Volume 18 - 2024 | https://doi.org/10.3389/fncel.2024.1379540 Crystallin βb2 (crybb2) is upregulated in regenerating retinas and in various pathological conditions of the retina the role of crybb2 in this disease is largely unknown we used recombinant crybb2 (rcrybb2) as intravitreal treatment of B10.RIII mice prior to immunization with human interphotoreceptor retinoid-binding protein peptide 161–180 (hIRBPp161-180) in complete Freund’s adjuvant (CFA) and concomitant injection of pertussis toxin (PTX) to induce experimental autoimmune uveoretinitis (EAU) more beta III-tubulin (TUBB3) + and RNA-binding protein with multiple splicing (RBPMS) + cells were found in the ganglion cell layer of the retina than in EAU eyes suggesting a loss of retinal ganglion cells (RGC) during the development of EAU the number of glial fibrillary acidic protein (GFAP) + cells increased in EAU eyes RGCs were better protected in EAU eyes treated with rcrybb2 both retinal ganglion cells and retinal endothelial cells stained positive for TUBB3 indicating that TUBB3 is present in naïve B10.RIII mouse eyes not exclusive to RGCs A significant decline in the number of RBPMS-positive retinal ganglion cells was observed in retinal flatmounts from EAU retinas in comparison to naïve retinas or EAU retinas with intravitreal rcrybb2 treatment Whereas no significant decrease in TUBB3 levels was detected using Western blot and RT-qPCR increased in EAU mice compared to naïve mice Level of Bax and Bcl2 in the retina was altered by treatment suggesting better cell survival and inhibition of apoptosis our histologic observations of the eyes showed no change in the incidence and severity of EAU nor was the immune response affected by intravitreal rcrybb2 treatment these results suggest that intravitreal injection of rcrybb2 reduces retinal RGC death during the course of EAU independent of local or systemic autoimmune responses treating posterior uveitis with rcrybb2 to protect RGCs may offer a promising novel therapeutic strategy Crystallin α, β, and γ have all been shown to have protective functions for retinal ganglion cells (RGCs). Expression of crystallin increases in the inner segments of photoreceptor neurons in retinas affected by oxidative damage, suggesting that it is involved in RGC axonal regeneration (Bohm et al., 2013; Lee et al., 2011; Li et al., 2021; Thanos et al., 2014) Previous studies have shown that crybb2 has a strong neuroprotective and regenerative potential in RGCs, similar to the effect of lens injury (Fischer et al., 2008). However, axon regeneration is a multifactorial process involving several factors in addition to crystallin (Liedtke et al., 2007) A meta-analysis has revealed a strong association between CRYBB2 expression in the human cortex and certain mental illnesses, including attention-deficit hyperactivity disorder, autism, major depressive disorder, bipolar disorder, and schizophrenia (Graw, 2017; Kim et al., 2014) However, previous studies have shown that oxidative stress, peroxynitrate-mediated nitration of photoreceptor mitochondrial proteins and cytochrome c, also develops in the early stages of EAU, even before leukocytes have infiltrated the retina, suggesting that such early responses may constitute important initial pathologic effector events in EAU-related photoreceptor damage (Saraswathy et al., 2010) A previous study found that αA- and βB2-crystallins are not only present in the cytoplasm of retinal cells, but that they are also expressed in the mitochondria during the early stages of EAU and that this is associated with the prevention of retinal cell death (Saraswathy and Rao, 2009). While several studies have demonstrated the role of αA-crystallin in EAU (Rao et al., 2008) little information is available on the role of the β/γ-crystallins in progression of EAU or as to whether crybb2 potentially protects the retina during the development of EAU we have now elucidated the potential influence of intravitreally injected rcrybb2 on the immune responses that influence EAU pathology and investigated its impact on retinal architecture Male B10.RIII mice (8–12 weeks of age) were purchased from Charles River (Sulzfeld Germany) and housed under an inverted 12:12-h light–dark schedule Animal experiments conformed with the German regulations of the Society for Laboratory Animal Science (GV-SOLAS) and the European Health Law of the Federation of Laboratory Animal Science Associations (FELASA) The protocol (84–02.04.2015.A252) was approved by the North Rhine-Westphalia State Agency for Nature All experimental procedures were conducted in accordance with the Institutional Animal Care and Use Committee and with the Association for Research in Vision and Ophthalmology resolution on the use of animals in research Treatments of mice eyes were performed under general anesthesia using a ketamine (2 mg/kg per body weight; Ceva-Sanofi Germany) and xylazine (1 mg/kg per body weight; Ceva-Sanofi) injected intraperitoneally the sections were deparaffinized in xylene 95 and 80%) and then rinsed in distilled water heat-induced antigen retrieval was conducted using sodium citrate buffer (10 mM sodium citrate heated to 95°C for 30 min).The sections were then incubated for 24 h with the primary antibody targeting beta III-tubulin (TUBB3 RNA-binding protein with multiple splicing (RBPMS United States) glial fibrillary acidic protein (GFAP Germany; 1:400 in 10% FCS) or polyclonal rabbit anti-crybb2 the slides were incubated (1:200 in 10% FCS) for 30 min at room temperature (RT) with the secondary antibody (anti-rabbit Cy2 antibody; Dianova The retinas (N = 4 per group) were initially fixed for a period of 4 h with 4% PFA in 1x PBS at a temperature of 4–8°C the retinal flat mounts were treated with 30% sucrose in 1xPBS at 4°C for 24 h and thereafter blocked with goat serum for 1 h at room The flat mounts were stained overnight with a polyclonal rabbit anti-RBPMS antibody or a monoclonal rabbit anti-CD31/PECAM1 and monoclonal mouse anti-TUBB3 (RBPMS: 1:200 dilution Germany) in PBST-X (0.3% Triton X-100 in PBS) the flat mounts were incubated for 1 h with goat anti-mouse AlexaFluor™ 488 (1:1000 dilution Germany) and goat anti-rabbit AlexaFluor™ 594 (1:1000 dilution the retinas were meticulously prepared on diagnostic microscope slides (Thermo Scientific) the flat mounts were embedded with Mowiol (Carl Roth) The sections were examined under a fluorescence microscope (Axiophot Germany) and three randomly selected regions per retina were photographed The number of RBPMS-positive cells in each region was enumerated in a masked fashion and the means were calculated for utilization in the statistical analysis After subtracting the specific background density in the surrounding region the protein density of a fixed area was determined for each spot The density of the spots was correlated and corrected for the relative density of the respective application control The spot density of the control group samples was defined as the respective reference value and the relative values of the other groups were calculated Total RNA was isolated from pooled retinas [naïve mice n = 5; EAU (untreated) n = 5 EAU + PBS (vitreous) n = 5; EAU + rcrybb2 (vitreous) n = 5] RNA was isolated using Gene Elute Mammalian Total RNA Miniprep Kit (Sigma-Aldrich) according to the manufacturer’s protocol RNA was quantified using a UV/visual spectral photometer (NanoDrop ND-1000 The High Capacity cDNA Reverse Transcription Kit (ABI United States) was used to reverse transcribe 1 μg of total RNA into complementary DNA (cDNA) The RT-qPCR primer pairs designed for SYBR-Green-based RT-qPCR were used for the analysis: 5´-GCCCCAGCATGCGACCTCTG-3′; reverse Bcl-2-associated X-protein (Bax; NM_007527): forward 5´-GCTGAGCGAGTGTCTCCGGC-3′; reverse 5´-GGGGAGTCCGTGTCCACGTCA-3′ beta III-tubulin (Tubb3; NM 22152): forward 5′- CATCAGCGATGAGCACGGCATA-3′; reverse 5′- CACCTACAGGAAATTGCTGGAGG −3′; reverse 5′- CCACGATGTTCCTCTTGAGGTG-3´ The level of various cytokines, including interferon (IFN)-γ, IL-6, IL-10, and IL-17, in cell culture supernatants were examined by using commercially available ELISA kits [OptEIA (PharMingen, Hamburg, Germany); IL-17 Duoset (R&D Systems GmbH, Wiesbaden- Nordenstadt, Germany); Bauer et al., 2017] Differential analysis between two groups (EAU group vs naïve group) was performed using the “Limma” R package in the online platform The classical Bayesian algorithm was used to calculate the differentially expressed genes in the GSE144168 dataset The absolute value of Log2Fold > 1.0 and adj p < 0.05 were used as significance indicators Student’s t-test (comparison of two groups) or one-way ANOVA (comparison of three or more groups) was used to analyze normally distributed data Welch-test was used when homogeneity of variance was not adequate a nonparametric test was used (U-Test for comparison of two groups; Kruskal-Wallis-test for comparison of three or more groups) Relative protein densities in Western blots are shown as mean ± SEM values p ≤ 0.05 was considered as statistically significant Localization of rcrybb2 in the eyes after injection into naïve mice Paraffin-embedded sections of eyes (N = 3 at each time point) after injection of 3 μg/2 μL rcrybb2 and immunofluorescence staining with an antibody directed against crybb2 showing pronounced fluorescent staining Paraffin-embedded sections of mouse eyes at 0 (A) and 21 days (C) after injection of 3 μg/2 μL rcrybb2 showing that rcrybb2 could still be detected after 21 days (D) Paraffin-embedded section of an untreated mouse eye Expression and localization of TUBB3 (green) RBPMS (red) and glial fibrillary acidic protein (GFAP; red) in naïve retinas or in retinas with EAU and prophylactic treatment with 2 μL rcrybb2 (3 μg/2 μL) or PBS as control Some mice were also treated with a single intralenticular injection of PBS as a positive control Mice were immunized 3 days later and eyes were collected 21 days after immunization The expression of retinal (A,D) TUBB3 (green) (B,E) RBPMS (red) and (C,F) GFAP (red) was determined by immunofluorescence staining of sections (7 μm) from mice that were naive or EAU + rcrybb2 (vitreous) on day 21 p.i Positive cells were counted in 3 different section per eye (N = 5 eyes per group) and data are expressed as mean ± SD (G,H,I) The number of retinal RBPMS+ cells (red) in naïve EAU (untreated) and EAU(rcrybb2)-treated retinas was determined by flatmount staining (N = 4 per group) (D–F,J) ANOVA with Tukey’s post-hoc test: ∗p < 0.05 ∗p < 0.05; ∗∗p < 0.01; ∗∗∗p < 0.001; ∗∗∗∗p < 0.0001 A similar result was observed when EAU eyes intravitreally injected with PBS were used instead of untreated EAU eyes as a control [TUBB3+: EAU + rcrybb2(vitreous; 15.8 ± 1.6) vs EAU + PBS(vitreous; 6.4 ± 0.45): p < 0.0001; EAU + PBS(lens; 11.2 ± 1.1) vs EAU + PBS(vitreous; 6.4 ± 0.45): p < 0.001] EAU eyes injected with rcrybb2 exhibited a higher number of TUBB+ cells compared to EAU eyes in which PBS was injected into the lens [TUBB3+: EAU + rcrybb2(vitreous; 15.8 ± 1.6) vs EAU + PBS(lens; 11.2 ± 1.1): p < 0.05] The cell count of TUBB3-positive cells in the EAU + crybb2 group was found to be significantly higher than that observed in the naive group [TUBB3+: EAU + rcrybb2(vitreous; 15.8 ± 1.6) vs. naive (11.8 ± 1.64): p < 0.05; Figures 2A,D; Table 1] This observation suggests that survival of RGCs in the rcrybb2 group and of lens-injured eyes is increased compared with the EAU-untreated control group or the group receiving an intravitreal injection of PBS RBPMS and CD31/PECAM1 in naïve retinas and in retinas with EAU RBPMS (red) in (A) naïve retinas and (B) retinas with EAU was determined by flatmount staining The results shows that TUBB3 is expressed in retinal ganglion cells (RGCs) but also in (C) CD31+ endothelial cells We then performed Western blotting (Figures 4A,C) and RT-qPCR (Figures 4B,D) to determine the retinal expression levels of TUBB3 and GFAP in the different experimental groups at 21 days p.i. (Table 2) Western blot analysis and RT-qPCR graphs of correlated relative densities Blots of (A) TUBB3 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and their correlated relative densities each with the corresponding control containing GAPDH (B) mRNA level of Tubb3 as measured by RT-qPCR analysis Blots of (C) GFAP and GAPDH and their correlated relative densities each with the corresponding control with GAPDH (D) mRNA level of Gfap as measured by RT-qPCR analysis Retinal samples were obtained from naïve eyes Relative optical densitometry revealed not significantly changed levels of TUBB3 in the control group with EAU compared to the naïve mouse group not receiving hIRBPp161-180 immunization the differences also did not reach the level of significance A similar picture was found when RT-qPCR was used to semi-quantify the expression levels Tubb3 (Table 2) Relative optical density of Western blotting showed increased levels of GFAP in untreated EAU mice compared with retinas from naïve mice [naïve (100.00 ± 0.00) vs. EAU (untreated; 165.64 ± 24.82): (p < 0.05); Table 2] Thus, we conducted a comparative RT-qPCR analysis to assess modulation of Bax/Bcl-2 levels in the retinas of B10.RIII mice with EAU on day 21p.i. as shown in Figure 5. Bax mRNA levels were slightly increased in the EAU (untreated) control group compared to the naïve mice [naïve (1.00 ± 0.00) vs. EAU (untreated): p < 0.05; Figure 5] mRNA level of the pro- or anti-apoptotic proteins Bax and Bcl-2 in the retina after treatment with rcrybb2 Gene transcription of Bax and Bcl-2 was measured by RT-qPCR analysis Retinal samples were isolated from naïve mice Severity of EAU after intravitreal injection of 2 μL rcrybb2 (3 μg/2 μL) or PBS as control The lens is a site of crystallin origin; therefore some mice were treated with a single intralenticular injection of PBS as a positive control Statistical differences of EAU scores of the eyes between groups were calculated by using the Kruskal-Wallis test with post-hoc analysis The analysis showed that there was no