downstream from the city downstream from the paper and cellulose industry The degree of inorganic contamination was monitored from January to December 2023 by collecting sediment samples from sections of the middle Tocantins River Sediment samples were systematically collected monthly with three replicates at each designated point These samples were carefully preserved in pre-cleaned plastic vials and maintained within a cold chain (refrigerated at 4 °C) until they reached the laboratory at the State University of the Tocantina Region of Maranhão (UEMASUL) Both the field collection and subsequent laboratory procedures followed ethical guidelines and were formally reviewed and approved by the Institutional Ethics Committee of the State University of the Tocantin Region of Maranhão (CEUA No: 1025220722) and the State University of Maranhão (CEUA No 040/2023) scientific activities were conducted with explicit authorization (SISBIO Number: 87310–1) by Normative Instruction No 748/2022 as outlined in the ICMBio Ordinance Samples of 500 g of surface sediments were collected with subsamples taken from the central part to avoid contamination the samples were dried in a drying oven at 70˚C (CienlaB) for three days or until a constant mass was obtained For the determination of total concentrations of elements in sediments a 0.5-g sample (dry weight) was taken and 1 mL of HCl (50%) and 8 mL of water were added; following the analytical methodology of the U.S Environmental Protection Agency (US EPA Method 3050B) The digestion was then accelerated in a digestion block (ECO 16 the sediment is categorized as experiencing no contamination to being moderately contaminated A range of 1–2 indicates a state of moderate contamination while 2–3 signifies a condition of moderate to heavy contamination The levels intensify as Igeo progresses: 3–4 suggests heavy contamination 4–5 indicates contamination from heavy to extremely contaminated and an Igeo equal to or greater than 5 denotes an extremely contaminated state The logarithm to the base 2 is utilized to express the concentration relationship more clearly It is important to note that understanding the nature of concentration values especially about background concentration levels is crucial for interpreting the index correctly This classification system offers a comprehensive understanding of the contamination degree in sediment samples thereby assisting in environmental assessments and the development of management strategies The EF serves as a valuable metric for understanding the extent to which elemental concentrations in a sample deviate from the natural background levels providing insights into potential anthropogenic influences and environmental impacts CM represents the concentration of the target element in the sample while CX denotes the concentration of the same element in the Earth's crust A value of EF greater than 1 indicates enrichment signifying an elevated concentration relative to the Earth’s crust suggesting a lower concentration compared to the typical Earth's crust EF is extensively employed in geochemistry and environmental studies to evaluate contamination or the anomalous presence of elements in a sample Its application provides valuable insights into potential anthropogenic influences and environmental implications The PLI indicates how many times the metal content in the sediment exceeds background levels (Soliman et al where n represents the number of metals studied interpreting the PLI involves comparing the calculated value with established limits or standards A PLI equal to 1 suggests that the area is within acceptable limits and is not significantly polluted Values above 1 indicate an increase in the pollution load a PLI < 1 indicates “Unpolluted,” PLI > 1 “Polluted,” and PLI > 5 “Very highly polluted” EFm represents the Enrichment Factor for each metal The SPI index is classified into five categories based on the classification by Soliman et al and > 20 (Dangerously polluted sediment) the potential ecological risk coefficient ($E_{r}^{i}$) for a specific metal and the overall potential ecological risk index (RI) induced by the combined impacts of the studied metals were evaluated using the following formulas: The ecological risk indices (RI) and potential ecological risks ($E_{r}^{p}$) were computed using pollution coefficients ($C_{f}^{i}$) and toxicity coefficients ($T_{r}^{i}$) (Okbah et al the ecological risk levels were categorized RI values ranging from 300 to 600 indicate considerable risk and values equal to or exceeding 600 represent significant risk while values between 40 and 80 indicate moderate risk Considerable risk is denoted by Epr values between 80 and 160 while high risk corresponds to values between 160 and 320 Epr values equal to or exceeding 320 indicate very high risk These categorizations enable a comprehensive assessment of ecological risk levels based on metal concentrations in sediment samples To evaluate significant differences in the average total concentration of essential and toxic elements across sampling stations or within the same station during different periods of 2023 it was essential to perform the Kolmogorov–Smirnov normality test and Levene’s test to assess variance homogeneity The Tukey test (p < 0.05) was also employed to compare means The data were analyzed using the statistical software SPSS version 22 To identify the association between potentially toxic and essential elements analyses statistical tools such as correlation matrix and principal component analysis (PCA) were explored on raw data using the free software PAST 4.03 (latest version 2020) emphasizing principal components explaining most variability and aiding interpretation of inter-variable relationships for a comprehensive sediment quality analysis Spatial distribution of potentially toxic elements in the sediments of the middle Tocantins River throughout 2023 Rainiest/coldest period (January to June) and the hot/dry season (July to December) (Koppen and Geiger A: Aluminium (Al); B: Chromium (Cr); C: Nickel (Ni); D: Lead (Pb) Values represent mean concentrations (mg/kg) of each metal Error bars indicate the standard deviation (SD) of the mean concentrations part of the rainiest and coldest period (January–July) recorded the highest values of elements in the water of the middle Tocantins River annual concentrations of Al exceeded both national and international water quality standards (P1: 0.69 mg/L,P2: 0.71 mg/L,P3: 0.63 mg/L; P4: 0.58 mg/L) Elevated levels of essential elements such as Cu and Se also raise significant concerns for environmental and health quality The same holds for essential elements,Cu and Zn surpassed the guidelines established by NOAA No statistical differences were observed in the average concentrations among the studied sections of the middle Tocantins River its safety level is established at 30 mg/kg for sediment quality guidelines (SGV) The same source mentions a safety level of 15 mg/kg for Fe It is crucial to underscore the lack of specific regulations for aluminum Continued monitoring is essential to assess the environmental and health implications of exceeding guidelines for other elements This situation is alarming and demands continuous monitoring Point P3 exhibited slightly elevated values for Cr (2.18 mg/kg) Assessment of anthropogenic pollution in sediments: Geoaccumulation Index For the Igeo, the samples of Al, Cr, and Cu consistently show only negative values, indicating a low level of pollution (Table 2) Ni and Pb stand out as the highest contaminants only Pb recorded a positive value for P3 (0.54); nevertheless it still falls within the range of no contamination to moderately contaminated considering the maximum values obtained for metal concentration in the Igeo equation both Ni and Pb recorded values higher than 1 for points P1 (1.50) suggesting a lower concentration compared to the typical Earth’s crust The mean values for the studied metals revealed a higher PLI for Ni (0.235) and Pb (0.184), both observed at P3 (Table 3) considering the observed maximum values obtained through ICPE analysis the PLI hierarchy is as follows: Pb (1.205 at P4) > Zn (1.041 at P3) > Ni (0.595 at P3) > Cr (0.282 at P3) > Cu (0.246 at P3) there is an escalation in pollution levels (PLI > 1 “Polluted” according to Soliman et al This emphasizes the importance of monitoring and implementing environmental management strategies to mitigate further contamination risks Each index specializes in investigating contamination emphasizing the need to tailor the choice based on the distinct goals of the assessment The overall PLI value was also higher for Pb when considering the maximum concentration of metals found Despite Al showing among the highest mean values likely due to its high reference value (a relatively abundant element in the Earth’s crust) the overall risk level for the middle Tocantins River remains classified as “Low-grade” in terms of potential ecological risk A coefficient closer to 1 or − 1 indicates a stronger correlation while values near 0 suggest a weaker or nonexistent linear relationship This enables researchers to effectively trace these pollutants and industries leading to the development of more efficient pollution management strategies and mitigation efforts Principal component analysis (PCA) of sediment quality monitoring data of the middle Tocantins River The PCA analysis unveiled three distinct groups based on sediment quality The first group comprised stations P1 (located in an urban area) and P3 (close to industrial waste discharge) P1 showed a positive association with the first and second components but a negative association with the third whereas P3 exhibited a positive association with the first and third components The second group solely included station P2 situated near the village of “Bananal” in a rural area which displayed a negative association with all PCA components The third group consisted solely of station P4 also located in rural areas but in proximity to industrial waste discharge (from pulp and paper production) P4 showed a positive association with both the second and third components but a negative association with the first This underscores the effectiveness of PCA in identifying pollution sources and providing valuable insights for conservation and management efforts freshwater ecosystems in this region play vital roles in biodiversity preservation Reforestation projects can help restore these areas enhancing their capacity to mitigate pollution and protect aquatic ecosystems Establishing a continuous monitoring system for pollution levels and rigorous enforcement to ensure adherence to environmental laws is crucial educational campaigns for local communities and industries on the impacts of pollution and the importance of sustainable practices can foster changes in behavior and selenium exceeded legal standards through 2023 Although aluminum showed the highest values among the potentially toxic elements there are no specific limits in national and international standards for this element and lead only surpassed the guidelines established by NOAA (National Oceanic and Atmospheric Administration) The seasonal fluctuation indicates a complex dynamic influenced by climatic or seasonal factors and May showed heightened levels of aluminum in urban área P1 had a higher presence of Al while Ni and Pb were more concentrated in P3 with lead and nickel standing out in urban areas (P1) and near the pulp and paper industry (P3 and P4) The EF highlights high concentrations of Pb (P4) and Zn (P3) The overall risk level for the middle Tocantins River remains classified as “Low-grade” concerning potential ecological risk These findings stress the importance of continuous monitoring and interventions to uphold water and environmental quality in the region The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request Guadie, A. et al. Effluent quality and reuse potential of urban wastewater treated with aerobic-anoxic system: A practical illustration for environmental contamination and human health risk assessment. J. Water Process Eng. 40, 101891. https://doi.org/10.1016/j.jwpe.2020.101891 (2021) Li, K. The application of reweighted markov chains in water-sediment prediction in inland river basins: A case study of the shiyang river basin. Sustain. Cities Soc. 73, 103061. https://doi.org/10.1016/j.scs.2021.103061 (2021) Liao, J. et al. Heavy metals in river surface sediments affected with multiple pollution sources, South China: Distribution, enrichment and source apportionment. J. Geochem. Explor. 176, 9–19. https://doi.org/10.1016/j.gexplo.2016.08.013 (2017) Peng, W., Li, X., Xiao, S. & Fan, W. Review of remediation technologies for sediments contaminated by heavy metals. J. Soils Sediments 18, 1701–1719. https://doi.org/10.1007/s11368-018-1921-7 (2018) Khaled, A., Abdel-Halim, A., El-Sherif, Z. & Mohamed, L. A. Health risk assessment of some heavy metals in water and sediment at Marsa-Matrouh, Mediterranean Sea, Egypt. J. Environ. Protect. 8(01), 74. https://doi.org/10.4236/jep.2017.81007 (2017) Niede, R. & Benbi, D. K. Integrated review of the nexus between toxic elements in the environment and human health. AIMS Public Health 9(4), 758. https://doi.org/10.3934/publichealth.2022052 (2022) Marengo, M. et al. Ecological and human health risk assessment of potentially toxic element contamination in waters of a former asbestos mine (Canari, Mediterranean Sea): Implications for management. Environ. Monitor. Assess. 195(1), 150. https://doi.org/10.1007/s10661-022-10737-x (2023) Padhye, L. P. et al. Contaminant containment for sustainable remediation of persistent contaminants in soil and groundwater. J. Hazard. Mater. https://doi.org/10.1016/j.jhazmat.2023.131575 (2023) Kanici Tarhane, A., Aluc, Y., Kiziltepe, S. & Ekici, H. An Investigation of heavy metal concentrations in the sera of cattle grazed in different locations in the Kars Province of Türkiye. Bull. Environ. Contam. Toxicol. 112(1), 1. https://doi.org/10.1007/s00128-023-03821-6 (2024) Haghnazar, H. et al. Potentially toxic elements contamination in surface sediment and indigenous aquatic macrophytes of the Bahmanshir River, Iran: Appraisal of phytoremediation capability. Chemosphere 285, 131446. https://doi.org/10.1016/j.chemosphere.2021.131446 (2021) Chiaia-Hernández, A. C. et al. Sediments: Sink, archive, and source of contaminants. Environ. Sci. Pollut. Res. 29(57), 85761–85765. https://doi.org/10.1007/s11356-022-24041-1 (2022) Soliman, N., Thabet, W. M., El-Sadaawy, M. M. & Morsy, F. A. Contamination status and potential risk of metals in marine sediments of Shalateen coast, the Red Sea. Soil Sediment Contam: Int. J. 31(1), 40–56. https://doi.org/10.1080/15320383.2021.1903832 (2022) Pelicice, F. M. et al. Large-scale degradation of the Tocantins-Araguaia River basin. Environ. Manag. 68, 445–452. https://doi.org/10.1007/s00267-021-01513-7 (2021) Serrão, E.A.O. Impactos das mudanças climáticas e do uso da terra na produção hidrelétrica na Amazônia Oriental. 2022. http://dspace.sti.ufcg.edu.br:8080/jspui/handle/riufcg/25111 Catálogo dos Peixes Comerciais do Baixo Rio Tocantins Análise das ações antrópicas na bacia hidrográfica do Riacho Bacuri no município de Imperatriz–MA Canadian Council of Ministers of the Environment (CCME). Canadian environmental quality guidelines, Winnipeg. 1999. https://ccme.ca/en/resources/sediment# NOAA (National Oceanic and Atmospheric Administration). Screening quick reference tables (SquiRTs). 1999. https://response.restoration.noaa.gov/sites/default/files/SQuiRTs.pdf USEPA. United States Environmental Protection Agency. Guidelines for Sediments. https://www.epa.gov/caddis-vol2/sediments Die Schwermetallbelastung der Sedimenten des Neckars und Seiner Nebenflu¨sse The geochemical evolution of the continental crust Chakravarty, M. & Patgiri, A. D. Metal pollution assessment in sediments of the Dikrong River, N.E. India. J. Human Ecol. 27(1), 63–67. https://doi.org/10.1080/09709274.2009.11906193 (2009) Fodoué, Y., Ismaila, A., Yannah, M., Wirmvem, M. J. & Mana, C. B. Heavy metal contamination and ecological risk assessment in soils of the pawara gold mining area, Eastern Cameroon. Earth 3(3), 907–924. https://doi.org/10.3390/earth3030053 (2022) Hu, B. et al. Application of portable XRF and VNIR sensors for rapid assessment of soil heavy metal pollution. PLoS ONE 12, e0172438. https://doi.org/10.1371/journal.pone.0172438 (2017) Turekian, K. K. & Wedepohl, K. H. Distribution of the elements in some major units of the earth’s crust. Geol. Soc. Am. Bull. 72(2), 175–192. https://doi.org/10.1130/0016-7606(1961)72[175:DOTEIS]2.0.CO;2 (1961) Loring, D. H. Normalization of heavy-metal data from estuarine and coastal sediments. ICES J. Mar. Sci. 48(1), 101–115. https://doi.org/10.1093/icesjms/48.1.101 (1991) Tomlinson, D. L., Wilson, J. G., Harris, C. R. & Jeffrey, D. W. Problems in assessment of heavy metals in estuaries and the formation of pollution index. Helgor. Mar. Res. 33(1), 1566–1575. https://doi.org/10.1007/BF02414780 (1980) Rubio, B., Nombela, M. A. & Vilas, F. J. M. P. B. Geochemistry of major and trace elements in sediments of the Ria de Vigo (NW Spain): An assessment of metal pollution. Mar. Pollut. Bull. 40(11), 968–980. https://doi.org/10.1016/S0025-326X(00)00039-4 (2000) Hakanson, L. An ecological risk index for aquatic pollution control. A sedimentological approach. Water Res. 14(8), 975–1001. https://doi.org/10.1016/0043-1354(80)90143-8 (1980) Calculation of heavy metals’ toxicity coefficient in the evaluation of potential ecological risk index Dash, S., Borah, S. S. & Kalamdhad, A. S. Heavy metal pollution and potential ecological risk assessment for surficial sediments of Deepor Beel, India. Ecol. Indic. 122, 107265. https://doi.org/10.1016/j.ecolind.2020.107265 (2021) Silva, C. P., Silveira, E. L., Santos, A. M. V. & Campos, S. X. Metal cross-contamination relationships between sediments and loricariidae species (siluriform) in a neotropical riverine system. Environ. Res. 258, 119412. https://doi.org/10.1016/j.envres.2024.119412 (2024) Priority Substance List Assessment Report for Aluminum Salts (Environment Canada and Health Canada Yan, J. et al. Effects of switching redox conditions on sediment phosphorus immobilization by calcium/aluminum composite capping: Performance, ecological safety and mechanisms. Chemosphere 343, 140294. https://doi.org/10.1016/j.chemosphere.2023.140294 (2023) Health risk assessment of workers exposed to metals from an aluminium production plant Liaquat, L., Batool, Z. & Haider, S. Developmental toxicity of aluminium and other metals: Areas unexplored. Biochem. Mech. Alum. Induced Neurol. Disord. https://doi.org/10.2174/9781681088839121010008 (2021) Ungureanu, E. L., & Mustatea, G. Toxicity of heavy metals. in Environmental Impact and Remediation of Heavy Metals. (IntechOpen, 2022). https://doi.org/10.5772/intechopen.102441 Human exposure to heavy metals: Toxicity mechanisms and health implications Fuentes-Gandara, F., Pinedo-Hernandez, J., Marrugo-Negrete, J. & Diez, S. Human health impacts of exposure to metals through extreme consumption of fish from Colombian Caribbean Sea. Environ. Geochem. Health 40, 229–242. https://doi.org/10.1007/s10653-016-9896-z (2016) Balali-Mood, M. et al. Toxic mechanisms of five heavy metals: Mercury, lead, chromium, cadmium, and arsenic. Front. Pharmacol. https://doi.org/10.3389/fphar.2021.643972 (2021) Kimijima, S., Sakakibara, M., Pateda, S. M. & Sera, K. Contamination level in geo-accumulation index of river sediments at artisanal and small-scale gold mining area in Gorontalo Province, Indonesia. Int. J. Environ. Res. Public Health 19, 6094. https://doi.org/10.3390/ijerph19106094 (2022) Senoro, D. B. et al. Quantitative assessment and spatial analysis of metals and metalloids in soil using the geo-accumulation index in the capital town of Romblon Province, Philippines. Toxics 10(11), 633. https://doi.org/10.3390/toxics10110633 (2022) Karkain, R. M., Karkain, S. M. & Sadeq, M. A. Assessment of heavy metal contamination in the sediments and soils in the City of Dubai based on the geoaccumulation index. Emirati J. Civil Eng. Appl. 2(1), 78–84. https://doi.org/10.54878/fk289z29 (2024) Haris, H. et al. Geo-accumulation index and contamination factors of heavy metals (Zn and Pb) in urban river sediment. Environ. Geochem. Health 39, 1259–1271. https://doi.org/10.1007/s10653-017-9971-0 (2017) Ahirvar, B. P., Das, P., Srivastava, V. & Kumar, M. Perspectives of heavy metal pollution indices for soil, sediment, and water pollution evaluation: An insight. Total Environ. Res. Themes 6, 100039. https://doi.org/10.1016/j.totert.2023.100039 (2023) Al Hejami, A., Davis, M., Prete, D., Lu, J. & Wang, S. Heavy metals in indoor settled dusts in Toronto, Canada. Sci. Total Environ. 