Volume 15 - 2024 | https://doi.org/10.3389/fimmu.2024.1450600 Rissen) is an emerging causative agent of foodborne diseases The current emergence of antibiotic resistance makes necessary alternative therapeutic strategies we investigated the potential of a phage-resistant strain of S Rissen (RR) as a tool for developing an effective lipopolysaccharide (LPS)-based vaccine The LPS O-antigen is known to play critical roles in protective immunity against Salmonella the high toxicity of the LPS lipid A moiety limits its use in vaccines we demonstrated that the acquisition of bacteriophage resistance by S Rissen leads to structural modifications in the LPS structure we characterized the LPS from phage-resistant strains as a smooth variant bearing under-acylated Lipid A portions (penta- and tetra-acylated forms) We then combined RT-qPCR and NMR-based metabolomics to explore the effects of phage resistance and LPS modification on bacterial fitness and virulence we conducted in vivo studies to determine whether lysogeny-induced remodeling of LPS affects the host immune response Results revealed that the under-acylated variant of LPS from RR attenuates the inflammatory response in BALB/c mice while eliciting a specific antibody response that protects against S our findings suggest that phage resistance may offer a novel strategy for reducing LPS toxicity highlighting its potential as a promising biological approach for developing LPS-based vaccines against Salmonella infections making the development of a successful vaccine a pressing challenge makes it challenging to develop safe vaccines In a previous study, we demonstrated that LPS from the bacteriophage-resistant strain of S. Rissen (RR) induces a reduced inflammatory response in vitro compared to the LPS produced by the bacteriophage-sensitive strain of S. Rissen (RW) (25, 26) and attributed this result to Lipid A modification The goal of the present study was to validate our hypothesis proposing bacteriophage-resistance as an alternative strategy to traditional chemical to obtain under-acylated variants of Lipid A Morons are prophage genes encoding proteins that enhance bacterial fitness through different mechanisms (28). They can increase bacterial virulence, promote resistance to environmental stressors, and contribute to phage resistance via Superinfection exclusion (Sie) proteins (25, 28). These proteins prevent further infections by the same or closely related phages, inhibiting phage genome entry into bacterial cell (29) Salmonella phages use LPS to enter host cells and establish a successful infection. Therefore, as part of the Sie mechanism, Salmonella may acquire prophage genes that modify the LPS structure (30) we tested the potential of RR to reduce the LPS reactogenicity through Lipid A modification proposing it as an alternative approach for developing LPS-based vaccines against Salmonella infections We found that the acquisition of the phage-resistant phenotype induces metabolic and physiological changes in RR which alter the host-pathogen interaction by remodeling the LPS acylation pattern we demonstrated that Lipid A modification in RR-LPS impairs the TLR4 signaling weakening the innate immune response while mediating early protection in BALB/C mice infected with S our findings offer a promising strategy for developing effective LPS-based vaccine to prevent Salmonella infection and may pave the way for the development of broad-spectrum vaccines against other Gram-negative bacteria All mouse experiments were carried out in accordance with the guidelines for the Care and Use of Laboratory Animals of the European Community (Legislative Decree n Number: 86/609/CEE) was approved by the Committee on the Ethics of Animal Experiments of the University of Naples and authorized from the Italian Ministry of Health The bacteriophage-sensitive S. enterica ssp. enterica serovar Rissen (RW) was isolated from food products and characterized by Istituto Zooprofilattico Sperimentale del Mezzogiorno (Portici, Naples, Italy), using standard conventional methods (31). The bacteriophage-resistant S. Rissen (RR), instead, was obtained from the RW strain following selection for resistance to phage Ф1, as described by Papaianni et al. (25) Both RR and RW strains were grown in Luria-Bertani (LB) medium (ThermoFisher Scientific The enumeration of phage particles, expressed as plaques forming colony (PFU/mL), was determined by performing the Double Agar Layer (DAL) method (32). Plaques were re-isolated, propagated and stored in SM buffer (NaCl 100 mM, Tris-HCl 50 mM, MgSO4 8 mM; pH 7.5) at + 4°C, or in liquid nitrogen with DMSO 5% (v/v) to avoid loss of phage titer (33) The genome assembly and annotation of the RR strain can be accessed via European Nucleotide Archive under the following accession number GCA_963679805 The human gastric adenocarcinoma cell line AGS was kindly provided by Prof Alessandra Tosco from the University of Salerno (Fisciano Cells were grown in Dulbecco’s Modified Eagle Medium (DMEM) high glucose (Microtech) supplemented with 10% fetal bovine serum (FBS; Microtech) 1% penicillin/streptomycin (Microtech) and 1% L-glutamine (Microtech) and maintained at 37°C The cell line was authenticated through the short tandem repeat (STR) analysis and periodically tested for mycoplasma contamination The primers for detecting SieB gene were: reverse primer 5’-CAAACAAATCCCGAACGACT-3’; forward primer 5’-ATGGTGGCAGGAGTTAATGC-3’ Dried cells of RR and RW S. Rissen strains were extracted by PCP (phenol:chloroform:petroleum ether 2:5:8) and by water/phenol method as already reported (35) The linkage positions of the monosaccharides were determined by GC-MS analysis of the partially methylated alditol acetates (PMAAs). Samples (1 mg) were methylated with CH3I (100 µL) and NaOH powder in DMSO (300 µL) for 20 h (39) The products were totally hydrolyzed with 2 M TFA at 120°C for 2 h and acetylated with Ac2O and pyridine (50 µL each All the derivatives were analyzed on Agilent Technologies gas chromatograph 7820A equipped with a mass selective detector 5977B and an HP-5 capillary column (Agilent AMGs and FAMEs analyses were performed using different temperature programs the AMGs analysis started at 140°C for 3 min followed by an increase from 140°C to 240°C at 3°C/min; while the FAMEs analysis started at 140°C for 3 min followed by an increase from 140°C to 280°C at 10°C/min PMAA analysis was performed using a temperature program that began at 90°C for 1 minute then increased from 90°C to 140°C at 25°C/min and 200°C to 280°C at 10°C/min with a final hold at 280°C for 10 minutes The supernatants obtained after mild acid hydrolysis of the entire LPSs (19.5 mg and 15 mg from RR-LPS and RW-LPS respectively) were fractionated on a Biogel P-10 column (Biorad 0.5 mg of each sample was treated with 1 mL of 1.25 M HCl/CH3OH for 20 h at 80°C The crude mixtures were extracted twice with hexane The analyses were performed on Agilent Technologies gas chromatograph 7820A equipped with a mass selective detector 5977B and an HP-5 capillary column (Agilent A temperature program starting at 140°C for 3 min and followed by an increase from 140°C to 280°C at 10°C/min was used for fatty acid analyses LPS isolated from both RR and RW (38) were purified according to Stephens et al. (42) LPSs were resuspended in endotoxin-free water containing triethylamine (TEA; 0.2%) deoxycholate (0.5%) and water-saturated phenol (500 μL) The obtained solution was vortexed for 5 minutes incubated on ice for 5 minutes and then centrifugated (10,000 g for 2 minutes at 4°C) The upper phase (aqueous) was transferred into a fresh tube supplemented with 75% ethanol and 30 mM sodium acetate precipitated for 1 hour at -20°C and lastly resuspended in TEA The RR and RW-LPS were coupled to Rat Serum Albumin (RSA; purchased from Sigma Aldrich) using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC), following the protocol described by Masoud, 2007 (43) purified LPSs (10 mg) were dissolved in sterile distilled water (1 mL) and the solution was mixed with 500 μL RSA (10 mg/ml) The mixture was stirred on an automatic shaker at room temperature for 3 h the pH was adjusted to 7 and the mixture was centrifuged (1000 rpm for 10 minutes) The supernatants were purified by using a Sephadex G-75 column and eluted with phosphate buffered saline (PBS) Eluates containing both LPS and protein were pooled and dialyzed against distilled water at 48°C RW and RR strains were obtained as indicated above (see the S. Rissen strains and culture conditions paragraph). RWΦ1- and RSΦ1- strains were derived from the RW and RR strains as described by Papaianni et al. (25) All strains were grown in LB medium and centrifugated when bacteria reached the exponential growth phase and the same cell density and the supernatant filtered by 0.22 μm filters (Millipore Sterile supernatants were quenched in liquid nitrogen for 10 minutes - in order to stop metabolic activities in the filtrates - and stored at -80°C Ten biological replicates of growth culture of each strain were prepared Uninoculated growth medium was used as negative control To achieve the NMR-based footprinting metabolomics analysis RSΦ1- and RWΦ1- were rapidly defrosted and 630 μL of each fluid sample were pipetted into eppendorfs containing 70 µL of D2O containing sodium 3-(trimethylsilyl)-2,2,3,3-tetradeuteropropionate (TSP) 0.1 mM (for chemical shift reference) and sodium azide 3 mM as antimicrobial agent HSQC resonances spectra were referenced to the lactate doublet (βCH3) assumed to resonate at 1.33 ppm for 1H and 20.76 ppm for 13C 1H NMR spectra of the O-chains were recorded by using a Bruker 600 MHz spectrometer equipped with a cryo-probe The samples (3 mg) were dissolved in 550 μL of D2O and the spectra were calibrated with external acetone (δH = 2.225 ppm; δC = 31.45 ppm) such as the Human Metabolome Database (HMDB) Statistical significance was determined by one-way analysis of variance (ANOVA) followed by Bonferroni post hoc correction p values < 0.05 were considered statistically significant The susceptibility of erythrocytes to RR or RW-LPS was evaluated by performing the hemolysis assay on fresh human blood Erythrocytes were isolated from blood of healthy donors (n=9) in accordance with the principles of good clinical practices reported in the Declaration of Helsinki and under the approval of the Ethics Committee of Villa Betania Hospital blood samples were obtained from the arm’s peripheral vein and collected in heparin tubes An informed consent was obtained from all participants As reported by Greco et al. (50) whole blood was centrifuged at 1,500 x g for 5 minutes and the supernatant (plasma) discarded Aliquots of 5 x 107/mL red blood cells were resuspended in PBS containing different concentrations of RR or RW-LPS (from 1 to 500 μg/mL) incubated at 37°C for 1 hour and centrifuged at 1,500 x g for 5 minutes and the released hemoglobin measured at 405 nm The percentage of hemolysis was calculated as the ratio of the untreated control Animal experiments were carried out on female BALB/c mice aged 8 to 10 weeks - purchased from Charles River Laboratories (Wilmington USA) - at the animal facility of the University of Naples “Federico II” Animal were housed in static microisolator cages Mice were randomly assigned to the treatment groups The sample group allocation was not blinded to the investigators Six mice per group were infected intraperitoneally with 100 μL of sterile phosphate-buffered saline (PBS), containing grown doses (103, 105, 107 and 109 CFU/animal) of RR or RW strains. Control group, instead, received 100 μL of PBS only. Mice were observed for 21 days, in order to evaluate clinical manifestations and death. Lethal Dose-50 (LD50) was calculated according to the Reed and Muench method (51) LPS purified from both RR and RW strains was administrated intraperitoneally in a dose responsible for endotoxemia (20 mg/Kg body weight) (52) and mice (6 per group) were observed 2 in order to evaluate body temperature and weight LPS was dissolved in PBS (100 μL per animal) and the control group was injected with PBS only Mice that lost more than 20% of their starting body weight or decreased their starting body temperature more than 4°C were euthanized Data were collected using the Bio-Plex 200 System (Bio-Rad) and analyzed by Bio-Plex Manager™ software was determined by the single target ELISA assay using the mouse IFN-β ELISA kit (Elabscience) according to the manufacturer’s instructions Samples were read using the 96-well plate reader (NeoBiotech) Cytokines were measured at different times and their concentration was determined based on the automatically calculated standard curve The first group was injected intraperitoneally with the RR-entire LPS while the second one with the RW-entire LPS purified and conjugated with Rat Serum Albumin (RSA) as reported above (“LPS purification for biological studies” and “LPS conjugation for mice immunization”) they were dissolved in sterile PBS (pH=7.4) and administrated twice at two-weeks interval at the final concentration of 10 μg (100 μL) The third group (control group) was injected with sterile PBS only (100 μL) Blood samples from the tail vein and feces were collected on day 4 21 and 28 to determine the adaptive immune response and evaluate the cross-protective ability conferred by the RR-LPS immunization 96-well plate was coated with RR or RW purified LPS (5 µg/mL) in 100 µL/well coating buffer (Na2CO3 0.64 g and NaHCO3 3.7 g) and incubated overnight at + 4°C wells were blocked with 200 µL/well of wash-buffer containing 2% bovine serum albumin (BSA) and the plate was incubated for 1h at 37°C Sera or fecal supernatants were diluted 1:100 in blocking buffer (100 µL/well) and incubated at 37°C for 1 h 100 µL of the HRP-conjugated goat anti-mouse IgG (1:2,000; Invitrogen) IgA (1:10,000; Abcam) or IgM (1:1,000; Invitrogen) were added to each well and incubated at 37°C for 30 min the plate was filled with 100 µL/well of the indicator substrate (TMB; 1 mg/mL to each well) and incubated at room temperature for 10 min in the dark After incubation the enzymatic reaction was stopped by adding 100 µL/well of stop solution (1M sulphuric acid) and 15-30 minutes later the optical density (OD) was recorded at 450 nm with an automatic ELISA reader (NeoBiotech) The assay was performed in triplicate and each incubation period was followed by multiple washings using PBS containing Tween 20 (0.05%) The standard curve was used to accurately determine the concentration of target LPS-immunoglobulins The efficacy of the RR-LPS immunization was evaluated by using a mouse model of salmonellosis producing disseminated infection after intraperitoneal injection of the bacteriophage-sensitive Salmonella Rissen (RW) mice immunized as detailed above (see the “Immunization” paragraph) were infected with the RW strain (109 CFU/100 μL) two weeks after the last immunization via the intraperitoneal route and the bacterial burden in the spleens was determined mice were sacrificed 3 days post-infection and spleens were aseptically removed Spleens (1 g) were homogenized in 1 mL of phosphate buffer saline (PBS) solution and serial dilutions were cultured on BHI agar for 24 hours and results were expressed as colony forming unit (CFU) per gram of tissue (CFU/spleen) the protective efficacy of the RR-LPS was also evaluated upon a single immunization Mice (n=13 per group) were immunized intraperitoneally with pure conjugated LPS (10 μg dissolved in PBS 100 μL) isolated from the RR or RW strains or with vehicle (PBS 100 μL; control group) each group was infected with the RW strain (109 CFU/100 μL) via the intraperitoneal route and the bacterial burden in the spleens was determined 3 days post-infection To investigate the role of anti-RR-LPS antibodies in imparting immune protection against S. Rissen infection, the bactericidal assay was performed. Mice were immunized as described above and four days after the last immunization, blood samples were collected, and serum separated by centrifugation. Polyclonal antibodies were purified by affinity chromatography, using protein A/G agarose beads as previously described (55, 56) antibody solution plus complement (BioMerieux complement or LB broth (for control group) were mixed with 5 μL of viable RW (final bacterial concentration 1 x 106 CFU/mL) in a 96-well plate and incubated at 37°C for 3 hours the absorbance at 600 nm was measured using a microplate reader To evaluate whether the RR-LPS immunization could confer cross-protection serum samples from mice immunized with the RR-LPS were tested for antibody reactivity against three different serovars of Salmonella (S Mice were immunized as described above and four days following the last immunization and the serum was separated by centrifugation (3,000 g Serum samples were used to measure IgG levels by the LPS-specific ELISA assay and animals giving the highest level of antibodies were selected for serum harvest colonies of the selected Salmonellae were mixed with 100 μL of serum (undiluted or diluted 1:50 or 1:100 with sterile PBS) or with sterile PBS only (negative control) The presence of cross-reaction was determined by observing the development of visible clumping of bacterial cells within 3 minutes To explore the target determinant of the anti-RR-LPS antibodies to S We tested the antibody reactivity against both LPS and O-antigen from the RR and RW strains using serum samples from mice immunized with the RR-LPS a 96-well plate was coated with O-antigen (5 µg/mL) or LPS (5 µg/mL) in 100 µL/well coating buffer (Na2CO3 0.64 g and NaHCO3 3.7 g) for 16 h at 4°C Sera were diluted 1:100 in 100 µL/well of wash-buffer containing 2% bovine serum albumin (BSA) and incubated at 37°C for 1 h 100 µL of the HRP-conjugated goat anti-mouse IgG diluted 1:2,000 (Invitrogen) was added to each well and incubated at 37°C for 30 min Statistical analysis was conducted using GraphPad Prism 9.0 software (San Diego followed by either Turkey or Bonferroni post-hoc correction was utilized to compare two or more experimental groups For simultaneous comparison of multiple groups with two or more factors we used two-way ANOVA followed by Bonferroni post-hoc test The Log-rank test was employed to compare Kaplan–Meier survival curves A minimum of n = 6 mice per group was included and no formal randomization procedure was implemented The reported values represent the means ± SD of two or three biological replicates A p-value of < 0.05 was considered statistically significant The RR strain expresses the prophage SieB gene Analysis of mRNA expression levels displayed increased levels of SieB gene in the RR strain - following AGS cell line infection - compared to RW strain Results are reported as graph bars and represent mean ± SD of three biological replicates from two independent experiments Two-way ANOVA followed by Turkey post-hoc correction was used to compare the SieB gene expression between RR and/or RW groups In conclusion, these results suggest that RR expresses the SieB gene, which confers immunity against secondary phage attack and contributes to the phage-resistance phenotype, likely through modifications of cell membrane elements, such as LPS (28). In addition, these results, along with previous reported results (26) prompted us to investigate whether the prophage-related virulence genes overexpressed by RR confer advantages to the host response against Salmonella To investigate whether phage-resistance alters the LPS structure and to assess the effects of these modifications on bacterial virulence and host immune responses the chemical structure of the Lipid A and O-antigen portions was examined differences in the Lipid A portion were detected the primary signal at m/z 1795.875 (calculated [M-H]- = 1796.229 Da) was assigned to the di-phosphorylated hexa-acylated glycoforms HexN2P2[C14:0(3-OH)]4(C14:0)(C12:0) The spectrum also showed the presence of a signal at m/z 2034.034 corresponding to the di-phosphorylated hepta-acylated species (calculated [M-H]- =2034.462 Da) which differs from the hexa-acylated species for the additional presence of a C16:0 and signals at m/z 1585.750 and 1359.630 corresponding to the di-phosphorylated penta- and tetra-acylated glycoforms each cluster exhibited heterogeneity as