significant difference between the different treated groups the differences between the left (treated) and right (untreated) eyes were not statistically significant as determined by U-test (A) Histologic EAU scores of the different groups: EAU (untreated) EAU + rcrybb2 (vitreous; N = 20 each group) (B) Representative section of a mouse retina with EAU (clinical score: 2) showing retinal folding untreated control mice (n = 20) showed moderate EAU scores for retinal detachment and photoreceptor cell damage at day 21 (EAU score = 2) Intravitreal treatment with rcrybb2 did not improve EAU scores compared to the untreated control mice The differences in untreated control mice as compared to those that received a PBS injection into the vitreous or a PBS injection into the lens also did not reach the level of significance in our experiments (Kruskal-Wallis test: n.s.) The severity of EAU was similar in the contralateral untreated (right) eye in all groups, which also did not reach the level of significance (Kruskal-Wallis test: n.s.). Finally, the severity of EAU in the left (treated) eye was compared with that in the right (untreated) eye. Statistical significance was not reached (Figure 6; Table 4) Influence of intravitreal rcrybb2 injection on hIRBPp161-180 specific immune responses Splenocyte supernatants from immunized mice were collected 24 h after stimulation and assayed for the indicated cytokines using ELISA kits Data are expressed as mean ± SEM ANOVA with Tukey’s post-hoc test: ∗p < 0.05 level of Tubb3 and Gfap was significantly higher in the retinal endothelium after inducing EAU Figure 8. Increased level of Tubb3 and Gfap in retinal endothelial cells in mice with EAU. Single-cell RNA sequencing (scRNAseq) analysis of endothelial cells from eyes with EAU (DE, diseased endothelium, N = 3) or healthy control eyes [NE, naïve endothelium, N = 4; GSE144168, reported by Lipski et al. (2020)] (A,B) Level of Tubb3 and Gfap calculated using the classical Bayesian algorithm of the “Limma” R package of Network Analyst 3.0 P: ∗∗p < 0.01 little is known about the role of crybb2 in the pathogenesis of EAU a single intravitreal injection of rcrybb2 3 days before immunization into naïve B10.RIII mice was used to evaluate the neuroprotective function of rcrybb2 in the development of EAU It was hypothesized that prophylactic administration of crybb2 would have a greater impact than therapeutic administration in which EAU is allowed to develop before being treated We therefore used prophylactic treatment to demonstrate its potential effectiveness The results show that intracellular fluorescence staining of injected rcrybb2 (as found in the vitreous and in the RGC layer but not in the deeper retina) remained stable for more than 21 days in vivo rcrybb2 was not administered again during our study In our experiments, the markers TUBB3 and RBPMS were used to specifically identify RGCs in the ganglion cell layer of the retina in sagittal eye sections (Jiang et al., 2015) Given the uneven distribution of retinal ganglion cells in the retina sections from three different regions of the eye (N = 5) were utilized with three different regions analyzed (twice in the midperiphery of the retina and once in the center of the eye) ensuring sufficient distance to the optic nerve head (at least 500 μm) The mean values and associated statistical parameters were then calculated from the aforementioned data The analysis showed that RGCs were significantly reduced in the retinas of mice with EAU compared to naïve mice Eyes into which rcrybb2 was injected intravitreally showed significantly more TUBB3- and RBPMS-positive cells in the retina than untreated mice with EAU A similar picture was also found after lens injury They are found throughout the entire central nervous system (CNS) and perform essential and complex functions in a healthy CNS Astrocytes can be detected by a mAb directed against GFAP Our results showed an increase in GFAP-positive cell after immunization while a decrease in these cells was observed following intravitreal injection of crybb2 These data suggest that rcrybb2 or lens injury (which was used as a positive control) may protect RGCs from cell death after EAU induction The data from the flat mount analysis are in agreement with the results obtained from the mediosagittale histologies The data demonstrate that eyes with EAU that have been prophylactically treated with rcrybb2 or naïve eyes contain a significantly greater number of RBPMS+ retinal ganglion cells than eyes with untreated EAU This evidence provides support for the hypothesis that treatment with rcrybb2 protects against degeneration of retinal ganglion cells the results clearly demonstrate that TUBB3 is not exclusively expressed in RGCs in murine retinas but rather that CD31+ endothelial cells also express it constitutively The data presented in this study are corroborated by single-cell RNA sequencing (scRNA-seq) data from a publication, which investigated retinal endothelia in the experimental autoimmune uveitis (EAU) model in C57BL/6 mice. The data demonstrate the constitutional transcription of Tubb3 in endothelial cells in naive retinas and an elevated expression in EAU eyes (Lipski et al., 2020) In a rat glaucoma model, it was demonstrated that while the number of RGCs declined during the progression of glaucoma, the overall level of TUBB3 protein remained elevated. The authors of the study were able to detect the expression of TUBB3 in desmin-, PDGFR-β- and α-SMA-positive pericytes, as well as in endothelin-1-positive endothelial cells in eyes affected by glaucoma (Prokosch et al., 2020) In a separate study, the actual proportion of RGCs was determined by using active tracers (fluorogold or hydroxystilbamidine methanesulfonate), and the results were compared with those obtained using TUBB3 and other markers in a range of species, including mice and rats (Nadal-Nicolas et al., 2023) the proportion of RGCs recognized by the antibody against TUBB3 exceeded 100% when the active tracer fluorogold was employed the average proportion of RGCs (with active tracer hydroxystilbamidine methanesulfonate) stained with the antibody against TUBB3 was 83% These data contradict our flat-mount results showing that endothelial cells express TUBB3 It is recommended that these disparate outcomes be taken into account in future research employing TUBB3 as a marker for retinal ganglion cells (RGCs) and measuring the ratio of Bax/Bcl2 in RGCs may be useful to determine the ratio of apoptosis to survival Our results showed that inducing EAU by immunization significantly increased Bax expression in the retina while the expression of Bcl-2 was significantly decreased compared with naïve control mice Bcl-2 expression in the retina was significantly increased after intravitreal administration of rcrybb2 These results suggest that intravitreal administration of rcrybb2 may alter the homeostasis of EAU-affected retinas to support cell survival and to inhibit cell death of RGCs in the mouse retina We found that intravitreal rcrybb2 treatment was unable to significantly alter the systemic immune response against hIRBPp160-180 as determined with isolated splenocytes We conclude that prophylactic injection of rcrybb2 may have little or no effect on the systemic cellular immune response and EAU These results suggest that rcrybb2 may act primarily by reducing apoptosis in RGCs rcrybb2 may act downstream of leukocyte activation There are some limitations in the present study we would like to address Although prophylactic treatment with crybb2 did not affect the severity of EAU our data suggest that it improved RGC survival An electroretinogram (ERG) could be used as a functional test to demonstrate improvement in visual function The specific ERG waves affected by RGC loss should depend on the type of RGCs lost Loss of magnocellular RGCs should primarily affect the b-wave whereas loss of parvocellular RGCs should primarily affect the oscillatory potentials A possible alternative approach would have been to mimic the effect of rcrybb2 ex vivo by using primary retinas and astrocytes in conjunction with rcrybb2, as has recently been shown (Liu et al., 2022) intravitreal administration of rcrybb2 showed a prolonged presence in the ocular tissues Although the treatment was unable to reduce the incidence and severity of EAU our results indicate that rcrybb2 was able to protect retinal RGCs from degeneration This protection seems to be independent of the local or systemic immune responses Although the clinical relevance of intravitreal administration of rcrybb2 has not been clearly defined yet it may offer a promising novel therapeutic strategy to avoid RGC loss in particular in degenerative diseases The following previously published datasets were used: Lipski, D.A., Willermain, F. (2020), Retinal endothelial cell phenotypic modification during experimental autoimmune uveitis: a transcriptomic approach, available at: https://www.ncbi.nlm.nih.gov/geo/download/?acc=GSE144168 The raw data supporting the conclusions of this article will be made available by the authors The animal study was approved by North Rhine-Westphalia State Agency for Nature The study was conducted in accordance with the local legislation and institutional requirements LW: Writing – review & editing BL: Writing – review & editing The author(s) declare that no financial support was received for the research Landkamp-Flock for skillful technical assistance The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher 1. ^https://www.networkanalyst.ca Rodent models of experimental autoimmune uveitis PubMed Abstract | Crossref Full Text | Google Scholar Redistribution of GABA immunoreactivity following central retinal artery occlusion Google Scholar Behavioral conditioning of immune responses with cyclosporine a in a murine model of experimental autoimmune uveitis Amniotic membrane transplantation induces apoptosis in T lymphocytes in murine corneas with experimental herpetic stromal keratitis Retinal ischemia induced by occlusion of both common carotid arteries in rats as demonstrated by electroretinography Google Scholar Effects of crystallin-beta-b2 on stressed RPE in vitro and in vivo Graefe's archive for clinical and experimental ophthalmology=Albrecht von Graefes Archiv fur klinische und experimentelle Ophthalmologie 251 Crystallin-beta-b2-overexpressing NPCs support the survival of injured retinal ganglion cells and photoreceptors in rats betaB2-Crystallin promotes axonal regeneration in the injured optic nerve in adult rats The pro-inflammatory role of high-mobility group box 1 protein (HMGB-1) in photoreceptors and retinal explants exposed to elevated pressure Cell death in rat retina after pressure-induced ischaemia-reperfusion insult: electron microscopic study PubMed Abstract | Google Scholar Effects of systemic and intravitreal TNF-alpha inhibition in experimental autoimmune uveoretinitis Th1 and Th2 responses in pathogenesis and regulation of experimental autoimmune uveoretinitis PubMed Abstract | Crossref Full Text | Google Scholar “Experimental autoimmune uveoretinitis in the rat and mouse” in Current protocols in immunology Google Scholar Understanding autoimmune uveitis through animal models PubMed Abstract | Crossref Full Text | Google Scholar The mouse as a model of experimental autoimmune uveoretinitis (EAU) Crossref Full Text | Google Scholar A CRYBB2 mutation in a Taiwanese family with autosomal dominant cataract Up-regulation of crystallins is involved in the neuroprotective effect of wolfberry on survival of retinal ganglion cells in rat ocular hypertension model Glial fibrillary acidic protein: GFAP-thirty-one years (1969-2000) Google Scholar Google Scholar Identification of differentially expressed genes in breast tumors from African American compared with Caucasian women Crystallins of the beta/gamma-superfamily mimic the effects of lens injury and promote axon regeneration Switching mature retinal ganglion cells to a robust growth state in vivo: gene expression and synergy with RhoA inactivation Marrow-derived activated macrophages are required during the effector phase of experimental autoimmune uveoretinitis in rats Google Scholar Galindo-Romero Axotomy-induced retinal ganglion cell death in adult mice: quantitative and topographic time course analyses Goldenberg-Cohen Protective effect of Bax ablation against cell loss in the retinal ganglion layer induced by optic nerve crush in transgenic mice PubMed Abstract | Crossref Full Text | Google Scholar Multiple functions of BCL-2 family proteins PubMed Abstract | Crossref Full Text | Google Scholar Everolimus improves experimental autoimmune uveoretinitis beta-III-tubulin: a reliable marker for retinal ganglion cell labeling in experimental models of glaucoma and degeneration in photoreceptors impacted by drusen Novel everolimus-loaded nanocarriers for topical treatment of murine experimental autoimmune uveoretinitis (EAU) Cyclosporine A-loaded Nanocarriers for topical treatment of murine experimental autoimmune Uveoretinitis Analysis of retinal cellular infiltrate in experimental autoimmune uveoretinitis reveals multiple regulatory cell populations A meta-analysis of gene expression quantitative trait loci in brain Neuroprotective effects of alpha(2)-selective adrenergic agonists against ischemia-induced retinal ganglion cell death Light-induced phosphorylation of crystallins in the retinal pigment epithelium Physiological and pathological functions of betaB2-crystallins in multiple organs: a systematic review Elongation of axons during regeneration involves retinal crystallin beta b2 (crybb2) Retinal endothelial cell phenotypic modifications during experimental autoimmune uveitis: a transcriptomic approach Crystallins play a crucial role in Glaucoma and promote neuronal cell survival in an in vitro model through modulating Muller cell secretion BAX to basics: how the BCL2 gene family controls the death of retinal ganglion cells Photothrombosis-induced ischemic neuronal