703, 134895. https://doi.org/10.1016/j.scitotenv.2019.134895 (2020) Huang, C. C. et al. A comprehensive exploration on the health risk quantification assessment of soil potentially toxic elements from different sources around large-scale smelting area. Environ. Monitor. Assess. 194(3), 206. https://doi.org/10.1007/s10661-022-09804-0 (2022) Kowalska, J. B., Mazurek, R., Gasiorek, M. & Zaleski, T. Pollution indices as useful tools for the comprehensive evaluation of the degree of soil contamination: A review. Environ. Geochem. Health https://doi.org/10.1007/s10653-018-0106-z (2018) Pejman, A., Bidhendi, G. N., Ardestani, M., Saeedi, M. & Baghvand, A. A new index for assessing heavy metals contamination in sediments: A case study. Ecol. Indic. 58, 365–373. https://doi.org/10.1016/j.ecolind.2015.06.012 (2015) Yang, T. et al. Comprehensive ecological risk assessment for semi-arid basin based on conceptual model of risk response and improved TOPSIS model-a case study of Wei River Basin, China. Sci. Total Environ. 719, 137502. https://doi.org/10.1016/j.scitotenv.2020.137502 (2020) Badawy, W. et al. Characterization of major and trace elements in coastal sediments along the Egyptian Mediterranean Sea. Mar. Pollut. Bull. 177, 113526. https://doi.org/10.1016/j.marpolbul.2022.113526 (2022) Zhang, J. et al. Assessment of heavy metal pollution and water quality characteristics of the reservoir control reaches in the middle Han River, China. Sci. Total Environ. 799, 149472. https://doi.org/10.1016/j.scitotenv.2021.149472 (2021) Mahler, B. J. et al. Biofilms provide new insight into pesticide occurrence in streams and links to aquatic ecological communities. Environ. Sci. Technol. 54(9), 5509–5519. https://doi.org/10.1021/acs.est.9b07430 (2020) Xiang, M. et al. Heavy metal contamination risk assessment and correlation analysis of heavy metal contents in soil and crops. Environ. Pollut. 278, 116911. https://doi.org/10.1016/j.envpol.2021.116911 (2021) Geng, M. et al. Assessing the impact of water-sediment factors on water quality to guide river-connected lake water environment improvement. Sci. Total Environ. 912, 168866. https://doi.org/10.1016/j.scitotenv.2023.168866 (2024) Olomukoro, J. O. & Enabulele, C. O. Assessment of heavy metal contamination and sediment characteristics in Ozomu lake, southern Nigeria: Implications for environmental health. Kuwait J. Sci. 51(2), 100192. https://doi.org/10.1016/j.kjs.2024.100192 (2024) Vezzone, M. et al. Metal pollution in surface sediments from Rodrigo de Freitas Lagoon (Rio de Janeiro, Brazil): Toxic effects on marine organisms. Environ. Pollut. 252, 270–280. https://doi.org/10.1016/j.envpol.2019.05.094 (2019) Vitkauskaitė, A. & Salytė, M. Air quality investigation using functional data analysis methods Lietuvos matematikos rinkinys Lietuvos matematikų draugijos darbai. Ser. B 64, 36–53. https://doi.org/10.15388/LMR.2023.33658 (2023) Wu, H. et al. Health risk assessment based on source identification of heavy metals: A case study of Beiyun River, China. Ecotoxicol. Environm. Saf. 213, 112046. https://doi.org/10.1016/j.ecoenv.2021.112046 (2021) Untreated wastewater reasons and causes: A review of most affected areas and cities Wear, S. L., Acuña, V., McDonald, R. & Font, C. Sewage pollution, declining ecosystem health, and cross-sector collaboration. Biolog. Conserv. 255, 109010. https://doi.org/10.1016/j.biocon.2021.109010 (2021) Akhtar, N., Syakir Ishak, M. I., Bhawani, S. A. & Umar, K. Various natural and anthropogenic factors responsible for water quality degradation: A review. Water 13(19), 2660. https://doi.org/10.3390/w13192660 (2021) Swanson, A. C., Kaplan, D., Toh, K. B., Marques, E. E. & Bohlman, S. A. Changes in floodplain hydrology following serial damming of the Tocantins River in the eastern Amazon. Sci. Total Environ. 800, 149494. https://doi.org/10.1016/j.scitotenv.2021.149494 (2021) Polizel, S. P. et al. Analysing the dynamics of land use in the context of current conservation policies and land tenure in the Cerrado: MATOPIBA region (Brazil). Land Use Policy 109, 105713. https://doi.org/10.1016/j.landusepol.2021.105713 (2021) Camargo, F. A. O. et al. Brazilian agriculture in perspective: great expectations versus reality. Adv. Agron. 141, 53–114. https://doi.org/10.1016/bs.agron.2016.10.003 (2017) Escobar, N. et al. Spatially-explicit footprints of agricultural commodities: Mapping carbon emissions embodied in Brazil’s soy exports. Glob. Environ. Change 62, 102067. https://doi.org/10.1016/j.gloenvcha.2020.102067 (2020) Melo, M. P. D. et al. Effects of local land use on riparian vegetation, water quality, and in situ toxicity. Rev. Ambient. Água 17, e2856. https://doi.org/10.4136/ambi-agua.2856 (2022) Qasem, N. A., Mohammed, R. H. & Lawal, D. U. Removal of heavy metal ions from wastewater: A comprehensive and critical review. Npj Clean Water 4(1), 1–15. https://doi.org/10.1038/s41545-021-00127-0 (2021) Saleh, T. A., Mustaqeem, M. & Khaled, M. Water treatment technologies in removing heavy metal ions from wastewater: A review. Environ. Nanotechnol. Monitor. Manag. 17, 100617. https://doi.org/10.1016/j.enmm.2021.100617 (2022) Dhenkula, S. P., Shende, A. D., Deshpande, L. & Pophali, G. R. An Overview of Heavy metals treatment & management for laboratory waste liquid (LWL). J. Environ. Chem. Eng. https://doi.org/10.1002/cben.201600010 (2024) Singh, V. et al. Toxic heavy metal ions contamination in water and their sustainable reduction by eco-friendly methods: Isotherms, thermodynamics and kinetics study. Sci. Rep. 14(1), 7595. https://doi.org/10.1038/s41598-024-58061-3 (2024) Deng, J. et al. Wide riparian zones inhibited trace element loss in mining wastelands by reducing surface runoff and trace elements in sediment. Toxics 12(4), 279. https://doi.org/10.3390/toxics12040279 (2024) Pandey, S., Kumari, T., Verma, P., Singh, R. & Raghubanshi, A. S. Impact of anthropogenic stresses on riparian ecosystem and their management perspectives. Ecol. Signif. River Ecosyst. https://doi.org/10.1016/B978-0-323-85045-2.00004-2 (2022) Awewomom, J. et al. Addressing global environmental pollution using environmental control techniques: A focus on environmental policy and preventive environmental management. Discov. Environ. 2(1), 8. https://doi.org/10.1007/s44274-024-00033-5 (2024) Guevara-Herrero, I., Bravo-Torija, B. & Pérez-Martín, J. M. Educational practice in education for environmental justice: A systematic review of the literature. Sustainability 16(7), 2805. https://doi.org/10.3390/su16072805 (2024) Li, S., Sun, H., Sharif, A., Bashir, M. & Bashir, M. F. Economic complexity, natural resource abundance and education: Implications for sustainable development in BRICST economies. Resour. Policy 89, 104572. https://doi.org/10.1016/j.resourpol.2023.104572 (2024) Download references We express our heartfelt gratitude to CNPq (403097/2022-3) and FAPEMA (193956/2022) for their invaluable support laying the foundation for our scientific research Postgraduate in Animal Science (PPGCA/UEMA) Multi-User Laboratories in Postgraduate Research (LAMP) Thiago Machado da Silva Acioly & Diego Carvalho Viana Natural and Technological Sciences (CCENT) State University of the Tocantina Region of Maranhão (UEMASUL) Animal Ecology and Biodiversity Laboratory (LEBA) Center for Advanced Morphophysiological Studies (NEMO) and editing; M.F.S.—visualization and methodology; J.I.—methodology The authors declare no competing interests Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations Download citation DOI: https://doi.org/10.1038/s41598-024-66570-4 Anyone you share the following link with will be able to read this content: Sorry, a shareable link is not currently available for this article. Sign up for the Nature Briefing: Anthropocene newsletter — what matters in anthropocene research, free to your inbox weekly. “Aquaculture in the Amazon can bring food security and improve people’s lives at the same time, providing a less uncertain source of income than other activities such as fishing. However, policies for the sector need to target small, medium and large producers alike,” concludes Pacheco. The page you're looking for does not exist... You don't have permission to access the page you requested. What is this page?The website you are visiting is protected.For security reasons this page cannot be displayed. Volume 9 - 2021 | https://doi.org/10.3389/fenvs.2021.662904 This article is part of the Research TopicRiverine Biogeochemistry Under Increasing Damming: Processes and ImpactsView all 6 articles Riparian vegetation performs important ecosystems services and maintaining regional plant and animal biodiversity Regular annual flooding maintains riparian forests through an intermediate disturbance regime seasonally flooded vegetation has developed adaptations for seed dispersal and gas transfer to survive and reproduce while undergoing periods of flooding a dam building boom threatens the integrity of riparian vegetation by moving riparian corridors into dry-adapted ecosystems and reducing downstream flooding of riparian areas the region is undergoing intense development pressure resulting in the conversion of native riparian vegetation into agriculture we measure how the installation of six large dams on the Tocantins River coupled with land cover change from native forest and savanna to cattle pasture has changed the land–water interface of this region Using land cover data provided by MapBiomas we quantified land cover change from 1985 to 2018 and measured changes in the riparian areas of the still free-flowing areas of the Tocantins River We found that deforestation in the riparian areas of the Tocantins River downstream of the dams is occurring at a higher rate than deforestation in the watershed reservoir filling resulted in creating hundreds of square kilometers of new riparian areas pushing the riparian zone away from forest-dominated ecosystems into savanna-dominated areas The quantity of in-stream vegetation throughout the study was dynamic and initially increased after damming before declining for the last decade of the study Changes to native land cover in riparian areas of the Tocantins River threaten the integrity of ecosystem services provided by riparian vegetation and are likely to lead to further degradation of these areas These riparian forest changes may be heightened by two additional factors: cumulative impacts of multiple dams on the same river and concurrent land use changes as regions with dams undergo economic development installation of additional dams is likely to lead to cumulative impacts on rivers both locally and at the scale of whole river basins Accounting for alterations to riparian areas beyond deforestation resulting from reservoir creation is important for mitigating impacts of dams to riparian ecosystems and restoring productive riparian zones Our objectives were to quantify land cover change and deforestation in (1) lotic (free-flowing portions of the river downstream of dams) and (2) lentic (areas that are now reservoirs after damming) portions of the river and to compare land cover change in these two zones to land conversion (3) from reservoir creation and (4) across the Tocantins landscape combining riparian areas fronting lotic and lentic environments Our final objective was to (5) measure changes in alluvial (in-stream) vegetation within the lotic portions of the river before and after damming The outcome of this study will help us understand how land cover is changing within the riparian zone of the Tocantins River and how these changes are different for riparian areas along lotic and lentic habitats Map of the Tocantins River watershed from the headwaters in Goiás to the confluence with the Araguaia River in Maranhão The green area in the inset map of Brazil indicates the Legal Amazon Inset images show examples of riparian vegetation and Cerrado (savanna) on or near the Tocantins River To understand how land cover changes may be different in different portions of this highly dammed system, we divided the land–water interface of the main channel of the Tocantins River into three separate regions: (1) the lotic zone, defined as portions of the river between the current reservoirs; (2) the lentic zone, defined as portions of the river that became a reservoir; and (3) the alluvial zone, defined as areas within the river channel (Figure 2) We examined land cover change in these zones in three land cover types: forest We selected pasture to represent agriculture because it was the dominant agricultural type in our dataset accounting for approximately 99% of agricultural land in the region To compare land cover change in the riparian area to areas away from the riparian zone in the lotic zone we measured land cover type and deforestation rates in three locations for: (1) a 500 m buffer defined as riparian area of permanent protection by the Brazilian forest code (2) a 500–1,000 m buffer beyond the riparian area of permanent protection and (3) the Tocantins River watershed through the confluence with the Araguaia we quantified forest loss in the 500 m riparian area of permanent protection We compared the land cover composition in the lentic zone before reservoir creation when the riparian area of permanent protection bordered a free-flowing river We quantified total areal coverage of forest and savanna lost to reservoir creation (where deforestation rates are near 100% due to inundation from the reservoir) and compared it to the amount of forest and savanna loss from other sources (shifting of the riparian zone after reservoir creation land cover change in the riparian area of the lotic zone) We quantified alluvial forest cover only in the portions of the river that were lotic for the entire study period Satellite imagery of the region surrounding the Cana Brava dam (installed 2002) near the city of Minaçu and (C) close-up of alluvial vegetation within the river (2020) The regions in the solid rectangles represent the lotic zones of the river—areas that remained free-flowing throughout the study The dashed rectangles represent the lentic zones of the river—areas that became dammed during the study The dotted rectangle shows the alluvial forest found within the lotic portion of the river We used shapefiles from Brazil’s Agência Nacional das Águas to define the boundaries of the lotic portions of the river and the reservoirs We digitized the pre-dam river within the reservoirs based on historic satellite imagery using Google Earth Pro we created a 500 m buffer around the different portions of the river We also created a 1,000 m buffer around the lotic river areas then subtracted the 500 m buffer from this region to get a 500–1,000 m buffer we removed the river or reservoir boundaries so that we were only measuring the vegetation where r is the rate of land cover change and t1 and t2 were the first and last year of the study A1 is the total area in the first year and A2 is the total area in the last year Over the 34-year study period, both savanna and forest in the riparian zone were converted to pasture at a nearly linear rate surrounding the lotic areas of the river that are currently free-flowing (Figure 3). In the 0–500 m buffer, forest declined at an annual rate of 0.85% while savanna declined by 0.96% annually. Pasture increased at an annual rate of 2.60% (Figure 3A) There was a total loss of 108.17 km2 of forest and 69.31 km2 of savanna during the study period Savanna was initially the dominant land cover in this region The watershed as a whole (excluding the 500 m riparian buffer; Figure 1) was dominated by savanna throughout the study (Supplementary Figure 1) savanna and pasture were almost co-dominant with savanna covering 35% of the watershed and pasture covering 30% Annual deforestation rates of both forest (0.68%) and savanna (0.78%) were lower in the watershed than in the riparian buffer while pasture also grew at a lower rate (1.70%) in the watershed than in the riparian zone The creation of reservoirs resulted in expanding the area considered riparian zone in this region (Figure 4) All reservoirs had at least double the riparian area that previously bordered the stretch of free-flowing river lost to the reservoir The Serra da Mesa reservoir created 735.10 km2 of new riparian area growing from 38.56 km2 before the dam to 91.07 km2 after the dam Total area of the riparian buffer (0–500 m) in the stretches of river that are currently dammed pre-dam (green; when the river was free-flowing) and post-dam (beige; where the river is now a reservoir) Dams are ordered by position on the river from upstream to downstream (left to right) That amount dropped to only 16.8% after the reservoir was installed all riparian areas bordering reservoirs had a greater savanna cover than the riparian areas surrounding the corresponding free-flowing river savanna became the dominant vegetation in the riparian zone surrounding all the reservoirs after damming except for the Cana Brava reservoir riparian zone which was still dominated by forest (46.8% forest which was not dominated by forest in either period the proportion of forest dropped after the reservoir was opened (37.2% dropping to 15.4%) For the Lajeado and Serra da Mesa reservoirs pasture cover in the riparian zone increased immediately after damming pasture increased from 9.8% before the dam to 35.1% after the dam pasture increased from 11.7% before damming to 25.4% immediately after damming and pasture in the 0-500 m riparian buffers surrounding the lentic portions of the river The dashed line indicates when each dam opened Lines to the left of the dashed lined indicate the buffer surrounding the pre-dam free-flowing river and those to the right of the dashed line indicate the buffer surrounding the post-dam lentic reservoir Dams are ordered by position on the river from upstream to downstream (left to right had the lowest percent loss of riparian forest (31%) The other five reservoirs had a higher proportion of forest loss within the riparian zone the percent of savanna lost that was in the riparian buffer was lower than the percent of forest lost within the riparian buffer more than half of the savanna lost to reservoir creation occurred in the riparian area and pasture cover after the filling of each reservoir The hatched area represents riparian forest in the 0–500 m buffer around the river before damming Numbers are the percent of deforested area accounted for by the riparian buffer for each land cover class The total amount of deforestation from reservoir creation which is almost always the only land cover change accounted for in environmental impact statements reservoir filling moved riparian environments creating a total of 2,176.67 km2 new riparian habitat an area 112% the size of all the vegetated reservoir area across the landscape another 926.36 km2 of riparian forest in lotic areas downstream of dams will most likely be impacted by hydrologic changes from dam operations (A) Total area (km2) and (B) percent cover of forest and pasture in the 0–500 m buffer surrounding the combined lotic and lentic areas of the Tocantins River Dashed lines indicate the year a dam opened (in order: Serra da Mesa Proportion of riparian vegetation fronting lotic versus lentic environments over the landscape Dashed lines indicate the year each dam opened (in order: Serra da Mesa Over the study period, alluvial forest decreased by 2.35 km2, less than 1% of the total area of the lotic river channel (Figure 9) forest cover increased by an average of 2.88 km2 This coincides with the filling of the first reservoir alluvial forest declined steadily from 2007 until 2014 Alluvial forest during the study period ranged from 7.03 to 8.24% of the total river area Area of forest cover within the river channel over the study period (1985–2018) Despite mandates to protect and restore riparian areas these areas continue to be degraded and deforested further changing the composition of riparian vegetation in the region riparian areas downstream of the dams in the Tocantins River may come to be dominated by savanna species and experience decline of forest due to decreases in seed dispersal and seedling establishment This could further increase susceptibility to fire within riparian areas Disruptions to income streams and food production may lead to increased deforestation in riparian regions to convert these areas to more profitable cattle pasture or for sale of hardwood The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: https://zenodo.org/record/4620082 and funding acquisition for this manuscript Both authors contributed to the article and approved the submitted version This research was funded in part by the Future Investigators in NASA Earth and Space Science and Technology award number 80NSSC19K1355 ACS was also funded by the University of Florida Informatics Institute and University of Florida Water Institute Graduate Fellowship programs This research is partially based upon work supported by the National Science Foundation (NSF) under