proven by the occurrence of signals differing in 80 u which indicates Lipid A species differing in the length of their acyl chains Reflectron negative MALDI-TOF MS spectra of S our findings suggest that RR-LPS is a weak stimulator of the host innate immune response and elicits a mitigated inflammatory response Orthogonal Projection to Latent Structure Discriminant Analysis (OPLS-DA) of bacteriophage-sensitive or resistant S before or after phage excision (RW; RR; RSФ1-; RWФ1- (A) Scores plot showing a distinct separation of RR group (blue squares) from RW respectively) and of RWФ1- and RSФ1- groups (red and purple squares respectively) from the RW group (green squares) (B) Loading plot indicating NMR variables (chemical shift) of metabolites responsible for between-classes separation (A) Scores plot showing a distinct separation of RSФ1- group (purple squares) from RWФ1- group (red squares) A total of 28 metabolites were identified as responsible for the above reported classes separation (Supplementary Table 2) significant differences in their concentration were detected N-acetyl-alanine and γ-aminobutyric acid) and 5 organic acid and derivatives (pyruvate hydrate succinate and formate) discriminated the RW group from the RR (p < 0.05) RSФ1- and RWФ1- groups did not display significant differences (p > 0.05) in the concentration of succinate This result suggests that the different concentration observed in the growth medium from RW and RR is ascribable to metabolic changes induced by the presence of the phage Ф1 and specifically to endogenous phage genome elements responsible for phage-resistance phage infection altered the expression levels of 3 amino acids and derivatives (betaine 1 sugar (myo-inositol) and other metabolites (nicotinate and imidazole) These metabolites were present in different concentrations (p < 0.05) in the growth medium from RWФ1- compared to RW The same result was found in RSФ1- compared to RR were detected between RW and RR groups or RSФ1- and RWФ1- thus addressing the mentioned differences to phage metabolism RSФ1- and RWФ1- groups were found to show significant differences (p < 0.05) in the concentration of the amino acid tyrosine due to the different behavior of Ф1 when excised from the phage-resistant or sensitive strain To evaluate the effects of lysogeny on the virulence profile of S. Rissen, the lethal dose 50 (LD50) of both RR and RW strains was determined in a mouse model of infection. Female BALB/c mice aged 10 weeks were infected intraperitoneally with a dose-range of viable RR or RW bacteria (103, 105, 107, 109 CFU/mouse) and survival was monitored for 21 days (Figure 5) Determination of 50% Lethal Dose (LD50) of RR and RW in BALB/c mice Survival curves of mice infected with different concentrations of RW strain (A) or RR strain (B) Uninfected control group included mice injected with PBS vehicle (n = 6/group) ** p < 0.01 (Long-rank Mentel-Cox test) Data are representative of two independent experiments LD50 was calculated according to the Reed and Muench method LD50 = Log10 end-point bacterial dose = Log10 (bacterial dose showing mortality next below 50%) + {[(50% - mortality at bacterial dose next below 50%)/(mortality at bacterial dose next above 50% - mortality at bacterial dose next below 50%)] x Log10 (differences between bacterial doses used in the assay)]} suggesting that mice are hyporesponsive to RR-LPS stimulation and hence unable to mount an immediate defensive response This property may reflect the unique organization of the RR-LPS and its capacity to mitigate the host immune system (A) Experimental design for the intraperitoneal (i.p.) injection of RR or RW-LPS female BALB/c mice (n = 6 per group) were injected intraperitoneally with 20 mg/Kg of RR or RW-derived LPS (RR-LPS and RW-LPS respectively) dissolved in PBS solution and then body weight and temperature were evaluated Mice (n = 6) in the control group (Control) were injected intraperitoneally with the same volume of PBS solution Graph represents mean ± SD of values from individual mice (dots) (C) Bar graph represents changes (%) of body weight 24 hours after LPS injection Data are representative of a single experiment Two-way ANOVA followed by Turkey post-hoc correction was used to compare body weight among three groups (Control One-way ANOVA followed by Turkey post-hoc correction was used to compare body weight changes among three groups **p < 0.01; ***p < 0.001; **** p < 0.0001 (E) Bar graph represents change of temperature 24 hours after LPS injection Two-way ANOVA followed by Turkey post-hoc correction was used to compare body temperature between RR-LPS and RW-LPS groups at different times following LPS injection One-way ANOVA followed by Turkey post-hoc correction was used to compare the mean temperature among three groups *p < 0.05; **p < 0.01; ****p < 0.0001 Cytokine levels in serum of BALB/c mice stimulated with RR or RW-LPS Mice (n = 6 per group) were injected intraperitoneally with 20 mg/Kg of RR or RW-LPS dissolved in PBS solution Mice in the control group (Control) were injected intraperiteonally with the same volume of PBS solution Serum was collected every 2 hours for 8 hours and 24 hours following injection The cytokines: (A) TNF-alpha; (B) G-CSF; (C) IL-6; (D) IFN-gamma; (E) IL-10; (F) IFN-beta and (G) RANTES/CCL5 were analyzed by ELISA Two-way ANOVA followed by Turkey post-hoc correction was used to compare cytokine levels among the three groups (control these results suggest a different capacity of RR and RW-LPS to stimulate the host immune response and a reduced toxicity of the RR-LPS As a powerful antigen, LPS plays a pivotal role in immunological processes, stimulating antibody production (68). However, due to the Lipid A reactogenicity, LPS – in its native form - is not suitable as vaccine (69). Instead, the low toxicity of the RR-LPS (Figure 7) – resulting from the deacylation of Lipid A (Figure 2) – could make it safe enough to develop antimicrobial vaccines To investigate the protective role of the RR-LPS against S. Rissen infection, the immunization assay was performed. Therefore, we first explored the concentration of the whole LPS structure necessary for mice immunization, by evaluating the hemolytic effect (Supplementary Figure S6) of a wide range of doses (spanning from 1 to 500 μg) Results demonstrated that the minimum concentration of RR-LPS showing hemolytic effect < 8% was 10 μg this concentration was selected to assess RR-LPS as a potential vaccine candidate IgG and IgA antibody response elicited after immunization with RR-LPS or RW-LPS Results are represented as mean titers (μg/mL) in serum or feces ± SD from female BALB/c mice (n = 6 per group) immunized intraperitoneally three times with: 1) RR-LPS (10 μg/100 μL PBS teal green); 2) RW-LPS (10 μg/100 μL PBS amaranth red) or 3) vehicle (100 μL PBS Two-way ANOVA followed by Turkey post-hoc correction was used to compare total antibody levels among three groups * p <0.05; **p <0.01; ****p <0.0001 IgG and IgA end-point anti-RR-LPS or RW-LPS antibody titers Results represent the antibody response elicited on day 7 after last immunization and are represented as mean titers (μg/mL) in serum or feces ± SD Two-way ANOVA followed by Turkey post-hoc correction was used to compare total antibody levels These results clearly suggest RR-LPS as a more effective and safer immunostimulant than the parent RW-LPS as it retains immunostimulatory properties while lacking most of its toxicity RR-LPS reduces bacterial burden in mice infected with S Conversely, mice that received unconjugated RR-LPS exhibited only a modest reduction in bacterial burden. Although bacterial burden was still higher than in those receiving PBS or a single dose of RW-LPS, it was not lethal (Table 1) Collectively, these findings suggest that LPS-specific antibodies significantly contribute to immune protection against S. Rissen infection, as confirmed by serum bactericidal activity (Figure 9) and highlight RR-LPS as a promising adjuvant for the development of vaccines against Salmonella infections Antibodies from mice immunized with RR-LPS display bactericidal activity against WT S 1 x 106 CFU/mL) was incubated at 37°C for 3 hours alone with purified antibodies derived from mice immunized with RR- or RW-LPS with complement or with both purified antibodies and complement Data are represented as Log10 of CFU/mL (OD600 = 1 = 5 x 108 CFU/mL) and represent means ± SD of three independent experiments One-way ANOVA followed by Turkey post-hoc correction was used to compare Log10 CFU/mL among different experimental conditions Salmonella species share a high degree of homology in genes encoding cell-surface molecules, including LPS, a major target of antibodies (20) immunization with LPS from one Salmonella serovar could confer immunity against related serovars serum samples (undiluted or diluted 1:50 and 1:100) exhibited variable agglutination with different selected Salmonella strains (S undiluted serum showed strong agglutination with S serum also agglutinated the above Salmonella serovars although the reaction required more time than the undiluted serum a late agglutination activity of undiluted serum was observed against S The strong interaction of anti-RR-LPS antibodies with S suggests the O-antigenic determinants O:6 and 7 as their major target These results indicate that anti-RR-LPS antibodies may confer cross-protection against related Salmonella serovars by targeting shared O-antigens The O-antigen portion of LPS is widely recognized as the key target for immune defense against bacterial infections These results demonstrate that O-antigen is the primary RR-LPS epitope responsible for modulating the antibody-mediated host protection, supporting our previous findings (Supplementary Table 4) poorly investigated portions of the LPS molecule may also contribute to the host defense and antibody reactivity In this study, we investigated the protective effect of an LPS-based vaccine against S. Rissen in BALB/c mice. LPS is a key immunogenic component of Gram-negative bacteria. It stimulates the host humoral immune response and provides protection against pathogens (72, 73) LPS also plays an essential role in bacterial virulence through its endotoxic component (Lipid A) which raises concerns about its safety as “subunit” vaccine in its native form limiting their survival and complicating large-scale vaccine production we propose - for the first time - phage resistance as a promising biological tool for producing under-acylated variants of LPS overcoming the limitations mentioned above as a naturally occurring selection mechanism bypasses the need for microbial genetic manipulation thus avoiding challenging related to the stability of mutations and the maintenance of the desired phenotypic traits phage-resistance promotes bacterial survival under stress conditions offering a cost-effective and sustainable alternative to conventional genetic LpxR encodes a deacylase responsible for removing acyl chains from Lipid A we hypothesized the capability of RR of producing deacylated Lipid A species In the present study, we validated the above hypothesis. Mass spectrometry analysis revealed that, unlike the RW strain, RR produces a higher abundance of two alternative variants of Lipid A as the penta-acylated and the tetra-acylated form (Figure 2) Both these two structures are less stimulatory for TLR4 and elicit a mitigated innate immune response These results demonstrate that the acquisition of the SieB gene which is associated with the distinctive phage-resistant phenotype of RR improves bacterial fitness and provides virulence factors (LpxR) which attenuate the innate immune response in the eukaryotic host These findings suggest that phage Ф1 provides RR with an adaptive advantage by enhancing bacterial fitness these results suggest that phage-resistance enhances bacterial fitness and reduces bacterial effectiveness in inducing cell host damage These results were confirmed in vivo. RR, in fact, curbs the mortality of mice. The highest tested concentration of RR (109 CFU/animal) resulted in 33% mortality in mice, compared to 100% mortality in those exposed to the same concentration of RW (Figure 5) This reduced mortality may reflect under-acylation of Lipid A and consequently reduced activation of the innate immune response Under-acylated Lipid A molecules, in fact, compete with native species of Lipid A (hexa-acylated forms) and inhibit the hexa-acylated Lipid A-MD2 complex functions, thus inducing a deficient TLR4 signaling and a reduced secretion of pro-inflammatory cytokines (58) further in-depth investigation is needed to elucidate the exact mechanism of protection and ascertain whether antibodies are the unique contributors to the RR-LPS induced immune protection this study demonstrates that under-acylated LPS molecules - derived from the bacteriophage-resistant strain of S Rissen - induce an attenuated innate immune response while promoting an effective adaptive immune protection These properties make RR-LPS a potentially promising candidate for vaccine development this study also highlights the potential use of phages as an alternative to conventional chemical or genetic methods for producing vaccines further studies are required to provide further insight into mechanism length and contribution of additional factors in improving vaccine potency and efficacy the possibility to extend this approach to other bacterial infections The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material The studies involving humans were approved by the Committee of Villa Betania Hospital in accordance with the principles of good clinical practices (Declaration of Helsinki) The studies were conducted in accordance with the local legislation and institutional requirements The participants provided their written informed consent to participate in this study The animal study was approved by the Italian Ministry of Health The study was conducted in accordance with the local legislation and institutional requirements The author(s) declare that no financial support was received for the research The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fimmu.2024.1450600/full#supplementary-material International Collaboration on Enteric Disease “Burden of Illness” Studies The global burden of nontyphoidal Salmonella gastroenteritis Introductory article on global burden and epidemiology of typhoid fever Progress in alternative strategies to combat antimicrobial resistance: focus on antibiotics Whole-genome comparative and pathogenicity analysis of salmonella enterica subsp Advances in the development of Salmonella-based vaccine strategies for protection against Salmonellosis in humans Typhoid conjugate vaccines: advancing the research and public health agendas Vaccines against invasive Salmonella disease: Current status and future directions Head-to-head comparison of humoral immune responses to vi capsular polysaccharide and salmonella typhi ty21a typhoid vaccines-A randomized trial Vi polysaccharide and conjugated vaccines afford similar early IgM or IgG-independent control of infection but boosting with conjugated Vi vaccines sustains the efficacy of immune responses Characterization of O-antigen delivered by Generalized Modules for Membrane Antigens (GMMA) vaccine candidates against nontyphoidal Salmonella GMMA-based vaccines: the known and the unknown Endotoxins: Lipopolysaccharides of gram-negative bacteria PubMed Abstract | Crossref Full Text | Google Scholar doi: 10.1146/annurev.biochem.71.110601.135414 PubMed Abstract | Crossref Full Text | Google Scholar André Boivin: A pioneer in endotoxin research and an amazing visionary during the birth of molecular biology Hit ‘em where it hurts: gram-negative bacterial lipopolysaccharide as a vaccine target PubMed Abstract | Crossref Full Text | Google Scholar Lipopolysaccharide structure and the phenomenon of low endotoxin recovery Development of immunization trials against Klebsiella pneumoniae A pentavalent shigella flexneri LPS-based vaccine candidate is safe and immunogenic in animal models Lipopolysaccharide: A tool and target in enterobacterial vaccine development doi: 10.1515/BC.2008.056/MACHINEREADABLECITATION/RIS Accessibility of O antigens shared between salmonella serovars determines antibody-mediated cross-protection Toll-like receptor activation by generalized modules for membrane antigens from lipid A mutants of salmonella enterica serovars typhimurium and enteritidis Mutation of waaN reduces Salmonella enterica serovar typhimurium-induced enteritis and net secretion of type III secretion system 1-dependent proteins Lipopolysaccharide: Biosynthetic pathway and structure modification PubMed Abstract | Crossref Full Text | Google Scholar Production of a Shigella sonnei vaccine based on generalized modules for membrane antigens (GMMA) Role of phage ϕ1 in two strains of Salmonella Rissen Bacteriophage-resistant salmonella rissen: an in vitro mitigated inflammatory response Critically evaluating the relative importance of phage in shaping microbial community composition The diverse impacts of phage morons on bacterial fitness and virulence Superinfection exclusion is an active virus-controlled function that requires a specific viral protein PubMed Abstract | Crossref Full Text | Google Scholar Prophages in Salmonella enterica: a driving force in reshaping the genome and physiology of their bacterial host doi: 10.4269/ajtmh.1971.20.3.tm0200030508a Crossref Full Text | Google Scholar In vitro techniques and measurements of phage characteristics that are important for phage therapy success Phage on tap-a quick and efficient protocol for the preparation of bacteriophage laboratory stocks BLAST Ring Image Generator (BRIG): Simple prokaryote genome comparisons A new method for the extraction of R lipopolysaccharides doi: 10.1111/j.1432-1033.1969.tb00601.x Maturation of the head of bacteriophage T4 PubMed Abstract | Crossref Full Text | Google Scholar A sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels PubMed Abstract | Crossref Full Text | Google Scholar Structural investigation of the oligosaccharide portion isolated from the lipooligosaccharide of the permafrost psychrophile Psychrobacter arcticus 273-4 A simple and rapid method for the permethylation of carbohydrates Crossref Full Text | Google Scholar Production and structural characterization of exopolysaccharides from newly isolated probiotic lactic acid bacteria Structural investigation and biological activity of the lipooligosaccharide from the psychrophilic bacterium pseudoalteromonas haloplanktis TAB 23 Ultra-purification of Lipopolysaccharides reveals species-specific signalling bias of TLR4: importance in macrophage function LPS-based conjugate vaccines composed of saccharide antigens of smooth-type Salmonella enteritidis and rough-type S gallinarum 9R bound to bovine serum albumin Bacteriophages promote metabolic changes in bacteria biofilm Excitation sculpting using arbitrary wave-forms and pulsed-field gradients Crossref Full Text | Google Scholar MLEV-17-based two-dimensional homonuclear magnetization transfer spectroscopy Crossref Full Text | Google Scholar Pure absorption gradient enhanced heteronuclear single quantum correlation spectroscopy with improved sensitivity Crossref Full Text | Google Scholar A general enhancement scheme in heteronuclear multidimensional NMR employing pulsed field gradients Metabolite profiling by one- and two-dimensional NMR analysis of complex mixtures Crossref Full Text | Google Scholar cytotoxicity and systemic in vivo toxicity of synthetic antimicrobial peptides Determination of 50% endpoint titer using a simple formula PubMed Abstract | Crossref Full Text | Google Scholar Protection of mice against lipopolysaccharide-induced endotoxic shock by pinocembrin is correlated with regulation of cytokine secretion Humic substances from composted fennel residues control the inflammation induced by Helicobacter pylori infection in AGS cells PubMed Abstract | Crossref Full Text | Google Scholar Quantification of gliadin levels to the picogram level by flow cytometry Protein A and protein G purification of antibodies PubMed Abstract | Crossref Full Text | Google Scholar Superinfection exclusion (sieB) genes of bacteriophages P22 and lambda doi: 