degeneration in the rat retina Google Scholar Nadal-Nicolas Oxidative photoreceptor cell damage in autoimmune uveitis The cell and molecular biology of glaucoma: mechanisms of retinal ganglion cell death Apoptosis in ocular disease: a molecular overview Google Scholar Nussenblatt Bench to bedside: new approaches to the immunotherapy of uveitic disease PubMed Abstract | Crossref Full Text | Google Scholar Bcl-2 heterodimerizes in vivo with a conserved homolog Google Scholar Neuroprotection in relation to retinal ischemia and relevance to glaucoma Google Scholar Expression of c-fos and c-Jun mRNA following transient retinal ischemia: an approach using ligation of the retinal central artery in the rat Google Scholar Modulation of alpha and beta crystallin expression in rat retinas with ocular hypertension-induced ganglion cell degeneration Bax is increased in the retina of diabetic subjects and is associated with pericyte apoptosis in vivo and in vitro Elevated intraocular pressure induces neuron-specific beta-III-tubulin expression in non-neuronal vascular cells Crystallins are regulated biomarkers for monitoring topical therapy of glaucomatous optic neuropathy Retinal ganglion cell death in experimental glaucoma and after axotomy occurs by apoptosis Google Scholar Role of oxygen free radicals in retinal damage associated with experimental uveitis PubMed Abstract | Google Scholar Small heat shock protein alphaA-crystallin prevents photoreceptor degeneration in experimental autoimmune uveitis Elevated retina-specific expression of the small heat shock protein is associated with photoreceptor protection in experimental uveitis The role of TLR4 in photoreceptor {alpha}a crystallin upregulation during early experimental autoimmune uveitis Mitochondrial proteomics in experimental autoimmune uveitis oxidative stress Cloning and mapping the mouse Crygs gene and non-lens expression of [gamma]S-crystallin PubMed Abstract | Crossref Full Text | Google Scholar Mutation screen of beta-crystallin genes in 274 patients with age-related macular degeneration Role of crystallins in ocular neuroprotection and axonal regeneration Traumatology of the optic nerve and contribution of crystallins to axonal regeneration Crossref Full Text | Google Scholar Molecular composition of drusen and possible involvement of anti-retinal autoimmunity in two different forms of macular degeneration in cynomolgus monkey (Macaca fascicularis) Vanita Sarhadi A unique form of autosomal dominant cataract explained by gene conversion between beta-crystallin B2 and its pseudogene Shared and differential retinal responses against optic nerve injury and ocular hypertension Villegas-Perez Rapid and protracted phases of retinal ganglion cell loss follow axotomy in the optic nerve of adult rats Google Scholar Race influences survival in glioblastoma patients with KPS >/= 80 and associates with genetic markers of retinoic acid metabolism A novel CRYBB2 mutation causes autosomal dominant cataract: a report from a Chinese family betaB2 W151R mutant is prone to degradation aggregation and exposes the hydrophobic side chains in the fourth Greek key motif Targeted knockout of the mouse betaB2-crystallin gene (Crybb2) induces age-related cataract NetworkAnalyst 3.0: a visual analytics platform for comprehensive gene expression profiling and meta-analysis Mutation screening of crystallin genes in Chinese families with congenital cataracts Google Scholar Heiligenhaus A and Thanos S (2024) Crystallin β-b2 promotes retinal ganglion cell protection in experimental autoimmune uveoretinitis Received: 31 January 2024; Accepted: 22 August 2024; Published: 10 September 2024 Copyright © 2024 Bauer, Böhm, Wu, Wang, Jalilvand, Busch, Kasper, Brockhaus, Wildschütz, Melkonyan, Laffer, Meyer Zu Hörste, Heiligenhaus and Thanos. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) distribution or reproduction in other forums is permitted provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited in accordance with accepted academic practice distribution or reproduction is permitted which does not comply with these terms *Correspondence: Dirk Bauer, ZGlyay5iYXVlckB1dmVpdGlzLXplbnRydW0uZGU= †These authors have contributed equally to this work and share first authorship Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher 94% of researchers rate our articles as excellent or goodLearn more about the work of our research integrity team to safeguard the quality of each article we publish Will be housed in Yexio's wooden Edge data centers Hochtief's Yorizon is partnering with VNClagoon (VNC) and BytesAtWork for its European "Giga-Cloud" offering VNC will provide its sovereign platform and software services while BytesAtWork will bring its cloud portals to the platform Yorizon is a "sustainable cloud provider" established by infrastructure technology and construction services company Hochtief alongside server and storage systems manufacturer Thomas-Krenn.AG Plans for the cloud platform were first announced in September 2024 It is set to be hosted in data centers belonging to Yexio and sustainable cloud infrastructure that will make Europe digitally independent,” said Gernot Hofstetter “This Giga-Cloud combines state-of-the-art data centers with a sovereign software solution that excites enterprises and authorities alike,” added Andrea Wörrlein The first Yexio data center is set to be launched late in the summer of 2025 The company had secured land for two more data centers as of September 2024 and Hochtief signed an extension of its cooperation with the Palladio infrastructure fund from five to 15 data centers in May 2024 The Heiligenhaus data center broke ground on March 12 It is located at the Heiligenhaus Innovation Park and is the result of a partnership between Hochtief and Palladio Partners The data center will use "direct water cooling" which will improve the facility's efficiency It is also notable for being built using wood for the structure and the facade of the data center Heiligenhaus is located in North Rhine-Westphalia Germany's primary data center hub is in Frankfurt Operators in Düsseldorf include Digital Realty Data Centre Dynamics Ltd (DCD), 32-38 Saffron Hill, London, EC1N 8FH Email. [email protected]DCD is a subsidiary of InfraXmedia Volume 13 - 2019 | https://doi.org/10.3389/fncel.2019.00430 Microglia represent the primary resident immune cells of the central nervous system (CNS) and modulate local immune responses Depending on their physiological functions microglia can be classified into pro- (M1) and anti-inflammatory (M2) phenotype Interleukin (IL)-10 is an important modulator of neuronal homeostasis with anti-inflammatory and neuroprotective functions we investigated how IL-10 deficiency affected the M1/2 polarization of primary microglia upon lipopolysaccharide (LPS) stimulation in vitro Microglia phenotypes were analyzed via flow cytometry Cytokine and chemokine secretion were examined by ELISA and bead-based multiplex LEGENDplexTM Our results showed that genetic depletion of IL-10 led to elevated M1 like phenotype (CD86+ CD206−) under pro-inflammatory conditions associated with increased frequency of IL-6+ TNF-α+ cells and enhanced release of several pro-inflammatory chemokines Absence of IL-10 led to an attenuated M2 like phenotype (CD86− CD206+) and a reduced secretion of TGF-β1 upon LPS stimulation IL-10 deficiency may promote the polarization of microglia into M1-prone phenotype under pro-inflammatory conditions Microglia are yolk sac-derived myeloid lineage cells (Kierdorf et al., 2013) that are commonly defined as innate immune cells in the CNS. Under homeostatic conditions, predominantly ramified and resting microglia screen their microenvironment to detect injury or infection and act to surveil the CNS by removing cell debris and contributing to neuronal plasticity (Davalos et al., 2005; Nimmerjahn et al., 2005) These previous studies demonstrate that treatment with IL-10 plays an important role in modulating inflammatory processes in CNS diseases we studied the role of IL-10 on the M1/2 phenotype of microglia by isolating brain-derived microglia from WT and IL-10 KO mice and analyzing their cytokine/chemokine response to pro-inflammatory culture conditions C57BL/6J WT (Charles River Laboratories, Wilmington, DE, United States) and C57BL/6J IL-10 knock-out (IL-10 KO) mice (B6.129P2-Il10tm1Cgn/J; Jackson Laboratories, Bar Harbor, ME, United States) (Kuhn et al., 1993) were housed in standard animal rooms under a 12-h light/dark cycle with food and water provided ad libitum Mice were bred with heterozygote mice and selected for the experiments according to genetic homogeneity Primary brain derived microglia from WT and IL-10 KO mice (2–14 days postnatally female and male) were isolated via magnetic cell sorting To perform one experiment 5 mice pubs were used per genotype brains were isolated and transferred into ice-cold PBS containing 1% BSA (Carl Roth Brains were minced and enzymatically digested by using Neural Tissue Dissociation Kit – Postnatal Neurons (Miltenyi Biotec After removing myelin using Myelin Removal Beads II (Miltenyi Biotec) CD11b-positive cells were positively selected by magnetic separation using CD11b (Microglia) MicroBeads according to the manufacturer’s instructions An average yield of 1.5 ± 0.15 × 106 CD11b+ cells/mouse brain from WT and 1.6 ± 0.17 × 106 CD11b+ cells/mouse brain from IL-10 KO mice were isolated After cultivation for 14 days, cells were stimulated for 24 h in medium with 5% FCS and 100 ng/ml LPS (E. coli O111:B4; Sigma Aldrich, Taufkirchen, Germany) or without LPS (control). Non-toxic concentration of LPS (100 ng/ml) has been titrated previously in vitro via MTT-assay. Similar LPS concentration has been used in other in vitro (Karlstetter et al., 2010, 2011) studies For immunofluorescent analysis the cells (6 × 104/well) were cultured for 14 days on 8-well glass chamber slides (Merck Millipore) After 24 h cells were fixed in PBS containing 4% paraformaldehyde (Carl Roth) for 30 min at room temperature (RT) unspecific binding sites were blocked by 5% goat serum (Biozol Cells were permeabilized using permeabilization buffer (Affymetrix United States) in PBS/1% FCS for 30 min at RT and stained using 0.5 μg/ml polyclonal goat anti-mouse/rat Iba1 (Abcam As secondary antibody 1 μg/ml polyclonal donkey anti-goat Alexa Fluor 488 (Abcam) were applied for 1 h at RT nuclei were stained by 1 μg/ml Hoechst 33342 (Sigma Aldrich) and slides were mounted by using Mowiol (Sigma Aldrich) The cellular specimens were examined by immunofluorescence microscopy (ApoTome.2; Zeiss Germany) and displayed by ZEN 2.3 lite software (Zeiss) cells were cultured in 6-well plates and were left unstimulated (control) or stimulated with LPS The 24 h cell culture supernatants were harvested and analyzed for their cytokine content by ELISA: interleukin-6 (IL-6) tumor necrosis factor alpha (TNF-α) IL-10 – all purchased from Biolegend (Koblenz Germany) and transforming growth factor beta 1 (TGF-β1; ELISA Ready-SET-Go Human/Maus TGF beta 1 Analysis was performed according to the manufacturer’s instructions For chemokine quantification including CC chemokine ligands (CCL) MCP-1 (CCL2) C-X-C motif chemokine ligands (CXCL) KC (CXCL1) and bead-based multiplex LEGENDplexTM analysis (LEGENDplexTM Mouse Proinflammatory Chemokine Panel (13-plex; Biolegend) were used according to the manufacturer’s instructions Analysis was performed with the Cytoflex flow cytometer (Beckman Coulter Data were analyzed via Legendplex V8.0 software (Biolegend) and specified as pg/ml Detection of NO was performed indirectly via nitrite in a 96-well flat bottom cell culture plate 10 μM sodium nitrite standard (Sigma-Aldrich Taufkirchen) was used 1:2 with PBS in a serial dilution series Supernatants of cell culture were applied undiluted as a triple determination Negative control (culture medium) was diluted 1:2 with PBS To each well 50 μl of sulphanilic acid solution (1% sulphanilic acid (Sigma-Aldrich Karlsruhe) was added followed by 10 μl of concentrated HCL 50 μl of N-(1-naphthyl) ethylenediamine solution (1% N-(1-naphthyl) ethylenediamine (Sigma-Aldrich) in methanol (Carl Roth) was added to each well Intensity of discoloration was proportional to NO content in the sample Measurement was performed with a wavelength of 550 nm in the microplate reader and NO content (in μM) was determined via linear regression For M1/2 phenotype classification via flow cytometry cells were cultured in 6-well plates and were stimulated with LPS or left unstimulated (control) Following marker were used for M1/2 classification: M1 marker: CCR2; CD86; M2 marker: CX3CR1; CD206 brefeldin A (eBioscience) as a protein transport inhibitor was added for the last 6 h of 24 h stimulation which promotes accumulation of intracellular cytokines within the cells cells were harvested using Accutase (Biowest and prestained with CD16/CD32 Fc-block (93; TruStain fcX The following antibodies were used for targeting: CD11b (BV510; M1/70) and CD86 (PE/Cy7; GL-1) – all purchased from Biolegend – and CCR2 (AF700; #475301) – purchased from R&D Systems (Wiesbaden Cells were washed twice with PBS and were then analyzed cells were fixed with IC fixation buffer (eBioscience) permeabilized with permeabilization buffer (eBioscience) and incubated with one of the following anti-mouse antibodies targeting TNF-α (PE/Cy7; MP6-XT22) and TGF-β1 (PerCP/Cy5.5; TW7-16B4) – all purchased from Biolegend Cells were washed twice with permeabilization buffer and analyzed cells were stained with the fixable viability dye (FVD) eFluor® 450 (eBioscience) according to the manufacturer’s instructions Samples were measured using GalliosTM 10/3 (Beckman Coulter) equipment At least 300,000 viable FVD efluor® 450-negative and CD11b-positive events per sample were counted using Kaluza 1.0 software Data were analyzed using Kaluza Analysis 2.1 Software (Beckman Coulter) and the percentage of positive cells was documented The data obtained were analyzed for normal