Grant No and conclusions or recommendations expressed in this article are those of the authors and do not necessarily reflect NSF views The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest We would like to thank the 2015 Water Institute Graduate Fellowship cohort as well as members of the Amazon Dams International Research Network for inspiring the questions behind this study We also thank the reviewers whose suggestions improved this manuscript The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fenvs.2021.662904/full#supplementary-material Supplementary Figure 1 | Changes in composition of forest excluding the 0-500 m riparian buffer surrounding the Tocantins River and all reservoirs Impacts of the hydroelectric power generation over the fish fauna of the Tocantins River CrossRef Full Text | Google Scholar Changes in soil organic matter composition after introduction of riparian vegetation on shores of hydroelectric reservoirs (Southeast of Brazil) Assessment of riparian vegetation sensitivity to river hydrology downstream of a major Texas dam CrossRef Full Text | Google Scholar High-quality seed dispersal by fruit-eating fishes in Amazonian floodplain habitats Relationships between forest cover and fish diversity in the Amazon river floodplain Trap-nesting Hymenoptera and their network with parasites in recovered riparian forests Brazil Tree mortality of a flood-adapted species in response of hydrographic changes caused by an Amazonian river dam Land cover changes in the Brazilian Cerrado and Caatinga biomes from 1990 to 2010 based on a systematic remote sensing sampling approach The Brazilian Forest Code and riparian preservation areas: spatiotemporal analysis and implications for hydrological ecosystem services Hydrological functions of tropical forests: not seeing the soil for the trees CrossRef Full Text | Google Scholar Intermediary disturbance increases tree diversity in riverine forest of southern Brazil CrossRef Full Text | Google Scholar Effects of changes in the riparian forest on the butterfly community (Insecta: Lepidoptera) in Cerrado areas Effects of dam-induced flow regime change on downstream river morphology and vegetation cover in the Hwang river CrossRef Full Text | Google Scholar Land-cover change dynamics and insights into ecosystem services in European stream riparian zones CrossRef Full Text | Google Scholar Landsat-based analysis of mega dam flooding impacts in the Amazon compared to associated environmental impact assessments: upper Madeira river example 2006–2015 Commander, C. (2013). The Influence of Dams on the Abundance of Arundo donax (Giant Reed) in Riparian Corridors. Available online at: http://dspace.calstate.edu/handle/10211.9/2335 (accessed October 23 Google Scholar Effects of large-scale changes in land cover on the discharge of the Tocantins river CrossRef Full Text | Google Scholar “New Brazilian forest code: changes and prospects,” in Proceedings of the 2015 Conference Milan (Milan: International Association of Agricultural Economists) CrossRef Full Text | Google Scholar Thirty years after Balbina dam: diversity and floristic composition of the downstream floodplain forest The negative influences of the new Brazilian forest code on the conservation of riparian forests Anatomical and morphological modifications in response to flooding by six Cerrado tree species Desenvolvimento Regional do Território do Estado do Tocantins: Implicações e Alternativas Cascavel: Universidade Estadual do Oeste do Paraná Google Scholar Adaptations of central Amazon tree species to prolonged flooding: root morphology and leaf longevity Influence of riparian vegetation and forest structure on the water quality of rural low-order streams in SE brazil Understanding impacts of dams on the small-scale fisheries of the Madeira river through the lens of the fisheries performance indicators Palm distribution patterns in the southwestern Brazilian Amazon: impact of a large hydroelectric dam Influence of experimental flooding on litter dynamics in a rio grande riparian forest CrossRef Full Text | Google Scholar Fernández Land-use coverage as an indicator of riparian quality CrossRef Full Text | Google Scholar Impacts of hydroelectric dams on alluvial riparian plant communities in eastern Brazilian Amazonian Fishers’ knowledge identifies environmental changes and fish abundance trends in impounded tropical rivers Ecosystem service state and trends at the regional to national level: a rapid assessment CrossRef Full Text | Google Scholar CrossRef Full Text | Google Scholar IBGE (2020). Tocantins. Available Online at: https://www.ibge.gov.br/cidades-e-estados/to/ (accessed October 7 Google Scholar Valley reshaping and damming induce water table rise and soil salinization on the Chinese loess plateau The changes proposed in the Brazilian Forest Code do not have scientific support Google Scholar Riparian habitat changes across the continental United States (1972-2003) and potential implications for sustaining ecosystem services The flood pulse concept in river-floodplain systems Google Scholar Amazonian Floodplain Forests: Ecophysiology CrossRef Full Text | Google Scholar Assessing riparian zone impacts on water and sediment movement: a new approach CrossRef Full Text | Google Scholar Seed dispersal in flood plain forests of Amazonia CrossRef Full Text | Google Scholar Vulnerability of the biota in riverine and seasonally flooded habitats to damming of Amazonian rivers Terras e Culturas: Aprendendo Com o Sistema Socioecológico do Tocantins CrossRef Full Text | Google Scholar Silent death: the new Brazilian Forest Code does not protect lizard assemblages in Cerrado riparian forests Google Scholar Hydropower and the future of Amazonian biodiversity CrossRef Full Text | Google Scholar Declining fisheries and increasing prices: the economic cost of tropical rivers impoundment Russian olive invasion into cottonwood forests along a regulated river in north-central Montana CrossRef Full Text | Google Scholar Response of black-water floodplain (igapó) forests to flood pulse regulation in a dammed Amazonian river Google Scholar Lobón-Cerviá The importance of forest cover for fish richness and abundance on the Amazon floodplain O gado que circulava: desafios da gestão participativa de unidades de conservação nos gerais do norte de Minas Google Scholar Riparian vegetation change in upstream and downstream reaches of three temperate rivers dammed for hydroelectric generation in British Columbia Environmental considerations in energy planning for the Amazon region: downstream effects of dams CrossRef Full Text | Google Scholar Biodiversity hotspots for conservation priorities The role of riparian corridors in maintaining regional biodiversity National Research Council (2002) CrossRef Full Text | Google Scholar Water quality functions of a 15-year-old riparian forest buffer system Alterations of riparian ecosystems caused by river regulation Google Scholar Ecological effects of river regulation on mammals and birds: a review CrossRef Full Text | Google Scholar Long-term responses of river-margin vegetation to water-level regulation Ecosystem services of a functionally diverse riparian zone in the Amazon–Cerrado agricultural frontier Uncertainties in assessing the extent and legal compliance status of riparian forests in the eastern Brazilian Amazon “Vegetation physiognomies and woody flora of the cerrado biome,” in The Cerrados of Brazil: Ecology and Natural History of a Neotropical Savanna Importance of riparian forest corridors for the ocelot in agricultural landscapes Diversity of adaptations to flooding in trees of Amazonian floodplains Google Scholar Central amazonian floodplain forests: tree adaptations in a pulsing system Google Scholar Struggle in the flood: tree responses to flooding stress in four tropical floodplain systems Flood tolerance in two tree species that inhabit both the Amazonian floodplain and the dry Cerrado savanna of Brazil Standardizing the calculation of the annual rate of deforestation CrossRef Full Text | Google Scholar R Core Team (2020). R: A Language and Environment for Statistical Computing. Available online at: https://www.r-project.org/ (accessed October 1 Google Scholar The Brazilian Cerrado vegetation and threats to its biodiversity CrossRef Full Text | Google Scholar Massive tree mortality from flood pulse disturbances in Amazonian floodplain forests: the collateral effects of hydropower production Flood-pulse disturbances as a threat for long-living Amazonian trees “Fitofisionomias do bioma Cerrado,” in Cerrado: Ambiente e Flora Google Scholar The interplay of sedimentation and carbon accretion in riparian forests CrossRef Full Text | Google Scholar Environmental impact assessment in Brazilian Amazonia: challenges and prospects to assess biodiversity Thirty years after Balbina Dam: diversity and floristic composition of the downstream floodplain forest Google Scholar Reconstructing three decades of land use and land cover changes in Brazilian biomes with landsat archive and earth engine Restoration of riparian vegetation in the south-western United States: importance of flow regimes and fluvial dynamism CrossRef Full Text | Google Scholar Importance of riparian forest buffers in conservation of stream biodiversity: responses to land uses by stream-associated salamanders across two southeastern temperate ecoregions Dam construction and ecological change in the riparian forest of the Hadejia-Jama’are floodplain doi: 10.1002/(SICI)1099-145X(199612)7:4<279::AID-LDR234<3.0.CO;2-L CrossRef Full Text | Google Scholar “Historical changes in western riparian ecosystems,” in Proceedings of the North American Wildlife and Natural Resources Conference (USA) Google Scholar Deforestation and conservation in major watersheds of the Brazilian Amazon Vegetation profiles in tropical forests from multibaseline interferometric synthetic aperture radar The buffer capacity of riparian vegetation to control water quality in anthropogenic catchments from a legally protected area: a critical view over the Brazilian new forest code “Diversidade fitofisionômica e o papel do fogo no bioma Cerrado,” in Efeitos do Regime de Fogo Sobre a Estrutura de Comunidades de Cerrado: Projeto Fogo community structure and dynamics of central Amazonian floodplain forests,” in Amazonian Floodplain Forests and aboveground wood biomass of a riparian forest of the lower Miranda River Recruitment and uccession of riparian vegetation in alluvial river regulated by upstream dams – focused on the Nakdong river downstream Andong and Imha dams “The effects of vegetation on stream bank erosion,” in Proceedings of the 2004 ASAE Annual Meeting (Ottawa ON: American Society of Agricultural and Biological Engineers) Google Scholar The assessment of the changes of biomass and riparian buffer width in the terminal reservoir under the impact of the south-to-north water diversion project in China Land cover change along tropical and subtropical riparian corridors within the Makalu Barun national park and conservation area Google Scholar Citation: Swanson AC and Bohlman S (2021) Cumulative Impacts of Land Cover Change and Dams on the Land–Water Interface of the Tocantins River Copyright © 2021 Swanson and Bohlman. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) distribution or reproduction in other forums is permitted provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited in accordance with accepted academic practice distribution or reproduction is permitted which does not comply with these terms *Correspondence: A. Christine Swanson, YS5jaHJpc3RpbmUuc3dhbnNvbkBnbWFpbC5jb20= Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher 94% of researchers rate our articles as excellent or goodLearn more about the work of our research integrity team to safeguard the quality of each article we publish André Seabra and his family at Água Benta Farm offers a glimpse into the contrasting approaches to cattle farming between André Seabra André was among the 486 local farmers who benefited from an artificial insemination program aimed at genetically improving the beef cattle stock This program was a component of the Integrated and Sustainable Regional Development Project of Tocantins (PDRIS) funded by the World Bank and implemented by the state government This gave André access to cutting-edge technologies that were beyond his grandparents' wildest dreams in their youth PDRIS allocated R$ 5 million (US$921,000) across 92 municipalities resulting in the insemination of 87,000 female cattle In exchange for the semen doses they received farmers were required to hire a veterinarian to oversee the insemination process and to enhance the overall quality of the stock with over four decades of experience in cattle farming "I've never used artificial insemination for my cattle I've always relied on breeding bulls to mate with the cows and it's proving successful," the family patriarch admitted The affordability and quick results of the program won over the skeptical couple "It was quite impressive," Ivone remarked "I wish we had access to such opportunities earlier André explained the economic and practical benefits: "Purchasing a breeding bull is costly and comes with various risks from transport to the chance of the animal succumbing to disease on the farm you're limited in genetic variety with just one bull Artificial insemination allows you to use semen from multiple top-quality bulls at a cost of no more than R$ 120 per dose." He estimated that without PDRIS achieving these results would have taken at least two more years The family now aspires to continue enhancing the genetic quality of their herd to cultivate traits that are prized in contemporary cattle farming: rapid weight gain André lauded the program for its accessibility: "This initiative has opened up opportunities for small-scale farmers to access technology and significantly improve the state's cattle stock with minimal red tape." The importance of an improved and efficient production process cannot be overstated in Tocantins where cattle farming accounts for 30% of the state's Gross Domestic Product (GDP) and 16% of its exports "The genetic improvement program was so triumphant that it persisted even after PDRIS concluded in December 2021 now funded by the state," said Mauricio Fregonesi the project manager from the Tocantins government The project's success also paved the way for the development of seven new slaughterhouses a plan set in motion at the outset of PDRIS to bolster the state's food safety Three of these facilities are slated to begin operations this year while the others are still under construction These establishments will adhere to stringent health standards and will treat all waste before releasing it back into the environment recalled the pre-project conditions: "Previously there were numerous illegal slaughterhouses with cattle being butchered under trees and meat sold in unregulated open-air markets as evidenced by data from the Brazilian Institute of Geography and Statistics (IBGE) the state was among the leading contributors to the increase in cattle slaughter nationwide Tocantins ranked eighth in the country for beef exports with 4.4% of Brazil's total beef sales originating from the state With the continued investments from the project there is an expectation to further enhance the state's agricultural sector's prominence always prioritizing quality while integrating innovative technologies and uniting generations of farmers The Tocantins-Araguaia waterway project began under the previous president federal prosecutors sued to stop the process claiming the environmental review was incomplete 27 required studies were missing from the process Parts of the channel project were approved with hydrology data from 2017 when river levels were much higher than in the last two years when a crippling drought caused record-low water levels is normally 3-3.5 meters (9.8-11.5 feet) high in the dry season but in October 2024 it was just 2 m (6.6 ft) high Many barges need at least 2.5 m (8.2 ft) of water to safely navigate rivers significantly adding to the cost of the project Ships can lighten their load to sit higher in the water an option that will also make shipping more expensive and each bargeload of grain more carbon intensive “Every foot of reduced water depth or draft is the equivalent of loading 7,000 fewer bushels of soybeans per barge,” Mike Steenhoek Climate scientists say the Amazon Basin will become drier with climate change; the Tocantins River is expected to shrink by half in the next 25 years Higgins also reports that the channel project didn’t receive the free prior and informed consent of local stakeholders Local fishers report being harassed and coerced to leave their traditional territories as real estate speculation has driven up the value of nearby land the National Department of Transport Infrastructure (DNIT) must compensate local people for any losses incurred as a result of an infrastructure project But the department says it’s only responsible for damages from dredging and blasting and won’t pay for damages from operations That will leave many communities without compensation Local fisherman Nilton Lopes de Melo told Mongabay that the compensation DNIT plans to give which no one will want to eat,” will last long after the detonations end He accused the DNIT of “violating our rights as traditional river peoples.” This is a summary of “Brazil’s shipping channel plans in Amazonian rivers will worsen climate change, experts warn” by Tiffany Higgins. Banner image of a traditional fisherperson near Tauiry Village. Photo by Tiffany Higgins for Mongabay. The “fortress conservation” model is under pressure in East Africa, as protected areas become battlegrounds over history, human rights, and global efforts to halt biodiversity loss. Mongabay’s Special Issue goes beyond the region’s world-renowned safaris to examine how rural communities and governments are reckoning with conservation’s colonial origins, and trying to forge a path forward […] Photo - Tocantins StateThe Ministry of Agriculture and Livestock (Mapa) of Brazil has established a regionalisation agreement with Singapore to ensure the trade of pork products even in the event of an African Swine Fever (ASF) outbreak in Brazil allows trade to continue provided that the disease occurs within a specific zone and that sanitary control measures follow the guidelines of the World Organisation for Animal Health (WOAH) The agreement will bring greater security and predictability to the pork trade between the 2 countries benefiting industry representatives on both sides represents an opportunity for further trade in the region According to the Brazilian Animal Protein Association (ABPA) Singapore was the 5th largest destination for Brazilian pork exports in 2023 Director of the Animal Health Department at the Secretariat for Agricultural Defence highlighted that the protocol reflects Singaporean authorities’ recognition of Brazil’s official veterinary services and its productive sector in ensuring food safety for the country The last recorded cases of ASF in Brazil occurred in 1981 with the disease officially eradicated from the national territory in 1984 following rigorous containment efforts the WOAH recognised Brazil internationally as free from the disease ASF is a highly contagious viral disease that affects domestic and wild pigs While the disease poses no risk to human health it can cause severe economic losses for the pork industry You have successfully subscribed to our newsletter pointed out that the State Secretariat of Finance (Sefaz) will monitor the lottery activities through a control and transparency system “The establishment of the lottery in the state has the potential to generate revenues that will benefit society and it is an activity regulated throughout the country,” he emphasized Comunicação social - todos os direitos reservados Please Register or Sign in to view this content Quantum Commodity Intelligence is a premium paid subscription service for professionals in the oil Quantum Carbon service subscribers have access to: Get in touch with us for subscription information on all Quantum platforms Adeusil Antonio Gonçalves and his son Roberto his aspiration was to leave his ferryman days behind he managed the ferry that shuttled residents and goods across the Manoel Alves River between São Valério and Santa Rosa do Tocantins which could have been disastrous,” he shared he had to operate the ferry after hours to transport those in urgent need of medical care the only alternative was a lengthy 180 km detour connecting the two towns a route that was not only time-consuming but also costly for local farmers the entire community longed for the bridge over the Manoel Alves despite the risk of job loss,” Ricardinho admitted the community celebrated the bridge's opening in May 2022 The 150-meter concrete