10.1128/JB.175.15.4712-4718.1993 PubMed Abstract | Crossref Full Text | Google Scholar Molecular basis of reduced potency of underacylated endotoxins Recognition of lipopolysaccharide pattern by TLR4 complexes PubMed Abstract | Crossref Full Text | Google Scholar Crystal structure of the TLR4-MD-2 complex with bound endotoxin antagonist eritoran Exploitation of physiology and metabolomics to identify pneumococcal vaccine candidates Structural and functional analyses of bacterial lipopolysaccharides Activation of lpxR gene through enterohaemorrhagic Escherichia coli virulence regulators mediates lipid A modification to attenuate innate immune response Liposomal lipopolysaccharide initiates TRIF-dependent signaling pathway independent of CD14 TLR4 and CD14 trafficking and its influence on LPS-induced pro-inflammatory signaling Cutting edge: involvement of the type I IFN production and signaling pathway in lipopolysaccharide-induced IL-10 production Like cures like: pharmacological activity of anti-inflammatory lipopolysaccharides from gut microbiome Biosynthetically engineered lipopolysaccharide as vaccine adjuvant PubMed Abstract | Crossref Full Text | Google Scholar Shortening the lipid A acyl chains of Bordetella pertussis enables depletion of lipopolysaccharide endotoxic activity Differential requirements of MyD88 and TRIF pathways in TLR4-mediated immune responses in murine B cells Clinical significance of soluble immunoglobulins A and G and their coated bacteria in feces of patients with inflammatory bowel disease Immune recognition of porin and lipopolysaccharide epitopes of Salmonella typhimurium in mice Vaccine development targeting lipopolysaccharide structure modification Two msbB Genes Encoding Maximal Acylation of Lipid A Are Required for Invasive Shigella flexneri to Mediate Inflammatory Rupture and Destruction of the Intestinal Epithelium Comparative immunogenicity and efficacy of equivalent outer membrane vesicle and glycoconjugate vaccines against nontyphoidal Salmonella Extragenic suppressors of growth defects in msbB Salmonella doi: 10.1128/JB.183.19.5554-5561.2001 MsbB deletion confers acute sensitivity to CO2in Salmonella enterica serovar Typhimurium that can be suppressed by a loss-of-function mutation in zwf Prophages mediate defense against phage infection through diverse mechanisms Pushing the envelope: LPS modifications and their consequences PubMed Abstract | Crossref Full Text | Google Scholar Metabolic control of virulence factor production in Staphylococcus aureus PubMed Abstract | Crossref Full Text | Google Scholar Butyrate specifically down-regulates Salmonella pathogenicity island 1 gene expression In silico clustering of Salmonella global gene expression data reveals novel genes co-regulated with the SPI-1 virulence genes through HilD Glutamate decarboxylase-dependent acid resistance in orally acquired bacteria: Function distribution and biomedical implications of the gadBC operon Pyruvate-associated acid resistance in bacteria PubMed Abstract | Crossref Full Text | Google Scholar Single amino acid utilization for bacterial categorization PubMed Abstract | Crossref Full Text | Google Scholar Polyamine and ethanolamine metabolism in bacteria as an important component of nitrogen assimilation for survival and pathogenicity The function of the glutathione/glutathione peroxidase system in the oxidative stress resistance systems of microbial cells Microbial methionine transporters and biotechnological applications Endotoxin-induced gamma interferon production: Contributing cell types and key regulatory factors Transcytosis of igA attenuates salmonella invasion in human enteroids and intestinal organoids Highly homogenous tri-acylated S-LPS acts as a novel clinically applicable vaccine against Shigella flexneri 2a infection Exploiting human memory B cell heterogeneity for improved vaccine efficacy TRIF is required for TLR4 mediated adjuvant effects on T cell clonal expansion T-independent type II immune responses generate memory B cells PubMed Abstract | Crossref Full Text | Google Scholar Corsaro MM and Capparelli R (2024) Phage-resistance alters Lipid A reactogenicity: a new strategy for LPS-based conjugate vaccines against Salmonella Rissen Received: 17 June 2024; Accepted: 22 November 2024;Published: 11 December 2024 Copyright © 2024 Cuomo, Medaglia, Casillo, Gentile, Fruggiero, Corsaro and Capparelli. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) distribution or reproduction in other forums is permitted provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited in accordance with accepted academic practice distribution or reproduction is permitted which does not comply with these terms *Correspondence: Rosanna Capparelli, Y2FwcGFyZWxAdW5pbmEuaXQ= †These authors have contributed equally to this work and share first authorship Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher. 94% of researchers rate our articles as excellent or goodLearn more about the work of our research integrity team to safeguard the quality of each article we publish. This website is using a security service to protect itself from online attacks. The action you just performed triggered the security solution. There are several actions that could trigger this block including submitting a certain word or phrase, a SQL command or malformed data. You can email the site owner to let them know you were blocked. Please include what you were doing when this page came up and the Cloudflare Ray ID found at the bottom of this page. Volume 12 - 2022 | https://doi.org/10.3389/fcimb.2022.936649 This article is part of the Research TopicThe Global Threat of Carbapenem-Resistant Gram-Negative Bacteria Volume IIView all 12 articles New Delhi metallo-β-lactamase-13 (NDM-13) is an NDM variant that was first identified in 2015 and has not been detected in Salmonella species prior to this study Here we describe the first identification of a Salmonella Rissen strain SR33 carrying blaNDM-13 The aim of this study was to molecularly characterize SR33’s antimicrobial resistance and virulence features as well as investigate the genetic environment of blaNDM-13 The Salmonella Rissen SR33 strain was isolated from a patient with fever and diarrhea and it was found to be multidrug-resistant (MDR) and to carry many virulence genes Phylogenetic analysis showed that SR33 shared a close relationship with most of the Chinese S blaNDM-13 was located in a transmissible IncI1 plasmid pNDM13-SR33 Sequence analysis of blaNDM-13-positive genomes downloaded from GenBank revealed that a genetic context (ΔISAba125-blaNDM-13-bleMBL-trpF) and a hybrid promoter (consisting of −35 sequences provided by ISAba125 and −10 sequences) were conserved ISAba125 was truncated by IS1294 in three plasmids carrying blaNDM-13 this is the first report of blaNDM-13 carried by Salmonella The emergence of blaNDM-13 in a clinical MDR S Rissen ST469 strain highlights the critical need for monitoring and controlling the dissemination of blaNDM-13 blaNDM-13 carried by a transmissible IncI1 plasmid may result in an increased risk of blaNDM-13 transmission IS1294 may be involved in the movement of blaNDM-13 Here we aim to characterize a blaNDM-13-positive Salmonella Rissen strain SR33 isolated in China this is the first report of blaNDM-13 detected in Salmonella The minimum inhibitory concentrations (MICs) for imipenem, ertapenem, ceftazidime, ceftriaxone, cefepime, amoxicillin/clavulanic acid, piperacillin/tazobactam, trimethoprim/sulfamethoxazole, levofloxacin, ampicillin, tetracycline, ciprofloxacin, chloramphenicol, and azithromycin were determined by broth microdilution following the CLSI guidelines, and MIC results were interpreted according to the CLSI breakpoints (Wayne, 2021) Transferability of plasmid harboring blaNDM-13 was assessed by the conjugation experiment Transconjugants were selected on Luria-Bertani agar plates containing rifampin (100 µg/ml) and imipenem (2 µg/ml) Transconjugants containing the blaNDM-13 gene were verified by PCR sequencing (forward primer sequence: ATGGAATTGCCCAATATTATGCAC and reverse primer sequence: TCAGCGCAGCTTGTCGGC) The antimicrobial susceptibility of the transconjugant was confirmed by the broth microdilution method The whole-genome sequence of SR33 has been submitted to the GenBank database with accession numbers CP092911–CP092914 The nucleotide sequence of plasmid pNDM13-SR33 has been deposited under accession number CP092912 Table 1 MIC values of antimicrobials for SR33 and its transconjugant Whole-genome sequencing (WGS) showed that blaNDM-13 and bleMBL were located on an IncI1 plasmid designated as pNDM13-SR33, which is 88,258 bp in length with an average GC content of 50.37%. The other resistance genes were found on the chromosome. pNDM13-SR33 was successfully self-transferred into C600, and the transconjugant SR33-C600 was resistant to all tested β-lactams (Table 1) these strains were mainly isolated from food The drug resistance profiles of these MDR strains were similar and common drug resistance genes include aadA1 Since the common drug resistance genes in SR33 were located on chromosomes Rissen ST469 isolates did not carry resistance plasmids we speculated that the antimicrobial resistance genes were mainly located on the chromosomes of these closely related MDR strains Figure 1 Phylogenetic distribution of antimicrobial resistance genes of SR33 of this study and other Chinese S Antimicrobial resistant genes are represented by colored squares genes with partial deletions are marked with black squares The source of each isolate is shown with colored triangles According to SPIFinder, SR33 contained SPI-1 to SPI-5, SPI-8, and SPI-9. All VFDB-annotated genes are listed in Table 2 Based on the annotation of the VFDB database The virulence genes are involved in adhesion systems Table 2 Virulence-associated genes in SR33 NDM-13 has been identified in plasmids of three E. coli stains, including an IncX3 plasmid pNDM13-DC33(accession no. KX094555), an IncFIB plasmid pSECR18-0956 (accession no. MK157018), and an IncI1 plasmid pHNAHS65I-1 (accession no. MN219406). Of note, pNDM13-SR33 shared 99% coverage and 100% identity with an IncI1-blaNDM-13 plasmid pHNAHS65I (accession no. MN219406) of E. coli discovered in 2020 (Figure 2) Figure 2 Genetic map of pNDM13-SR33 (no As shown in Figure 3 the blaNDM-13-producing strains shared a conserved genetic structure (ΔISAba125-blaNDM-13-bleMBL-trpF) The conserved region was found involved in various genetic contexts with different insertion sequences The genetic context of blaNDM-13 in SR33 was highly similar to pHNAHS65I-1 (no MN219406) with ΔISAba125 truncated by the insertion of an IS1294 upstream which was also detected in pSECR18-0956 (no the blaNDM-13 region was adjacent to an ISCR1 complex class 1 integron (ISCR1-sul1-qacEΔ1-IntI1) The sequences of L704 and IOMTU558 (accession no a cluster (IS3000-ΔISAba125-IS5-ΔISAba125) was found upstream of blaNDM-13 in pNDM13-DC33 (no a hybrid promoter (consisting of −35 sequences within the inverted repeat left of ISAba125 and −10 sequences) located upstream of blaNDM-13 was conservative in blaNDM-13-producing strains Figure 3 blaNDM-13 flanking sequence of pNDM13-SR33 (no and genes encoding hypothetical proteins are shown in red Δ; indicates a truncated gene or mobile element The percentages signify the genetic identity between these sequences SR33 was found to be MDR and to harbor nine resistance genes These resistance genes were consistent with the phenotypes except for cmlA1 SR33 remained sensitive to chloramphenicol which might be due to the fact that the cmlA1 gene had a sequence deletion of 96 bp Since SR33 was resistant to all β-lactams and susceptible to quinolones it explains well why cefixime was ineffective against this infection and levofloxacin was effective Based on phylogenetic analysis, SR33 was closely related to the majority of the Chinese S. Rissen ST469 strains downloaded from EnteroBase. Since the available 37 Chinese S. Rissen ST469 isolates were mostly isolated from food, poultry, and humans, it is in agreement with the idea that S. Rissen infection occurs in humans as a zoonosis through food chain transmission (Xu et al., 2020) it is possible that this patient had a foodborne infection Another important finding is that most Chinese S Rissen ST469 strains were MDR and shared similar drug resistance profiles Since the antimicrobial resistance genes were mainly located on chromosomes we should pay close attention to the vertical transmission of MDR S These observations emphasize the necessity of the surveillance of S MDR strain SR33 possessed important pathogenicity islands and many virulence-associated genes blaNDM-13 in SR33 carried by an IncI1 transmissible plasmid may result in an increased risk of blaNDM-13 transmission ΔISAba125 truncated by IS1294 was found in three blaNDM-13-harboring plasmids including pNDM13-SR33 We thus suspected that IS1294 may be involved in the mobilization and dissemination of blaNDM-13 this study first reports an NDM-13-producing Salmonella isolate The emergence of blaNDM-13 in a clinical MDR Salmonella Rissen ST469 strain poses a significant threat to public health Rissen ST469 strains isolated from China were MDR which highlights the importance of the surveillance for S The blaNDM-13 carried by a transmissible IncI1 plasmid may cause an increased risk of blaNDM-13 transmission IS1294 may be involved in the mobilization and dissemination of blaNDM-13 The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: https://www.ncbi.nlm.nih.gov/genbank/, CP092911-CP092914 The studies involving human participant were reviewed and approved by the Ethics Committee of the First Affiliated Hospital of Xiamen University The participant provided his written informed consent to participate in this study HX and XL contributed to the conception and design of the study YH and SZ performed laboratory experiments All authors have read and approved the manuscript This study was funded by the Youth Foundation of the National Natural Science Foundation of China (81902104) Basic and Applied Basic Research Foundation of Guangdong Province (2021A1515220153) Basic and Applied Basic Research Foundation of Guangdong Province Natural Science Foundation (2022A1515012481) and Joint Research Projects of Health and Education Commission of Fujian Province (2019-WJ-42) Kai Zhou (Shenzhen Institute of Respiratory Diseases The First Affiliated Hospital (Shenzhen People’s Hospital) Southern University of Science and Technology The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fcimb.2022.936649/full#supplementary-material Role of mobile genetic elements in the global dissemination of the carbapenem resistance gene bla(NDM) Detection of New Delhi Metallo-β-Lactamase Variants NDM-4 and NDM-7 in Enterobacter aerogenes Isolated from a Neonatal Intensive Care Unit of a North India Hospital: A First Report Non-typhoidal salmonella in the pig production chain: a comprehensive analysis of its impact on human health CrossRef Full Text | Google Scholar Contemporary IncI1 plasmids involved in the transmission and spread of antimicrobial resistance in enterobacteriaceae In silico detection and typing of plasmids using PlasmidFinder and plasmid multilocus sequence typing VFDB 2016: hierarchical and refined dataset for big data analysis–10 years on Virulence comparison of salmonella enterica subsp enterica isolates from chicken and whole genome analysis of the high virulent strain s multidrug-resistant Enterobacteriaceae isolated from seafood Worldwide dissemination of the NDM-type carbapenemases in Gram-negative bacteria PubMed Abstract | CrossRef Full Text | Google Scholar European Food Safety Authority The European union summary report on trends and sources of zoonoses zoonotic agents and food-borne outbreaks in 2016 Salmonella challenges: prevalence swine poultry potential pathogenicity such isolates García-Fernández Multilocus sequence typing of IncI1 plasmids carrying extended-spectrum beta-lactamases in escherichia coli and salmonella of human and animal origin Grimont, P. A., Weill, F. X.. Antigenic formulae of the Salmonella serovars. WHO collaborating centre for reference and research on Salmonella 9 1–166. Available online at: https://www.scacm.org/free/Antigenic%20Formulae%20of%20the%20Salmonella%20Serovars%202007%209th%20edition.pdf Google Scholar Continuous evolution: perspective on the epidemiology of carbapenemase resistance among enterobacterales and other gram-negative bacteria Genetic contexts related to the diffusion of plasmid-mediated CTX-M-55 extended-spectrum beta-lactamase isolated from enterobacteriaceae in China NDM-1- and OXA-48-Producing klebsiella pneumoniae: High mortality from pandrug resistance Microbial Drug resistance (Larchmont N.Y.) 24 (7) A review of salmonella enterica with particular focus on the pathogenicity and virulence factors host specificity and antimicrobial resistance including multidrug resistance Emergence of a multidrug-resistant clinical isolate of escherichia coli st8499 strain producing ndm-13 carbapenemase in the republic of Korea doi: 10.1016/j.diagmicrobio.2019.02.013 MEGA X: Molecular evolutionary genetics analysis across computing platforms Multilocus sequence typing of total-genome-sequenced bacteria Enzyme inhibitors: The best strategy to tackle superbug NDM-1 and its variants Salmonella pathogenicity island 1 (SPI-1) and its complex regulatory network First report of complete sequence of a bla(ndm-13)-harboring plasmid from an escherichia coli st5138 clinical isolate NDM-1–a cause for worldwide concern PubMed Abstract | CrossRef Full Text | Google Scholar PubMed Abstract | CrossRef Full Text | Google Scholar Novel arrangement of the blaCTX-M-55 gene in an escherichia coli isolate coproducing 16S rRNA methylase Pérez-Vázquez Emergence of NDM-producing Klebsiella pneumoniae and Escherichia coli in Spain: Phylogeny virulence and plasmids encoding blaNDM-like genes as determined by WGS Analysis of the resistome of a multidrug-resistant NDM-1-producing Escherichia coli strain by high-throughput genome sequencing CrossRef Full Text | Google Scholar from a multidrug-resistant escherichia coli clinical isolate in Nepal Expansive spread of IncI1 plasmids carrying blaCMY-2 amongst escherichia coli doi: 10.1016/j.ijantimicag.2014.04.016 ISfinder: The reference centre for bacterial insertion sequences CrossRef Full Text | Google Scholar and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria and tuberculosis Complete sequencing of IncI1 sequence type 2 plasmid pJIE512b indicates mobilization of blaCMY-2 from an IncA/C plasmid Prokka: rapid prokaryotic genome annotation CrossRef Full Text | Google Scholar The harvest suite for rapid core-genome alignment and visualization of thousands of intraspecific microbial genomes Performance Standards for Antimicrobial Susceptibility Testing (USA: Clinical and Laboratory Standards Institute) Google Scholar Unicycler: Resolving bacterial genome assemblies from short and long sequencing reads NDM metallo-β-Lactamases and their bacterial producers in health care settings Characterization of multidrug resistance patterns of emerging salmonella enterica serovar rissen along the food chain in China Characterization of a new metallo-beta-lactamase gene and a novel erythromycin esterase gene carried on a unique genetic structure in klebsiella pneumoniae sequence type 14 from India The salmonella in silico typing resource (sistr): An open web-accessible tool for rapidly typing and subtyping draft salmonella genome assemblies Identification of acquired antimicrobial resistance genes IS26 is responsible for the evolution and transmission of bla(NDM)-harboring plasmids in escherichia coli of poultry origin in China Xu H and Li X (2022) Emergence of a Salmonella Rissen ST469 clinical isolate carrying blaNDM-13 in China Received: 05 May 2022; Accepted: 11 July 2022;Published: 08 August 2022 Copyright © 2022 Huang, Ma, Zeng, Fu, Xu and Li. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) *Correspondence: Heping Xu, eG1zdW54aHBAMTYzLmNvbQ==; Xiaoyan Li, eGlhb3lhbmxpQGd6aG11LmVkdS5jbg== Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher 94% of researchers rate our articles as excellent or goodLearn more about the work of our research integrity team to safeguard the quality of each article we publish Metrics details Salmonella species commonly causes infection in humans and on occasion leads to serious complications we present the first case reported of a patient with a mycotic aneurysm likely secondary to Salmonella Rissen infection The patient presented with 4 weeks of lower back pain chills and a single episode of diarrhoea 2 months prior during a 14-day trip to Hong Kong and Taiwan Magnetic resonance imaging revealed an aneurysmal left internal iliac artery with adjacent left iliacus rim-enhancing collection A stool culture was positive for Salmonella Rissen ST 469 EBG 66 on whole genome sequencing The patient underwent an emergency bifurcated graft of his internal iliac aneurysm and was successfully treated with appropriate antibiotics This case highlights the importance of considering the diagnosis of a mycotic aneurysm in an unusual presentation of back pain with features of infection The case presented here is the first case reported in literature of a patient with a mycotic aneurysm secondary to Salmonella enterica subsp. enterica serovar Rissen infection, successfully treated with surgery and antibiotics. Blood tests revealed the following: haemoglobin 118 g/L, mean cell volume 73.3 fL, erythrocyte sedimentation rate 100 mm, C-reactive protein 87 mg/L, ferritin 1000 μg/L and a white cell count of 8.4 × 109/L (normal differential), lactate 2.0 mmol/L, urea 5.9 mmol/L, creatinine 78.2 μmol/L, normal electrolytes and liver function tests. The patient’s contrast CT scan (pelvis) showing a left internal iliac artery mycotic aneurysm (*) A few days later the patient underwent a bifurcated graft of his internal iliac aneurysm receiving 1000 mg flucloxacillin and 120 mg gentamicin intravenously at induction for vascular surgery prophylaxis (rather than specific Salmonella treatment) No collections were noted intraoperatively He was initially treated with intravenous amoxicillin/clavulanate (1000 mg/200 mg) three times daily 11 days after admission with some clinical improvement Oral ciprofloxacin 500 mg twice daily was added 19 days after his admission he was discharged on oral ciprofloxacin 500 mg twice daily and amoxicillin/clavulanate (500 mg/125 mg) three times daily as treatment for a presumed S Amoxicillin/clavulanate was continued to cover the possibility of poly-microbial infection as the patient showed initial clinical response to this agent At his 6 months follow-up review in clinic the patient was well and was taking his antibiotic treatment without side effects A CT scan at 11 months showed ongoing inflammatory changes at the site of the graft and a decision was made to rationalise his antibiotics to life-long azithromycin suppressive treatment He has since submitted three culture-negative stool samples and has been allowed to return to work as a chef The unusual nature of this case lies in the causative organism there have been no cases of a mycotic aneurysm in literature where S The key take-away messages of this case are the consideration of mycotic aneurysm in patients with cardiovascular risk factors presenting with back pain accompanied by chills or fever a diagnosis of a mycotic aneurysm should not be excluded based on negative blood cultures mycotic aneurysms secondary to Salmonella infection can be successfully treated with open surgery and antibiotics which may have to be life-long due to risk of a potentially fatal graft infection Data sharing is not applicable to this article as it includes personal medical information only accessible to healthcare professionals relevant to the care of this particular patient No datasets were generated or analysed during this study Salmonella in the pork production chain and its impact on human health in the European Union Protective host immune responses to Salmonella infection Mycotic aneurysm due to non-typhi Salmonella: report of 16 cases Mycotic aneurysm due to Salmonella species: clinical experiences and review of the literature Andrews JR, Ryan ET. Diagnostics for invasive Salmonella infections: current challenges and future directions. Vaccine. 2015;33(S3):C8–15 Available from: https://doi.org/10.1016/j.vaccine.2015.02.030 Development of broad-range 16S rDNA PCR for use in the routine diagnostic clinical microbiology service Laohapensang K, Rutherford RB, Arworn S. Infected aneurysm. Ann Vasc Dis. 2010;3(1):16–23 Available from: https://www.ncbi.nlm.nih.gov/pubmed/23555383 CTX-M-55-type ESBL-producing Salmonella enterica are emerging among retail meats in Phnom Penh Zhang L, Fu Y, Xiong Z, Ma Y, Wei Y, Qu X, et al. Highly prevalent multidrug-resistant salmonella from chicken and pork meat at retail markets in Guangdong, China. Front Microbiol. 2018;9:2104 Available from: https://www.ncbi.nlm.nih.gov/pubmed/30258419 Arbune M, Ciobotaru R, Voinescu D. Endovascular infection with Salmonella group C - a case report. Germs. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4570840/pdf/germs-05-03-099.pdf Sörelius K, di Summa PG. On the Diagnosis of Mycotic Aortic Aneurysms. Clin Med Insights Cardiol. 2018;12:1179546818759678. https://doi.org/10.1177/1179546818759678 Daye D, Walker TG. Complications of endovascular aneurysm repair of the thoracic and abdominal aorta: evaluation and management. Cardiovasc Diagn Ther. 2018;8(S1):S138–56 Available from: http://cdt.amegroups.com/article/view/16911/19122 Download references This research did not receive any specific grant from funding agencies in the public Carmichael contributed equally to this work JN analysed and interpreted the data and was a major contributor in writing the manuscript KS was a major contributor in reviewing the manuscript VW was a major contributor in the conception and design of the work and in reviewing the manuscript AC was a major contributor in the conception and design of the work and in reviewing the manuscript All authors have read and approved the final manuscript The patient described here provided written consent to his data being accessed and described The patient described here reviewed the manuscript and provided written consent to this text and his imaging being published The authors declare that they have no competing interests Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations Download citation DOI: https://doi.org/10.1186/s12879-020-4819-0 Anyone you share the following link with will be able to read this content: a shareable link is not currently available for this article Mars has some of the most impressive volcanoes in the Solar System. ESA’s Mars Express has now imaged the pitted fissured flank of the planet’s second-tallest: Ascraeus Mons This image comprises observations from Mars Express’ High Resolution Stereo Camera (HRSC) Ascraeus Mons is the northernmost and tallest of three prominent volcanoes found in the Tharsis region of Mars a volcanic plateau in Mars’ western hemisphere It measures a towering 18 km in height but its slopes are gentle This slow climb is reflected in the volcano’s huge base diameter of 480 km giving it a footprint roughly the size of Romania on Earth Ascraeus Mons is surpassed in height only by Olympus Mons the tallest volcano not only on Mars but in the entire Solar System The image shows the lower southern flank of Ascraeus Mons There is a dramatic difference in elevation from one side to the other with the left (southern) side of the frame sitting about 10 km lower than the right (northern) side The volcano’s peak is found to the right (north) of the frame as seen most clearly in the wider context map of the region Many similarly dramatic features – collectively named Ascraeus Chasmata encompassing an enormous patch of collapsed terrain over 70 km across – are visible across the frame: lava flows and tubes and large fissures spanning tens of km in length. these features knit together to form a scene resembling trails of ink dispersing artfully in water or a plant’s beautifully complex root system as it digs down into soil To the right side of the frame lie numerous wrinkled lava flows. This crinkled ground then encounters chains of ‘pit craters’: features where strings of circular or near-circular depressions have combined and coalesced to form troughs with a notable example being the dramatic Cenotes found on the Yucatán Peninsula The pit crater troughs and chains shown here have also grouped together to form an especially large and eye-catching collapse area These chains and troughs likely form where hidden voids lie below the surface causing ground to become unstable and collapse – a bit like a sinkhole The subsurface voids are thought to be created as the surface layer of a lava flow rapidly cools and hardens; the lava flow beneath then ceases and ebbs away over time leaving tube-shaped pockets of space lurking several metres below ground. The ground to the left of the pit crater chains is marked by so-called ‘sinuous rilles’: smaller snaking channels without rims that are often found at the flanks of volcanoes but their creation may involve flows of lava ash or water – or a combination of the three The leftmost part of the image is dominated by large fissures of up to 40 km long Branching out from these fissures are channels that weave and braid together (‘braided channels’) isolating chunks of martian terrain to form ‘islands’ and terraces These are likely to have formed by water – perhaps as snow and ice built up on the flanks of Ascraeus Mons before later melting away Mars Express has been orbiting the Red Planet since 2003 identifying the composition and circulation of its tenuous atmosphere and exploring how various phenomena interact in the martian environment of which Ascraeus Mons is a fascinating example The mission’s High Resolution Stereo Camera (HRSC) was developed and is operated by the German Aerospace Center (Deutsches Zentrum für Luft- und Raumfahrt; DLR) and Dubendorf Air Base to detect defects in runways with AI before major problems occur but it’s crucial to prevent bigger problems and enhance maintenance routines our IBM Research team based in Zurich has developed an AI model that uses computer vision to detect tiny cracks in high-resolution images collected by drones the military airport on the outskirts of Zurich to inspect the airport’s runway surface The project will test out several different AI models and how they perform a drone equipped with a camera will scan the runway Our AI model will automatically apply what’s known as instance segmentation – a way to detect individual object instances and find their boundaries – to identify cracks on more than 10,000 images This directs a civil engineering expert to relevant regions to judge the state of the runway With the help of GPS and image stitching technology developed by our team we can then create representations of the runway to help people quickly find and describe the location of the defects in the field Information on crack lengths and widths is automatically populated and stored so that it can be searched for later This isn’t the first inspection project we’ve worked on our team has been working with Sund and Baelt (S&B) inspecting Europe’s longest suspension bridge It’s the third-longest suspension bridge in the world linking the eastern and western parts of Denmark our AI has inspected more than 20 of the bridge’s pillars One of the big challenges we’ve addressed recently is being able to precisely locate cracks less than a millimeter wide on a structure that’s hundreds of meters long while also increasing the detection accuracy on the high-resolution images we capture and visualize the large amounts of data we collect with our imagery our team also tested the inspection technology at Frankfurt’s Fraport airport The project’s goal was to inspect runways to detect anomalies and identify foreign object debris — obstacles on the runway We used our visualization and image stitching capabilities on the data which also helped us to develop the backend technology we’re using in Dubendorf While the current project in Switzerland also addresses runway inspection but we’ve gone a step further with the tech We expect the data to look different than everything we captured with the bridge project To ensure we achieve the best possible results we needed annotated and task-specific data to help us build new models – this could be labor intensive and time consuming For our case, it means that the foundation models learn a general representation of concrete surfaces and runways. The AI can then search for cracks after the foundation model has been fine-tuned to the specific setting of detection cracks on that particular bridge or runway. Volume 12 - 2021 | https://doi.org/10.3389/fmicb.2021.702909 This article is part of the Research TopicFood Safety and Public HealthView all 33 articles Salmonellosis represents a growing threat to global public health Salmonella enterica remains the leading cause of bacterial foodborne diseases in China Rissen) has been recognized as one of the emerging serovars among humans in different countries worldwide To address essential epidemiological information for S Rissen isolates recovered from samples across the food chain were collected from 16 provinces or province-level cities between 1995 and 2019 Risk factors due to the consumption of animal-derived food products were also analyzed especially in the Eastern and Southern parts of China and there is an increasing frequency in recent years as evidenced by the greater number of isolates recovered in 2016 Rissen isolates recovered in this study were from human samples (63.4%; 749/1182) 58.4% (438/749) were from asymptomatic carriers Rissen isolates from humans from Guangxi (59.5%; 446/749) and Shanghai (29.5%; 221/749) Among 302 human diarrheal isolates (40.3%; 302/749) Rissen in children with diarrhea (age below 10 years old) This is of clinical significance as diarrhea is one of the crucial causes of child mortality globally and our findings here highlighted the importance of Salmonella infections in Chinese children Rissen isolates were also found to be associated with pork and poultry products in China This study projected the most updated national-wide study of S Rissen isolates obtained from different sources in China over the past two decades Continued surveillance is warranted to further monitor this emerging serovar in China and elsewhere over the world A bilateral changing trend in association between previously under-reported Salmonella serovars such as Salmonella Rissen and Salmonella Derby causing foodborne salmonellosis and increasing pork and poultry production has been observed (Padungtod and Kaneene, 2006; Jiang et al., 2021) Rissen) is a frequently reported serovar around different countries with a significant association with intensive pig industry the knowledge on Salmonella Rissen epidemiological prevalence and disease burden in China is largely unknown our study aimed to establish an epidemiological relationship of 1,182 S and environment over a period ranging from 1995 to June 2019 in China aiming to understand the clinical epidemiology of S Given the importance of NTS infection in worldwide foodborne illnesses and childhood diarrhea knowledge of national-wide epidemiology for emerging NTS serovars could guide appropriate control measurements and policy planning Updated information about the epidemiology and prevalence of different Salmonella serovars in specific areas may facilitate precision public health interventions for mitigation of emerging pathogens The pure colonies of bacteria were seeded in Luria-Bertani (LB) broth for serotyping. For further serotyping analysis, the PCR confirmed Salmonella isolates were performed by slide agglutination method to define O and H antigens using commercial antisera (SSI Diagnostica, Denmark), and the results were interpreted according to the White-Kauffmann-Le Minor scheme (Grimont and Weill, 2007) The chi-square test variances were used to test the significant differences in the prevalence of Salmonella isolates between samples collected from different geographical regions in addition to the difference between the prevalence of asymptomatic carriers and diseased humans if information is available P-values less than 0.05 were considered statistically significant Statistical analysis of the results was performed with GraphPad Prism 7 and also showed no significant difference between the different provinces (P > 0.05) (data not shown) Increasing trend of the Salmonella serovar Rissen in China between 1995 and June 2019 Rissen in China as compared to other Salmonella serovars Rissen serovar in humans in addition to the prevalence of clinical patients and asyndromatic carriers in China as compared to other Salmonella serovars Rissen isolates obtained from four established sources (humans and environment) in China during 1995–2019 Pie charts reveal that the different sources for samples in each province and the size of charts is according to the actual number of the isolates obtained from each province green color for environmental samples and violet color human samples Rissen isolates collected from different geographical parts Rissen isolates collected from different origins Rissen isolates collected from different human age groups Rissen between the asymptomatic carriers and diseased patients The threshold of significance for the P-values indicated as follows: *⁣*⁣*⁣*⁣**P < 0.0001; *⁣*⁣*⁣**P < 0.0001; ∗∗∗P < 0.001 Our results also showed that the majority of S. Rissen isolates studied in this study were obtained from humans (63.36%; 749/1182) followed by foods (31.1%; 368/1182), animals (3.29%; 39/1182), environment (2.11%, 25/1182), and also displayed statistically significant difference between the isolates recovered from the food samples and those collected from human and animal samples (P < 0.0001) (Figure 3B) this is the first study to establish an epidemiological relationship of 1,182 S and food products over a period of two decades in China majority of these isolates are located and prevalent in Guangxi Rissen isolates were obtained from females 134 isolates were recovered from diseased females 46% (342/749) of males were affected with S 51.75% (177/342) of males showed disease syndromes caused by S We also noticed that there was no statistically significant difference between the isolates obtained from males and females in this study (P > 0.05) (data not shown) Among isolates obtained from live animals and food products, we found that sample obtained from live pigs (84.61%, 33/39) and pork products (65.56%, 253/386) were the highest prevalent with S. Rissen isolates followed by live chicken (15.39%, 6/39) and chicken meat (22.53%, 87/386), respectively (Supplementary Table 1) 25/1182) isolates were obtained from environmental sources Two isolates were obtained from soil and the other 23 isolates were obtained from water samples Rissen isolates from clinics and asymptomatic carriers in different provinces or province-level cities in China Rissen isolates from different age-group of humans recovered from different provinces or province-level cities in China This suggests that the most prevalent age-group was the children under the age of 10 The high levels of Salmonella Rissen contamination suggest Hazard Analysis and Critical Control Point (HACCP) system for the pork being sold in retail outlets in many countries should be improved or adjusted the consumption of contaminated swine products is considered one of the most important sources of human infection resulting in Salmonella outbreaks Rissen in pork is of concern because it has been responsible for increasing sporadic human cases in China contamination by Salmonella in animal-derived foods in China is a serious issue posing increasing the risk for human infections Rissen in different foodstuffs highlights the need for continuing surveillance of these food products Our results suggest that animal-derived foods should be paid more attention to mitigate the dissemination of Salmonella These findings highlight the importance of strict prevention and control measures in the pork and poultry production process to ensure food safety along the food chain in China This study presented the most comprehensive and updated epidemiological description of emerging S original data on Salmonella