distribution (Shapiro-Wilk normally test) and for homogeneity of variance (Brown-Forsythe test) Differences were considered as significant at ∗p < 0.05 the MACS sorted CD11b+ brain derived primary Iba1+ cells are termed as microglia cells Fluorescence microscopy of Iba1+ WT and IL-10 KO microglia Representative figures of four independent experiments (n = 4); overlay Iba1/green Cytokine analysis via ELISA (Figures 2A–D and Supplementary Table S1) showed that LPS treatment led to significantly elevated secretion of IL-6 and TNF-α in the supernatants in both WT and IL-10 KO microglia (p < 0.0001) While IL-10 KO cells did not produce IL-10 WT cells secreted significantly more IL-10 upon LPS treatment than unstimulated cells (control: 40 ± 17 pg/ml LPS: 332 ± 91 pg/ml; p < 0.001) IL-10 KO cells secreted a significantly lower amount of TGF-β1 upon LPS stimulation than WT cells (IL-10 KO: 68 ± 27 pg/ml; WT: 184 ± 43 pg/ml; p < 0.05) Cytokine pattern of WT (black bars) or IL-10 KO (gray bars) microglia of control group or after LPS treatment ∗p < 0.05; ∗∗p < 0.01; ∗∗∗p < 0.001; ****p < 0.0001 Intracellular flow cytometry (Figures 2E–H and Supplementary Figure S2) showed that LPS stimulation significantly increased the number of TNF-α+ cells in both WT (control: 6 ± 0.8% LPS: 28.5 ± 4.4%; p < 0.001) and IL-10 KO (control: 7 ± 1.9% LPS: 46.4 ± 5.7%; p < 0.0001) microglia while the number of IL-6+ cells was only significantly increased in IL-10 KO (control: 2.5 ± 0.9% LPS: 18.5 ± 6.2%; p < 0.001) Intracellular IL-10 staining was negative in IL-10 KO microglia and did not differ between the control and LPS group in WT microglia IL-10 KO microglia showed a significantly higher number of TNF-α- and IL-6-positive cells after LPS stimulation (p < 0.05) than WT microglia Chemokine release (Δ: LPS minus control) of WT (black bars) and IL-10 KO (gray bars) microglia under LPS treatment Analysis of NO level in supernatants showed a significant increase upon LPS stimulation (p < 0.001) in supernatants of both, WT and IL-10 KO microglia without significant differences between both genotypes (Supplementary Figure S3) Upon LPS stimulation CX3CR1 was significantly downregulated in both genotypes (WT: 13 ± 4.5% p < 0.05; IL-10 KO: 8.8 ± 1.2% p < 0.001) compared to the control groups Flow cytometry of WT (black bars) and IL-10 KO (gray bars) microglia of control group or after LPS treatment ∗p < 0.05; ∗∗∗p < 0.001 In this study we analyzed the effect of IL-10 deficiency on the M1/2 phenotype of microglia in an inflammatory environment in vitro. Herein, we isolated CD11b-positive cells from the brain of postnatal mice at the age of 2–14 days by using column-based magnetic separation with CD11b microbeads (Holt and Olsen, 2016) we could show that both WT and IL-10 KO microglia express as well pro-inflammatory (IL-6 TGF-β; IL-10 KO: TGF-β) cytokines pointing to a transitional phenotype including both M1 and M2 phenotype We could show that microglial activation by LPS enhanced secretion of IL-6 and TNF-α in WT and IL-10 KO cells. It is known that IL-10 downregulates the LPS-induced production of several proinflammatory cytokines (Frei et al., 1994; Lodge and Sriram, 1996). Elevated LPS induced IL-6 and TNF-α expression could be shown in brain tissue of IL-10 KO mice compared to WT mice via qPCR (Anderson et al., 2017) we expected a higher amount of pro-inflammatory cytokine IL-6 and TNF-α in the supernatants of IL-10 KO microglia but found no differences between WT and IL-10 KO cells we assumed a saturation effect which make any differences undetectable via ELISA the flow-cytometric analysis showed that genetic depletion of IL-10 increased the frequency of IL-6+ and TNF-α+ cells after LPS stimulation that lack of IL-10 leads to an enhanced IL-6 and TNF-α expression upon LPS treatment the similar cytokine content in both genotypes and the lower frequency of TNF-α+ and IL-6+ of WT cells a higher cytokine release by WT cells upon LPS treatment could be also responsible for the similar cytokine content in the supernatant IL-10 depletion in microglia cells might result in lower TGF-β1 release and thereby participate in regulating M2 cell frequency by influencing TGF-β1 IL-10 may counteract an immune response toward an M1 phenotype and modulate the polarization of microglial cells to a more anti-inflammatory M2 phenotype Our results confirmed the increased CCL2 and CCR2 expression upon LPS stimulation in WT and IL-10 KO cells without significant difference between both genotypes We further studied the fractalkine receptor CX3CR1, which is highly expressed in the non-polarized M0 microglial phenotype (Sheridan and Murphy, 2013). As previously shown for N9 microglial cells (Cunha et al., 2016) we showed that CX3CR1 was significantly downregulated after LPS stimulation in both WT and IL-10 KO microglia Lively et al. describe a IL-10 mediated down regulation of CXCR1 expression in murine primary microglia (Lively et al., 2018) We can confirm this finding as the frequency of CX3CR1+ microglia was higher in unstimulated IL-10 KO microglia than in WT microglia indicating a suppressive effect of IL-10 on CX3CR1 expression Classification via the marker CCR2 and CX3CR1 used for macrophages did not show differences in the two genotypes uponLPS treatment. We therefore include further M1 (CD86) and M2 (CD206) marker which were used for M1/2 phenotyping of microglia cells (Peng et al., 2017; Zhou et al., 2017) our analysis showed a reduced M2 CD86-CD206+ phenotype and an unaltered M1/2 CD86+ CD206+ phenotype in both genotypes upon LPS treatment the M2 phenotype was significantly reduced in IL-10 KO compared to WT microglia after LPS stimulation an LPS-induced M1 CD86+ CD206− phenotype could be shown in IL-10 KO cells our results suggest that IL-10 deficiency did not have a significant effect on microglia M1/2 phenotype when left untreated Whereas lack of IL-10 promotes microglia to an increased expression of pro-inflammatory cytokines/chemokines and the lower release of TGF-β1 as anti-inflammatory cytokine these results indicate that absence of IL-10 led to a M1-prone microglial phenotype during LPS treatment The datasets generated for this study are available on request to the corresponding author The animal experiments were performed in accordance with the European Health Law of the Federation of Laboratory Animal Science Associations (FELASA) and regulations of the Society for Laboratory Animal Science (GV-SOLAS) in Germany The protocol was approved by the North Rhine-Westphalia State Agency for Nature and Consumer Protection (LANUV) (authorization number AZ 2015.A011/§4.16.006) All experimental procedures conformed to the guidelines of the National Institutes of Health and to the Association for Research in Vision and Ophthalmology resolution on the use of animals in research and AH designed the study and wrote the manuscript and MK performed the experiments and analyzed the data All authors read and approved the final version of the manuscript This study was funded by the DFG He 1877/19-1; part of the FOR 2240 program (Lymph) Angiogenesis and cellular immunity in inflammatory diseases of the eye/project 8 uveitis We thank Bo Wang and Kevin Gilhaus for their technical assistance in this study The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fncel.2019.00430/full#supplementary-material FIGURE S1 | Isolated CD11b+ cells cultured in 8-well chamber slides develop from (A) round shaped cells at day 1 to cells with growing cell extension at (B) day 4 and (D) after 12 days in cell culture to a dense network of cells (Magnification ×200) FIGURE S2 | Gating Strategy for primary microglia in flow cytometry (B) microglia stained with the live-dead dye eFluor450 Living cells (FVD eFlour450 negative) are shown in region 1 (R1) (C) isotpye control IgG2b κ BV510 and IgG1 κ APC (D) CD11b+ BV510 cells with IgG1 κ APC Isotype control and (E) intracellular cytokine staining of CD11b+ cells with anti-IL-6 APC FIGURE S3 | NO release of WT (black bars) or IL-10 KO (gray bars) microglia of control group or after LPS treatment NO content in μM (N = 12) in the supernatant of microglia TABLE S1 | Cytokine/Chemokine level experimental autoimmune encephalomyelitis; ELISA enzyme-linked immunosorbent assay; IFN- γ transforming growth factor beta; TNF- α Effect of bacterial wall lipopolysaccharide (LPS) on morphology and cytoskeletal organization of microglia in cultures Modulation of three key innate immune pathways for the most common retinal degenerative diseases Antigen presentation in EAE: role of microglia PubMed Abstract | CrossRef Full Text | Google Scholar Opposite effects of interferon-gamma and prostaglandin E2 on tumor necrosis factor and interleukin-10 production in microglia: a regulatory loop controlling microglia pro- and anti-inflammatory activities doi: 10.1002/(sici)1097-4547(19990615)56:6<571::aid-jnr3>3.3.co;2-g P2Y(12) receptor on the verge of a neuroinflammatory breakdown IL-10 plays an important role in the homeostatic regulation of the autoreactive repertoire in naive mice Novel INfluences of IL-10 on CNS inflammation revealed by integrated analyses of cytokine networks and microglial morphology Chemokine expression by glial cells directs leukocytes to sites of axonal injury in the CNS Attenuation of astroglial reactivity by interleukin-10 Comparison of phenotypic and functional properties of immediately ex vivo and cultured human adult microglia doi: 10.1002/(sici)1098-1136(199609)18:1<1::aid-glia1>3.3.co;2-i New tools for studying microglia in the mouse and human CNS Localization of monocyte chemoattractant peptide-1 expression in the central nervous system in experimental autoimmune encephalomyelitis and trauma in the rat IL-10 is critical in the regulation of autoimmune encephalomyelitis as demonstrated by studies of IL-10- and IL-4-deficient and transgenic mice Review: activation patterns of microglia and their identification in the human brain The role of microglia in mediating the effect of the environment in brain plasticity and behavior Identification of a unique TGF-beta-dependent molecular and functional signature in microglia Induction and blockage of oligodendrogenesis by differently activated microglia in an animal model of multiple sclerosis Sall1 is a transcriptional regulator defining microglia identity and function Key aging-associated alterations in primary microglia response to beta-amyloid stimulation Microglia change from a reactive to an age-like phenotype with the time in culture Polarization of macrophages and microglia in inflammatory demyelination Characterization of phenotype markers and neuronotoxic potential of polarised primary microglia in vitro IL-10 plays a pivotal role in anti-inflammatory effects of resveratrol in activated microglia cells Transgenic interleukin 10 prevents induction of experimental autoimmune encephalomyelitis Exploring new inflammatory biomarkers and pathways during LPS-Induced M1 Polarization ATP mediates rapid microglial response to local brain injury in vivo Characterizing microglia activation: a spatial statistics approach to maximize information extraction Culture and characterization of microglia from the adult murine retina Role of microglia in neurological disorders and their potentials as a therapeutic target Comparison of polarization properties of human adult microglia and blood-derived macrophages Alternatively activated microglia and macrophages in the central nervous system Antigen presentation in the central nervous system The inhibitory effect of IL-10 on MHC class II expression and production of cytokines depends on the inducing signals and the type of cell analyzed Chemokine upregulation follows cytokine expression in chronic relapsing experimental autoimmune encephalomyelitis Monocyte chemoattractant protein-1 is sufficient for the chemotaxis of monocytes and lymphocytes in transgenic mice but requires an additional stimulus for inflammatory activation Microglia as a source and target of cytokines Functional diversity of microglia - how heterogeneous are they to begin with Sall1 regulates cortical neurogenesis and laminar fate specification in mice: implications for neural abnormalities in townes-brocks syndrome Production and function of monocyte chemoattractant protein-1 and other beta-chemokines in murine glial cells The P2Y12 receptor regulates microglial activation by extracellular nucleotides The brain’s best friend: microglial neurotoxicity revisited Chemokine and chemokine receptor expression in the central nervous system Novel applications of magnetic cell sorting to analyze cell-type specific gene and protein expression in the central nervous system Two inflammatory mediator cytokine genes are closely linked and variably amplified on chromosome 17q Microglia-specific localisation of a novel calcium binding protein Macrophages: a double-edged sword in experimental autoimmune encephalomyelitis The spider effect: morphological and orienting classification of microglia in response to stimuli in vivo Antidepressant therapies inhibit inflammation and microglial M1-polarization Curcumin is a potent modulator of microglial gene expression and migration The novel activated microglia/macrophage WAP domain protein acts as a counter-regulator of proinflammatory response Triggering the brain’s pathology sensor Reactive microglial changes in rat neocortex and hippocampus after exposure to acute perinatal hypoxia Microglia emerge from erythromyeloid precursors via Pu.1- and Irf8-dependent pathways Siglec-H is a microglia-specific marker that discriminates microglia from CNS-associated macrophages and CNS-infiltrating monocytes Sall1 regulates microglial morphology cell autonomously in the developing retina An automated method to quantify microglia morphology and application to monitor activation state longitudinally in vivo Microglia: a sensor for pathological events in the CNS Interleukin-10-deficient mice develop chronic enterocolitis Microglial/Macrophage polarization dynamics following traumatic