structure is part of the Integrated and Sustainable Regional Development Project of Tocantins (PDRIS) backed by the state government and the World Bank The initiative poured $282 million into seven sectors: transportation we undertook 718 activities,” Mauricio Fregonesi the project's manager for the Tocantins government The PDRIS was responsible for upgrading 2,200 km of state roads it facilitated the construction of galleries thereby improving access for residents across 72 municipalities making 5,500 km of secondary roads in Tocantins more accessible He transitioned to a role with the São Valério City Hall where he now performs maintenance duties in schools and on city property but it comes with far fewer worries," he says with a sense of contentment a 64-year-old retired mason and electrician from Santa Rosa when basic necessities for the Apinajé village had to be transported by donkey cart to the river's edge someone would cross over to announce the goods' arrival a few canoes would come to collect them,” he recalls Keeping up with the latest car models is a challenge,” he says with a chuckle as he crossed the new bridge from Santa Rosa to São Valério to service security cameras on a farm Roberto finds it easier to navigate the area “The bridge has been a boon for all of us here I can now attend to more customers,” Roberto explains an agronomist engineer and farmer from the Apinajé village recalls the community's collective effort in the final stages of the bridge's construction “Heavy rains had delayed the embankment work we added more trucks to assist the government's teams soy and corn producers originally from Paraná have witnessed firsthand the logistical benefits requiring fewer trucks that can be larger in size "We used to spend 6 reais per sack for transport but now it's down to between 4 and 4.50 reais," Matheus notes "With an annual production of 35,000 to 40,000 sacks we're saving up to 60,000 reais on freight costs." “Tocantins is a major producer of essential goods in Brazil and the project's road infrastructure was designed to enhance logistics who co-managed the project for nearly five years The new infrastructure has made a noticeable difference in the lives of the region's inhabitants "Golden grass lifted us from extreme poverty," says Railane Ribeiro da Silva A tiny community in central Brazil has made a name for itself in tourism and design all thanks to a native plant known as golden grass which is used to craft accessories and decorative items This natural resource now stands for both the earnings and the pride of Mumbuca's quilombola community in Tocantins particularly for the Village's Association of Artisans and Extractors who greet global visitors with music and tales my golden grass that sprouted in the field unplanted It was my beloved who said to me that the field's flower is my golden grass It was Grandma Miúda who showed us how to weave It was in Mumbuca that this craft began with much love” you're not just purchasing a product; you're preserving a tradition that's over two centuries old and still standing strong," explains 28-year-old artisan Railane Ribeiro da Silva "Golden grass lifted us from extreme poverty which used to make us fearful of outsiders Railane is the granddaughter of Grandma Miúda (Guilhermina Ribeiro da Silva who learned the art of braiding golden grass from her mother Grandma Miúda played a crucial role in popularizing this craft nationwide and bringing progress to the region The World Bank joined this narrative by funding the golden grass supply chain through the Integrated and Sustainable Regional Development Project of Tocantins (PDRIS) carried out over nine years in partnership with the state government This initiative poured $282 million into seven sectors: transportation $3 million was allocated for various projects the project helped establish a modest museum where visitors can delve into Grandma Miúda's history view golden grass cultivation and harvesting photos a fully equipped office," Railane rejoices The project also enabled sustainable harvesting training "The training sessions made it easier to develop products from golden grass," remembers Fatima Amazonas "The women needed a proper place to sell their goods They gained empowerment through sheer determination and joy," she continues in Prata Community in São Félix do Tocantins the project funded a plaza that's now a central hub for locals this quilombola community was cut off from the world Our lives were very basic," teacher Osirene Francisca de Souza reminisces "Electricity didn't arrive until the 2000s," she adds "It's even become a venue for school events," she notes the plaza is a lively spot where adults can unwind at food stalls while kids play in the playground Other project-supported initiatives include: • The establishment of the Tocantins Tourism Observatory in partnership with local educational and commerce institutes for sector research and planning • The creation of an adventure park in Cantão State Park with zip lines and acrobatic paths • The formulation of a strategic plan to enhance sport fishing in several municipalities • The commissioning of a bird-watching guide for Tocantins and training for bird guides • The installation of tourist signs in the Serras Gerais region The tourism boom necessitated visitor-friendly infrastructure new restrooms and a rest area kiosk were constructed a shelter kiosk was built at the entrance to Jalapão State Park These enhancements have improved the visitor experience as noted by 26-year-old advertiser Beatriz Fróes and 25-year-old food engineer Maria Julia Rossi from São Paulo and the reasonable prices made our visit delightful," they commend "Some services and signs could be better but that's to be expected in an emerging tourist destination." The charm and untouched nature of Jalapão also captivated Kàllyta Queiroz "We plan to bring our daughters when they're older," says Kàllyta Traveling with young children is not advisable due to the lengthy dirt road drives a trip to Jalapão promises an unforgettable blend of natural beauty and hospitality in a Brazilian region ripe for exploration This site uses cookies to optimize functionality and give you the best possible experience. If you continue to navigate this website beyond this page, cookies will be placed on your browser. To learn more about cookies, click here. Hello, Login Hello, Loginor My Account Follow us on: See the top gainers, losers, invest and get updated what's happening in the crypto market India's Largest Regional Retail Option Traders Summit. (BOTS) is a prestigious options trading event organized by Traders Gurukul. Held on the 2nd OR 3rd Sunday of every month, across top cities in India This functionality will provide users with ease of access navigation and enable create a new revenue line by generating leads of potential customers for brokers in a more integrated manner. A collection of the most-viewed Moneycontrol videos. Apple’s India Bet: $14 Billion iPhone Opportunity for Indian Factories in Q1 JSW-Bhushan's ₹19,350 Cr Power Deal: Here’s Why the Takeover Collapsed Live: Nifty Clocks Triple-Digit Gains Driven By Autos, Oil & Gas & Metals| M&M, RR Kabel In Focus Romanian Presidential Elections| A Trump-Style Nationalist Challenge To The EU| N18G Stock Markets Copyright © Network18 Media & Investments Limited videos or any other content in whole or in part in any form or medium without express written permission of moneycontrol.com is prohibited *We collect cookies for the functioning of our website and to give you the best experience Cookies from third parties which may be used for personalization and determining your location. By clicking 'I Accept', you agree to the usage of cookies to enhance your personalized experience on our site. For more details you can refer to our *I agree to the updated and I warrant that I am above 16 years of age I agree to the processing of my personal data for the purpose of personalised recommendations on financial and similar products offered by MoneyControl I agree personalized advertisements and any kind of remarketing/retargeting on other third party websites I agree to receive direct marketing communications via Emails and SMS Please select (*) all mandatory conditions to continue. killing at least one person and spilling sulfuric acid into the Tocantins River The incident occurred on the Juscelino Kubitschek de Oliveira Bridge which links the cities of Estreito in Maranhão state and Aguiarnópolis in Tocantins state The 533-meter (0.3-mile) bridge’s central span gave way in the afternoon while several vehicles According to officials from the National Department of Transport Infrastructure the tanker carrying sulfuric acid plunged into the river following the collapse The fire department confirmed one fatality Preliminary reports indicated that at least 11 people were involved in the incident Aguiarnópolis city councilman Elias Junior was recording a video calling for repairs to the bridge which he believed could no longer handle the weight of heavy trucks As he pointed out a large crack on the bridge The video has not been independently verified and Junior did not immediately respond to requests for comment Rescue operations were temporarily halted by early evening when divers identified that one of the submerged tankers was leaking sulfuric acid is part of the BR-226 highway and connects Brasília a northern city set to host the United Nations Climate Change Conference next year The collapse has raised serious concerns about the safety of the structure with authorities investigating the cause of the collapse and assessing the environmental impact of the sulfuric acid spill Male celebrities like Dhoni and Aaryan are changing the perception of men’s jewellery as a personal fashion statement Platinum Guild International and Senco Gold & Diamonds are partnering with these icons to promote their collections while Kalyan Jewellers and Malabar Gold & Diamonds have male brand ambassadors for their cross-generational appeal The dates displayed for an article provide information on when various publication milestones were reached at the journal that has published the article activities on preceding journals at which the article was previously under consideration are not shown (for instance submission All content on this site: Copyright © 2025 Elsevier B.V. Nossos serviços estão apresentando instabilidade no momento Algumas informações podem não estar disponíveis 2024 10h00 AM | Last Updated: November 21 the Brazilian Gross Domestic Product (GDP) hit 10.1 trillion with a growth of 3.0% in volume compared with 2021 Twenty-four out of 27 Federation Units increased their GDP The information is from the System of Regional Accounts 2022 produced by the IBGE in partnership with State Statistical Offices States Secretariats of Government and the Superintendence of the Manaus Free Trade Zone (SUFRAMA) "Today the IBGE is involved in the revision of the series of the entire System of Accounts which will adopt the year of 2021 as the new base-year the System of Regional Accounts remains releasing its estimates based on the base-year 2010 When the new series with the base-year 2021 is released the results of the system of Regional Accounts will be eventually re-released integrated with the new series of the System of National Accounts as well like the aggregation level of economic activities and the absence of GDP tables under the point of view of income," explained Alessandra Poça "The increase in the GDP for the second consecutive year represents the recovery of the Brazilian economy mainly due to the effects of the COVID-19 pandemic," highlights Poça none of the five Major Regions dropped in volume in 2022 the South Region recorded a technically stable result "The result of the South Region is mostly explained by the performance of Rio Grande do Sul due to Agriculture," highlights the manager the Central-West Region reported the highest growth (5.9%) Agriculture contributes to the rise of the GDP in the North and Central-West the highest GDP rises occurred in Roraima (11.3%) The performance of Agriculture definitively contributed to the result of 2022 in these states though not having a positive performance in the national average grew in the North Region and in part of the Central-West the growth was due to Other services and Administration "The first activity significantly advanced in volume in the three states of the North Region with the continuation of the upturn cycle of on-site activities whereas the second activity registered a slighter growth due to the significant weight in the respective economies," notes Poça Other Services and Trade and repair of motor vehicles and motorcycles stood out as well the growth in Other services also stood out waste management activities and decontamination "The expansion in the generation of wind energy in the state contributed to the latter," explains the manager Mining and quarrying industries leverage drop in the GDP in Pará and Espírito Santo The only Federation Units that dropped in volume of the GDP in 2022 the reduction was mainly due to Agriculture which caused the reduction in the production of cereals and soybeans had their performances in volume mostly explained by Mining and quarrying industries since the extraction of iron ore reduced in both of them The drop in Manufacturing industries also impacted with the highest changes in volume of the GDP the growth in volume was limited by the retraction recorded in Mining and quarrying industries whereas Paraná mainly reduced in Agriculture and Santa Catarina Southeast Region gains share in the national GDP In terms of GDP share between 2021 and 2022 the Southeast Region increased 1.0 percentage point whereas the South (-0.7 p.p.) and North (-0.6 p.p.) regions reduced which concentrated 53.3% of the national GDP Rio de Janeiro and São Paulo gained share of 0.9 p.p the result was caused by Mining and quarrying industries to the price in the extraction of petroleum and gas the relative advance was mainly due to Financial activities Manufacturing industries and Trade and repair of motor vehicles and motorcycles," highlights the manager Minas Gerais and Espírito Santo registered a loss of share of 0.5 and 0.3 p.p. in addition to the reduction in volume of this activity in both states unlike the prices of petroleum in the same year Goiás recorded the biggest relative advance by Trade and repair of motor vehicles and motorcycles and Manufacturing industries Mato Grosso do Sul and the Federal District also gained share influenced by Manufacturing industries in the former insurance and related services in the latter mostly due to a loss of share of the value added of the activity of Transportation The South Region (-0.7 p.p.) was the region with the highest loss of share due to the performances of Rio Grande do Sul (-0.6 p.p.) and Santa Catarina (-0.2 p.p.) the region added up to 16.6% of share in the Brazilian GDP "The reduction in the share was mainly due to Agriculture in Rio Grande do Sul and to Transportation storage and mailing and Trade and repair of motor vehicles and motorcycles in Santa Catarina," explains Poça the North Region stood with a share of 5.7% which reported a relative reduction in the region due to the performance in volume and price of Mining and quarrying industries Amazonas reduced its share from 1.5% to 1.4% in relation to the national GDP whereas Rondônia rose its weight from 0.6% in 2021 to 0.7% in 2022 The other Federation Units maintained their shares the Northeast Region maintained its ahre of 13.8% in the Brazilian GDP Seven states exchanged theirr positions in the ranking of relative share between 2021 and 2022 a movement noticed some times along the time series Pará fell from the tenth to the twelfth position whereas Mato Grosso and Pernambuco advanced one position each and ranked in the tenth and eleventh positions though they registered the same share until the first decimal place São Paulo and Rio de Janeiro lose weight in the national economy the Central-West and North regions registered the highest relative gains of share in the Brazilian GDP The only region to lose share in the time series was the Southeast (-4.1 p.p.) with the reduction in the weight of the economies of São Paulo (-3.8 p.p.) and Rio de Janeiro (-0.9 p.p.) Mato Grosso gained the highest share (1.2 p.p.) the national GDP registered an average increase of 2.2% per year the North and Central-West recorded the highest annual growth rates whereas the Northeast Region stood close to the national average The Southeast and South regions reported the lowest rises: 1.9% per year each Mato Grosso and Tocantins were the major highlights both of them with an average change of 4.8% per year Piauí (3.7% per year) and Maranhão (3.4% per year) Rio Grande do Sul and Rio de Janeiro remained as the two Federation Units with the lowest average increases in volume in the time series Federal District remains with the highest per capita GDP in Brazil The per capita GDP in Brazil was R$49,638.29 in 2022 and the Federal District remained as the Federation Unit with the highest Brazilian per capita GDP 2.4 times higher than the national average Rio de Janeiro ranked in the second position The calculation took into account the resident population of the first results of the 2022 Population Census The ranking of the ten highest per capita GDPs includes only Federation Units from the Central-West Besides the first position occupied by the Federal District along the entire time series the relative advance of Mato Grosso stands out in the Central-West Region rising from the 11th position to the fourth position between 2002 and 2022 Mato Grosso do Sul ranked in the sixth position in 2022 advancing two positions in relation to 2022 whereas Goiás appears in the tenth position the same position occupied in the beginning of the time series though it has exchanged positions along the period The System of Regional Accounts brings data on the composition and evolution of the GDP of each Federation Unit calculated from statistics on the annual value of production intermediate consumption and gross value added of each economic activity They also allow to estimate the annual value added by activity © 2018 IBGE - Instituto Brasileiro de Geografia e Estatística Nós utilizamos cookies para melhorar sua experiência de navegação no portal. Para saber mais sobre como tratamos os dados pessoais, consulte nossa Política de Privacidade. Brazil — The fisherman and I sit on the banks of the Tocantins River in Vila Belém one of more than a hundred fishing villages north of Marabá municipality will have their livelihoods negatively impacted if the proposed Tocantins River industrial shipping channel goes forward The project would dynamite their fishing grounds and deepen the river to allow faster shipping of soy and minerals to China and Europe his hands moving horizontally to sketch the shuttling motion of boxy barges sliding up and downstream past his home Brazil’s National Department of Infrastructure and Transportation (DNIT) plans a 212-kilometer (132-mile) blasting and dredging project that will demolish 35 kilometers (22 miles) of the 45 kilometer (28 mile) stretch of river known as the Lourencão Rocks — all of it culturally and biologically significant The company hired to do the job, São Paulo-based DTA Engenharia (and parent company DTA-O’Martin) says it would need to excavate 986,541 cubic meters (1,290,347 cubic yards) of rock over two and a half years DTA would need to dredge a distance totaling 177 kilometers (110 miles) digging up 5,674,000 cubic meters (7,421,319 cubic yards) of sand and dumping the load inside the riverbanks where Amazonian turtles now lay their eggs 2019 in Itupiranga municipality (one of five eventually held) that no harm would come to the river’s fish The fisherfolk had to wait four hours into that meeting to present a different view Six community associations from the villages of Vila Belém and Vila Tauiry organized fisherfolk to attend the municipal hearing that evening at which more than 450 people overflowed a local school auditorium The fisherfolk were eager to know how dozens of months of dynamiting bulldozing and the building of industrial ports along what is now a bucolic Amazonian river — and afterward barge traffic putting 100-145 meters of river-width off limits to fishing — could possibly not affect their livelihoods DTA PowerPoints promised “free access” to the new industrial channel a vow seemed aimed at prospective companies seeking to ship soy and ore not fisherfolk who in low-water season would be unable to lower their canoes into parts of the Tocantins River — their street the São Paulo engineer from DTA stated simply: “There will be some explosions And then the fish will momentarily move away.” When the public comment period began four hours in were restricted in their