prevalence and associated microbial ecology were collected and the dynamics of S Rissen infection have been extensively studied This investigation may have potential benefits for future S Rissen surveillance and outbreak detection in China The updated knowledge may lead to a better understanding of the prevalence and disease burden caused by S This information will provide support for the development of novel approaches to mitigate Salmonella infections along the food production chain and in humans Salmonella control strategies from farm to table should focus on all stages of the food production chain to reduce contamination levels and consumer risk more research regarding the characteristics of the dissemination of S Rissen in China is highly needed and continued surveillance of this serovar is necessary as it can cause human diseases as well as asymptomatic carrier which may represent as the reservoir for human transmissions This study provides a framework for understanding Salmonella epidemiology from a national-wide to a global perspective and these findings here may offer valuable information for developing future Salmonella surveillance systems globally The original contributions presented in the study are included in the article/Supplementary Material further inquiries can be directed to the corresponding author The studies involving human participants were reviewed and approved by the Chinese National CDC The patients/participants provided their written informed consent to participate in this study ME analyzed the data and finalized the figures DS and XX did the experiment and collect the data MY conceived the idea and assisted with data analysis and writing This study was supported by the National Program on Key Research Project of China (2019YFE0103900 and 2017YFC1600103) as well as European Union’s Horizon 2020 Research and Innovation Programme under Grant Agreement No Zhejiang Provincial Natural Science Foundation of China (LR19C180001) and Zhejiang Provincial Key R&D Program of China (2021C02008 and 2020C02032) The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmicb.2021.702909/full#supplementary-material Supplementary Figure 1 | Pie chart of the prevalence of S Rissen isolates obtained from food of animal-origin samples in China American Academy of Pediatrics Committee on Environmental Health (AAPCEH) “Developmental toxicity: Special considerations based on age and developmental stage” in Pediatric Environmental Health Balk (Elk Grove: American Academy of Pediatrics) Google Scholar Survival of Salmonella enterica in poultry feed is strain dependent Epidemiology of antimicrobial resistance in Salmonella isolated from pork Google Scholar Role of slaughtering in Salmonella spreading and control in pork production Google Scholar Impact of sporadic reporting of poultry Salmonella serovars from selected developing countries Google Scholar Detection of high serological prevalence and comparison of different tests for Salmonella in pigs in Northern Ireland Emergence and Dissemination of mcr-Carrying Clinically Relevant Salmonella Typhimurium Monophasic Clone ST34 Influence of Pigskin on Salmonella Contamination of Pig Carcasses and Cutting Lines in an Italian Slaughterhouse Google Scholar Serodiversity and antimicrobial resistance profiles of detected Salmonella on swine production chain in Chiang Mai and Lamphun Google Scholar Salmonella: from pathogenesis to therapeutics Impact of cleaning and disinfection procedures on microbial ecology and Salmonella antimicrobial resistance in a pig slaughterhouse Google Scholar Weaned piglets: another factor to be considered for the control of Salmonella infection in breeding pig farms Google Scholar Centers for Disease Control and Prevention (Cdc) Incidence and trends of infection with pathogens trans¬mitted commonly through food — Foodborne Diseases Active Sur¬veillance Network,10 U.S Google Scholar A Hospital-based Case-control Study of Diarrhea in Children in Shanghai and Antimicrobial Management of Invasive Salmonella Infections Resistance and virulence determinants of faecal Salmonella spp A cross-sectional study of Salmonella in pre-slaughter pigs in a production compartment of northern Thailand Global Burden of Colistin-Resistant Bacteria: Mobilized Colistin Resistance Genes Study (1980–2018) Emerging colistin resistance in Salmonella enterica serovar Newport isolates from human infections Genomic Characterization of mcr-1-carrying Salmonella enterica Serovar 4,[5],12:i:- ST 34 Clone Isolated From Pigs in China Detection of mcr-9-harbouring ESBL-producing Salmonella Newport isolated from an outbreak in a large-animal teaching hospital in the USA European Food Safety Authority and European Centre for Disease Prevention and Control (Efsa and Ecdc) The European Union Summary Report on Trends and Sources of Zoonoses Zoonotic Agents and Food-borne Outbreaks in 2013 CrossRef Full Text | Google Scholar Epidemiology of Human Salmonellosis in Ireland Google Scholar Salmonella infection - prevention and treatment by antibiotics and probiotic yeasts: a review Antimicrobial resistance and molecular epidemiology of Salmonella Rissen from animals Outbreak of Salmonella Rissen Associated with Ground White Pepper:Epi Investigation Google Scholar PubMed Abstract | CrossRef Full Text | Google Scholar Salmonella gastroenteritis in children (clinical characteristics and antibiotic susceptibility): comparison of the years 1995-2001 and 2002-2008 Microbial contamination of pig carcasses at a slaughterhouse in Vientiane capital Google Scholar A review of Salmonella enterica with particular focus on the pathogenicity and virulence factors Prevalence and antimicrobial resistance of Salmonella recovered from pig-borne food products in Henan Antibiotic resistance profiles of Salmonella recovered from finishing pigs and slaughter facilities in Henan PubMed Abstract | CrossRef Full Text | Google Scholar Serovars and drug susceptibility of Salmonella isolated from patients with sporadic diarrhea in Yamanashi Prefecture during the last decade (1985-1994) doi: 10.11150/kansenshogakuzasshi1970.69.1294 Distribution and genotypic characterization of Salmonella serovars isolated from tropical seafood of Cochin Lertworapreecha Antimicrobial resistance in Salmonella enterica isolated from pork Nontyphoidal salmonella infection in children with acute gastroenteritis: prevalence Antimicrobial resistance and phage types of Salmonella isolates from healthy and diarrheic pigs in Korea Characterization of Salmonella Resistome and Plasmidome in Pork Production System in Jiangsu Detection of colistin resistance mcr-1 gene in Salmonella enterica serovar Rissen isolated from mussels Foodborne Hazards of Particular Concern for the Young Google Scholar Google Scholar Google Scholar Martinez-Urtaza Identification of Salmonella serovars isolated from live molluscan shellfish and their significance in the marine environment Permanent Carriers of Nontyphosa Salmonellae CrossRef Full Text | Google Scholar Google Scholar Dunging gutters filled with fresh water in finishing barns had no effect on the prevalence of Salmonella enterica on Brazilian swine farms Salmonella in food animals and humans in northern Thailand Google Scholar A Meta-Analysis of Major Foodborne Pathogens in Chinese Food Commodities Between 2006 and 2016 Persistent Asymptomatic Human Infections by Salmonella enterica Serovar Newport in China Google Scholar Source attribution of human salmonellosis: an overview of methods and estimates Core genome sequence analysis to characterize Salmonella enterica serovar Rissen ST469 from a swine production chain Laboratory-based surveillance of nontyphoidal Salmonella infections in China Google Scholar Detection and characterization of extended-spectrum beta-lactamases in Salmonella enterica strains of healthy food animals in Spain A cross-sectional study of Salmonella in pork products in Chiang Mai and antimicrobial resistance phenotypes of salmonella enterica isolates from carcasses at two large United States pork processing plants Appearance of Salmonella enterica isolates producing plasmid-mediated AmpC beta-lactamase Copyright and License information Google Scholar Vaeteewootacharn Salmonellosis and the food chain in Khon Kaen Google Scholar Multiplicity of Salmonella entry mechanisms a new paradigm for Salmonella pathogenesis Google Scholar Unveiling contamination sources and dissemination routes of Salmonella sp in pigs at a Portuguese slaughterhouse through macrorestriction profiling by pulsed-field gel electrophoresis Distribution of Salmonella enterica serovars from humans livestock and meat in Vietnam and the dominance of Salmonella Typhimurium phage type 90 Temporary and chronic carriers of Salmonella typhi and Salmonella paratyphi B Longitudinal survey of the occurrence of Salmonella in pigs and the environment of nucleus breeder and multiplier pig herds in England Global burden of childhood pneumonia and diarrhoea Antibiotic Resistance in Salmonella Typhimurium Isolates Recovered From the Food Chain Through National Antimicrobial Resistance Monitoring System Between 1996 and 2016 Antigenic formulae of the Salmonella Serovars WHO Collaborating Centre for Reference and Research on Salmonella Google Scholar World Health Organization (WHO). (2015). Drug-resistant Salmonella. Fact Sheet N_139. http://www.who.int/mediacenter/factsheets/fs139/en Accessed Oct 2011 2011a Google Scholar Growth and virulence properties of biofilm-forming Salmonella enterica serovar typhimurium under different acidic conditions Characterization of Multidrug Resistance Patterns of Emerging Salmonella enterica Serovar Rissen along the Food Chain in China Epidemiological investigation and antimicrobial resistance profiles of Salmonella isolated from breeder chicken hatcheries in Henan PubMed Abstract | CrossRef Full Text | Google Scholar Bacterial persistent infection at the interface between host and microbiota PubMed Abstract | CrossRef Full Text | Google Scholar Highly Prevalent Multidrug-Resistant Salmonella From Chicken and Pork Meat at Retail Markets in Guangdong and Class 1 Integrons Profiles of Salmonella from Animals in Slaughterhouses in Shandong Province Xu X and Yue M (2021) Changing Patterns of Salmonella enterica Serovar Rissen From Humans Copyright © 2021 Elbediwi, Shi, Biswas, Xu and Yue. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) *Correspondence: Min Yue, bXl1ZUB6anUuZWR1LmNu †These authors have contributed equally to this work Pakistan is experiencing its worst floods this century At least two-thirds of the country’s districts have been affected Scientists say several factors have contributed to the extreme event which has displaced some 33 million people and killed more than 1,200 Prices may be subject to local taxes which are calculated during checkout doi: https://doi.org/10.1038/d41586-022-02813-6 Correction 02 September 2022: An earlier version of this story incorrectly stated the number of houses that have been destroyed Correction 16 September 2022: A previous version of this story incorrectly stated that at least one-third of the country was under water Reprints and permissions Trump gutted two landmark environmental reports — can researchers save them Why the green-technology race might not save the planet Carbon majors and the scientific case for climate liability When a great ball of fire came crashing down How the Atlantic jet stream has changed in 600 years — and what it means for weather Ship-pollution cuts have an electrifying effect: less lightning at sea POST-DOCTORAL RESEARCH FELLOW Post Summary of the role The Characterisation & Processing of Advanced Materials HT is an interdisciplinary research institute created and supported by the Italian government whose aim is to develop innovative strategies to pr.. UNIL is a leading international teaching and research institution with over 5,000 employees and 17,000 students split between its Dorigny campus Department of Energy and Environmental Materials and advance cancer research in a leading translational institute Olivia Newton-John Cancer Research Institute Sign up for the Nature Briefing newsletter — what matters in science JUF amplifies our collective strength to make the world a better place — for everyone we consider the totality of local and global Jewish needs and how to address them we help people connect to Jewish life and values enduring community that comes together for good Rissen are emerging serotypes of Salmonella that require close monitoring for antimicrobial resistance and containment of their spread The study aimed to identify antimicrobial resistance genes (ARGs) in S.1,4,[5],12:i:- and S Rissen strains isolated from environmental sewage in Guangzhou City A phylogenetic tree was constructed using single nucleotide polymorphism data to assess genetic relatedness among strains offering insights for Salmonella infection outbreak investigations in the future to control the spread of drug-resistant Salmonella Novel technologies must be utilized to disinfect sewage and eliminate ARGs Ensuring food safety and proper sewage disinfection are essential to curb the dissemination of Salmonella Jun Yuan, yuanjuncom@163.com; Chaojun Xie, 35451900@qq.com Resistance of Salmonella to 17 antibiotics (n=41) from Environmental Sewage—Guangzhou City A phylogenetic tree illustrating the evolutionary relationship of Salmonella strains isolated from Guangzhou’s environmental wastewater using whole-genome SNPs A draft of a federal government risk study to assess contamination in spices found that about 12% of shipments were tainted with pathogens such as Salmonella or filth that included insect parts or animal hair The detailed look at the cleanliness of the nation's spice supply unveiled by the Food and Drug Administration (FDA) yesterday was prompted by a large Salmonella Rissen outbreak in the United States in 2008 and 2009 that sickened nearly 100 people in five states and was linked to ground white pepper a Salmonella Montevideo and Seftenberg outbreak linked to a cracked pepper coating on salami products sickened 272 people in 44 states The United States imports most of its spices and usage has increased steadily since 1966 written by the FDA Center for Food Safety and Nutrition results of federal and industry product sampling The FDA said the report is designed to assist with policy making decisions and help producers It said the draft of the report will be posted in the Federal Register and it invited stakeholders and the public to comment on the findings The FDA team identified 14 foodborne outbreaks linked to spices from 1973 to 2010 the events sickened 1,946 people and led to 128 hospitalizations and 2 deaths Investigators noted that infants and children were the hardest-hit groups in five of the outbreaks Ten of the outbreaks involved Salmonella enterica subtypes and unspecified—were implicated in nine of the outbreaks because most of the countries reporting the outbreaks are not spice-producing countries A review of import testing data found a 6.6% Salmonella prevalence in spice shipments which is higher than other imported foods subject to the same FDA regulations and testing More than 80 different Salmonella serotypes were found in the 3-year testing period that the FDA examined The most common filth adulterants were insect parts Nearly all the insects found in the spices were those commonly found in stored item which hints at problems with packing and storage FDA inspections in 2010 at 59 domestic facilities that pack and repack spices found that 10% had Salmonella in the environment and problems with pest management was the most frequently cited observation Spices can become contaminated at several points along the production chain then sold and combined with harvest from other farms The spices are often held and dried in the open air then sent to companies to be processed and packaged Treatments to reduce contamination aren't uniformly applied to all spices or all lots of a spice at a given time such as failing to limit animal access to spice sources during harvest or drying or failing to limit insect exposure during storage we concluded that knowledge and technology are available to significantly reduce the risk of illness from consumption of contaminated spices in the United States." The FDA Food Safety Modernization Act of 2011 gives health officials new tools to boost the safety of spice shipments including new recall authority and more frequent foreign and domestic inspections The authors also credited spice and food trade groups for developing recent guidance to control contamination Federal Register comments can be submitted starting on Nov 4 Oct 30 FDA draft risk profile on contamination in spices Oct 30 FDA press release on the report Federal Register notice Global Virus Network scientists highlight the need for robust surveillance and readiness for potential human-to-human viral transmission only the severe infections continued to cause symptoms. Almost 90% of the European cases were reported in Romania The Wall Street Journal reports the Trump administration is investing $500 million in the universal vaccine project There are currently 59 herds quarantined in 4 Idaho counties The CDC today addressed what's known about treatments pushed by Kennedy urging caution about vitamin A use and citing individual decision-making by heath providers for others Yet uptake of the vaccine was extremely low—less than 4% through November 2024 Today Novavax weighed in on the FDA's latest stipulations noting that postmarketing commitments aren't unusual and are in place for many approved drugs and biologics 44% of respondents said the new leaders will make them trust their health recommendations less than they used to and Ohio notes an infection in an unvaccinated adult CIDRAP - Center for Infectious Disease Research & PolicyResearch and Innovation Office Email us © 2025 Regents of the University of Minnesota All rights Reserved.The University of Minnesota is an equal opportunity educator and employer Research and Innovation Office | Contact U of M | Privacy Policy Newsletter subscribe Yemen’s president Abed Mansour Hadi has yielded to the demands of Houthi gunmen who over ran the capital Sana’a agreeing to a power-sharing role that will dilute his powers and give the rebels a strident voice in state affairs The deal amounts to a capitulation for the embattled leader, who will no longer have full authority to assign the entire government, or to make executive decisions without the input of the Houthis. A senior Houthi official welcomed the compromise but warned that deadlines had been breached when previous deals had been struck over the past three months. “This deal specifies a two week grace period to implement the core of what was agreed upon and we will be watching up close to see whether the government is serious or not this time,” a member of the Houthi political council told the Guardian. Rebels had earlier on Wednesday entered Hadi’s home three times, trying to force concessions that would consolidate their hold on power in Sana’a. Gulf States joined Yemeni officials in denouncing the Houthi moves as a coup and said they would do ‘whatever it takes’ defend Hadi’s leadership. The Houthis, who represent a minority Shia population in Yemen, seized a missile base on Wednesday. The rebels had effective control over much of the country’s military, which watched on earlier in the week as the rebels battled briefly with presidential guards. Houthi officials had earlier said they would rather partner with Hadi than oust him. Such a stance aims to make Hadi a client of a new Houthi-led power base, which had been flexing its muscles ever since rebels rode into Sana’a last September demanding a greater say in how the state is run. “We will not remove the president from power,” said Abdullah Shaban, a senior Houthi leader in Sana’a. “He is the president of Yemen but its our duty to ensure that he is not involved in corruption and involves all political factions in the decision making. He will remain as long as he wishes to. “I advised the president last month to take the Houthi threat seriously but his advisors led him to the hole he is in now. We will not stop putting pressure until the demands of the Yemeni people are