brain injury and transforming growth factor-beta differentially regulate lipopolysaccharide-induced production of pro-inflammatory cytokines and nitric oxide in co-cultures of rat astroglial and microglial cells doi: 10.1002/(sici)1098-1136(200004)30:2<134::aid-glia3>3.0.co;2-3 Expression and regulation of interleukin-10 and interleukin-10 receptor in rat astroglial and microglial cells Expression of Tmem119/Sall1 and Ccr2/CD69 in FACS-Sorted microglia- and monocyte/macrophage-enriched cell populations after intracerebral hemorrhage Targeting the shift from M1 to M2 macrophages in experimental autoimmune encephalomyelitis mice treated with fasudil Comparing effects of transforming growth factor beta1 on microglia from rat and mouse: transcriptional profiles and potassium channels Balancing the immune response in the brain: IL-10 and its regulation Regulation of microglial activation by TGF-beta Comprehensive analysis of mouse retinal mononuclear phagocytes Parthenolide inhibits the LPS-induced secretion of IL-6 and TNF-alpha and NF-kappaB nuclear translocation in BV-2 microglia Analysis of microglia and monocyte-derived macrophages from the central nervous system by flow cytometry Alternative activation of macrophages: an immunologic functional perspective doi: 10.1146/annurev.immunol.021908.132532 CNS remyelination and the innate immune system Characterization of the microglial phenotype under specific pro-inflammatory and anti-inflammatory conditions: effects of oligomeric and fibrillar amyloid-beta Altered M1/M2 activation patterns of monocytes in severe relapsing experimental rat model of multiple sclerosis Amelioration of clinical status by M2 activated monocyte administration P2Y12 receptor is expressed on human microglia under physiological conditions throughout development and is sensitive to neuroinflammatory diseases Production of interleukin-10 by mouse glial cells in culture Interleukin-10 and the interleukin-10 receptor Role of microglial-derived tumor necrosis factor in mediating CD14 transcription and nuclear factor kappa B activity in the brain during endotoxemia Resting microglial cells are highly dynamic surveillants of brain parenchyma in vivo TGFbeta produced by IL-10 redirected astrocytes attenuates microglial activation Dynamic motility of microglia: purinergic modulation of microglial movement in the normal and pathological brain Microglial M1/M2 polarization and metabolic states Increased expression of M1 and M2 phenotypic markers in isolated microglia after four-day binge alcohol exposure in male rats Polymerization of MIP-1 chemokine (CCL3 and CCL4) and clearance of MIP-1 by insulin-degrading enzyme Macrophage heterogeneity in the rat as delineated by two monoclonal antibodies MRC OX-41 and MRC OX-42 the latter recognizing complement receptor type 3 Acceleration of experimental autoimmune encephalomyelitis in interleukin-10-deficient mice: roles of interleukin-10 in disease progression and recovery TMEM119 marks a subset of microglia in the human brain Activation of the NLRP3 inflammasome in microglia: the role of ceramide Interleukin-10 expression in lipopolysaccharide-activated microglia is mediated by extracellular ATP in an autocrine fashion Neuron-glia crosstalk in health and disease: fractalkine and CX3CR1 take centre stage Microglial disruption in young mice with early chronic lead exposure Endogenous transforming growth factor-beta promotes quiescence of primary microglia in vitro IGF2) expression in human microglia: differential regulation by inflammatory mediators Microglia detection in the brain preparations after long-term storage in formalin Differential Roles of M1 and M2 microglia in neurodegenerative diseases TGF-beta1 modulates microglial phenotype and promotes recovery after intracerebral hemorrhage Torres-Platas Morphometric characterization of microglial phenotypes in human cerebral cortex A20 critically controls microglia activation and inhibits inflammasome-dependent neuroinflammation IL-10 production by adult human derived microglial cells Suppression of acute and protracted-relapsing experimental allergic encephalomyelitis by nasal administration of low-dose IL-10 in rats Differential roles of microglia and monocytes in the inflamed central nervous system Adult neural stem cells expressing IL-10 confer potent immunomodulation and remyelination in experimental autoimmune encephalitis IL-10 is involved in the suppression of experimental autoimmune encephalomyelitis by CD25+CD4+ regulatory T cells Microglia polarization with M1/M2 phenotype changes in rd1 mouse model of retinal degeneration Silencing of TGFbeta signalling in microglia results in impaired homeostasis Heiligenhaus A and Kasper M (2019) Loss of IL-10 Promotes Differentiation of Microglia to a M1 Phenotype Copyright © 2019 Laffer, Bauer, Wasmuth, Busch, Jalilvand, Thanos, Meyer zu Hörste, Loser, Langmann, Heiligenhaus and Kasper. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) *Correspondence: Maren Kasper, bWFyZW4ua2FzcGVyQHV2ZWl0aXMtemVudHJ1bS5kZQ== †These authors have contributed equally to this work and share last authorship Kiekert the German technology pioneer in automotive access and intelligent safety closure systems has announced that it is boosting production at its Heiligenhaus site following the appointment of Jérôme Debreu as both CEO and CFO The popular move will lead to 150 additional local jobs and was celebrated during an event at the plant on 9 December an occasion that was also attended by Volker Kiekert It was the first visit of a family member to the site since 1971 and reflected Debreu’s pledge to reconnect the group to its roots after some operations had been shifted to Eastern Europe and rumors were swirling that its German base was under threat this was a statement of his commitment to ensuring the company’s future is in the area it has called home since the mid-19th century “Trying to run a German company without a headquarters in Germany is strategically unsound and not feasible in the long run,” Debreu tells The CEO Magazine “We need to maintain and grow the center of competence in Heiligenhaus and therefore we also need production close at hand for future product and process development “My job in terms of corporate social responsibility was to take care of the people who made Kiekert – that’s what I have done.” The first major customer to be affected by the move is Ford it sends out a powerful statement about his company’s values and ambitions “Heiligenhaus is the strategic hub of our company,” he says proudly “This is where our global success story began Our German headquarters and plant here are firmly linked to our corporate identity and will continue to play an important role in supplying our European customers and strategically developing our product portfolio in the future.” Trying to run a German company without a headquarters in Germany is strategically unsound As the global leader in automotive access systems Kiekert supplies over 100 vehicle manufacturers It has developed and manufactured well over two billion locking systems and achieved an extraordinary worldwide market share of 21 per cent it employs around 5,300 people at 10 locations in 10 countries One in three new cars contains Kiekert technology “We’ve been in the area for more than 160 years have more than 700 people working in Germany and wish to continue employment for the families who depend on us,” Debreu says proudly “This is where the real world matters – you need to have a beer with the people You need to meet them again and again,” he stresses but real contact and presence is what matters long-term.” The ‘re-localizing’ of production has been a part of Debreu’s plans since he took over as CEO in 2021 While other major component and OEM manufacturers were building factories in Asia and eastern European countries Jérôme recognized the simmering global tensions and made the counterintuitive – and strategically important – decision to do the exact opposite “Many companies have been moving production from Germany to foreign countries The fact that we decided to grow the facility in Germany is purely strategic and will hugely benefit us in the long term We were not swayed by what others were thinking “How can you be a German world leader and yet your way of making a profit is to save costs by closing your own headquarters It’s like taking a gun and shooting it at your head There cannot be any survival for Kiekert if we don’t stay in Germany.” we need to develop local people and products where the customers are The company plans to grow production turnover in Germany to about €80 Million (US$83 million) annually output at its facility in the Czech Republic will also be increased as more product lines are launched “Kiekert’s strength lies in its many years of experience combined with its know-how in areas such as development “An engineer cannot properly engineer without production and production cannot work efficiently without an engineer – it’s a closed cycle.” The disruption and uncertainty of the past three years has made Debreu’s plan even more crucial for Kiekert’s continued expansion “The industry is very aware that globalization has hurt us very much since 2019 and the focus on more regional or local supply chains means more stability in the future,” he says “A secondary driver was to confirm to external stakeholders credit facilities and banks that we are here to stay in Germany.” Training and upskilling German staff will create what he describes as ‘anticipation skills’ something that is difficult when interactions are remote “You don’t get anticipation skills when you only talk to people online we need to develop local people and products where the customers are – it’s a re-localization They need to have a future and I think that’s the biggest mistake in management today that people don’t learn how to build their successors “It makes no sense to manufacture Japanese products in Germany and then export them You have to manufacture close to Japan for the Japanese market It makes no sense at all to manufacture in China and then export to Europe.” Debreu’s passion and belief in Kiekert’s home country are both palpable “It would be insane if I didn’t prepare my succession for the Kiekert employees of tomorrow,” he declares “They need to have a future and I think that’s the biggest mistake in management today that people don’t learn how to build their successors.” The CEO Magazine is more than a business title; it’s a source of information inspiration and motivation for the world’s most successful leaders Learn all about The CEO Magazine at TheCEO.com ' + scriptOptions._localizedStrings.webview_notification_text + ' " + scriptOptions._localizedStrings.redirect_overlay_title + " " + scriptOptions._localizedStrings.redirect_overlay_text + " The expected tariff cost is significantly lower than the $4 billion to $5 billion crosstown rival General Motors estimates, which Ford attributes to its higher mix of U.S.-built vehicles. Volume 11 - 2020 | https://doi.org/10.3389/fimmu.2020.573955 Patients with chronic anterior uveitis are at particularly high risk of developing secondary glaucoma when corticosteroids [e.g. dexamethasone (Dex)] are used or when inflammatory activity has regressed Macrophage migration into the eye increases when secondary glaucoma develops and may play an important role in the development of secondary glaucoma Our aim was to evaluate in vitro if increased hydrostatic pressure and corticosteroids could induce changes in macrophages phenotype By using a pressure chamber cell culture system we assessed the effect of increased hydrostatic pressure (HP) and immunosuppression (Dex) on the M1/M2 phenotype of macrophages Bone marrow-derived macrophages (BMDMs) were stimulated with medium or LPS + Dex and incubated with different HP (0 The numbers of CD86+/CD206− (M1 phenotype) CD86–/CD206+ (M2 phenotype) CD86+/CD206+ (intermediate phenotype) and F4/80+/IL-10+ macrophages were determined by flow cytometry TNF-α and IL-10 levels in cell culture supernatants were quantified by ELISA and collagen IV expression in BMDMs were detected by immunofluorescence microscopy Higher HP polarizes macrophages primarily to an M1 phenotype (LPS d2: p = 0.0034) with less extra cellular matrix (ECM) production and secondary to an M2 phenotype (medium d7: p = 0.0433) with enhanced ECM production d2: p < 0.0001; d7: p < 0.0001) with more ECM production Higher HP further increased M2 polarization of Dex-treated macrophages (Dex These changes in the M1/M2 phenotype by high HP or Dex treatment may play a role in the pathogenesis of secondary uveitic glaucoma- or glucocorticoid (GC)-induced glaucoma Often, IOP first increases when inflammatory activity has been eliminated, possibly due to reduced uveoscleral outflow (5) It is generally believed that secondary open-angle glaucoma develops as a result of chronic changes in the trabecular meshwork (TM) outflow pathway Glucocorticoids (GCs) may modify gene expression in TM cells and tissues, as shown for myocilin and fibronectin (6, 7) the aqueous outflow resistance increases and thereby elevates the IOP which can also be found in primary open-angle glaucoma patients Macrophages comprise a group of cells with strong plasticity, heterogeneity, and immunological functions, which are closely related to various physiological and pathological processes. They can be divided into classically activated (M1, proinflammatory functions) or alternatively activated (M2, repair or regulatory functions) macrophages (12, 13) A similar situation could be found in patients with chronic anterior uveitis who are at particular high risk of developing secondary glaucoma even when corticosteroids are used or when inflammatory activity has regressed We hypothesized that changes in the HP might be associated with disparate macrophage effector functions We questioned if increased hydrostatic pressure and corticosteroids could induce changes in the macrophage phenotype we used a pressure chamber cell