response by organizers and a giant sports clock with red digital letters holding each speaker to three minutes The fisherfolk described how a warning shot then flee deeper into the Lourencão Rocks — not away from them — to meet their doom that the fish will not be harmed in any way the biologist who did the fish collection studies for DTA’s report a Federal University of Southern and Southeastern Pará State biologist who has done years of participatory fish collection studies with the Tauiry village fisherfolk to study their livelihood she lit into the DTA expert: “How dare you devalue their knowledge?” she asked Biologist Alberto Akama of the Emilio Goeldi Museum would tell me later that the fisherfolk are correct; the fish inhabiting these rocky rapids have evolved not to flee as DTA claims: “They don’t know anything about fish the fish will dig deeper into the cavities of the rock because that’s how they protect themselves They’ve adapted to have the escape mechanism of going deeper into the rock Then [the company] will dynamite the rocks releases its September 2019 report analyzing the thousands of pages of environmental impact studies submitted by DTA the agency will state that what the company’s biology team has done isn’t science nor is it based on current scientific methodology It turns out neither the government’s DNIT nor DTA have studied the ecological impacts of the industrial channel once it’s operational including the construction of shipping ports and the daily impacts of industrial barge traffic DTA didn’t propose alternate sites for the removed materials have collaborated with researchers to rescue turtle eggs and raise the young formed a reservoir that flooded and eliminated beach nesting sites making the natural beaches at the Lourencão Rocks crucial habitat Should DTA be permitted to dump sand on the river margins this important community turtle management program would likely be forced to end The 212 kilometers of industrial dredging would worsen and remove habitat for many animals Cunha warned that the armored catfish of the Loricariidae species which now feed on river bottom algae and detritus “They claim that they’ll just dredge once and it will be over,” Akama said of DTA Engenharia “But that’s not how these rivers work.” Because they silt up over time the company “will have to continually dredge.” Ripping up aquatic habitat would likely exterminate many of the fish in the river The company plans to deposit the dynamited material into the deepest part of the river the biologist pointed out: “There are fish that live in that [deep water zone] habitat Seven additional threatened species are known to exist in the Lower Tocantins River Alberto Akama said of the project: “It will probably exterminate all of these fish.” the Araguaia River flows through the Cerrado biome where it joins the Tocantins River right before Marabá The joined rivers flow north through the Pedral do Lourencão to the industrial port of Vila do Condé near Belém around 155 kilometers (92 miles) upriver from the Atlantic Ocean DNIT points out that this port is “advantageously located” to access foreign markets It’s a “number [that] is considered low compared with other rivers in the Amazon,” says Frias with the low population likely due to seven large hydroelectric dams in the basin If the Araguaian dolphins were recognized as a distinct species “They would be classified as critically endangered,” Frias told Mongabay could push those dolphin numbers even lower “This intervention will cause an enormous alteration to the sediments” in the river It “will cause a lot of noise and intense concentration and movement of ships The diversity and abundance of fish will be directly affected the dolphins will lose natural habitat and availability of food resources.” IBAMA concluded that DTA’s animal collections and utilized incomplete methods that neither reflected current scientific collection practices nor were accurate regarding fish inhabiting the Tocantins River basin More than a dozen species were misidentified The engineering company frequently labelled an endangered fish with the name of a non-endangered fish Fourteen endangered species known to live in the area were not mentioned at all in DTA’s collection studies The 45-kilometer Lourencão Rocks — with its midriver stony labyrinths — constitute a specialized “pedral” ecosystem IBAMA’s report points out that the scientific literature on similar pedral river sites shows them to be richly biodiverse IBAMA and Cunha noted that the Lourencão Rocks were given no dedicated collection of samples or study a flawed omission by the company hired to demolish those rocks IBAMA also found that DTA’s environmental impact studies did not use currently accepted scientific methods for fish collection resulting in species numbers much lower than expected DTA’s lack of scientific rigor also led to a failure in reporting endangered fish that are already known to exist in the river DTA identified dozens of fish species that don’t even exist in the river basin which biologists say will suffer the largest impacts from a 500-kilometer shipping channel DTA studied only the small area abutting the future construction headquarters failing to research turtle habitat in the 212-kilometers where dynamiting and dredging would occur not only be impacted by the noise from dynamiting and shipping but would be harmed by oil leaks from barges IBAMA ordered DTA to redo the fish collections and to conduct a new dedicated study of Lourencão Rocks fish. As for the fisherfolks’ demand that they be consulted about the proposed project, as required by the International Labour Organization’s Convention C169 (of which Brazil is a signatory) and also that an anthropological study be done only asking that DTA conduct studies on traditional fishing practices because we delayed the project,” concludes Ronaldo Barros Macena The fisherfolk nearest the Lourencão Rocks argue that they have been overlooked in the environmental impact studies as traditional communities whose sustenance and uniquely sustainable culture depends on these 45 kilometers of midriver rocks no matter what DTA researchers say in the revised impact assessment the government will still demolish their homeland and the rocky fish nursery with which their life stories are entwined the knowledge of how to live sustainably in this part of the Amazon basin The local community associations have demanded safeguards in the face of the potential collapse of their fishery such as funds to develop aquaculture projects and to train young people to develop ecotourism projects But the fisherfolk remember with despair another infrastructure project the Tucuruí dam forced removals of traditional people and most residents were not indemnified Fisherfolk told me that substantial payments that the project operator pays in reparation for Tucuruí go to local municipal governments and aren’t distributed to the villages that still go without trash collection Not everyone agrees the traditional fisherfolk have a legal right to consultation IBAMA’s director of environmental licensing of river construction projects explained that though quilombos (communities of slave descendants) and indigenous people who will be impacted by the industrial waterway must be consulted as part of the environmental review process there is no such protocol for traditional fisherfolk (ribeirinhos) Pará State’s Public Defender office in Marabá sent IBAMA and DTA a letter urging them to follow ILO 169 and conduct formal consultation of the fishermen noting that the convention explicitly states that traditional fisherfolk shouldn’t be treated differently than other peoples Siqueira also cites Brazil’s Law #9,985/ 2000 which states that such traditional peoples are important because they contribute to the conservation of the ecosystems where they reside president of the Tauiry community association says of the government: “They never consulted with us Still, fisherfolk resistance remains strong. Teenagers I met — Ruan, Gleiciane and her sisters — sent me a video they made of themselves atop a section of the Lourencão Rocks joyfully and defiantly: “They want to destroy our Pedral We have our rights… to be protagonists in our own history.” In 2016, DNIT hired DTA Engenharia to develop the shipping channel without any environmental review — which according to Brent Millikan of NGO International Rivers isn’t required for industrial waterway channels despite their length and potential to affect hundreds of human DTA won the contract because it came in lowest among the five bidders contending it lacked the technical expertise to do demolition and excavation of the midriver rock environment as well as the financial resources to perform the work said it is contractually prohibited from giving interviews so all information presented here has come from DNIT DNIT said it wouldn’t discontinue use of DTA in this or future projects as each bidding process is separate IBAMA’s Regis Fontana Pinto said not approving the project is highly unlikely given DNIT’s prioritization of it as “necessary.” the fisherfolk of the Lourencão Rocks await the new studies and hope to be protagonists in their own history Banner image: A mother and calf Araguaian river dolphin swim near Mocajuba on the Araguaia River Update: When this story was published on 2 July, the DTA Engineering (DTA Engenharia) company link presented in this article was active clicking on the link results in an error message Mongabay has reached out to the company regarding access to its website but had received no response as of 13 July FEEDBACK: Use this form to send a message to the author of this post The “fortress conservation” model is under pressure in East Africa as protected areas become battlegrounds over history and global efforts to halt biodiversity loss Mongabay’s Special Issue goes beyond the region’s world-renowned safaris to examine how rural communities and governments are reckoning with conservation’s colonial origins and trying to forge a path forward […] It’s a fiercely contested question: Do carbon offsets provide a solution to curbing greenhouse gas emissions But that hasn’t stopped the carbon trade from booming as more countries and companies look for ways to meet international targets for global carbon reductions Deforestation rates across the state are lower than pre-2016 levels despite slight increases in the past two years and the cash flow generated from the agreement with Mercuria will bolster the state’s conservation efforts “The main benefit [of the agreement] will be to obtain financial resources for the implementation of environmental public policies,” Lelis and Aleandro Lacerda involved in the execution of the state’s carbon strategy The Earth Innovation Institute, the main technical partner to Tocantins, expressed the same enthusiasm, saying in a press release that the scale of high-integrity credits from jurisdictional REDD+ programs could “increase funding for Amazon Forest and Cerrado savanna conservation more than ten-fold.” Experts warn the hype of the carbon market is little more than hot air “Those of us who [were] around for the beginning of this whole crazy idea of carbon offsets in the mid-1990s we didn’t believe that it could last more than a couple of years because it was so obviously damaging to the climate,” Larry Lohmann a scholar and activist who has studied carbon credits for more than two decades Carbon projects have become all the rage since the 2015 Paris Agreement came into force the international coordinator at the World Rainforest Movement all industrial sectors now want to be ‘carbon neutral’ by 2030 or at a maximum 2050,” he wrote “I was in the Amazon [twice] this year and it is crazy Tocantins will be the first Brazilian state to sell carbon credits on the international market once it has the certification from the REDD+ framework But different types of carbon projects have existed in Brazil for years has a results-based payment contract where emissions are registered but not sold as carbon credits There was also an attempt to sell carbon offsets in the state of Rondônia causing “very severe conflicts” that led to the Federal Public Ministry having to intervene The U.N. states that “Full and Informed Consent [from Indigenous and forest-dependent communities] must be adhered to” for emission reductions to qualify under the REDD+ framework “I can assure you after having visited so many communities in REDD project areas in the past 15 years that [the Indigenous communities] still do not know what REDD is,” Overbeek wrote “They have been mostly told about some benefits and suffered from restrictions on the use of the forest after the project started.” Carbon credits are effectively “pollution permits,” Schmidlehner said and this is usually not communicated to Indigenous and local communities “They don’t know that maybe they are contributing to pollution in another place and harming another community in another place of the world These are all things that are somehow hidden from them,” he said The biggest criticism experts shared of carbon offsets is that they encourage the continued use of fossil fuels “[Carbon offsets] are obviously very good for the fossil economy which is a very powerful force,” Lohmann said “It’s not confined to the fossil fuel companies [they] are very much committed to continuing the use of fossil fuels as long as possible Proponents of the carbon market say the financial investment in carbon credits can actually encourage companies to urgently invest in sustainable practices to cut down on offset costs leading to a consequential reduction in fossil fuels “It makes sense that a company that’s buying offsets is going to want to eliminate that cost by accelerating its own decarbonization,” Daniel Nepstad president and executive director of the Earth Innovative Institute “Companies are going to invest in their own decarbonization as quickly as they can because they know they can’t carry those costs year on year.” meaning forest offsets only work if the tree cover remains intact for that period “You cannot promise that especially now that we have climate change,” Schmidlehner said “The basis of REDD logic is very questionable.” The logic becomes even more dubious when the additionality clause is considered Additionality means that emissions reductions wouldn’t occur without support from carbon credit sales It’s a logic that is dangerous,” Schmidlehner said adding that carbon credit proponents can exaggerate deforestation threats in order to increase the value of carbon sales There are some parties that benefit from the REDD framework such as project developers and carbon brokers Overbeek wrote — but the environment is not one of them “REDD has been a complete failure in terms of its promise to reduce deforestation and mitigate climate change,” he wrote “I have not seen any study showing that all these about 300 or more projects and programs around the world — now probably many more — with billions of dollars invested in them in supposed ‘forest protection’ have provoked a change Deforestation worldwide in the past 15 years has only increased.” The jurisdictional model in Tocantins “will be replicated for the other Amazonian states,” Lelis there are challenges ahead “because the level of demand to meet the requirements of international standards is enormous which requires investments of pre-investment resources,” he said more financial aid is required to slow down deforestation and bring environmental policies up to scratch to turn other states into attractive candidates for potential carbon offset investments The project in Tocantins is in the very early stages and it’s too early to determine how successful it will be senior researcher at the Talanoa Institute He said questions remain about how Indigenous communities will be involved and added the state needs to “be very careful” in this respect to ensure Indigenous and forest communities participate in decision-making processes relating to the carbon projects “It’s a big illusion that is created because most of these projects do not really make a difference,” Schmidlehner said CORRECTION (7/3/2023): An earlier version of this article stated that Winnie Overbeek is the international coordinator at the World Movement for Tropical Forests The name of the organization is actually World Rainforest Movement FEEDBACK: Use this form to send a message to the author of this post Forest carbon offsets are a tool, not a silver bullet (commentary) This handout photo released by Tocantins Fire Department shows firefighters during a rescue operation after the Juscelino Kubitschek de Oliveira bridge connecting Tocantins and Maranhao fell on December 22 2024 over the Tocantins river at the city of Aguiarnopolis Sao Paulo: A search operation for a dozen people missing after a deadly bridge collapse in Brazil was being complicated by the possible presence of acid in the water At least two people are confirmed dead from the collapse which occurred late Sunday on the Juscelino Kubitschek de Oliveira bridge linking the states of Maranhao and Tocantins and four trucks -- two of which were carrying sulphuric acid Their dangerous cargo prompted officials to pause the search operation early Monday Water supplies to communities in the region were also suspended because of the possible "toxic" acid pollution more than half a kilometer (1,600 feet) long spans the Tocantins River between the towns of Estreito and Aguiarnopolis and serves as the main route linking the two Brazilian states Brazil's infrastructure and transport department said the causes of the collapse of the bridge It said the central beam of the structure gave way The collapse came on top of two other deadly transport accidents in Brazil over the weekend The country's worst highway accident in 17 years happened on Saturday when a bus crashed and caught on fire killing 41 people in the southeast state of Minas Gerais Police said a large block of granite apparently fell from a truck coming the opposite way The truck driver -- whose license was suspended two years ago -- fled the scene a private plane crashed into the city of Gramado in south Brazil The Piper Cheyenne 400 turboprop was being piloted by a businessman named Luiz Claudio Salgueiro Galeazzi At least 17 people on the ground were injured a house and a furniture store as it crashed shortly after takeoff California Dreams was better than Saved by the Bell Brazil – one of the rural roads’ critical spots fixed in the context of PDRIS project Credits: Agência Public Propaganda e Marketing the community dreamed of a bridge to safely cross the Manuel Alves River can take up to four hours when the water is high but we are very proud to finally retire it.” worker at the Manuel Alves bridge construction site and resident in the local community Tocantins is one of Brazil’s remotest states geographycally Its huge territory and sparse population made transport connectivity challenging particularly in providing all-season access to rural communities and reliable logistics to the state’s thriving agricultural sector The state’s administration lacked capacity for efficient delivery of public services which faced quality issues as well as a high drop-out rate The state struggled with gender-based violence (GBV) alongside major trunk roads in which heavy freight traffic leads to a prevalence of sexual exploitation of women and girls Tocantins also needed to ensure better enforcement of environmental regulations in order to avoid excessive burden on economic activity while ensuring preservation of the Cerrado biome The Tocantins Integrated Sustainable Regional Development Project (PDRIS) was designed to improve road transport and enhance the efficiency of selected public services with the goal of supporting an integrated and territorially balanced development agenda in the state This agenda included improving local livelihoods and educational services especially in lagging areas of the state’s territory PDRIS was the third World Bank project to focus on rural roads in Tocantins. The project incorporated a multi-sector approach to promote the state’s development. PDRIS supported the rehabilitation of paved and unpaved roads, by mainstreaming the use of performance-based contracts known as CREMA (Contracts for Rehabilitation and Maintenance), which were shown to yield superior performance in road asset management The roads component also fixed more than 1,600 critical spots with bridges aiming to ensure year-round accessibility to rural communities in western Tocantins These works were selected using a participatory approach in which inputs from communities’ consultations were considered on par with criteria such as traffic volumes PDRIS supported the institutional development and public services provision in Tocantins The road improvements also had synergy with other interventions