met.” A senior UAE official in Sana’a confirmed that Gulf states were considering shutting their missions in Sana’a to protest developments. “Our government is currently studying the possibility of closing the United Arab Emirates embassy in Yemen,” the official said. “We downsized our staff months ago and we are keeping a close eye on the developments. We will close the embassy as soon as we are given orders.” On the streets of the capital, Ali Allanah, a fruit vendor located near the president’s residence said Hadi had no option but to step down. “Hadi is not the president anymore,” he said. “He can’t take care of himself let alone a country. “We only asked the president for security, thats all, and he couldn’t even grant us that.” Another local man, who fled Sana’a during clashes on Tuesday and is now scared to return said: “Its not secure for me to be in the house, but it is lawless [in Sana’a] and if militants are told my house is empty they would use it to attack government forces.” “My family is terrified and I cannot allow them to comeback to Sana’a until a deal is reached between both clashing sides. When is that going to be? I don’t know.” Authorities in Yemen’s southern port city of Aden closed all land, sea and airports on Wednesday raising fears that instability could spread to other regions of the volatile country. Oil production in Yemen’s most strategic oil province of Shabwa was halted on Saturday and fuel shortages are leading to long queues outside of petrol stations across the country. Yemen has been racked by political turmoil for much of the past four years, since an uprising, inspired by revolutions in Tunisia, Egypt and Bahrain, rumbled through the Middle East’s poorest nation. The revolt eventually led to the ousting of Ali Abdullah Saleh, who had led the country for four decades. Saleh is believed to be close to the Houthi rebels. Yemen is also battling a Sunni insurgency, with al-Qaida in the Arabian Peninsula remaining a potent threat in rural areas. The terror group is also active outside of the country, with the Charlie Hebdo killers boasting of carrying out the massacre in Paris earlier this month in its name. Volume 8 - 2021 | https://doi.org/10.3389/fvets.2021.705044 Nontyphoidal Salmonella (NTS) is the most reported cause of bacterial foodborne zoonoses in Vietnam and contaminated pork is one of the main sources of human infection the prevalence of NTS carrying multiple antimicrobial resistance genes (ARGs) have been increased The genomic characterization along the pig value chain and the identification of ARGs and plasmids have the potential to improve food safety by understanding the dissemination of ARGs from the farm to the table collected in 2013 at different stages in Vietnamese slaughterhouses and markets VITEK 2 Compact System was used to characterize the phenotypical antimicrobial resistance of the isolates whole-genome sequencing (WGS) was used to detect ARGs and plasmids conferring multidrug resistance Whole genome single nucleotide polymorphism typing was used to determine the genetic diversity of the strains and the spread of ARGs along the pig value chain 86.9% (20/23) of the samples were resistant to at least one antibiotic Resistance to ampicillin was most frequently detected (73.9%) followed by piperacillin and moxifloxacin (both 69.6%) and 69.6% (16/23) were multidrug-resistant (MDR) The observed phenotype and genotype of antimicrobial resistance were not always concordant Plasmid replicons were found in almost all strains [95.6% (22/23)] and the phylogenetic analysis detected nine clusters (S ARGs and plasmid content were almost identical within clusters We found six MDR IncHI1s with identical plasmid sequence type in strains of different genetic clusters at the slaughterhouse and the market high rates of multidrug resistance were observed in Salmonella strains from Vietnam in 2013 Genomic analysis revealed many resistance genes and plasmids which have the potential to spread along the pig value chain from the slaughterhouse to the market This study pointed out that bioinformatics analyses of WGS data are essential to detect and control the MDR strains along the pig value chain Further studies are necessary to assess the more recent MDR Salmonella strains spreading in Vietnam During the last years, whole-genome sequencing (WGS) has been shown to be useful for genetic characterization of Salmonella isolates including serovar prediction (18). To our knowledge, WGS is not yet established in Vietnam for NTS analysis, and most of the studies still rely on conventional microbiological methods (19) we used WGS and bioinformatics analysis to decipher the genetic traits (ARGs and plasmid replicons) of S Rissen isolates collected in 2013 in Vietnam at different stages of the pig value chain (pig slaughterhouses and pork markets) We performed phenotypic characterization and AMR testing as well as a phylogenetic analysis using a distance matrix based on single-nucleotide polymorphisms (SNPs) Plasmids carrying ARGs were traced for potential dissemination through the pig value chain The aim of this study was to show that WGS could potentially help to detect and to control the dissemination of ARGs from the farm to the table in Vietnam In this study, 23 Salmonella isolates (13 S. Derby and 10 S. Rissen) were analyzed. They were collected from diverse positions in pig slaughterhouses and pork markets in Hung Yen province in Vietnam in 2013 (Table 1) Reinhard Fries from the Institute of Food Safety and Food Hygiene Working Group Meat Hygiene of Freie Universität Berlin (FU) They were isolated and serotyped following the DIN EN ISO 6579-1:2017-07 in 2013 and stored on glycerol or cryotubes at −20°C these strains were transferred from the Institute of Food Safety and Food Hygiene to the Institute of Bacterial Infections and Zoonoses (IBIZ Jena) under appropriate shipping conditions Bioinformatics results of the 23 isolates of Salmonella enterica subsp Isolates were resuspended in 3 mL of brain heart infusion broth (Mast Diagnostica GmbH Germany) and incubated between 4 and 18 h at 37°C They were cultivated on RAMBACH® Agar (Merck KGaA Germany) for 24 ± 3 h at 37°C and the colonies had a characteristic red–pink color with a bright edge The isolates were recultivated on Columbia blood plates for 24 h at 37°C. Antimicrobial susceptibility test (AST) of the strain was assessed by determining the minimum inhibitory concentration (MIC) using the VITEK 2 Compact System (bioMérieux, Marcy-l'Étoile, France). VITEK cards AST-N195 and AST-N248 were employed to determine MIC values (mg/L) according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines (20) Twenty-four different antibiotics were evaluated: ampicillin VITEK 2 Compact System (bioMérieux France) also detected the EUCAST epidemiological cutoff values (ECOFFs) Here the 24 antibiotics are enclosed in seven antimicrobial families: β-lactam antibiotics Derby isolates were also tested with Micronaut AST-system plate M/E1-055-040 (MERLIN Diagnostika Germany) following the manufacturer's instructions and according to EUCAST guidelines Turbidity reading and interpretation were done manually the 23 Salmonella isolates were grown overnight at 37°C in 3 mL of Luria-Bertani broth (Mast Diagnostica GmbH DNA extraction was performed using the DNeasy blood and tissue kit (QIAGEN GmbH Germany) following the manufacturer's instructions for Gram-negative bacteria DNA sequencing libraries were constructed using the Nextera XT Preparation Kit (Illumina Inc. CA) following the manufacturer's instructions Paired-end sequencing was performed on an Illumina MiSeq platform (Illumina Inc.) using a 300-cycle MiSeq reagent kit One strain (19CS0402) was additionally sequenced using the MinION platform to analyze the complete genome sequence and the plasmid structure High-molecular-weight DNA was extracted using Genomic-tip 100/G and genomic DNA buffer kit (QIAGEN GmbH) The sequencing library was prepared using the Oxford Nanopore Technologies 1D Ligation Sequencing Kit (SQK-LSK109) with the Native Barcoding Expansion Kit (EXP-NBD104) as recommended by the manufacturer Furthermore, WGSBAC uses Snippy v.4.3.6 for core-genome SNP (cgSNP) detection. FastTree v.2.1.10 (30) uses the SNP distance matrix obtained by Snippy v.2.1.10 (30) to build a cgSNP-based phylogenetic tree. For visualization of the phylogenetic trees, we employed the online tool iTOL v.5.1.0 (31) To compare the IncHI1 plasmids of the same plasmid ST replicon, the whole p19CS0402-IncHI1 (Figure 1) sequence was mapped against the Illumina draft sequences carrying the same replicon. The multiple alignment was performed by the algorithm Mauve (35) within the external software Geneious Prime v.11.1.5 (Biomatters, Ltd., Auckland, New Zealand). Annotation was performed with Prokka v.1.14.5 (23) (Supplementary Table 1) Complete plasmid sequence of p19CS0402-IncHI1 from the Vietnamese strain 19CS402 Resistance genes of the 23 isolates of Salmonella enterica subsp trimethoprim–sulfonamide and quinolones Comparison of antibiotic resistance phenotype and genotype of the 15 Salmonella Derby samples Samples highlighted in different colors: clusters with more than one isolate Green color figure: slaughterhouse samples The average of phylogenetic distance in S. Rissen strains was 32 SNPs (0–64 SNPs; Supplementary Table 3). They were grouped into four different clusters. Two of them contained strains taken in the slaughterhouse and the market (yellow and blue highlight, Figure 3). The distance among the S. Rissen strain clusters was up to six SNPs (Supplementary Table 3) Green color figures: slaughterhouse samples Blue annotation: mobile genetic elements [e.g. transposons (Tn) and insertion sequences (IS)] Yellow annotations: efflux pumps or antiseptic resistance genes Isolates organized in clusters with information about the collection place The six IncHI1 replicons belonging to the same ST were found in the samples collected in the slaughterhouse (splitting place) and in the market (pork and cutting board). They belonged mostly to different clusters, and they were found in both serovars (Table 5) Although the difference in these plasmids lies in some of the ARGs and their MGEs further investigations must be done to validate the fosA7.3 functionality in S these discordances show that the genotypical determination of the AMR could add relevant information to the phenotypic detection However, possible ARG transmission was not only seen within single clusters. Six isolates that belonged to serovars Rissen and Derby and belonged to four different clusters (based on SNP typing, Table 5, gray cells) carried an MDR IncHI1 plasmid with identical plasmid ST. These isolates were found in the slaughterhouse (splitting place) and at the market (pork and cutting board, Table 5 Observations like this reveal the potential spread and distribution of a plasmid transmitting multidrug resistance in different clusters and serovars along the pig value chain Limitations to this study include the moderate number of strains obtained from samples from Vietnam the data presented here highlight the importance of antibiotic resistance among Salmonella strains in Vietnamese pigs and show its potential spread to humans a comparison of our strains with the same serovar and ST from pigs slaughtered in Vietnam was not possible because of the limited number of public sequences strain with the same characteristic as our strains our publication will add information to increase the number of sequence data to the public databases collected in 2013 at various stages in pig slaughterhouses and pork markets in Vietnam VITEK 2 Compact System determined AMR phenotype and the phylogenetic relationships between the strains The 86.9% (20/23) of the samples were resistant to at least one antibiotic The most frequently detected ARGs conferred resistance against tetracycline but no ESBL- and AmpC-encoded genes were found in any of the isolates the relation between the phenotype and the ARGs was discordant in the samples Some of the ARGs were found on plasmids such as IncHI1 which accounted for 26.1% of the samples and carried between 3 and 10 ARGs SNP analysis showed the potential of transmission of MDR Salmonella from slaughterhouse to market via the pork chain could be a potential factor for the spread of multidrug resistance among clusters To investigate the MDR situation in the Vietnam pig value chain further studies should be done using WGS to identify ARGs and track MDR strains and plasmids the location of ARGs in plasmids or the chromosome could help to monitor and control the spread of ARGs WGS and bioinformatics tools should be introduced as a standard procedure to help the identification of critical points within pork production chains to control the spread of antimicrobial-resistant Salmonella The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article//Supplementary Material Ethical review and approval was not required for the animal study because Samples were collected from slaughterhouse and market environmental samples and HT contributed to conception and design of the study BG-S performed the laboratory work and wrote the manuscript All authors contributed to manuscript revision BG-S and SG-S were supported by in-house projects of the Friedrich-Loeffler-Institut on AMR-One Health We thank Jörg Linde for support on the bioinformatics servers Fiona Balzer and Herlinde Irsigler for skillful technical assistance and Fabian Steinlechner for his time and support The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fvets.2021.705044/full#supplementary-material Single-nucleotide polymorphism (SNP) analysis IncHI1 plasmid isolates' identity percentage comparison 1. OIE. Terrestrial Animal Health Code II. (2019). Available online at: https://www.oie.int/en/what-we-do/standards/codes-and-manuals/terrestrial-code-online-access/ Google Scholar and associated microbiological hazards in retail shrimps purchased in Ho Chi Minh city (Vietnam) Species-wide whole-genome sequencing resolves invasive and noninvasive lineages of salmonella enterica serotype paratyphi B Risk factors associated with Salmonella spp prevalence along smallholder pig value chains in Vietnam and extended-spectrum and AmpC beta-lactamase productivity of Salmonella isolates from raw meat and seafood samples in Ho Chi Minh City Distribution of virulence genes among Salmonella serotypes isolated from pigs in Southern Vietnam Prevalence and epidemiology of Salmonella spp Antimicrobial residues and resistance against critically important antimicrobials in non-typhoidal Salmonella from meat sold at wet markets and supermarkets in Vietnam Antibiotic resistance in Salmonella isolates from imported chicken carcasses in Bhutan and from pig carcasses in Vietnam 10. WHO. Global Antimicrobial Resistance Surveillance System (GLASS) Report: Earlyimplementation 2020. (2020). Available online at: https://apps.who.int/iris/handle/10665/332081 Google Scholar extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance Antimicrobial resistance gene expression associated with multidrug resistant Salmonella spp Alternate antimicrobial resistance genes in multidrug resistant Salmonella spp isolated from retail meats in Vietnam using RNA-sequencing analysis Zoonotic transmission of mcr-1 colistin resistance gene from small-scale poultry farms Mobile genetic elements associated with antimicrobial resistance core-genome and protein expression in IncHI1 plasmids in Salmonella Typhimurium Plasmids carrying antimicrobial resistance genes in Enterobacteriaceae Emergence of multidrug-resistant Salmonella enterica subspecies enterica serovar infantis of multilocus sequence type 2283 in German broiler farms Distribution of Salmonella serovars and antimicrobial susceptibility from poultry and swine farms in central Vietnam 20. EUCAST. Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 9.0, 2019 (2019). Available online at: http://www.eucast.org 21. Seemann T. Shovill GitHub. Assemble Bacterial Isolate Genomes From Illumina Paired-End Reads. (2018). Available online at: https://github.com/tseemann/shovill (accessed February 25 QUAST: quality assessment tool for genome assemblies PubMed Abstract | CrossRef Full Text | Google Scholar Improved metagenomic analysis with Kraken 2 PubMed Abstract | CrossRef Full Text | Google Scholar Validating the amrfinder tool and resistance gene database by using antimicrobial resistance genotype-phenotype correlations in a collection of isolates CARD 2017: expansion and model-centric curation of the comprehensive antibiotic resistance database PlasmidFinder and in silico pMLST: identification and typing of plasmid replicons in whole-Genome Sequencing (WGS) The Salmonella In Silico Typing Resource (SISTR): an open web-accessible tool for rapidly typing and subtyping draft Salmonella genome assemblies FastTree: computing large minimum evolution trees with profiles instead of a distance matrix Interactive Tree Of Life (iTOL) v4: recent updates and new developments PubMed Abstract | CrossRef Full Text | Google Scholar Fast and accurate de novo genome assembly from long uncorrected reads Pilon: an integrated tool for comprehensive microbial variant detection and genome assembly improvement Mauve: multiple alignment of conserved genomic sequence with rearrangements WHO Collaborating Center for Reference and Research on Salmonella 37. EUCAST. Redefining Susceptibility Testing Categories S, I and R. (2019). Available online at: http://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/EUCAST_Presentations/2018/EUCAST_-_Intermediate_category_-_information_for_all.pdf Salmonella contamination: a significant challenge to the global marketing of animal food products Non-typhoidal Salmonella in the pig production Chain: a comprehensive analysis of its impact on human health Genetic diversity of Salmonella Derby from the poultry sector in Europe and antimicrobial resistance of nontyphoidal salmonella gastroenteritis in hospitalized children in Ho Chi Minh City Antibiotic resistance in fecal sludge and soil in Ho Chi Minh City Source attribution study of sporadic Salmonella Derby cases in France Salmonella Derby: a comparative genomic analysis of strains from Germany The role of whole genome sequencing in antimicrobial susceptibility testing of bacteria: report from the EUCAST Subcommittee Epidemic multiple drug resistant Salmonella Typhimurium causing invasive disease in sub-Saharan Africa have a distinct genotype 47. WHO. Critically Important Antimicrobials for Human Medicine. (2019). Available online at: https://apps.who.int/iris/bitstream/handle/10665/312266/9789241515528-eng.pdf Google Scholar Antimicrobial consumption in medicated feeds in Vietnamese pig and poultry production Antimicrobial use through consumption of medicated feeds in chicken flocks in the Mekong Delta of Vietnam: a three-year study before a ban on antimicrobial growth promoters Antimicrobial use and resistance in animals PubMed Abstract | CrossRef Full Text | Google Scholar Differential distribution of plasmid-mediated quinolone resistance genes in clinical enterobacteria with unusual phenotypes of quinolone susceptibility from Argentina ResFinder 4.0 for predictions of phenotypes from genotypes EUCAST expert rules in antimicrobial susceptibility testing The tetA gene decreases tigecycline sensitivity of Salmonella enterica isolates First detection of a fosfomycin resistance gene in Salmonella enterica serovar Heidelberg isolated from broiler chickens Comparative genomics and phylogeny of sequenced IncHI plasmids CrossRef Full Text | Google Scholar The plasmidome of a Salmonella enterica serovar Derby isolated from pork meat Whole genome sequencing analysis of multiple Salmonella serovars provides insights into phylogenetic relatedness food animals and agriculture environmental sources Multidrug-resistant Salmonella enterica serovar Paratyphi A harbors IncHI1 plasmids similar to those found in serovar Typhi Comprehensive genomic investigation of coevolution of mcr genes in Escherichia coli strains via nanopore sequencing Comparative phenotypic and genotypic analyses of Salmonella Rissen that originated from food animals in Thailand and United States Fries R and Tomaso H (2021) Genomic Characterization of Multidrug-Resistant Salmonella Serovars Derby and Rissen From the Pig Value Chain in Vietnam Received: 04 May 2021; Accepted: 28 July 2021; Published: 27 August 2021 Copyright © 2021 González-Santamarina, García-Soto, Dang-Xuan, Abdel-Glil, Meemken, Fries and Tomaso. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) *Correspondence: Belén González-Santamarina, YmVsZW4uZ29uemFsZXpzYW50YW1hcmluYUBmbGkuZGU= We have passed the half way mark in Melodifestivalen 2024 and tonight we rolled on with heat 4 from Volvo CE Arena in Eskilstuna Six new acts battled it out for two direct qualification spots into the grand final in Stockholm Winning the heat was Melfest veteran Danny Saucedo and “Happy That You Found Me” and he can be happy that he found a heat win because he has now done that all 5 times he has participated in Melfest After the second round of voting it was Dotter and “It’s Not Easy To Write A Love Song” that got the second direct ticket for the final Albin Tingwall and Scarlet progress to the final qualifying round next week 30 acts participate in Melfest 2024 split into 5 heats of six acts each The number 1 and 2 placed acts from each heat qualify directly to the grand final in Stockholm and the two lowest placed acts are finished in the competition This make up for the first 10 acts qualifying for the grand final Number 3 and 4 of each heat will have their fate decided in a Final Qualification held in connection with heat 5 The 10 songs in all will compete for 2 tickets to the grand final decided by the percentage of votes each entry got in their heat plus the amount of votes they get in the Final Qualification Do you think any of these acts could go on to win the entire thing she won’t win 🙁 Her next song be like “It’s Not Easy to Win Melodifestivalen” Not a very exciting year for Melodifestivalen It’s been more predictable than ever so far with the known names going through even with the most mediocre songs It seems like they’re trying to push the Norwegian twins considering that in their inability to think outside of their own schemes SVT always leaves their favorite act for last in the last semi those two aren’t good singers or performers and there sure are better choices Danny Sausedo sounded so dated with same ‘Amazing’ 2012 hook for a winner of 4 heat It would be sad for her to compete in ESC with her worst melfest entry 🙁 but well Not with that song… Bullet proof was amazing but this one wasn’t very good I really liked “In i dimman” and hope they will be as good or better this year I don’t know why everyone goes crazy about Dotter That’s what makes people interesting We like things another dislikes and dislikes things others like I’m someone who loves Dotter’s music/voice and appearance ……………I think………… I thought she would be eliminated this year The performance seemed like a desperate attempt at being Loreen… They were easily the best and most interesting this semi Dotter is leagues above anything else that we’ve heard and seen It’s the only entry (apart from a few Swedish ones that are chanceless anyway or have already been eliminated) that feels sincere and not generic but still mainstream Exciting news: in Israel today the Eurovision team came to the studio to work on the song “October Rain” Apparently a new version of the song with different lyrics will be recorded today It seems that Israel will eventually participate So much for “we’ll rather withdraw then change anything” Avada Kedavra, I speak to destroy Ireland for the ESC24 win! Heat 5 is the last hope for something solid Let’s not pretend these are actually good songs Dotter all the way to Eurovision song contest thank you Her outfit didn’t remind me that much of Loreen while Dotter had wool that got stuck in a lawn mover you didn’t know what to expect like you usually do like Danny’s song In the finals the tv votes might change totally there is no clear winner as it was last year For example people who voted for Maria Sur might as well give their votes to Dotter (as I will) and… Read more » Lol poeple must be blind to say Dotter outfir and Loreen are similar lol Her outfit that didn’t remind that much of Loreen while Dotter had wool that got stuck in a lawn mover ? People who voted for Maria Sur might as well give their votes to Dotter (as I will) and the Jury will hopefully vote for Dotter I’d have liked Scarlet over Dotter as the other direkt til fina I’d have liked to have seen it again in whatever we call the andra chansen round now Scarlet blew away every single act in Melfest so far SCARLET was easily the best one in this Heat They wrote the song together with Swedish songwriters and they work a lot in Sweden Why did Swedish Victor Crone represent Estonia in Eurovision 2019 Lots of artists have been competing/trying to compete for other countries not like M&M who are worldfamous ultrapopular big superstars they are more connected to Sweden than Victor is to Estonia And he was just the first example I came to think of I also think it’s a shame if M&M will represent Sweden My guess is that they want to get more connected to the very successful Swedish music industry The have conquored Norway now they want the rest of the world and Sweden is the road to get there Danny Saucedo really stood out from the rest (even Dotter) And the staging was effective and elevated the song This song tonight was different from her usual style and not that strong I felt her performance got her through to the final I usually like weird or very different songs but i coud not root for them tonight,… Read more » Agreed about Danny and Dotter but I liked Scarlet I can’t decide if Danny’s staging is boring or genius no choreography or anything and the stage look a bit cheap to be honest Genius because Sweden usually sends highly choreographed staging where every movement is rehearsed in detail He trusts his experience and showmanship and he looks very relaxed and sponteneous and like he is just having fun I would love so much that we could sent Scarlet to Eurovision but it gonna probably never happen… almost all Swedes are so tone deaf that the boring pop songs go to the final as usual every year The same thing happened to Loreen in 2017 when she lost to a Shawn Mendes wannabe We already know now that Scarlet (who really deserved the last final place) will be eliminated in Finalkvalet I still get so angry thinking about the 2017 Andra Chansen and it’s been 7 years (and I was watching from the US) a song that finished second in their heat has never won Mello So if she did she would be the first one ever A song that didnt win it’s semi won in 2004 Go to Wikipedia yourself and check how the winners of Mello placed in their heats those years Then you’ll see that 2004 and 2019 they placed first in their heats 2013 is the only exception because Robin placed 3rd and went through “the second chance” But it has never happened that someone who placed second in their heat has won Not once in the 22 years that there’s been heats I love her but she can’t even win this heat so it’s impossible for her to win the whole thing I love Dotter past tracks at Melodifestivalen and It’s Not Easy to Write a Love Song is good and well written but all I could see in her performance was too much effort too much planning yet full of clichés… A mix of Cornelia and Loreen on stage And it was not memorable for something as such I’ve heard her say a few times in interviews she had so much vision for how she wanted to stage and perform it but it’s mad how influenced it seemed by Loreen and Cornelia Loreen doesn’t own lying down on something and Cornelia doesn’t own that style of camerawork but I was expecting a lot more of a vision from Dotter A shame Scarlet didn’t make it to the final Danny’s song and performance is pretty good but she’s overdoing her movements and mimics And if he wins it’s because it’s Danny not because of the song And then he better think about some other staging and clothes staging and performance were amazing tonight Not sure but surely a contender for the crown Well going by that logic then you can say Loreen won cause she was Loreen the song really felt uoriginal…and the staging was nothing to cheer about either but I couldnt help feel that she was going all in for becoming CorneliaJacobs.2 this time around…so despite a good song Scarlet was said to be the hardest song ever in MF by some… barely… pure pop feeling I still think this song might grow on me…but it was overall a bit disappointing struggled with… Read more » For me Dotter and Scarlet were the standouts Dotter has a very natural charisma that makes whatever she’s performing feel expensive and with Scarlet I immediately felt the fantasy Lia should have gone through and Dotter should be out I think everyone was expecting them to qualify No winner candidate in sight and it’s already week four I love Danny but this year’s song and performance was tired and uninspired Poor thing was sick with obvious voice issues but I don’t like her getting through on sing back… If there aren’t enough good songs we don’t need five heats It is just a festival of mediocre at this point Very few artists in melodifestivalen do all the vocals live and alone Dotter was helped by both a backing singer behind stage (Melanie Wehbe) and prerecorded backing vocals She lip synced parts of the performance because her voice did not hold as she was sick If you watch the performance it is obvious she lip synced parts of the song The “slaying” vocals was performed by Melanie Wehbe singing backing vocals behind stage (no secret she also helped with Lia Larsson’s vocals) and the prerecorded vocals (all allowed in melodifestivalen) she was sick and could not help it – but I have not seen anyone lip syncing go to the finals before this and I feel it is undeserved Dotter going DTF while barely being able to talk Because her doctor said she was not allowed to speak in order to save her vocal chords She cancelled all interviews and press meetings I’m gonna be so gutted if Scarlet don’t make it to the final Kinda surprised Albin managed to squeak through (I know he didn’t “squeak through” as such I just forgot about the song as soon as it was over) Danny and Dotter were both very underwhelming would have rather had Scarlet and Albin go through Everyone’s hoping Marcus & Martinus are bringing a winner I’m actually wondering whether Medina could bring something epic Also why did Carina say a few things in English today Swedes switch to English when they don’t want their kids to understand what they are saying common thing in Sweden and probably a few other places that parents speak in English to each other to avoid their children overhearing conversations they don’t want them to hear Much pressure is now on Marcus and Martinus and also Medina If that’s what people are looking for My hope is that someone can up-grade at last one step from what we have heard and seen these four weeks I like Marcus and Martinus and Medina.… Read more » Particularly in Sweden where Mello is supposed to be more than a national selection but a festival in it’s own right It’s completely valid to voice an opinion that the songs seem weaker than some other years Literally what is wrong with me wondering Medina bring something epic I said it because I like them and that describes their style of music I’m not saying it because I want/expect Sweden to win two years in… Read more » In general eurovision fans have pretty high expectations when it comes to Sweden And the songs that fans don’t like or call overrated get the chance to become hits in Sweden But last year was also weak and the year before that I’m just saying it’s just never enough. Maybe issue is you expecting every song to be “epic If you constantly expect songs to be epic you will be disappointed Seems like international fans always expect these shows to be epic The point is to entertain people through music Not every heat will be epic and not every year will be epic If SVT wanted epic songs they could just choose 10 massive songs and let them fight think that of the 30 songs in Melfest the people selecting the songs think like this: 5 are supposed to have potential for a good results in ESC The rest are there for other reasons: a place for a new artist to be seen and heard (example: Melina Borglowe) others for pure entertainment (Like Gunilla Persson) and then a groupd that is there to diversify (Lasse Stefanz So the 5-ish that is supposed to have ESC-potential (according to the people that selects the songs) are (this year): Liamoo Carina was speaking Swenglish to parents of young children to give them secret messages Like if the kids fell asleep watching Mello you should carry them to their beds and then eat their candy But many schoolkids in Sweden speak great English In Sweden parent often use English when talking about things they don’t want little kids to know her speaking “Swenglish” with a mix of English and Swedish when talking about families Björn Gustafsson’s humour is funnier than Edward af Sillén’s The joke was fun for 20 sec and then it was all downhill Marcus and Martinus better come with an unforgettable song next week cause so far Melodifestivalen has been very uninspiring and middle of the road… Swedish journalist Tobbe Ek was asked in a podcast yesterday if he has heard any of the songs in the last heat He didn’t want to say too much but he seemed to think that both Marcus & Martinus and Medina are very good And that it’s likely the winner will be from the last heat He has obviously not seen the performances though How do you expect them to come with unforgettable song when last year they came with most generic song ever Scarlet gave a good vocal performance twinned with great visuals and dancers akin to Bambie Thug Danny’s performance didn’t have any dancers the visuals were amazing and more importantly It’s like this was composed RIGHT AFTER Amazing I have a feeling the lyrics are referring to how he has made a comback in English He really did well with the vocals I thought Don’t repeat the crime of “Cry” I don’t know Steps well enough to which of their songs the piano undertune of Danny’s song reminds of This is my least favourite part of the song Which I think itself was heavily inspired by ABBA I agree that the winner reprise was better The performance producer/creator is doing something wrong when the song is better without the original performance I’m so happy that Danny’s so happy He’s so happy that he found it (the fifth heat win) That was the biggest favourite in all 4 heats to win Let’s see if it’s Dotter or Scarlet who follows along 🙂 Dotter stans downvoting those of us who don’t have her in our top Happy to discuss in replies but unless we’re being rude/unjust (which simple rankings obvs aren’t) I’d downvote really necessary?! Hopefully next week we will see the winner song of this years Melfest (Marcus & Martinus) Norwegian twin(k)s won’t win in Sweden Overview Meet the team Press Write for us Input your search keywords and press Enter Movies in theaters Movies at Home Florence Pugh Movies and Shows (Thunderbolts) What to Watch: In Theaters and On Streaming Weekend Box Office: Thunderbolts* Secures $76 Million Debut New Movies and Shows streaming in May: What to Watch on Netflix This website is using a security service to protect itself from online attacks The action you just performed triggered the security solution There are several actions that could trigger this block including submitting a certain word or phrase You can email the site owner to let them know you were blocked Please include what you were doing when this page came up and the Cloudflare Ray ID found at the bottom of this page Lithuania — the three Baltic States are primed and ready to launch their campaigns for Eurovision 2024 They’ve each developed a rich history at the contest Estonia and Lithuania have now been competing for three decades There have been highs — they share two Eurovision victories between them — and lows — each have failed to qualify for the final at some point The task of representing the three nations now lies in the hands of Dons But which of them has your favourite entry Then head down and vote in our poll and show some love for your Baltic champion of the year Make sure you’re happy with your selection before submitting a vote — you’ll only be able to do so once Which of these acts do you think will get the best result at Eurovision 2024 Let us know all your thoughts in the comments below Jonathan is a Eurovision fan from the United Kingdom and first watched the contest in 2005 After coming across the national selections and junior contest ten years later he's now fully immersed himself into the Eurovision lifestyle You can follow Jonathan on Twitter: @JonathanVautrey and Instagram: @jonathanvautrey I personally find Luktelk pretty repetitive (N)NETM(K)M is so much more entertaining and catchy of a song and I like Dons has the best personality of the Baltic participants this year I have to go with Estonia (again) this year That video is one of the most interesting that has been made I do believe that Latvia finally has a qualifier this time around (Justs in 2016 was the last one) all 3 should find themselves on the stage for the Saturday show Perhaps not this year but I feel it coming I do think Lithuania will win Eurovision sometime this decade but in the future if they keep improving and getting better results If Lithuania ever does win Eurovision in the future I plan to write a Hetalia fan fic tracking Lithuania’s Eurovision journey leading up to the victory through the eyes of the personification But I am not posting it until Lithuania actually wins I really root for Lithuania to win at some point They’ve been in the game with solid entries for a long time now Kaunas could be the host city since almost all foreign artists go there and has the capacity for that level of a show Estonia is one of my favourites of the year Lithuania is really the best among these 3 but it’ clearly better than Estonia… I do think it’s a shame there’s a lack of support for Latvia Last year they had a brilliant song that got shunned and it seems like this year will be a repeat of that They’re all in my top 10 this year (Lithuania 2nd Latvia and Lithuania are my qualifiers on my opinion It’s surprising to see that people really vote more for Estonia than for Latvia But they’re the only ones without a win so far They’re also the biggest of the Baltics population-wise Interesting that Wiwibloggs always launch this kind of poll about the baltics Latvia for me and its actually my winner this year The Baltics have a strong season this year Difficult to predict how the voting will go but my favorite is ‘(nendest) narkootikumidest ei tea me (küll) midagi’ due to it being in my native language and I enjoy that ‘Luktelk’ is also strong and in its native Lithuanian – a plus Not a ballad person but Latvia with ‘Hollow’ is seemingly underrated all songs have translations that can be checked out… Read more » Estonian flag* Latvian flag* Lithuanian flag* I think it’s a strong year for the Baltic entries All three are great songs with different attributes Lithuania “Luktelk” has the most memorable Chorus and hooks; great choreo and some haunting singing from Silvester when he’s not too busy working the crowd This should do well enough to qualify for the grand final Latvia “Hollow” has a gravity about it that reaches me but it needs much better staging and storytelling to do well Estonia “That long song title I can’t be bothered to… Read more » “(nendest) narkootikumidest ei tea me (küll) midagi” the Baltics usually struggle in a competing year ending in four (Lithuania and Estonia were bottom 2 in 1994 and all three Baltics failed to qualify in 2004 and 2014) We’re gonna see at least two of them in the final I guarantee it I’m trying to learn the song by heart (mission impossible) Lithuania is my favorite but really think all 3 can qualify It would be cool to see all three qualify to the final for once although I do acknowledge latvia has an uphill climb Very unpopular opinion but I think Lithuania could be NQ or be at the bottom 7 in the finals For some I get the same vibe like Slovenia 2023 and Albania 2022 Estonia waste of the fee for participating To Many Gay Dudes This Year Its Begining To Feel Forced Very Good Lyrik But I Dont Like The HairLess Look singer and performance is from Silvester Belt As from the studiocut I wasnt much with the track of Latvia After seeing his live show at the pre-party in Madrid I got very impressed by his vocals The Estonian entry of 5miinust & Puuluup make me smile,also the songtrack as it must be the longest one in ESC history The live show in their national Final was a hot mess and didnt convince me.