culture system to determine the M1/M2 phenotype of macrophages under increased hydrostatic pressure (HP) to increase our knowledge of the processes macrophages might undergo during glaucoma development and progression Female C57/BL6J mice (6–8 weeks) were purchased from Charles River Wiga (Sulzfeld, Germany) and used to isolate macrophages for all experiments. Previous secondary glaucoma studies have shown no statistically significant differences in gender with respect to the expression of cytokines, chemokines or MMPs in the AH (18) and Consumer Protection (LANUV) (AZ 81-02.05.50.19.006) The use of animals was in accordance with the Institutional Animals Care and Use and Ethics Committee and with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research Bone marrow-derived macrophages (BMDMs) were obtained from two femurs of female C57/Bl6 mice and 2 × 106 nucleated cells were cultured in 10 ml RPMI 1640 medium containing 10% fetal calf serum and 15% L929 cell-conditioned media in 10-cm untreated tissue culture dishes (VWR, Germany). The conditioned medium was prepared of 5-day supernatant from L929 cell line (19–21) nonadherent cells were removed and adherent cells were harvested for assays using Accutase (Sigma-Aldrich 1 × 106 adherent cells in 1 mL RPMI 1640 medium containing 10% fetal calf serum were cultured in 6-well plates BMDMs with medium, 100 ng/mL LPS (eBioscience, Dreieich, Germany), 200 ng/mL Dex (Sigma-Aldrich, Taufkirchen, Germany), or LPS+Dex were cultured under different HPs for 2 or 7 days. Then, the cells were used for MTT testing, immunofluorescence staining, and flow cytometry. The cell culture supernatants were harvested and used for ELISA (22) The connection of Toll like receptor-4 (TLR-4) and its ligand lipopolysaccharide (LPS) with IRI or glaucoma has been demonstrated in previous studies, showing that genetic deletion of TLR-4 is neuroprotective in IRI disorders (23). Furthermore, mutations on the TLR-4 correlated with altered susceptibility to primary open angle glaucoma and were even described as a possible bio-indicator (24) The pressure chamber system has been described previously (25) cell culture plates were positioned in the pressure chambers consisting of rust-free steel Each chamber has an external connector for adjusting pressure with an external pressure meter The chamber system can be used to reproducibly establish normal or increased HP conditions for cell culture and is able to maintain constant pressures for several days and 60 mmHg was set to mimic increased IOP BMDMs were cultured under different HP for 2 or 7 days The pressures in the chamber were checked 4 times per day Antibodies for immunofluorescence were purchased from the following sources: F4/80 (0.2 μg/ml Secondary antibody were goat anti-rat IgG Alexa Fluor® 488 (2 μg/ml streptavidin Alexa Fluor® 594 (0.5 μg/ml goat anti-rabbit IgG Alexa Fluor® 488 (2 μg/ml The following antibodies (BioLegend) were used for flow cytometry: APC anti-mouse F4/80 (2.5 μg/ml PE/Cy7 anti-mouse CD86 (1.25 μg/ml PE/Cy7 anti-mouse TNF-α (5 μg/ml and Alexa Fluor® 488 anti-mouse IL-10 (12.5 μg/ml Data were collected with a flow cytometer CytoFLEX (Beckman Coulter GmbH (Beckman Coulter GmbH) was used for analysis Supernatants from BMDMs with or without stimulation were harvested 2 or 7 days after incubation with different HPs and then stored at −20°C. In the supernatants, the content of TNF-α or IL-10 (BioLegend, Koblenz, Germany) was determined by ELISA (27, 30) Data were analyzed using Graph Pad Prism software version 7 (La Jolla All data were analyzed using the Kolmogorov-Smirnov and Shapiro-Wilk tests to check the normal distribution of the data A normal distribution was found in all subgroups To determine the effects of treatment (medium or LPS+Dex) and the level of hydrostatic pressure (0 two-way analysis of variance (ANOVA) followed by Tukey's multiple comparisons test was used to determine significant differences Results were shown as mean ± standard deviation (SD) P < 0.05 was considered statistically significant All experiments were repeated independently at least three times The figures were generated using Graph Pad Prism 7 MTT conversion assay of BMDMs under different hydrostatic pressures MTT conversion (%) (as a marker for cell viability) of medium or 60 mmHg on day 2 (A) and day 7 (B) (n = 6 independent experiments) The OD value in the medium group at 0 mmHg served as control and the viability was set as 100% Statistical significance between different pressures: *p < 0.05 ***p < 0.001; Statistical significance between different treatments: #p < 0.05 ###p < 0.001 ####p < 0.0001 Data were analyzed by two-way ANOVA and Tukey's post hoc test or M1/2 subpopulations in BMDMs under increased HP To calculate differences in the M1/M2 populations BMDMs were stained using antibodies targeting F4/80 and CD206 and the specimens were analyzed by flow cytometry Dotplots showing CD86+/CD206– (upper left area) CD86–/CD206+ (lower right area) or CD86+/CD206+ (upper right area) populations on day 2 (A) and day 7 (B) by flow cytometry Graphs showing the calculated frequency of CD86+/CD206– (C) Graphs showing the calculated frequency of each group on day 7 (E,F) (n = 3) ****p < 0.0001; Statistical significance between different treatments within one pressure: ##p < 0.01 After stimulating BMDMs with LPS and Dex, upregulation of M1 frequency was significantly weaker than after LPS alone (p < 0.0001) (Figure 2C), while the frequency of M2 events was lower than after Dex alone (p < 0.001) (Figure 2D) The frequency of the intermedium phenotype (CD86+/CD206+) was low in each group on day 2 and no significant difference was found between them (data not shown) Using the pressure chamber cell culture system we analyzed the expression and release of TNF-α and IL-10 from BMDMs cultured under increased HP using immunofluorescence microscopy TNF-α expression in BMDMs under different hydrostatic pressures (A) Representative immunofluorescence images of TNF-α (red) staining in BMDMs under different hydrostatic pressures F4/80-positive (green) cells represent macrophages (B) Graphs displaying the calculated MFI/cell of TNF-α on day 2 (B) and day 7 (C) (n = 9) ****p < 0.0001; Statistical significance between different treatments within one pressure: #p < 0.05 Frequency of F4/80+/TNF-α+ events under increased HP To calculate differences in the F4/80+/TNF-α+ populations BMDMs were stained with antibodies targeting F4/80 and TNF-α and were analyzed by flow cytometry (A) Dotplots showing isotype control and positive staining of TNF-α in cells Graphs showing the calculated frequency of F4/80+/TNF-α+ events on day 2 (B) and day 7 (C) (n = 3) Statistical significance between different pressures: **p < 0.01 ***p < 0.001; Statistical significance between different treatments within one pressure: #p < 0.05 TNF-α levels in the supernatant of BMDMs under different hydrostatic pressures Graphs displaying the calculated TNF-α levels in the supernatant from BMDMs on day 2 (A) and day 7 (B) (n = 6) as measured by ELISA ***p < 0.001 ****p < 0.0001; Statistical significance between different treatments within one pressure: ####p < 0.0001 After prolonged culture for 7 days, significantly lower levels of TNF-α could be found than after 2 days at the same HP level (Figure 3C). However, the differences in TNF-α expression between various pressures did not reach the level of significance in the medium or LPS groups as determined by immunofluorescence staining and flow cytometry (Figures 3C, 4C) On day 7, the TNF-α level in the supernatant of BMDMs with LPS treatment cultured at 60 mmHg was significantly higher than at 0 mmHg (p < 0.0001) or 20 mmHg (p = 0.0006) as measured by ELISA. Furthermore, the TNF-α level at 20 mmHg was also significantly higher than in the 0 mmHg group (p < 0.0001) (Figure 5B) The difference between 0 and 20 mmHg group also reached the level of significance (p = 0.0161) IL-10 expression in BMDMs under different hydrostatic pressures (A) Representative immunofluorescence images of IL-10 (red) staining in BMDMs under different hydrostatic pressures Graphs displaying the calculated MFI/cell of IL-10 on day 2 (B) and day 7 (C) (n = 9) **p < 0.01; Statistical significance between different treatments within one pressure: #p < 0.05 Frequency of IL-10+/F4/80+ events under increased HP To calculate differences in the IL-10+/F4/80+ populations BMDMs were stained with antibodies targeting F4/80 and IL-10 The specimens were then analyzed by flow cytometry (A) Dotplots showing isotype control and positive staining of IL-10 in cells Graphs showing the calculated frequency of IL-10+/F4/80+ events on day 2 (B) and day 7 (C) (n = 3) **p < 0.01; Statistical significance between different treatments within one pressure: ####p < 0.0001 IL-10 levels in the supernatant of BMDMs under different hydrostatic pressures Graphs displaying the calculated IL-10 levels in the supernatant from BMDMs on day 2 (A) and day 7 (B) (n = 6) as measured by ELISA On day 7, no significant difference in IL-10 expression in BMDMs was found between different HPs in medium (Figure 6C) The BMDMs cultured with LPS under higher pressure (60 mmHg) on day 7 showed increased production of IL-10 as compared to 20 mmHg (p = 0.0100) or 0 mmHg (p < 0.0001) The IL-10 level at 20 mmHg was also significantly higher than at 0 mmHg (p = 0.0005) The expression of IL-10 in Dex-treated BMDMs was significantly increased under higher HP (60 mmHg) compared to 0 mmHg (p = 0.0136) and 20 mmHg (p = 0.0089) as determined by fluorescence microscopy (Figure 6C) Furthermore, flow cytometry of BMDM showed that the frequency of IL-10+/F4/80+ events at 60 mmHg was significantly higher than that in the 0 mmHg group (p = 0.0244) (Figure 7C) It has been documented that M2 macrophages, but also TM cells, produce large amounts of ECM upon culture with Dex (31, 32) we analyzed the expression of fibronectin and collagen IV ECM-proteins which can also be found in the TM of glaucomatous eyes in macrophages in the cell culture setup with or without increased HP After 2 days, fibronectin expression was lower in LPS-stimulated BMDMs than in medium control BMDMs under the same HP level (p < 0.001). However, no significant difference in the fibronectin or collagen IV staining pattern was found between the various pressures in the medium or LPS group (Figures 9A,B,D,E) Fibronectin and collagen IV expression by BMDMs under different hydrostatic pressures Representative immunofluorescence images of fibronectin (A green) staining in BMDMs under different HP on day 2 and day 7 Graphs displaying the calculated MFI/cell of fibronectin on day 2 (B) and day 7 (C) and MFI/cell of collagen IV on day 2 (E) and day 7 (F) (n = 9) Statistical significance between different pressures was reached (*p < 0.05 ***p < 0.001); Statistical significance between different treatments within one pressure (#p < 0.05 ####p < 0.0001) The present study investigates the influence of increased HP and the corticosteroid Dex on the M1/M2 phenotype of murine macrophages Increased HP induced the production of the proinflammatory cytokine TNF-α and generated an M1 phenotype in macrophages after 2 days of incubation a prolonged exposure (7 days) under increased HP induced a pronounced M2 phenotype in these macrophages This was associated with an increase in IL-10 and fibronectin production on day 7 The additional treatment of macrophages with Dex for 2 days induced the production of the anti-inflammatory cytokine IL-10 Further incubation with increased HP enhanced this phenotype M1 macrophages were characterized by the highly expressed surface markers CD68, CD80, CD86, major histocompatibility complex-II, and CC chemokine receptor 2 (CCR2), while M2 macrophages were characterized by the surface molecules CD163, CD206, CX3CR1, and YM1/2 (35, 36) The results of this study indicate that LPS-stimulated macrophages have a stronger M1 polarization under elevated pressure after 2 days macrophages cultured under elevated pressure in the medium group polarized to M2 the M1 population in the LPS group decreased under higher pressure M1/M2 can be also classified according to differences in cytokines and chemokine expression (36). Proinflammatory cytokines such as TNF-α, IL-1β, -6, -12, -18, and -23 are produced by M1 macrophages, while TGF-β1 and IL-10 are produced by M2 macrophages (37) After culture under higher HP with LPS treatment for 2 days numbers of TNF-α+ macrophages and levels of TNF-α release were higher These results support the assumption that macrophages are polarized into an M1 phenotype upon higher pressure after 2 days After prolonged culture under higher pressure (60 mmHg) and LPS treatment for 7 days, the expression of TNF-α on day 7 was lower than on day 2 and did not show significant differences compared to macrophages under 0 or 20 mmHg. At the same time the level of IL-10 was increased when macrophages were cultured under higher pressure. This is in line with a more frequent M2 polarization on day 7, as M2 macrophages can highly express IL-10 (36, 40) these findings indicated a shift in the macrophage population toward an M2 phenotype upon increased pressure after 7 days macrophages are cultivated on glass slides to which they do not adhere well the cells are placed on plastic plates to which they adhere very well Such differences could be partly responsible for the difference in the observed IL-10 differences The same study demonstrated that after genetic depletion of the GC receptor macrophages produced increased levels of TNF-α and IL-6 in response to LPS stimulation The increased M2 polarization of GC-exposed macrophages in the outflow pathway owing to higher pressure may be related to the pathogenesis of GC-induced ocular hypertension or glaucoma The change in the phenotype of macrophages and the underlying function may play an important role in the development and deterioration of uveitis glaucoma We suspect that some macrophages remain in the eye after uveitis the remaining