such as supporting the productivity of small cattle producers with a special focus on relying on schools’ outreach to mitigate gender-based violence (GBV) along main highways people with all-season access to quality roads achieving 100 percent coverage of rural population in the western half of Tocantins The PDRIS project supported Tocantins’ road network rehabilitation and the state’s overall agenda for sustainable and territorially balanced development the project supported local economic activities and institutional capacity strengthening contributing to the achievement of the following results from 2012 to 2021: through the International Bank for Reconstruction and Development (IBRD) provided $282 million of funding for the project the World Bank provided strong technical assistance to support the project’s multi-sectoral implementation approach The implementation of PDRIS was carried out by several Tocantins state-level agencies under strong leadership of the state’s Planning Secretariat (Seplan) The transport component was led by the Transport and Public Works Agency (Ageto) while sectoral interventions were implemented by their respective agencies: the Agriculture Secretariat (Seagro) and the State’s Nature Development Institute (Naturatins) The World Bank’s support to the regional development agenda in Tocantins continues after the closing of the PDRIS project the state aspires to tap into the economic potential of improved connectivity between its growing agricultural hubs to major national trunk corridors such as the newly inaugurated North-South Railway or the future East-West Integration railway The adequate maintenance of the road network in advance of climate change-induced degradation also represents an important area for continued Bank engagement with the state Project Overview: PDRIS Bridge over Manuel Alves River represents a leap in the region’s development Environment Secretariat pilots the use of drones for environmental mapping Road to Rights: actions to reduce vulnerability of children and adolescents © 2025 World Bank Group. All Rights Reserved. Archaeologists with Brazil’s National Historic and Artistic Heritage Institute (Iphan) have identified 16 new archaeological sites in Jalapão in the eastern part of the state of Tocantins The sites feature rock art—including human and animal footprints engraved symbols and figures representing celestial bodies—thought to have been made around 2,000 years ago According to previous archaeological research in the area, humans inhabited Tocantins as far back as 12,000 years ago, and remnants of their societies have been found up until the time of contact with European colonisers. news22 March 2024Archaeologists in Brazil find petroglyphs alongside dinosaur tracksNo this does not mean dinosaurs and humans lived there at the same time podcast3 July 2020The destruction of Australia’s ancient Aboriginal heritagePlus art under threat in Putin's Russia and George Shaw on Thomas Jones Produced in association with Christie's news25 October 2023Extreme drought in the Amazon reveals ancient rock carvingsThe carvings Canadian mining company Aura Minerals has celebrated high profits in recent years which will be directly affected by the company’s new gold mining project had their right to prior consultation ignored Aura Minerals’s value increased by almost 700% between 2019 and 2022 on the Toronto Stock Exchange — the best performance among 3,500 companies The reason for such extraordinary performance is simple: The company pays investors extremely well Residents of Baião — located a little more than 3 miles away from the mining site — in turn were not heard in the decision to resume the project that used to belong to mining company Vale The open-pit mine is located near the community and will affect them directly the only river to cross the Quilombola territory in the event of an accident with the dam used by the company the Baião community would be instantly engulfed and would disappear completely “The company claims that they are not in our territory but do they have an escape route to save the territory if the dam collapses The other communities will be affected in terms of water but Baião risks disappearing,” Maryellen Crisóstomo said to the Mining Observatory Crisóstomo is one of the leaders of quilombo Baião and serves as head of communication for the National Coordination of Rural Black Quilombola Communities (CONAQ) The Tocantins State Public Defender’s Office (DPE/TO) paid a technical visit to Baião in December 2022 to confirm the mining company’s lack of dialogue with locals Despite being so close to the site, the Quilombola were not consulted about the impacts of mining in the region Indigenous and traditional peoples’ right to free prior and informed consultation is provided for by Convention 169 of the International Labor Organization that right has been guaranteed by law since 2004 That means that the Brazilian state must consult Native and traditional peoples about enterprises and infrastructure works with potential to cause impacts on territories cultural practices and social dynamics of the communities affected by the activities The consultation must be transparent so communities understand the potential impacts on their lives doubts and decisions of communities consulted the Quilombola from Baião finished a protocol in which they detailed how the consultation should be conducted To avoid having their doubts and concerns ignored residents of Baião appealed to the Federal Prosecution Service in Tocantins (MPF/TO) in September 2021 the Quilombola reported the arbitrary way in which Aura Minerals approached the community in July of that year coercing them to answer questionnaires with personal information claiming that the questionnaire was “just like IBGE’s” [The Brazilian Institute of Geography and Statistics The community refused to fill out any forms and turned to the Prosecution Service which questioned Brazil’s National Mining Agency the Palmares Cultural Foundation and the National Institute for Colonization and Agrarian Reform (INCRA) A 10-day deadline for feedback was set in August 2022 but the agencies had not responded by February 2023 the Prosecution Service claimed that it was looking into the facts and it needed concrete data in order to make any decision “If the impact on the Quilombola community is proved appropriate lawsuits will be filed,” says a representative In search of alternatives, the community resorted to the DPE/TO, which mediated a meeting on Jan 11 with representatives of the Quilombola communities of Baião and Poço Dantas Dianópolis and São Joaquim from Porto Alegre the meeting included the State Coordination of Quilombola Communities of Tocantins the Department of Environment and Tourism of Almas the Rural Development Institute of Tocantins and Aura Almas Mineração the Brazilian subsidiary of the Canadian mining company the meeting was not attended by technical staff from the mining company who could start a dialogue and speak honestly about the potential impacts on communities and the risks posed by the dams The company’s representatives only advertised the project’s alleged economic benefits “I’m particularly scared by their failure to mention the critical part The residents were presented with a slide show on the advantages of mining in the region — contrary to what they had expected which was the beginning of a transparent dialogue about the potential impacts on their communities “The big question is: What is the real threat to our territory?” Crisóstomo said The cornerstone of the venture was laid in December 2021 The Tocantins Court of Justice suspended the injunction granted in May 2021, which allowed the operation of the mining company after the Tocantins state government claimed, through the state attorney’s office, that it posed environmental risks to the region then acting Governor Wanderlei Barbosa granted Aura an environmental license to operate When asked by the Mining Observatory to comment on the exact content of the “agreement,” the government of Tocantins did not respond the State Court of Justice declared that 21 articles of the law on environmental licensing sanctioned in July 2021 during former Governor Mauro Carlesse’s administration which does not respond to the specific questions about the case Regarding their lack of consultation with the Quilombola and the fact that they ignored the presence of nearby communities in addition to safety and emergency protocols and the risks posed by the tailings dam the company said it “promotes responsible and sustainable growth in its businesses and adopts the best safety and ESG practices” and that “it respects the culture and well-being of the communities where it operates integrating best practices and environmental projects into its businesses and activities.” but the company chose to maintain its position The mining company’s lobby is strong in the municipality It promises a long-term enterprise with creation of jobs and an initial investment of 375 million reais ($71 million) “The proposals fascinate the local population,” said Crisóstomo The open-pit gold mine has an estimated useful life of 17 years and average production of 50,000 ounces a year each ounce being equivalent to just over 28 grams the construction work will create 400 direct jobs and around 1,200 indirect ones Tax revenues for the municipality of Almas are estimated at 80.3 million reais ($15 million) under the systems known as Financial Compensation for the Exploitation of Mineral Resources (CFEM) and Service Tax (ISS) The state treasury should receive 30.3 million reais ($5.7 million) from CFEM and royalties In Brazil, in addition to Almas, Aura Minerals has copper and gold mining projects in the states of Rio Grande do Norte and Mato Grosso, and it also operates in Colombia, Mexico and Honduras. In an interview with newspaper O Estado de S.Paulo in September 2021 despite the political turmoil and threats to democracy already underway at the time and which have worsened since then as a result of the Jan “gold is immune to any crisis in Brazil” and Aura would be an “option” for investors when “everything goes wrong” because its operations are based on the U.S dollar and 80% of its revenues are in gold The Baião quilombo is certified by the Palmares Foundation and has been waiting since 2010 to be recognized as Quilombola territory by INCRA the “slow implementation of that policy gives rise to this type of violence and conflict in the territory It’s not just about mining; it’s also about deforestation and silted rivers,” she argued The Quilombola from Baião have documents proving their presence in the area since 1919 Contacted by the Mining Observatory to comment on the delay in the process and no deadline can be established for the procedures.” the duration of each process depends on the level of complexity and includes factors such as the degree of difficulty in accessing cartographic historical and anthropological information necessary to prepare the Technical Identification and Delimitation Report (RTID) The factors listed by INCRA to explain why it takes so long to provide a quilombo with a land title include the number of properties in the territory problems notifying all holders of real estate in the territories during the stages when the RTID can be challenged and notifications will be issued for inspection and evaluation of their properties total number of challenges as well as administrative and court appeals filed during the course of each process time for legal proceedings to expropriate rural properties and other variables aspiring presidential candidate Jair Bolsonaro declared that he would not allow demarcation of any Indigenous or Quilombola territory during his term in office The promise was fulfilled with several budget cuts and the dismantling of agencies in charge of policies for Native and traditional communities In April 2022, INCRA had more than 1,800 open processes to regularize Quilombola territories the agency approved a rule that made it even more difficult to recognize Quilombola communities and The rule established that only communities with RTID would enjoy their territorial rights Under that rule, the research and studies necessary for a Quilombola territory to be recognized will only be carried out if funds are available. It also disregards the Quilombola’s right to consultation Living in the middle of the Agricultural Development Plan of Matopiba (an area comprising the Cerrado border of the states of Maranhão the Quilombola from Baião are directly impacted by the advance of agribusiness and suffer from land-grabbing families that could not afford digging artesian wells depend exclusively on the municipality’s water trucks the Quilombola say they fear they will have to leave the territory they have occupied for more than 90 years with so many environmental destruction fronts around them It is by remaining in the territory that they guarantee that traditional farming practices religion and ways of life keep persisting to this day which is located in southeastern Tocantins — a region affected by water shortages — has been historically marked by slavery and the gold rush technical director of civil society organization Alternatives for Small-Scale Agriculture in Tocantins pointed out several factors making water scarce in the region “There is the impact of agribusiness in the Matopiba region causing lack of water and the depletion of the Urucuia aquifer which is lowering the water discharge that supplies the entire southeastern region of Tocantins,” he said Scientists confirm the views expressed by Gonçalves, aka Paulão. The advance of agribusiness based on large-scale irrigation may be one of the main drivers of the depletion of the Urucuia aquifer, an immense reservoir that lies below the plateaus and rivers impacted by large farms The Quilombola issue is also historical in the region and is directly connected to mining The African diasporic population was trafficked to southeastern Tocantins to be exploited in the gold cycle of the 1700s “Southeastern Tocantins is a large Quilombola territory of Black populations that don’t have any land title,” Gonçalves explained “There is no conclusive action by INCRA to regularize the areas and the state government refuses to regulate the Quilombola territories,” he said “It is a large Black population — almost an Africa in Tocantins — and none of these communities can enjoy their territorial rights,” Gonçalves concluded Banner image: Aura Minerals’s mine in Almas Article originally published in Portuguese on Observatório da Mineração/The Mining Observatory. Volume 10 - 2022 | https://doi.org/10.3389/fevo.2022.826394 Few phylogeographic studies have focused on understanding the role of the Tocantins–Araguaia Interfluve (TAI) in the diversification of Amazonian biodiversity Herein we evaluate the phylogeographic relationships of 14 avian lineages present in the TAI and its two neighboring Amazonian Areas of Endemism: the Xingu (XAE) and Belém (BAE) Four alternative scenarios coupling degree of genetic differentiation and area relationships were tested: (1) populations distributed in TAI and XAE are not genetically differentiated from each other (assumed as the null hypothesis); (2) populations from TAI are more closely related to those from BAE; (3) populations from TAI are more closely related to those from XAE; and (4) TAI populations represent independent or endemic lineages not present in either the BAE or XAE Molecular analyses considered Bayesian Inference methods and Bayesian Information Criterion (BIC) evolutionary models haplotype sharing and genetic differentiation estimates We found three distinct phylogeographic patterns: (i) four lineages presented no population structure across XAE TAI and BAE; (ii) six lineages were represented in the TAI with distinct phylogroups replacing each other between XAE and BAE but with varying degrees of contact and evidence of gene-flow within the TAI; and (iii) for four lineages the Tocantins River acted as a barrier isolating BAE phylogroups from those inhabiting both TAI and XAE These different patterns demonstrate a heterogeneous response to the barrier effects posed by both the Tocantins and Araguaia rivers on the local fauna Historical geomorphological and hydromorphological factors such as the presence and absence of paleochannels and anastomosed channel stretches and variations in sedimentation rates support a dynamic history for the Araguaia-Tocantins floodplains likely accounting for the observed heterogeneity in species’ specific responses the scenario of phylogeographic breaks and population subdivision recovered herein along the Tocantins and Araguaia rivers associated with the existence of contact zones and the occurrence of gene flow define the TAI as hitherto unknown biogeographic suture zone clearly demonstrating the complexity of diversification scenarios across Amazonia To fill in these gaps, here we evaluate the phylogeographic relationships of at least 21 taxa belonging to 17 species of the avifauna of the TAI associated with humid and ecotonal forests occurring in its central-northern portion, with other Amazonian Areas of Endemism, mainly the neighboring Xingu (XAE) and Belém (BAE) (sensu Silva et al., 2005) Considering the relevant role played by major Amazonian rivers as geographic barriers directly influencing the diversification of neotropical avifauna we assume that the Araguaia and Tocantins rivers could act in such way promoting genetic structuring of bird populations within the TAI Hence, we tested four alternative predictions concerning comparative levels of genetic differentiation and phylogeographic relationships (Figure 1) among the BAE as follows: (1) populations distributed in the TAI and XAE are not genetically differentiated from each other assumed as our null hypothesis; (2) populations from TAI are more closely related to those from XAE; (3) populations from TAI are more closely related to those from BAE; and (4) TAI populations represent genetically differentiated lineages not shared with the BAE and XAE These hypotheses examine the possibility of the Tocantins and Araguaia rivers acting as geographical barriers to gene flow and the role of TAI as a contact or even as a new area of endemism for the Amazon geological features of the Araguaia and Tocantins rivers are considered to support the discussion on how both rivers have influenced patterns of gene flow between lineages from their opposite banks Figure 1. Left: Amazonian areas of endemism according Silva et al. (2019) with the TAI shown in southeasternmost Amazonia Right and clockwise: frames (A–D) of the four hypotheses of expected phylogeographic patterns for the TAI and neighboring areas (Belém Area of Endemism – BAE and Xingu Area of Endemism – XAE) all three areas are inhabited by genetically undifferentiated populations (assumed as the null hypothesis) TAI and XAE are inhabited by sister populations to the exclusion of BAE populations TAI and BAE are inhabited by sister populations to the exclusion of XAE populations TAI populations are inhabited by reciprocally monophyletic populations with respect to those in both BAE and XAE List containing 14 avian lineages included in the molecular analyses and the taxon present in each of the major areas sampled in this study The genetic marker chosen for the molecular analyses was the mitochondrial NADH dehydrogenase subunit 2 gene (ND2). In addition to the 397 samples sequenced, another 141 ND2 sequences belonging to the selected species and respective outgroups were obtained from the GenBank database (Supplementary Table 2) Total DNA was extracted following standard procedures of the phenol-chloroform technique (Sambrook et al., 1989). The amplification of the ND2 gene occurred through the Polymerase Chain Reaction (PCR). Primers used for gene amplification were H6313: CCTTGAAGCACTTCTGGGAATCAGA (Sorenson et al., 1999) and L5215: TATCGGGCCCATACCCCGAAAAT (Hackett, 1996) The total volume of PCR reactions was 25 μL containing: 12.4 μL of Master Mix (50 U/mL 400 μL of each dNTP and 3 mM of MgCl2) 0.4 μL of each of the primers (200 ng/μL) and The amplification profile proceeded in the following order: an initial 5 min step at 95°C for block temperature homogenization; followed by 35 cycles of 3 min each 1 min at the initiator association temperature for each selected species for the polymerization of eventual molecules from which the polymerase has dissociated before the end of the total synthesis of the fragment The association temperatures of the primers of each species were determined by a temperature gradient PCR (from 50 to 63°C) The amplified samples were checked in electrophoresis using a 1% agarose gel and purified following the Polyethylene Glycol (PEG-8000) protocol The products of the amplifications and purifications were sequenced using the