… Read more » I like Latvia but I fear it won’t qualify while I really don’t like the song from Estonia but think it has a fair chance to qualify nothing is too competitive here or too tryhard i also like Lithuania (worthy NF winner in what was a very strong NF honestly my personal favourite there was Gaude Vejai by Zalvarinis i liked the game of thrones vibe in that ethno bop) i see it as this years ”Estonia 2023 – Bridges” good song by a solid live vocalist I voted for Latvia but all 3 are quite good this year They are all so different but good in their own genres Lithuania just tips past Latvia and Estonia Estonia’s song is the most unique and different of the three but Silvester has my respect for singing in his native language Dons’s song sounds best in english though you wouldn’t understand a thing from it in latvian It’s also easily the best-written song in English this year How interesting that in (what is considered to be) the SONG contest good song with meaningful lyrics is somehow so underrated that Wiwibloggs didn’t interview him during Madrid pre-party Latvia is the one in danger of NQing again I think Latvia will be this year’s Bridges He’ll qualify in the lower positions and then have huge jury support in the final I think they’re all strong this year and deserve top 12 or better Broadband TV News September 14, 2017 12.44 Europe/London By Robert Briel Esports is reaching the elusive millennials audience but total viewing figures are now even overtaking traditional sports Bakker said there are opportunities for traditional players in the broadcast market in the esports world as the passionate fanbase is very vocal.” He outlined that there is a need for storytelling portraying the players but started way back in 1080 with Atari hosting the first tournaments in New York City the global esports market was estimated in 2016 to top $463 million its audience power is unparalleled and offer enormous opportunities for broadcasters Prize money has rissen to $100 million a year with members of winning teams pocketing $2 each for a single tournament Visa and others have now come aboard as sponsors Broadcasting of live esports events was until recently mainly online but is now also coming to tradtional broacdst channels Multichoice and Canada’s Super Channel recently and Bakker said he hopes to announce an agreement with a European DTH platform in the coming months Ginx was launched in 2008, but turned into Ginx Esports TV in 2016 with Sky and ITV taking shares in the fledgling broadcaster Ginx eSports TV showcase majors eSports tournaments from across the globe The schedule includes coverage of Turner’s Eleague tournament Filed Under: IBC Special Tagged With: eSports, Ginx, IBC 2017, Michiel Bakker Edited: 14 September 2017 12:48 Arnhem-based Robert covers the Benelux, France, Germany, Austria and Switzerland as well as IPTV, web TV, connected TV and OTT. Email Robert at rbriel@broadbandtvnews.com Today, consumers are increasingly using bandwidth-intensive and latency-sensitive workloads, such as 4K and 8K streaming, online gaming, and AR/VR applications. As a result, Internet Service Providers must update their networks and by extension Wi-Fi experiences and performance. … [Download the White Paper ...] All the Stories from the IBC Special Copyright © 2025 Broadband TV News LLP · Log in A retired Brighton antiques dealer has been jailed for four years for running a cannabis farm with his partner The force said that officers found more than more than 1,700 cannabis plants in various stages of growth Lewes Crown Court was told that they were worth up to £2.1 million They denied the charge and – after a trial lasting three and a half weeks – the jury cleared Jesse Boyle pleaded guilty in January at the start of the trial On Thursday (2 March) Judge Guy Anthony handed a four-year prison sentence to Terry Boyle who had earlier given his address to Brighton magistrates as Chalky Road The judge also jailed Hawkins and Cooper for four years each for the drugs offence and gave Cooper a two-year sentence for money laundering Police raided the farm at 9.15am on Wednesday 26 February 2014 and found the cannabis plants in an outbuilding officers held two other people during the raid – a 19-year-old woman and a 42-year-old man At the time of the raid Detective Inspector Gavin Patch said: “This was an intelligence-led operation After the sentencing hearing the investigating officer said: “This has been the largest cannabis factory I have dealt with “And this has been a long and complex investigation involving a number of officers and we have succeeded in taking a massive amount of cannabis off the streets “In the process three people who worked together to set up this professional set-up are going to serve time in prison An application is expected to be made for a confiscation order under the Proceeds of Crime Act A key asset will be the proceeds from the sale of the farmhouse which was built for Boyle on the site of a horticultural nursery in 2005 It was put up for sale for £1.3 million last year And it is believed to have sold for under £1 million He is one of the seven children of the late Brighton antiques dealer Billy Boyle and website in this browser for the next time I comment Δdocument.getElementById( "ak_js_1" ).setAttribute( "value" This site uses Akismet to reduce spam. Learn how your comment data is processed Brighton and Hove Albion owner Tony Bloom believes that he can help Hearts “disrupt Scottish football” having worked with the.. Brighton and Hove Albion 4 Arsenal 2 Brighton and Hove Albion left Arsenal shell-shocked once again as they ran out.. Brighton and Hove Albion 1 Newcastle United 1 Brighton and Hove Albion looked to be on course for a 1-0.. Brighton and Hove Albion face Newcastle United at the Amex this afternoon with Jan Paul van Hecke back in the.. Roji Cat Beer Bar is a vibrant fusion of Japanese street culture and Gold Coast nightlife born from the Lee family’s deep love for Japan and their annual snowboarding trips alongside long-time family friend and renowned brewer Satoshi ‘Toshi’ Tamura (formerly of Black Hops) have created a lively new venue that brings a slice of Tokyo’s buzzing atmosphere and dizzying blend of energy to Miami What started as a casual idea over beers evolved into a full-fledged vision – to recreate the vibrancy of Tokyo’s bustling alleyways in a bar setting alley-like layout feels serendipitously perfect reminiscent of the hidden streets of Tokyo where adventure awaits around every corner and behind every door neon lights and intimate nooks invite you to explore A standout feature is the electric dart boards a private karaoke room offers the chance to sing your heart out in near sound-proof privacy At the heart of Roji Cat is Satoshi’s passion for brewing The bar boasts a dozen house-made beers on tap with crowd-pleasers including Toshi’s Japanese rice lager and Black lager accompanying a rotating selection of seasonal specialties in the opening line-up The signature cocktails put a Japanese spin on the classics a refreshing blend of apricot-infused iced tea with delicate notes of plum umeshu where sweet melon and lychee combine to deliver a bold citrus punch there’s a full bar featuring 24 carefully selected sakes with a menu that delivers an elevated take on Japanese street food some of the standouts include yuzu karaage chicken kimchi burgers and perfectly grilled robata skewers of chicken If a trip to Japan isn’t on your travel bingo card for 2024, Roji Cat in Miami is the next-best thing. Head to our Stumble Guide for opening times. InDaily Queensland acknowledges the Traditional Owners of the land on which we work and live, the Turrbal, Yuggera, Yugambeh and Kombumerri people, and recognise their continuing connection to land, waters and culture. We pay our respects to their Elders past, present and emerging. Three men have been convicted of multiple offences carried out as part of a vigilante attack on men guarding a repossessed farmhouse in Roscommon five years ago Following a trial that ran for over three months the jury at Dublin Circuit Criminal Court today returned its verdicts after deliberating for a total of 13 hours and 58 minutes A fourth man facing charges in relation to the same incident was acquitted by the jury which had began its deliberations last Thursday Co Donegal was found guilty of false imprisonment of and assault causing harm to Ian Gordon He was also found guilty of aggravated burglary and three counts of arson in relation to three vans which were allegedly set alight He was acquitted of one count of arson in relation to a car and the robbery of a wristwatch from John Graham Sweeney was further convicted of criminal damage to a door of a house violent disorder and to causing unnecessary suffering to an animal by causing or permitting an animal to be struck on the head Claremorris was found guilty of false imprisonment of and assault causing harm to Ian Gordon aggravated burglary and criminal damage to a door of a house He was also convicted by the jury of violent disorder three counts of arson and of causing unnecessary suffering to an animal by causing or permitting an animal to be struck on the head He was found not guilty of robbery of a wristwatch from John Graham and Co Roscommon was found guilty of false imprisonment of and assault causing harm to Ian Gordon He was also found guilty of aggravated burglary to causing unnecessary suffering to an animal by causing or permitting an animal to be struck on the head He was acquitted of robbery of a wristwatch from John Graham and one count of arson in relation to a car which was allegedly set alight The jury returned unamimous guilty verdicts in respect of the charge of violent disorder faced by O'Toole Jurors found the three men guilty by a majority of 11 to one on the 14 other charges of which they were each convicted a security worker with an address at Bailis Downs was found not guilty of the 17 charges he faced He was found not guilty of false imprisonment of and assault causing harm to Ian Gordon aggravated burglary and four counts of arson He was further acquitted of criminal damage to the door of a house robbery of a wristwatch from John Graham and causing unnecessary suffering to an animal by causing or permitting an animal to be struck on the head The four defendants had pleaded not guilty to all counts a group of approximately 30 armed men smashed their way into a house at a recently repossessed rural property at Falsk and a chain saw and they attacked the men who were guarding the property The State's case was that the four accused and the other men present had gone there to take back the house for the previous owner Anthony McGann and his brother who had been forcibly removed from the property during a court-ordered eviction five days earlier The prosecution said that the men who went to Falsk all shared the common goal of getting the security men off the property and making sure they didn't come back and that to achieve this the group engaged in sustained and brutal violence designed to terrorise the men working there The case was prosecuted on the legal principle of common design which holds that if two or more people embark on a plan together to commit crimes each person is criminally liable for anything done by the others One security guard testified that he was struck to the face with a metal object beaten on the ground and then forced to eat faeces from his own guard dog The dog had lost control of its bowels after a number of blows to the head from a baseball bat and was later euthanised Some of the victims described men repeatedly jumping on their body and legs One man said he was attacked with a meat cleaver baseball bat and sticks and had his trousers doused with petrol The men testified that they believed they were going to die and others described running for their life from the mob and jumping into a river to escape Judge Martina Baxter thanked the jury for the attention and time they had given to the case Please check your inbox to verify your details Now download the free app for all the latest Sunday World News, Crime, Irish Showbiz and Sport. Available on Apple and Android devices Powered by Bury Free Press, Suffolk Free Press, Newmarket Journal & Haverhill Echo Powered by Bury Free Press, Suffolk Free Press, Newmarket Journal and Haverhill Echo Home Bury St Edmunds News Article A butcher says he is hoping to bring his trade ‘into the 21st Century’ by going online Cijay Rissen launched his website for the Meat Market Brandon, Suffolk at the beginning of November to keep a pace with people’s shopping habits He says a number of events have persuaded him to make the move as fewer people use the high street has also taken his business in another direction He is now rearing his own livestock after taking on a flock four sheep “They became available after a friend said his family didn’t want them any more,” he said “We are expect a first heard of lambs in February and then long term I hope to have about 50 ewes in a field a rent “I have always made sure to use only quality local meat but I saw this an opportunity to raise my own happy flock with the animal’s welfare in mind I am also hoping to start breeding pigs as well The Meat Market Brandon was founded in 1965 Mr Rissen has now also invested in a new scales system which gives digitally itemised bills “It’s always been traditional for butchers to scribble orders over the counter on pieces of paper,” he said The Meat Market website now allows customers to also place their order online These are now available for delivery or collection Mr Rissen says his business has taken several blows since he took over the Meat Market in 2014 including the loss of a bus service and a high street bank plus the loss the the grocer’s shop have meant I have lost more than 100 customers a week “Shopping habits have changed and as an industry we just have to keep up with that,” said Mr Rissen “When I took over this business there used to be 10 butchers in Brandon and surrounding area; now there are two or three.” The shop’s website can be found at www.meatmarketbrandon.online Insbesondere im etwa 100.000 Einwohnerinnen und Einwohner zählenden Darna stieg die Zahl der gemeldeten Todesopfer am Dienstag stark In der Früh war noch von Hunderten geborgenen Leichen die Rede gewesen Und die Zahl der Vermissten in den betroffenen Gebieten ist enorm: „Wir bestätigen anhand unserer unabhängigen Informationen dass die Zahl der vermissten Personen bei etwa 10.000 liegt“ teilten die Internationalen Komitees vom Roten Kreuz und Roten Halbmond (IFRC) mit sagte der Luftfahrtminister der im Osten herrschenden Regierung wie sich ein breiter Strom mit voller Wucht durch das Stadtzentrum schlängelte nachdem zwei Dämme unweit der Stadt mit einem lauten Knall gebrochen waren Von den Wassermassen wurde alles mitgerissen: Menschen Sehenswürdigkeiten und Häuser sollen so ins Meer gespült worden sein Hani Schennib vom Nationalen Rat für Beziehungen zwischen den USA und Libyen gab gegenüber al-Jazeera an der zur völligen Zerstörung der Dämme in Darna geführt habe Das führte zu „einer plötzlichen Überflutung der Stadt in einem Ausmaß dass etwa vier Quadratkilometer des Stadtzentrums vollständig weggespült wurden“ Zwar lassen sich einzelne Extremereignisse nicht direkt auf eine bestimmte Ursache zurückführen klar ist laut Weltklimarat aber: Durch die Klimakrise werden Extremwetterereignisse wie Überschwemmungen Das heißt: Niederschläge und Stürme werden stärker dass 25 Prozent der Stadt verschwunden sind“ Leichen lagen aufgereiht auf der Straße vor einem überfüllten Krankenhaus und die Bewohnerinnen und Bewohner suchten unter den Leichentüchern wurde die zuvor von den Not- und Rettungsdiensten angegebene Zahl der Todesopfer in Darna bestätigt In einem Bezirk der Stadt seien bisher 1.700 Leichen geborgen worden In dem anderen der zwei Bezirke seien 500 Tote gefunden worden Auch ein Sprecher der örtlichen Notdienste berichtete von den schwierigen Bemühungen der Rettungskräfte aber die Durchfahrt ist schwierig und gefährlich da ein Teil der Straße zerstört ist und ein weiterer Einsturz aufgrund der riesigen Wassermengen erwartet wird.“ Man sei auf die Unterstützung von Hubschraubern angewiesen Strom und Internetverbindung seien unterbrochen „Daniel“ war bereits vergangene Woche mit extremem Starkregen über Griechenland Vor allem im griechischen Thessalien sorgte das Sturmtief für Überschwemmungen Bis Sonntag meldeten die griechischen Behörden 15 Todesopfer zwei Menschen wurden nach Angaben des Zivilschutzes noch vermisst In der Türkei und Bulgarien kamen laut den Behörden zwölf Menschen ums Leben Von Libyen aus bewegte sich „Daniel“ dann auf Ägypten zu Die international anerkannte Regierung in der Hauptstadt Tripolis unter Ministerpräsident Abdul Hamid Dbaiba sprach von den schwersten Regenfällen seit mehr als 40 Jahren Sturm „Daniel“ hatte Libyen am Sonntag erfasst Laut den Rettungsdiensten wurde vor allem der Nordosten getroffen al-Mardsch und Schahat wurden unter Wasser gesetzt In und um Schahat seien rund 20.000 Quadratkilometern überflutet wie der Bürgermeister der rund 43.000 Einwohnerinnen und Einwohner zählenden Stadt dpa-Angaben zufolge mitteilte Die Regierung in Tripolis kontrolliert die östlichen Gebiete nicht Mindestens ein Hilfsflug startete am Dienstag von der westlichen Stadt Misrata aus wie ein Reuters-Journalist an Bord des Flugzeugs berichtete Laut Dbaiba brachte das Flugzeug 14 Tonnen an Hilfsgütern Leichensäcken und 87 medizinische und paramedizinische Fachleute nach Bengasi man habe umgerechnet 412 Millionen US-Dollar für den Wiederaufbau in Darna und anderen Städten im Osten bereitgestellt Nach einem verheerenden Sturm und schweren Überschwemmungen im Nordosten Libyens sind in der besonders betroffenen Hafenstadt Darna Tausende Menschen Opfer der Naturkatastrophe geworden Am Dienstag kamen Flugzeuge mit humanitären Hilfs- und Rettungsteams aus Ägypten der Türkei und den Vereinigten Arabischen Emiraten in Bengasi an Auch der ägyptische Generalstabschef traf sich mit dem General Chalifa Haftar Mit der selbst ernannten Libyschen Nationalarmee (LNA) kontrolliert Haftar den Osten des Landes Auch die Europäische Union sicherte Unterstützung zu dass sie sich mit den UNO-Partnern und den libyschen Behörden darüber abstimmen wie sie die Hilfsmaßnahmen unterstützen können Angekündigt wurde finanzielle Unterstützung Frankreichs Präsident Emmanuel Macron sprach dem „libyschen Volk“ seine „Solidarität“ aus und erklärte sprach den Betroffenen sein „Mitgefühl und Beileid“ aus und erklärte Washington arbeite mit den Vereinten Nationen und den libyschen Behörden zusammen Deutschlands Kanzler Olaf Scholz nannte die Nachrichten aus Libyen „bestürzend“ Der britische Außenminister James Cleverly bot den Menschen in Libyen Unterstützung an die von der katastrophalen Überschwemmung im Osten Libyens betroffen sind“ Großbritannien stehe für Unterstützung parat „Wir sind in Kontakt mit libyschen Behörden und der UNO welche Unterstützung wir dem libyschen Volk in dieser tragischen Zeit bieten können.“ Die Bilder aus Libyen zeigen „ein unvorstellbares Ausmaß der Zerstörung durch eine schwere Naturkatastrophe“ so Bundespräsident Alexander Van der Bellen der via Twitter (X) den Angehörigen der Todesopfer und allen Menschen die von den verheerenden Überschwemmungen in dieser ohnehin krisengeschüttelten Region betroffen sind Am Montag wurde eine dreitägige Staatstrauer ausgerufen Die Katastrophe schien das Bürgerkriegsland zunächst zusammenzuschweißen In Libyen war nach dem Sturz von Langzeitmachthaber Muammar al-Gaddafi im Jahr 2011 ein Bürgerkrieg ausgebrochen In dem ölreichen Staat ringen bis heute zahlreiche Milizen um Einfluss Derzeit kämpfen zwei verfeindete Regierungen Der Konflikt wird durch ausländische Mächte zusätzlich befeuert red, ORF.at/Agenturen