macrophages probably already show an M2 phenotype which tends to promote fibrotic mechanisms and can therefore also be involved in increasing IOP Further treatment of the eye with Dex or an increase in IOP would likely increase this phenotype and accelerate the development of secondary glaucoma we compared the functional capacity of BMDMs under different HPs with respect to M1 and M2 phenotypes and effector functions Increased HP provokes a time-dependent primary M1-related immune response followed by a secondary M2 response Dex treatment of macrophages and increased HP showed synergistic effects reflected by a pronounced M2 phenotype induction The results imply that increased HP may affect the outcome of inflammation and measures extenuating such a mechanism could help to manage secondary glaucoma more effectively All datasets presented in this study are included in the article/Supplementary Material and CH designed the study and wrote the manuscript and CH performed the experiments and analyzed the data All authors contributed to the article and approved the submitted version This study was supported in part by the Deutsche Ophthalmologische Gesellschaft (DOG) The authors would like to thank the China Scholarship Council for their support in this research The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fimmu.2020.573955/full#supplementary-material Identification of primary bone marrow-derived cells Whole events from one sample on day 7 in the SSC/FCS window Ungated events are displayed in SSC-H/SSC-A dot plot Single live cell gate was set and positive events are depicted in the left area F4/80 isotype control and F4/80-positive events are shown in the right-side gate The Advanced Glaucoma Intervention Study (AGIS): 7 The relationship between control of intraocular pressure and visual field deterioration PubMed Abstract | CrossRef Full Text From ocular hypertension to ganglion cell death: a theoretical sequence of events leading to glaucoma PubMed Abstract | CrossRef Full Text | Google Scholar Comparative effectiveness of treatments for open-angle glaucoma: a systematic review for the US Preventive Services Task Force doi: 10.7326/0003-4819-158-4-201302190-00008 and outcome of juvenile arthritis–related uveitis Elevated intraocular pressure in uveitis associated with juvenile idiopathic arthritis-associated uveitis cDNA microarray analysis of gene expression changes induced by dexamethasone in cultured human trabecular meshwork cells Tissue differential microarray analysis of dexamethasone induction reveals potential mechanisms of steroid glaucoma The complex role of neuroinflammation in glaucoma PubMed Abstract | CrossRef Full Text | Google Scholar Ultrastructural analysis of the pigment dispersion syndrome in DBA/2J mice PubMed Abstract | CrossRef Full Text | Google Scholar Monocyte modulation of aqueous outflow and recruitment to the trabecular meshwork following selective laser trabeculoplasty Macrophage activation and polarization: nomenclature and experimental guidelines Neuroinflammation in glaucoma: a new opportunity Different responses of macrophages in retinal ganglion cell survival after acute ocular hypertension in rats with different autoimmune backgrounds Macrophage plasticity and polarization in tissue repair and remodelling A circulating cell population showing both M1 and M2 monocyte/macrophage surface markers characterizes systemic sclerosis patients with lung involvement Alteration of MCP-1 and MMP-9 in Aqueous Humor Is Associated with Secondary Glaucoma in Fuchs Uveitis Syndrome Functional heterogeneity of culture-grown bone marrow-derived macrophages PubMed Abstract | Google Scholar NY; Austin; London; Montreal; Sydney; Tokyo; Toronto: Elsevier Google Scholar The isolation and characterization of murine macrophages Amniotic membrane induces peroxisome proliferator-activated receptor-γ positive alternatively activated macrophages Toll-like receptor 4 contributes to retinal ischemia/reperfusion injury PubMed Abstract | Google Scholar Associations between TLR4 polymorphisms and open angle glaucoma: a meta-analysis The pro-inflammatory role of high-mobility group box 1 protein (HMGB-1) in photoreceptors and retinal explants exposed to elevated pressure On the influence of neutrophils in corneas with necrotizing HSV-1 keratitis following amniotic membrane transplantation Loss of IL-10 promotes differentiation of microglia to a M1 phenotype Stiffness increases mononuclear cell transendothelial migration CrossRef Full Text | Google Scholar Soy protein-derived ACE-inhibitory peptide LSW (Leu-Ser-Trp) shows anti-inflammatory activity on vascular smooth muscle cells Interleukin-4 and dexamethasone counterregulate extracellular matrix remodelling and phagocytosis in type-2 macrophages Dexamethasone stiffens trabecular meshwork TNF-α induces human neural progenitor cell survival after oxygen–glucose deprivation by activating the NF-κB pathway Coinduction of nitric-oxide synthase and arginase I in cultured rat peritoneal macrophages and rat tissues in vivo by lipopolysaccharide Macrophages under pressure: the role of macrophage polarization in hypertension PubMed Abstract | CrossRef Full Text | Google Scholar The chemokine system in diverse forms of macrophage activation and polarization Alternative activation of macrophages: mechanism and functions PubMed Abstract | CrossRef Full Text | Google Scholar Nicotine mediates CD161a+ renal macrophage infiltration and premature hypertension in the spontaneously hypertensive rat Fenretinide inhibits macrophage inflammatory mediators and controls hypertension in spontaneously hypertensive rats via the peroxisome proliferator-activated receptor gamma pathway Understanding the mysterious M2 macrophage through activation markers and effector mechanisms PubMed Abstract | CrossRef Full Text | Google Scholar Dexamethasone turns tumor antigen-presenting cells into tolerogenic dendritic cells with T cell inhibitory functions Dexamethasone promotes tolerance in vivo by enriching CD 11clo CD 40lo tolerogenic macrophages Additive suppression of LPS-induced IL-10 and TNF-α by pre-treatment of dexamethasone and SB203580 in a murine alveolar macrophage cell line (MH-S) Potential regulatory molecules in the human trabecular meshwork of patients with glaucoma: immunohistochemical profile of a number of inflammatory cytokines M2 macrophage accumulation in the aortic wall during angiotensin II infusion in mice is associated with fibrosis Reduced myocardial ischemia-reperfusion injury in toll-like receptor 4-deficient mice Optic nerve degeneration after retinal ischemia/reperfusion in a rodent model Expression of inflammatory cytokines in retina ischemia-reperfusion injury rats Google Scholar Ischemic injury leads to extracellular matrix alterations in retina and optic nerve PubMed Abstract | CrossRef Full Text Macrophage-mediated injury and repair after ischemic kidney injury PubMed Abstract | CrossRef Full Text | Google Scholar Identification of different macrophage subpopulations with distinct activities in a mouse model of oxygen-induced retinopathy Cortisol modulates the induction of inflammatory gene expression in a rainbow trout macrophage cell line More than suppression: Glucocorticoid action on monocytes and macrophages Macrophage glucocorticoid receptors regulate Toll-like receptor 4–mediated inflammatory responses by selective inhibition of p38 MAP kinase Disruption of fibronectin matrix affects type IV collagen fibrillin and laminin deposition into extracellular matrix of human trabecular meshwork (HTM) cells Transforming growth factor β2 (TGFβ2) signaling plays a key role in glucocorticoid-induced ocular hypertension Intraocular pressure response to topical corticosteroids PubMed Abstract | Google Scholar Glaucoma and corticosteroid provocative testing PubMed Abstract | CrossRef Full Text | Google Scholar The role of steroids in outflow resistance PubMed Abstract | CrossRef Full Text | Google Scholar Dysregulation of monocyte/macrophage phenotype in wounds of diabetic mice PubMed Abstract | CrossRef Full Text | Google Scholar Glucocorticoid induction of the glaucoma gene MYOC in human and monkey trabecular meshwork cells and tissues Dexamethasone alters F-actin architecture and promotes cross-linked actin network formation in human trabecular meshwork tissue Dexamethasone inhibition of trabecular meshwork cell phagocytosis and its modulation by glucocorticoid receptor β Activation of human macrophages by mechanical ventilation in vitro TNF-alpha suppresses alpha-smooth muscle actin expression in human dermal fibroblasts: an implication for abnormal wound healing Prevalence of uveitic secondary glaucoma and success of nonsurgical treatment in adults and children in a tertiary referral center Multiplex cytokine analysis of aqueous humor in juvenile idiopathic arthritis-associated anterior uveitis with or without secondary glaucoma CrossRef Full Text | Google Scholar Bauer D and Heinz C (2020) Increased Hydrostatic Pressure Promotes Primary M1 Reaction and Secondary M2 Polarization in Macrophages Received: 18 June 2020; Accepted: 26 August 2020; Published: 14 October 2020 Copyright © 2020 Wang, Kasper, Laffer, Meyer zu Hörste, Wasmuth, Busch, Jalilvand, Thanos, Heiligenhaus, Bauer and Heinz. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) †These authors have contributed equally to this work and share last authorship Metrics details Juvenile idiopathic arthritis (JIA) is often associated with severe chronic anterior uveitis (CAU) and immunosuppressive therapy may be required the value of cyclosporine A (CsA) as monotherapy or as combination therapy for treating uveitis was studied in a large cohort of JIA children Multicentre retrospective study including 82 JIA children (girls n=60) suffering from unilateral or bilateral (n=55) CAU although patients were on topical or systemic corticosteroids Inactivity of uveitis during the entire treatment period (mean 3.9 years) was obtained with CsA monotherapy in 6 of 25 (24%) patients but more often when CsA was combined with the immunosuppressives (35/72 patients; 48.6% systemic immunosuppressive drugs and steroids could be reduced by ⩾50% (n=19) or topical steroids reduced to ⩽2 drops/eye/day (n=40) in selected patients Pre-existing cystoid macular oedema did not resolve under CsA treatment in any of the patients CsA was discontinued because of systemic hypertension (n=1) These observations suggest that CsA has limited value as a second-line immunosuppressive drug for the treatment of JIA-associated CAU The efficacy was better as the combination therapy in patients not responding to other immunosuppressives (eg it is essential that inflammatory inactivity is achieved A step-by-step anti-inflammatory treatment approach is generally suggested beginning with topical and possibly systemic corticosteroids one of the classical immunosuppressive drugs azathioprine (AZT) or cyclosporine A (CsA) is commonly used as a second-line medication and CsA is often added to the regimen in patients who do not respond adequately to the treatment A total of 82 children with confirmed JIA and associated chronic anterior uveitis (CAU) were analysed The children were treated with CsA (Immunosporine® or Neoral®) for uveitis at the German Center of Pediatric Rheumatology in Garmisch-Partenkirchen (Germany) or the Department of Ophthalmology at St Franziskus Hospital Muenster (Germany) The design of the work conforms to the standards currently applied in Germany No institutional review board approval is required for the chart review studies Patients with uveitis unrelated to JIA were excluded Ophthalmic evaluations included best-corrected visual acuities (BCVAs) Active uveitis was defined by the presence of ⩾1+ cells in the anterior chamber Unilateral or bilateral disease and duration of uveitis were noted Institution and termination of CsA therapy any topical and anti-inflammatory medication before and under CsA therapy the first uveitis manifestation in the second eye after institution of CsA therapy and any uveitis-related complications in at least one eye were documented Patients were followed up at 6- to 12-month intervals both by the paediatric rheumatologist and ophthalmologist Dosages of systemic corticosteroids and immunosuppressive agents were adjusted or drugs discontinued according to arthritis and uveitis activity and to the drug-related side effects The indication for systemic CsA monotherapy was active uveitis despite the treatment with topical (⩾3 drops/day) and possibly systemic corticosteroids (⩾10 mg or ⩾0.15 mg/kg body weight) Sparing of systemic steroids was a major indication for CsA CsA was considered as a second- or third-line immunosuppressive if uveitis remained active under treatment with any other immunosuppressives ⩾50% decrease in both corticosteroid use and immunosuppressive agent (if not on combined immunosuppressive drug and systemic corticosteroid at study entry then only ⩾50% decrease of corticosteroids); moderate response ⩾50% decrease in either corticosteroid or immunosuppressive agent; and poor response decrease of <50% in both corticosteroid and immunosuppressive agent Systemic and topical steroid sparing was analysed separately in our study For statistical analysis SPSS software (SPSS for Windows The χ2 square test and fisher's exact test for categorical data were used for statistical analysis when appropriate A P-value <0.05 was considered as significant difference The mean follow-up/treatment time after starting cyclosporine therapy was 3.9 years (range: 1.0–12.0) The initial CsA dosage was 3.0 mg/kg (range: 2.0–5.0 mg/kg) and the mean dosage at the end of treatment or the end of the follow-up Uveitis response under CsA as monotherapy or as combination therapy with other immunosuppressive drugs In two cases (2.0%), the second eye was affected for the first time, although the patient was under treatment with CsA. The sparing effect of immunosuppressives and steroids differed markedly between the individuals (Table 