Kit-Big Dye Terminator Cycle Sequencing Standard Version 3.1||on the ABI 3130 Sequencer from Applied Biosystems according to the manufacturer’s specifications After DNA extraction, amplification and sequencing processes, the sequences were edited and aligned by the ClustalW method using the BioEdit software (Hall, 1999). The saturation in the number of mutations was evaluated through graphs of transitions plotted against transversions as a function of genetic distances using the DAMBE program (Xia and Xie, 2001) The population genetics fixation index Fst was calculated using the Arlequin 3.0 program (Excoffier et al., 2005). Following Wright (1978), Hartl and Clark (2007), and Frankham et al. (2008) Fst values smaller than 0.49 were interpreted as representing low differentiation moderate differentiation and above 0.7 high genetic differentiation only four lineages belonging each to a distinct species did not show signs of geographic structuring across the Tocantins and Araguaia rivers we describe the results of the phylogeographic analyses in detail The phylogenetic and population genetic analyses obtained for the different lineages sampled uncovered three main distinct phylogeographic patterns (Figure 2) as follows: i) no population structure across XAE and Dendrocincla fuliginosa; (ii) TAI as a contact zone with evidence of gene-flow of lack thereof between distinct species/phylogroups replacing each other in the XAE and BAE as in Pyrrhura anerythra/Pyrrhura coerulescens Dendrocolaptes medius/Dendrocolaptes retentus and Taenotriccus andrei; and (iii) the Tocantins River as the barrier isolating BAE phylogroups from those inhabiting both TAI and XAE Granatellus pelzelni/Granatellus paraensis We found no support among the sampled taxa for two of our a priori hypotheses; i.e. no TAI lineages/populations grouped as sister to those in the BAE to the exclusion of XAE phylogroups (as postulated by hypothesis 3) and no reciprocally monophyletic (endemic) phylogroups on the TAI were recovered (as predicted by hypothesis 4) AGUA 97 and AGUA 47) belonged to these two distinct mitochondrial clades reinforcing the TAI as a wide contact zone between otherwise genetically structured populations across the lower Tocantins River a situation clearly not maintained across the Araguaia River this phylogeographic structure was not well supported statistically and could just be a sampling artifact it is necessary to increase the sampling of T The determination of phylogeographic patterns in the Amazon involving the sampling of the TAI area has been limited (Hrbek et al., 2014; Rocha et al., 2015) or completely absent (e.g. Aleixo, 2002; Ribas et al., 2006, 2012; Patané et al., 2009; Batista et al., 2013; Rodrigues et al., 2013; Soares et al., 2019) This lack of TAI samples in Amazonian phylogeographic studies precludes postulating any preliminary hypothesis regarding the historical relationships between this eastern Amazon interfluve and other regions we assessed for the first time the comparative barrier effects posed by both the Tocantins and Araguaia rivers on 14 avian linages in the southeasternmost Amazonian biota With the caveat that we sampled only one mitochondrial locus which is insufficient to estimate accurate rates of gene flow and hybridization our data showed the TAI as a contact zone between the rather differentiated avifauna of the neighboring BAE and XAE providing further support to the overall view that the upper reaches of major Amazonian rivers are more permeable to gene flow and faunal exchange than their lowermost parts The phylogeographic patterns documented herein demonstrated that TAI lineages are closely related to those in the neighboring XAE and BAE the different patterns of genetic diversity and area relationships found revealed that taxa have had distinct evolutionary histories in the TAI This variation in strength of the barrier effect played by the Tocantins River is consistent with the narrowing of its course upstream from its confluence with the Araguaia River which can be two to three times narrower compared to its lower course This is clearly demonstrated by the phylogeographic patterns detected for the allopatric species pairs P These genetically distinct populations of W vidua are apparently not in direct contact and exchanging genes due to the presence of an intervening modern ecological barrier at the same time that their establishment in different parts of the TAI reflects distinct origins and possible independent colonization events into this interfluve In contrast to pattern “ii,” pattern “iii” documented herein for five species supported an extended barrier effect along the Tocantins River upstream from its confluence with the Araguaia River, highlighting the variability in inter-specific responses to a single riverine barrier, as verified for the middle and upper portions of the Negro and Branco rivers (Naka et al., 2012; Naka and Brumfield, 2018) the proximity of middle and upper Tocantins River to the Amazon – Cerrado ecotone may enhance the barrier effect posed by the physical course of the river itself which could “stabilize” the southeasternmost limits of ranges of several humid forest taxa within the TAI The continuing existence of gene flow together with the variation in the intensity of the barrier effect of the Tocantins and Araguaia rivers show that the time of diversification of these populations present in the TAI is still very recent Contact zones represent areas where there is an overlap between parapatric populations of different taxa (Haffer, 1997; Aleixo, 2007) The recovered phylogeographic pattern “ii” demonstrated that within the TAI there is the concomitant occurrence of distinct populations or lineages otherwise endemic to the XAE and BAE The low and non-significant Fst values between XAE and TAI (Fst = 0.157) coerulescens lineages support a scenario of ongoing gene flow between them In turn, C. obscurus is a recently split species recognized by recent taxonomic revisions within the Campylopterus largipennis complex (Lopes et al., 2017). Our phylogenetic analyses recovered structure between XAE and BAE populations of this species, but which was not maintained in the TAI, where specimens of both lineages were found in syntopy (Supplementary Figure 7) Despite the marked molecular divergences observed between BAE and XAE C no apparent diagnosable morphological differences between were observed the extension of gene flow between these distinct populations must be assessed with a wider spectrum of genetic markers they can represent a relevant crossing point for the local biota between opposite river banks in closer proximity The reduction in the width of the river in this stretch goes from 1.2 km to ca geomorphological fluvial processes support a strong physical historical connection between XAE and BAE biotas in the TAI which is consistent with the documented contact zones and hybridization and gene flow events documented herein between lineages isolated in the BAE and XAE across the Lower Tocantins River the recovered pattern “iii” supports the Tocantins River as a barrier separating genetically differentiated populations distributed in the XAE and TAI from those occurring in the BAE pattern “ii” indicates the joint occurrence within the TAI of taxa otherwise distributed allopatrically in the XAE and BAE characterizing the existence of a contact zone these contact zones involve either (1) an instance of apparent parapatry between two genetically distinct populations occurring in different parts of the TAI and separated by the original presence of savanna formations (such as in W or (2) taxa in apparent direct contact and which hybridize with each other within the TAI (such as in D all these characteristics combined support the TAI as a novel biogeographic suture zone The data presented in the study are deposited in the GenBank Nucleotide Database repository accession numbers: ON137233–ON137450 and ON157084–ON157237 Ethical review and approval was not required for the animal study because there was no handling of birds just traditional laboratory work involving tissue aliquots The source specimens of these aliquots were collected before the present study by field expeditions of different teams from the consulted ornithological collections TD and SD analyzed the specimens in ornithological collection and LA-S performed the laboratory work referring to molecular analyses and AA applied and analyzed the data in computer applications TD and FM analyzed the data under geological and fluvial morphology perspectives AA and SD reviewed and improved the English version of manuscript All authors reviewed and approved the manuscript Laboratory work related to this manuscript were generously funded by CNPq (“INCT em Biodiversidade e Uso da Terra da Amazônia” # 574008/2008-0; # 563236/2010-8; and # 471342/2011-4) and FAPESPA (ICAAF 023/2011) to AA TD was supported by Doctoral fellowship from CAPES to the Postgraduate Program in Biodiversity and Biotechnology of the Bionorte Network (PPG-BIONORTE) at Universidade Federal do Pará/Museu Paraense Emílio Goeldi and PosDoctoral fellowship CAPES (88887.351860/2019-00) to the Postgraduate Program Science of Environment at Federal University of Tocantins The handling editor declared a past collaboration with one of the authors All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher We are grateful to the two reviewers and editor LN for improvements provided to our manuscript We thank the staff of the MPEG (Museu Paraense Emílio Goeldi Brazil) for allowing us to borrow tissues and study specimens under their care We also thank LGEMA-USP (Laboratory of Genetics and Molecular Evolution of Birds University of São Paulo) and Department of Ornithology of the Museu Nacional do Rio de Janeiro for sending tissue samples requested from their respective cryogenic collections TD thanks all the team of the ECOAVES/UFT Research Group and Renato Torres Pinheiro for all the logistical support TD is also grateful the Postgraduate Program Science of Environment at Federal University of Tocantins (in Portuguese PPG-Ciamb/UFT) for the post-doctoral internship The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fevo.2022.826394/full#supplementary-material Ab’sáber Os Domínios de Natureza no Brasil: Potencialidades Paisagísticas Google Scholar Agência Nacional das Águas [ANA] (2020). Mapa da Região Hidrográfica Tocantins-Araguaia. Available online at: https://www.gov.br/ana/pt-br/todos-os-documentos-do-portal/documentos-spr/mapas-regioes-hidrograficas/tocantins-araguaia-para-site-ana-a0.pdf (accessed on July 14 Google Scholar Molecular systematics and the role of the várzea-terra firme ecotone in the diversification of Xiphorhynchus woodcreepers (Aves: Dendrocolaptidae) CrossRef Full Text | Google Scholar Historical diversification of a terra-firme forest bird superspecies: a phylogeographic perspective on the role of different hypotheses of Amazonian diversification Conceitos de espécie e o eterno conflito entre continuidade e operacionalidade: uma proposta de normatização de critérios para o reconhecimento de espécies pelo Comitê Brasileiro de Registros Ornitológicos “Aves,” in Fauna da Floresta Nacional de Carajás: Estudos Sobre Vertebrados Terrestres “Instabilidade climaìtica e diversificaçaϸo de espeìcies na Amazônia,” in Cenários para a Amazônia: Clima “Aves,” in Os Animais da Tanguro Mato Grosso: Diversidade na Zona de Transição entre a Floresta Amazônica e o Cerrado Range extensions of birds in southeastern Amazonia doi: 10.1676/0043-5643(2000)112[0137:REOBIS]2.0.CO;2 CrossRef Full Text | Google Scholar “Molecular studies and phylogeography of Amazon tetrapods and their relation to geological and climatic models,” in Amazonia: Landscape and Species Evolution Araújo-Silva Phylogeography and diversification of an Amazonian understorey hummingbird: paraphyly and evidence for widespread cryptic speciation in the Plio-Pleistocene Mixing the waters: a linear hybrid zone between two riverine Neotropical cardinals (Paroaria baeri and P Phylogeography of the teiid lizard Kentropyx calcarata and the sphaerodactylid Gonatodes humeralis (Reptilia: squamata): testing a geological scenario for the lower Amazon-Tocantins Basins Azuaje-Rodríguez Molecular systematics of the Amazonian endemic genus Hylexetastes (Aves: Dendrocolaptidae): taxonomic and conservation implications “Morfogênese Fluvial,” in Hidrogeomorfologia: Formas Processos e Registros Sedimentares Fluviais Magalhães Junior (Rio de Janeiro: Bertrand Brasil) “Avian diversification in Amazonia: evidence for historical complexity and a vicariance model for a basic diversification pattern,” in Diversidade Cultural e Biológica da Amazônia D’incao (Belém: Museu Paraense Emílio Goeldi) “Molecular systematics and taxonomic revision of the Amazonian Barred Woodcreeper complex (Dendrocolaptes certhia: Dendrocolaptidae) with description of a new species from the Xingu–Tocantins interfluve,” in Handbook of the Birds of the World Special Volume: New Species and Global Index Google Scholar Birdlife International (2020). Species Distribution Data Request Version 2020. Available online at: http://datazone.birdlife.org/species/requestdis (accessed on Sep 10 Google Scholar A collection of birds from Presidente Kennedy and adjacent areas Tocantins: a further contribution to knowledge of Amazonian avifauna between the Araguaia and Tocantins rivers “Patterns and Processes of Diversification in Amazonian White Sand Ecosystems: Insights from Birds and Plants,” in Neotropical Diversification: Patterns and Processes Carnaval (Cham: Fascinating Life Sciences) Systematic revision of the Spotted Antpitta (Grallariidae: Hylopezus macularius) with description of a cryptic new species from Brazilian Amazonia Corrêa, A. G. (2017). WA2759636, Pyrrhura coerulescens Neumann, 1927. Available online at: http://www.wikiaves.com/2759636 (accessed on Sep 21 Google Scholar Historical biogeography and patterns of differentiation within the South American avifauna: areas of endemism CrossRef Full Text | Google Scholar and biogeography of the Black-capped/Tawny-bellied Screech Owl (Megascops atricapilla M “Buff-browed Chachalaca (Ortalis superciliaris) version 1.0,” in Birds of the World A taxonomic review of the Golden-green Woodpecker Piculus chrysochloros (Aves: Picidae) reveals the existence of six valid taxa Range extension and conservation of Psophia interjecta Griscom & Greenway 1937 (Aves: Psophidae) in the Tocantins-Araguaia interfluve “Aves da Amazônia Tocantinense e zonas ecotonais: composição biogeografia e conservação,” in Avanços nos Estudos da Biodiversidade e Biotecnologia na Amazçnia Arlequin (version 3.0): an integrated software package for population genetics data analysis CrossRef Full Text | Google Scholar Phylogeography of the Chestnut-tailed Antbird (Myrmeciza hemimelaena) clarifies the role of rivers in Amazonian biogeography Geomorfológica e Turística do Parque Estadual da Serra dos Martírios-Andorinhas: potencial para o geoturismo Pesquisas em Turismo e Paisagens Cársticas 2 Google Scholar The trans-riverine genetic structure of 28 Amazonian frog species is dependent on life history Fundamentos da Genética da Conservação Ribeiro Preto: Sociedade Brasileira de Genética Google Scholar A naming convention for geomorphic river types using the River Styles Framework Guia completo para identificação das Aves do Brasil Google Scholar Google Scholar Molecular Phylogenetics and Biogeography of Tanagers in the Genus Ramphocelus (Aves) PubMed Abstract | CrossRef Full Text | Google Scholar On the river effect in some forest birds of southern Amazonia Boletim do Museu Paraense Emílio Goeldi Google Scholar Contact zones between birds of southern Amazonia Google Scholar “Hypotheses to explain the origin of species in Amazonia,” in Diversidade Cultural e Biológica da Amazônia Hypotheses to explain the origin of species in Amazonia PubMed Abstract | CrossRef Full Text | Google Scholar Florestas estacionais e áreas de ecótono no estado do Tocantins classificação das fitofisionomias florestais e subsídios para conservação BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/95/NT Google Scholar Google Scholar Habitat Association Predicts Genetic Diversity and Population Divergence in Amazonian Birds Avian extinctions induced by the oldest Amazonian hydropower mega dam: evidence from museum collections and sighting data spanning 172 years Drainage analysis in geologic interpretation: summation Google Scholar A new species of river dolphin from Brazil or: how little do we know our biodiversity Instituto Brasileiro de Geografia e Estatística [IBGE] (2012) Manual Técnico da Vegetação Brasileira Brazil: Instituto Brasileiro de Geografia e Estatística Google Scholar Instituto Brasileiro de Geografia e Estatística [IBGE] (2019). Biomas e Sistema Costeiro-Marinho do Brasil: Compatível Com a Escala 1:250 000. Available online at: https://biblioteca.ibge.gov.br/index.php/biblioteca-catalogo?view=detalhes&id=2101676 (accessed on Oct 16 Google Scholar Google Scholar Geomorphology and Environmental aspects of the Araguaia fluvial basin Google Scholar Características físico-bióticas e problemas ambientais associados à planície aluvial do Rio Araguaia Google Scholar Phylogeny and phylogeography of squirrel monkeys (genus Saimiri) based on cytochrome b genetic analysis Paragominas: a quantitative baseline inventory of an Eastern Amazonian avifauna Google Scholar A cryptic new species of hummingbird of the Campylopterus largipennis complex (Aves: Trochilidae) Maldonado-Coelho refuges and population divergence of fire-eye antbirds (Pyriglena) in the Amazon Basin Historical relationships among Neotropical lowland forest areas of endemism as determined by mitochondrial DNA sequence variation within the Wedge-billed Woodcreeper (Aves: Dendrocolaptidae: Glyphorynchus spirurus) Redefining the Cerrado–Amazonia transition: implications for conservation CrossRef Full Text | Google Scholar Morphology and mitochondrial phylogenetics reveal that the Amazon River separates two eastern squirrel monkey species: Saimiri sciureus and S “Paleoclima e Paleoambiente do Cerrado Durante o Quaternário com Base em Análises Palinológicas,” in Paleontologia: Cenário de Vida – Paleoclimas Morfometria de sistemas lacustres da planície aluvial do médio rio Araguaia Avian distribution patterns in the Guiana Shield: Implications for the delimitation of Amazonian areas of endemism CrossRef Full Text | Google Scholar The dual role of Amazonian rivers in the generation and maintenance of avian diversity The role of physical barriers in the location of avian suture zones in the Guiana Shield Municípios de Belém e Ananindeua Belém: Museu Paraense Emilio Goeldi Google Scholar Brasil,” in Inventário Zoobotânico no Rio das Mortes Fauna e flora do Pantanal do Mortes-Araguaia Cabette (Nova Xavatina: Universidade do Estado de Mato Grosso) “Composição e vulnerabilidade da avifauna da Amazônia maranhense Brasil,” in Amazônia Maranhense: Diversidade e Conservação Oliveira (Belém: Museu Paraense Emilio Goeldi) Pacheco, J. F. (2005). WA1882554, Pyrrhura coerulescens Neumann, 1927]. Available online at: http://www.wikiaves.com/1882554 (accessed on Sep 22 Google Scholar An avifaunal inventory of the CVRD Serra dos Carajás project Google Scholar Annotated checklist of the birds of Brazil by the Brazilian Ornithological Records Committee Levantamento preliminar da avifauna do Campus da EMVZ da Universidade Federal do Tocantins com observações sobre a reprodução de algumas espécies Evolutionary history of Ramphastos toucans: molecular phylogenetics Annotated checklist of birds recorded between 1998 and 2009 at nine areas in the Belém area of endemism with notes on some range extensions and the conservation status of endangered species PubMed Abstract | CrossRef Full Text | Google Scholar Diversification and species limits in scale-backed antbirds (Willisornis Rambaut, A., and Drummond, A. J. (2009). Tracer version 1.5. Available online at http://beast.bio.ed.ac.uk/Tracer (accessed on April 05 Google Scholar “Suture-zones of hybrid interaction between recently joined biotas,” in Evolution Biology Google Scholar Contribution of river-created habitats to bird species richness in Amazonia CrossRef Full Text | Google Scholar A paleobiogeographic model for biotic diversification within Amazonia over the past three million years Molecular systematics and patterns of diversification in Pyrrhura (Psittacidae) with special reference to the picta-leucotis complex Sedimentação em rios entrelaçados e anastomosados CrossRef Full Text | Google Scholar Google Scholar Sistemas rio-planície de inundação: geomorfologia e conectividade hidrodinâmica Google Scholar The Araguaia River as an Important Biogeographical Divide for Didelphid Marsupials in Central Brazil “Molecular systematics and taxonomic revision of the Lineated Woodcreeper