3) Sixteen of the 25 patients developed new uveitis complications in at least one eye during the CsA monotherapy A total of 72 patients received CsA as part of a combined systemic immunosuppressive treatment regimen. In 57 patients, CsA was added to the current course of systemic immunosuppressives. In another 15 patients, a second systemic immunosuppressive agent was added when systemic CsA monotherapy proved to be unsuccessful (Figure 1) Inactivity of uveitis was achieved in 32 of 72 patients (44.4%) at 1 year (P=0.49 as compared to CsA monotherapy) and in 35 of 72 patients (48.6%) during the entire period (mean 3.3 years) receiving CsA in combination with other systemic immunosuppressives (MTX n=18 CsA was more effective when given as combination therapy (P=0.037) no significant difference was found between the CsA mono- and combination therapy (P=0.82) A sparing effect of topical steroids was obtained in 33 patients (reduction to ⩽2 drops/day n=14 while the dosage was unchanged in another 33 and even increased in one other patient (unknown dosage in four patients) These numbers did not differ significantly from those in the monotherapy group (P=0.39) As MTX is the most frequently used immunosuppressive in JIA-associated uveitis patients, the value of additional CsA was analysed, especially in those patients who were not responding to MTX. In 37 children, CsA was added as a second systemic drug, when uveitis remained active under the MTX therapy (Table 4) uveitis inactivity was achieved during the entire treatment period and the difference compared to the respective effect with CsA monotherapy was close to the significance level (P=0.065) An attempt to taper off MTX was made in 10 of these 18 children immunosuppressive and/or systemic steroid sparing was possible in 45.9% of the patients The systemic steroid or immunosuppressive sparing effect (P=0.62) or sparing of topical steroids (P=0.24) of additional CsA with MTX did not differ from the CsA monotherapy group Whereas 48 patients (58.5%) already had developed uveitis complications before the initiation of CsA treatment, another nine patients (10.9%) developed first uveitis complications under CsA (Table 5) As the extent of synechia formation was not determined no conclusions can be drawn in this study on the worsening of the condition Sixteen of the 25 patients (64%) developed new secondary complications during the treatment period with CsA monotherapy New uveitis complications were reported in 35 (48.6%) of the 72 patients under systemic combination immunosuppression therapy and in 17 patients (45.9%) with additional CsA to the MTX and these numbers did not differ from the CsA monotherapy group (P=0.25 and 0.2 Cystoid macular oedema (CME) had already been detected under the previous MTX therapy in four patients and did not disappear in any of the patients after adding CsA glaucoma was present in three patients and was documented in a total of 10 patients at the end of the follow-up CsA treatment had to be stopped because of adverse reactions in 11% of all patients Reported adverse reactions included systemic hypertension (n=1) recurrent infections of the urinary tract (n=1) Only little evidence has been published from a few patients to suggest that CsA may improve JIA-associated uveitis the observations from 82 patients in this report reveal that this particular form of uveitis does not respond well to CsA as a monotherapy and that MTX non-responders show better responses when CsA is added to the treatment regimen although the role of T lymphocytes in the pathogenesis of JIA-associated uveitis has not been defined yet In their retrospective study, Kilmartin et al8 reported on 14 children suffering from uveitis who were treated with CsA Inflammation improved at a dosage of 5 mg/kg in 76% Systemic steroids could be tapered off in four patients (29%) and reduced in another 10 (71%) only three of the patients had JIA and the response was not adequate in these children Twelve of 28 patients (43%) with objective signs of arthritis showed an improvement in the number of active joints as compared to the baseline examination the physicians' evaluations only indicated 24% improvement In none of the seven uveitis patients could the steroid treatment be discontinued; the dose could be reduced in four patients Uveitis activity was reduced in eight of the involved eyes (66%) and visual acuity improved in 58% of them of them 23% because of remission (none in the uveitis group) 43% because disease flared up or the treatment was ineffective (42% in the uveitis group) and 26% (none in the uveitis group) because of side effects In 1 patient with uveitis not responding to combined MTX and prednisone quiescence was achieved with additional CsA The most common side effects from CsA were hypercreatinaemia (39%) systemic hypertension (15%) and hypertrichosis (29%) Schlote et al19 reported on 4 children with CAU who were treated with CsA The 2 patients with JIA-associated uveitis responded only moderately to a combination of CsA and systemic prednisolone All patients developed moderate hypertrichosis Our observations suggest that CsA has limited efficacy in the treatment of JIA-associated CAU During the mean follow up of 2.0 years under systemic CsA monotherapy inactivity of uveitis was only maintained in 6 of 25 (24%) children uveitis was inactive in 9 of the 25 patients (36%) the treatment only produced a minor sparing effect of anti-inflammatory medication Although CsA is commonly used to treat uveitis in juvenile arthritis patients our data suggest that its efficacy is low when administered as systemic immunosuppressive monotherapy in this patient population The impact of CsA on the visual outcome could not be determined in this study as the documented VAs were frequently unreliable due to children's incompliance or opacities in the visual axis Although this case series has been without a control group the data reveal that new uveitis complications often occurred during the treatment period new complications were detected in 16 of the 25 patients (64%) included the first uveitis manifestation developed in the formerly uninvolved eye which was present in four children before the initiation of CsA therapy did not disappear under the treatment in any of them who are not responding to MTX is an important issue as the drug is the most frequently used immunosuppressant in this patient group noteworthy that our data show that CsA was significantly more effective when it was added to an immunosuppressive drug When CsA was added to MTX in the children with active uveitis inactivity was achieved in approximately half of them show that the sparing effect of the other systemic immunosuppressive drugs and of topical steroids may be variable systemic immunosuppressive drugs and steroids could be reduced by ⩾50% in 19 patients or topical steroids reduced to ⩽2 drops/eye/day in 40 patients if treatment of 2 years or longer is expected Apart from the anti-inflammatory value of these medications drug safety is of the utmost importance in JIA children with uveitis especially as long-term treatment is usually required which is a good reason for preferentially using particular drugs the use of CsA may be favoured in patients who do not respond to MTX as contrasted to some recently introduced drugs the present data suggest that the value of CsA in the step-ladder approach for the treatment of children with JIA-associated uveitis must be reconsidered Although this study is somewhat limited by its retrospective design the results suggest that CsA monotherapy is of limited value while the addition of CsA may be beneficial in patients not responding properly to MTX or other immunosuppressive drugs Prospective randomized studies and long-term registries are necessary to define the most effective and safe treatment regimen Vision-threatening complications in childhood uveitis A review of current data on incidence and prevalence World-wide prevalence of juvenile arthritis why does it vary so much Incidence and outcomes of uveitis in juvenile rheumatoid arthritis Graefes Arch Clin Exp Ophthalmol 2006; 244: 281–290 Epidemiology of uveitis in juvenile idiopathic arthritis from a national paediatric rheumatologic and ophthalmologic database Klin Monatsbl Augenheilkd 2005; 222: 993–1001 An evaluation of baseline risk factors predicting severity in juvenile idiopathic arthritis associated uveitis and other chronic anterior uveitis in early childhood Prognosis of juvenile rheumatoid arthritis-associated uveitis Cyclosporin A therapy in refractory non-infectious childhood uveitis Late onset uveitis in juvenile-type chronic polyarthritis controlled with prednisolone Efficacy and safety profile of cyclosporin A in the treatment of juvenile chronic (idiopathic) arthritis Risk factors for cyclosporine-induced nephropathy in patients with autoimmune diseases International Kidney Biopsy Registry of Cyclosporine in Autoimmune Diseases Cyclosporine therapy for severe sight threatening uveitis in children and adolescents Standardization of uveitis nomenclature for reporting clinical data Results of the first international workshop International League of Associations for Rheumatology classification of juvenile idiopathic arthritis: second revision Outcome measures and classification criteria for the rheumatic diseases A compilation of data from OMERACT (Outcome Measures for Arthritis Clinical Trials) ILAR (International League of Associations for Rheumatology) Tumour necrosis factor alpha inhibitors in the treatment of childhood uveitis Low-dose cyclosporin A therapy in chronic posterior uveitis Low-dose cyclosporin A therapy in treating chronic Ophthalmology 1996; 103: 365–373; discussion 373–374 Cyclosporin A in therapy of chronic uveitis in childhood Four years' experience with cyclosporin A in pediatric kidney transplantation International consensus recommendations on cyclosporin use in rheumatoid arthritis Download references Download citation Anyone you share the following link with will be able to read this content: a shareable link is not currently available for this article Current Treatment Options in Rheumatology (2017) This website is using a security service to protect itself from online attacks The action you just performed triggered the security solution There are several actions that could trigger this block including submitting a certain word or phrase You can email the site owner to let them know you were blocked Please include what you were doing when this page came up and the Cloudflare Ray ID found at the bottom of this page Die Nachfolge des Heiligenhauser Unternehmens ist damit gesichert Das Hochregallager bei Steinbach & Vollmann (RP) Andreas Kupka hat gemeinsam mit der Mittelstandsholding Endurance Capital sowie der Familie zu Sayn-Wittgenstein die Steinbach & Vollmann GmbH & CO. KG (STUV) erworben. Das nordrhein-westfälische Unternehmen mit Sitz in Heiligenhaus ist spezialisiert auf die Herstellung hochwertiger Verschlüsse und Beschläge für die Kühl- und Sicherheitsindustrie sowie den Stahl- und Metallbau Andreas Kupka verfügt über eine 30-jährige Branchenerfahrung in der er selbst Unternehmen gründete und zu mittelständischer Größe entwickelte neuer Eigentümer und Geschäftsführer von STUV: „Das Unternehmen besetzt attraktive Nischenmärkte mit dem Potenzial eine herausragende Marktstellung zu entwickeln und langfristig gute Wachstumsraten zu erreichen Das mit drei Standorten weltweit und einem international ausgerichteten Distributionsnetz vertretene Unternehmen besitzt eine hervorragende Basis für die Zukunft und hat einen starken Kern.“ STUV blickt auf eine 135-jährige Unternehmensgeschichte zurück in der sich das Unternehmen zu einem Spezialhersteller für Verschlussprodukte und Sicherheitssysteme für die Industrie entwickelt hat Im Jahr 2018 lag der Umsatz bei rund 20 Millionen Euro Mit dem altersbedingten Ausscheiden des langjährigen Geschäftsführers Wolfgang Finger wurde von den Gründerfamilien nach einer langfristigen Nachfolgelösung gesucht „Mit der Konstellation von uns und Endurance Capital als langfristig orientierten Finanzierungspartnern und Andreas Kupka als geschäftsführender Gesellschafter haben wir eine für das Unternehmen optimale Zukunftslösung finden können“ Die Steinbach & Vollmann GmbH & CO. KG ist ein international aktives Unternehmen. Rund 160 Mitarbeiter arbeiten täglich am Stammsitz in Heiligenhaus und den Tochterunternehmen in Spanien und China dafür dass der internationale Kundenstamm mit innovativen und zuverlässigen Verschlusslösungen beliefert wird Bei STUV erhalten die Kunden alles aus einer Hand: vom einzelnen Drehriegel bis zur kompletten Steuerungstechnik für Hochsicherheitssysteme Yvonne Catterfeld und Mark Forster die beste Stimme Deutschlands auf ProSieben & Sat.1 Der deutsche Chartstürmer ist aus den europäischen Radio- und Streaming-Playlists mit Songs wie „I Believe“ oder „Feel Alive“ nicht mehr wegzudenken dass man die „The Voice of Germany“-Fans in den sozialen Medien gefragt habe wen sie 2024 am Buzzer von ‚The Voice of Germany‘ sehen möchten „Und die meistgenannten Wiedersehens-Wünsche werden wir in der 14 Staffel unserer Musikshow erfüllen: Mit Mark Samu und Yvonne kehren drei Coaches auf die roten Stühle zurück die unsere Zuschauerinnen und Zuschauer sehr gerne bei #TVOG wiedersehen möchten Und #TVOG-Newcomer Kamrad vervollständigt das Coach-Quartett 2024 perfekt – herzlich willkommen in der ‚The Voice‘-Familie!“ ProSieben-Chef Hannes Hiller: „‚The Voice of Germany‘ wird neu und bleibt vertraut Wir feiern 2024 mit Kamrad eine große Coach-Premiere und bringen gleichzeitig Samu Yvonne und Mark erstmals seit 2017 wieder so zusammen auf die roten Stühle zurück.“ Diese Vierercombo verspreche großartiges Musik-Entertainment in der 14 Und schon mit dem Aufzeichnungsstart der sogenannten „Blind Auditions“ bei denen die vier Coaches die Kandidatinnen und Kandidaten nur hören Juni haben die Talente die Qual der Wahl – mit welchem der vier Coaches sie sich im Finale sehen