complex (Lepidocolaptes albolineatus: Dendrocolaptidae) with description of a new species from southwestern Amazonia,” in Handbook of the Birds of the World Composição e Vulnerabilidade da Avifauna do Leste do Estado do Pará Belém(Br): Museu Paraense Emílio Goeldi Google Scholar MrBayes 3: Bayesian Phylogenetic Inference Under Mixed Models The performance of phylogenetic algorithms in estimating haplotype genealogies with migration Google Scholar Molecular and plumage analyses indicate the incomplete separation of two woodpeckers (Aves Diversification history in the Dendrocincla fuliginosa complex (Aves: Dendrocolaptidae): Insights from broad geographic sampling Secretaria e Planejamento do Estado do Tocantins [Seplan] (2012). Atlas do Tocantins: Subsídios ao Planejamento da Gestão Territorial. Available online at: https://www.to.gov.br/seplan/atlas-do-tocantins/1asvwxbj530d (accessed on Sep 3 Google Scholar Rios e enchentes na Amazônia como obstáculo para a avifauna Atlas do Simpósio sobre a Biota Amazônica 5 Google Scholar versão revista e atualizada por José Fernando Pacheco Google Scholar Guia de Campo Avis Brasilis: Avifauna Brasileira Google Scholar Differentiation of Xiphocolaptes (Dendrocolaptidae) across the river Xingu Brazilian Amazonia: recognition of a new phylogenetic species and biogeographic implications Google Scholar O destino das áreas de endemismo da Amazônia Google Scholar A dynamic continental moisture gradient drove Amazonian bird diversification Refugial isolation versus ecological gradients CrossRef Full Text | Google Scholar biogeography and taxonomy of forest-falcons in the Micrastur ruficollis species complex (Aves: Falconidae) Taxonomy of the Pyrrhura perlata-coerulescens complex (Psittaciformes: Psittacidae) with description of a hybrid zone CrossRef Full Text | Google Scholar Birds of an Amazonia-Cerrado ecotone in southern Pará and the efficiency of associating multiple methods in avifaunal inventories Primers for a PCR-Based Approach to Mitochondrial Genome Sequencing in Birds and Other Vertebrates Global Geomorphology: An Introduction to the Lanforms Google Scholar Google Scholar and phylogeographic breaks in North America Google Scholar Cryptic speciation in the White-shouldered Antshrike (Thamnophilus aethiops Aves-Thamnophilidae): the tale of a transcontinental radiation across rivers in lowland Amazonia and the northeastern Atlantic Forest Padrões Espaciais em Comunidades de Aves Amazônicas Belém(Br): Museu Paraense Emílio Goeldi/Universidade Federal do Pará Google Scholar Levantamento e conservação da avifauna na zona urbana de Marabá Google Scholar A narrative of travels on the Amazon and Rio Negro Google Scholar and the role of rivers as drivers of speciation in Amazonian birds A rapid ornithological assesment from the kayapó indigenous reserve east of the rio Xingu at aldeia kubenkrankei Google Scholar Variability within and among Natural Populations Google Scholar DAMBE: Data analysis in molecular biology and evolution PubMed Abstract | CrossRef Full Text | Google Scholar Morais F and Aleixo A (2022) Comparative Phylogeography of Birds Across the Tocantins–Araguaia Interfluve Reveals a New Biogeographic Suture in the Amazon Far East Copyright © 2022 Dornas, Dantas, Araújo-Silva, Morais and Aleixo. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) *Correspondence: Alexandre Aleixo, YWxleGFuZHJlLmFsZWl4b0BoZWxzaW5raS5maQ== fervedouros are unique karst springs that provide a cool oasis in Brazil’s dry Cerrado Fervedouro do Ceica is the biggest such spring known in Jalapão A biodiverse state park in South America’s largest savanna is home to natural springs Swimming in a fervedouro feels a bit like floating in a pool of champagne as water from a subterranean river gurgles up from a rupture in the earth Although its Portuguese name translates as “boiler,” a fervedouro isn’t a hot spring But the unique appearance of the fervedouros is unlike any other karst springs in the world which separates the Amazon from the Atlantic Coast The park was left virtually untouched by the agricultural industry for centuries capital of the Brazilian state of Tocantins and drive five to six hours eastward on unpaved roads (Related: Our Best of the World 2021 list will inspire your next journey.) Its inaccessibility kept Jalapão obscure—until the debut of O Outro Lado do Paraíso (The Other Side of Paradise) a popular 2017 soap opera that set its characters’ love triangles and land disputes in the park The show tripled tourism to the region practically overnight Sunset from Jalapão’s golden dunes gives another perspective on one of Brazil’s newest parks The dunes were formed by the natural erosion of a nearby mountain Brazilian audiences were especially captivated with images of the rare fervedouros A constant upflow of clear water buoys swimmers Many travelers never get beyond this pocket of paradise including turquoise waterfalls and golden sand dunes tourist dollars were flowing into the area surrounding the park for the first time and new businesses launched in the nearby towns of São Felix and Mateiros (Related: In Mexico’s vibrant forests, locals adapt to a year without tourists.) most of the park will likely remain a wild in keeping with its unofficial catchphrase: Jalapão is brutal some people called on the government to pave more of the main accesses but others worried about the implications new roads might have on the park’s sensitive ecology (Related: This map shows millions of acres of lost Amazon rainforest.) of which there are less than 250 in the world; and any new species yet to be discovered A limit of eight people at a time keeps the Fervedouro do Rio Sono from being overwhelmed “The [current] road makes it slow for cars to move so there’s enough time for animals to avoid cars imagine the speed people could achieve,” Napolitano says is suffering as a result of being disturbed by human presence The tourism boom has economically benefited the region by creating jobs and increasing revenue for businesses operating in the park And although many are calling for hard lines to be drawn during this sensitive period of growth a tourism and environmental management specialist with the WWF believe that this moment is an opportunity one of the last villages visitors see before entering Jalapão State Park in this remote region of Brazil More than 40,000 square miles have been destroyed in the past decade alone (Related: Inside the faltering fight against illegal Amazon logging.) Less than 3 percent of the Cerrado is under legal protection, but Lobo hopes that the increased tourism to parks like Jalapão may help raise awareness of the Cerrado among domestic travelers, who might then advocate for more preservation of Brazil’s wild places. Despite Brazil’s 371 million acres of protected land, Brazilians have never had much of an off-road vacation culture. But when friends bring home stories of wild macaws, blue waterfalls, and majestic plateaus, the untouched beauty of Brazil’s interior becomes a little better understood and a lot more intriguing. With the reopening of the park and the announcement of new investments in roads and other tourism infrastructure, Jalapão is expected to become the postcard destination of the Tocantins as well as the entire Cerrado, bringing a new era of awareness to a region long overshadowed by the rainier ecosystem next door. Grey Glacier stretches nearly 12 miles through a landscape of spindly Patagonian peaks filled with whipped and blue-tipped miniature mountains ice chunks float silently like pieces of fallen sky somber evidence of the mighty glacier’s quickening retreat Take a boat ride or kayak to its towering terminus or hike the lake’s perimeter for incredible panoramic views One of several frosty fingers in the Southern Ice Fields within remote Torres del Paine National Park In a remote corner of Venezuela the Churún River freefalls 2,600 feet off the edge of cloud-capped Auyán-tepui to form Angel Falls it’s the world’s highest uninterrupted waterfall Unlike other massive cascades that roar and rumble where they hit the ground Angel Falls’ streams dissipate into a fine mist casting off colorful rainbows along its enormous vertical drop The river resumes at the mountain base and continues through jungle to Canaima camp the starting point for most excursions to the falls Just outside Quito the Avenue of Volcanoes contains seven sky-scraping points topping 17,000 feet See the entirety of famed Cotopaxi’s perfect conical shape from the reforested pine and cypress slopes of lesser neighbor Rumiñahui Volcano (it tops out at 15,500 feet) navigate through the wild terrain past grazing alpacas with a drive south along the Pan American Highway Like ruffled sheets of white sand, the rolling Lençóis Maranhenses dunes stretch as far as the eye can see heavy rains and impermeable bedrock conspire to break up the monotony trapping sparkling blue-green pools between the mounds The desolate landscape in northern Maranhão state sits just inland from the Atlantic and was protected as a national park in 1981 In desolate Paracas Natural Reserve where subtropical desert meets Peru’s chilly southern coast seafoam blue-green waters of the South Pacific collide with Red Beach This eye-popping combo of complementary colors was made possible by eons of waves pummeling nearby Punta Santa Maria massif turning its pink granodiorite rock into sand which pulses nutrient rich water along the coast the colorful shoreline is also a hotbed of life where orcas and some 225 species of migratory birds thrive Sunbaked Isla del Sol wows with white sand beaches and rocky cliffs that could be mistaken for the Mediterranean if it weren’t for the distant snowy-mountain views While most islands’ shores are at sea level Its shoreline rests at a cool 12,500 feet in the southern part of ancient Lake Titicaca The island’s beauty has been an open secret for centuries; head inland to explore the forest-claimed Inca ruins that dot the Island A profusion of green beckons from Brownsberg Nature Reserve where more than 1,500 plant species blanket the slopes of a high plateau Tucked within one of the continent’s least visited countries you’ll share the wild Guinean moist forest with black bearded saki and howler monkeys by Tula Connell | Mar 23 Indigenous community members and CUT union leaders in Brazil campaigned to end the Araguaia-Tocantins waterway dredging project that would have damaged livelhoods and the environment Brazilian communities along a river near the Amazon are celebrating the government’s decision to halt a blasting and dredging project that could destroy their livelihoods and severely damage the environment the Public Prosecutor’s Office recommended that the Brazilian Institute of the Environment and Renewable Natural Resources (IBAMA) suspend its preliminary license for the Araguaia-Tocantins waterway project in the state of Pará the government cited the absence of prior consultation with residents who would be impacted especially Indigenous communities and quilombolas and the lack of information on the effects of the project on the communities ignoring several government agency recommendations Key to Success: Mobilizing a Diverse Coalition Members of the Caravan in Defense of the River Tocantins meet with residents of Nova Ipixuna to discuss a proposed waterway project that threatened livelihoods and the environment it is really important to connect to the diversity around us,” Foro said The campaign was victorious because “we created a grand alliance between the unions and with other movements And that alliance is what gave us strength formed the Caravan in Defense of the Tocantins River to raise awareness about the negative impacts of the waterway construction and demand that the government honor international treaties respecting Indigenous and Tribal People’s right to safeguard and manage the natural resources on their lands through riverside meetings and in online forums With its strength in workers’ collective voice the Brazilian labor movement was well-positioned to respond to the needs of workers and their communities including the impact of climate change and environmental degradation on jobs and communities “The unions in those cities are kind of seen as the principal organization in the social movements,” she said they were able to be an umbrella organization and give us support.” who recently was selected by the new administration of President Luiz Inácio “Lula” da Silva to serve in the Ministry of Women says “many women will be impacted by this project and through my role now at the Ministry of Women I plan to be alongside the women who are going to be impacted by this project.” “Everyone knows that this recommendation doesn’t resolve the issue,” she says “The problem is still there and it will be a long journey There still will be something in the middle between this recommendation.” While she is hopeful about working with the new administration whose election with the support of union and community groups opened dialogue with historically marginalized communities along the Amazon Foro is keenly aware they must work to ensure the democratic process thrives “It’s important that we continue the fight Even with a democratically elected government that is representative now there is still pressure that is coming from all different sides but also there is the pressure from large companies [email protected] 2024: To advance the plan to eliminate trachoma as a public health problem in the Americas the Pan American Health Organization (PAHO) and the Government of Canada are developing a project in 10 countries in the Region the project is being implemented in cooperation with the Ministry of Health in the Special Indigenous Health District of Tocantins (DSEI) surveys (examinations and data collection) were conducted with more than 3,000 people PAHO/WHO Officer for Malaria and Neglected Infectious Diseases explains that "we’re conducting surveys to provide a better understanding of the local situation to understand the transmission of the disease." a technical consultant at the Department of Communicable Diseases of the Secretariat of Health Surveillance and Environment (SVSA) highlights that the area was chosen because "it presented a history of trachoma cases in addition to not having participated in the national trachoma prevalence survey for validation of trachoma elimination as a public health problem the surveys promoted "institutional exchange with intercultural and gender approaches." The information collected was sent daily by the teams via smartphone to Tropical Data The results will be presented later to build a proposal for an intersectoral intervention with an emphasis on intercultural and gender issues involving the participation of the local population an infectious eye disease and the leading cause of blindness among women in poor and remote areas of Latin America where it affects around 5.6 million people indigenous populations in the Amazon basin are disproportionately affected by the disease It is estimated that women are twice as likely as men to be affected by the disease and up to four times more likely than men to go blind due to trachoma including traditional gender-based caregiving roles in endemic communities and limited access to basic health services Caused by the bacterium Chlamydia trachomatis trachoma is transmitted both by flies (mechanical vectors) and through direct contact with the eye secretions of infected people Factors that favor transmission include overcrowding and poor sanitary and hygiene conditions a pilot was carried out to align the teams and adjust the methodology recorders trained by the Tropical Data/ICTC trachoma prevalence survey training system and local health teams from the Ministry of Health two of which had an additional professional for blood and swab collection for laboratory evaluation samples with the aim of identifying the situation and the presence of chlamydia in the community The first stage of the household approach began with an initial contact where the professionals introduced themselves and asked the residents for permission to enter and detail the work being carried out The surveys also assessed environmental issues to which people are exposed The analyses will contribute to accelerating the implementation of PAHO/WHO's integrated package of interventions against trachoma which includes interventions in S-surgery for TT management and E-improved environmental conditions (improved access to water and basic sanitation) to prevent infection and interrupt disease transmission EuroChem Grows: The story of our expansion into Brazil If we are setting our sights on becoming the world’s leading fertilizer producer we have a duty to serve our customers better than anyone else in the world This ambitious growth target inevitably involves expansion into the territories where our customers need us so we can supply them with the right products season after season EuroChem views acquisitions as an area of extremely high corporate and social responsibility and will only venture into markets where we can have a long-term positive effect on people’s lives calling upon our track record as a responsible custodian of important production assets to bring proven global expertise and add sustainable value to projects The expansion of our distribution network into Brazil is a story of carefully targeted and painstakingly managed M&A activity with the concerns of the local workforce and the health of the regional economy guiding our decision-making throughout we announced the full acquisition of Fertilizantes Tocantins (FTO) a fast-growing fertilizer blender and distributor strategically located in Brazil’s emerging fertile farming regions in the North with a network reaching up to 5,000 customers As EuroChem had already been a major supplier of raw materials and finished product to FTO for onward blending and distribution aided by the need to retain staff and provide new training and career growth opportunities for Young Specialists which contributes to Brazil’s talent pool and industry expertise in the life-critical agriculture sector now known as EuroChem Fertilizantes Tocantins remains on its fast growth trajectory following the transaction with increased sales converting to greater tax contributions for state and federal coffers EuroChem in Brazil following the integration of FTO: “The full acquisition prompted many changes new challenges and also countless opportunities for development We have experienced serious gains in efficiency by improving our processes EuroChem is a global company with ambitious growth targets which encourages and requires skills such as resilience It is a unique moment for those professionals who are driven to learn and build the future together with the company dynamic company with great potential to expand in an essential market for Brazil.” Daniela Machado “EuroChem has enabled us to expand our portfolio especially those products with higher added value we have nearly tripled the sale of our premium line of fertilizers in Brazil and this generates value not only for the company This has a direct impact on productivity and the quality of farmer’s products We have already noticed a rise in productivity in plantations we have made fertilizers more efficient through technology.” Rodrigo Grabalos Spurred on by the successful addition of FTO to the EuroChem family the company looked to anchor its presence in Brazil with the 2021 acquisition of the highly promising Serra do Salitre phosphate fertilizer project comprising a mine and production plants in Minas Gerais Serra do Salitre is an advanced-stage integrated upstream phosphates project comprising an open pit phosphate mine with more than 350 million metric tonnes (MMT) of reserves; and a 1 MMT-per-year manufacturing plant for MAP/NP and SSP/TSP products which is due to come on stream in 2023 the acquisition of Serra do Salitre “creates the potential for phosphates and complex fertilizer production in Brazil and significantly improves our competitive position in Brazil enabling us to leverage the extensive blending and distribution capabilities brought by the acquisition of Fertilizantes Tocantins.” Due to the nature of Brazil’s crop mix – 44% of which is soya – there is a higher demand for phosphate-based fertilizers compared to other regions since half of the phosphate fertilizers consumed within the country are currently covered by imports Brazil is one of the world’s biggest fertilizer markets and phosphates are considered to be one of the three primary nutrients all of which plants require for healthy growth EuroChem is one of only three companies in the world with in-house production capacity in all three primary nutrient groups and its cost-effective production base combined with access to world-class logistics makes it a natural partner to supply Brazilian soils