You’ll find them in urban apartment buildings and rickety forest cottages; they’re part of trendy seaside hangouts There are more saunas in Finland than there are cars making it both a national pastime and a cultural imperative cocoon-like business class seats designed around the same principles of warmth and quietude and—of course—a sauna within their platinum lounge at Helsinki Airport I experienced all this firsthand on a small island in Helsinki, where one chilly afternoon I found myself sitting half-naked in a humid, cedar-paneled room with Anna Velten, who works at Finnish sauna and wellness consultancy Terhen rolling in waves from a pile of white-hot stones below the wooden floorboards the sauna has always been a sacred space where people have healed and cleansed both physically and spiritually,” Velten told me while pouring another ladle of water onto the rocks and each other—it can be a deeply spiritual experience.” Photo: Julia Kivelä / Courtesy of Helsinki PartnersThose words hit home when she started chanting a Finnish hymn passed down for generations as a way to summon the perfect löyly She explained that this löyly wasn’t just the hot steam prickling my lungs Velten’s water-pouring prowess also contributed: slow and steady “It should feel deeply warming and pleasant,” she said As the löyly roared and the heat pressed me down onto the wooden bench Velten brought out a bundle of leafy birch branches and gently whipped my back is said to stimulate blood circulation and cleanse the skin the woody scent of birch leaves filled the boiling air and just as I started to wonder if I might spontaneously combust the icy wind cut through my skin like a million needles I shuffled barefoot through mushy snow towards the rock-strewn Baltic coast The shock sucked the breath out of my lungs I existed in a place of pure ecstasy—the kind of sharp exhilarating clarity I had spent eons chasing through meditations and chi-chi wellness retreats can release more than 30 different feel-good hormones,” Velten said “It’s an escape from the hustle of everyday life and encourages people to be fully present in the moment I spent the following days chasing that high. At The Hotel Maria Helsinki’s latest luxury hotel taking over a courtyard-connected quartet of 19th-century office buildings With its marble-clad interiors and plant-draped atrium lounge the hotel’s cavernous spa was a far cry from the no-frills saunas I had seen so far but an hour of alternating between the sauna and Jacuzzi tub jolted the jet lag right out of me If my sauna sessions in Helsinki were all about ritual and refinement, the ones in Finnish Lapland offered something wilder. At Octola a hush-hush hideaway set deep in the Arctic woodlands of Rovaniemi the sauna was stripped back to its most elemental form: a log cabin (albeit a very luxurious one) in the snow miles away from passing cars and city lights Between dog-sledding tours around the estate’s endless pine forests and eye-opening meetings with the region’s indigenous Sámi people and their reindeer herds I’d nip out for a sweat session before cooling off in a knee-deep layer of powdery snow the sky still dark and painted with the faint green haze of the northern lights we drove to a lonely sauna cabin deep inside the estate save for a small hole surrounded by lit-up blocks of ice I stepped outside into a skin-searing minus 20 degrees Celsius it clicked: this wasn’t just about chasing temperature extremes and to the undeniable pull of something ethereal lingering far deeper a final sauna felt like the only proper farewell I shed my airport layers and let the heat seep into my skin I thought of Velten’s words from days earlier: “It’s a transition rite from work to leisure from the ordinary to the sacred.” And this time but a ritual I was finally beginning to understand make sure you drink enough water or herbal tea to stay hydrated and wear a towel or sauna hat over your head to protect yourself from the dizzying heat Cool off between sauna sessions by stepping outside for a mood-boosting cold plunge or dip in the snow don’t treat the sauna as just a quick sweat session embrace the silence (especially in public saunas and appreciate the deep-rooted connections it has to the Finnish way of life The Danish Home Lighting Trend That Can Improve Your Mental Health In America’s Cities, Saunas Are Becoming the Hottest Social Spot Millie Bobby Brown Shares Her Favorite Paella Recipe—and Details About Her Wedding to Jake Bongiovi A Day-by-Day Guide to Hiking the Legendary Nakasendo Trail in Japan Never miss a Vogue moment and get unlimited digital access for just $2 $1 per month Ike Baker Velten [formerly Ike Kligerman Barkley- SF Bay Area] is known for distinctive design rooted in tradition but modern in its sculptural forms Our architecture and interior staff work collectively or independently with outside partners and colleagues to produce personalized living environments as well as the occasional public building that receives the same level of intimate detailing Our San Francisco Bay Area-based office serves clients smoothly from coast to coast and beyond We realize our projects through traditional handicraft and cutting edge processes Structures are imagined and communicated through impressionistic sketches and digital renders and are designed using the latest technologies Enduring material integrity is a hallmark of our work See all... Lately, color drenching And it’s for good reason: The technique is enveloping The finished product looks just as good in a countryside cabin as a jewel-box city apartment that’s catching my eye that might just be the next color drenching or color blocking: color folding And here’s how she defines it: “Color folding is a more playful way to use color and an alternative to color blocking or drenching,” Velten says “I like to think of it as continuing panels of color in asymmetrical folds wrapping the room in different distortions of color choices.” and chocolate brown to bring color folding to life saturating larger walls in the lighter tones while the smaller walls are painted in the moodier shades Even the doors and molding get in on this technique as you’ll notice it’s never white but minty green and/or darker teal where bolder shades are used to create almost imposing monoliths of color these distinct color zones appear to “fold” into one another smoothly “It makes it feel softer and more kinetic than stark color blocking,” Velten says Velten has a few suggestions on how to get great results without any clunkiness “I tend to like softer colors with one or two darker accents on smaller walls,” she says “And continuing the trim or molding in some asymmetrical extensions as well.” She also thinks color folding is made for larger rooms Velten doesn’t think color drenching is going anywhere anytime soon “I think color folding is very nuanced — it can’t work everywhere without feeling a little chaotic,” Velten says “Color drenching is still a really serene technique for making a room feel held!” Read the commentsFiled in:Ideas & Inspiration The home you love starts here The home you love starts here Apartment TherapyThe wordmark for the Apartment Therapy brand.More From Us By subscribing, you acknowledge and agree to our Terms of Use and Privacy Policy. This website is using a security service to protect itself from online attacks The action you just performed triggered the security solution There are several actions that could trigger this block including submitting a certain word or phrase You can email the site owner to let them know you were blocked Please include what you were doing when this page came up and the Cloudflare Ray ID found at the bottom of this page Metrics details Cancer stem cells drive disease progression and relapse in many types of cancer a thorough characterization of these cells remains elusive and with it the ability to eradicate cancer at its source leukemic stem cells (LSCs) underlie mortality but are difficult to isolate due to their low abundance and high similarity to healthy hematopoietic stem cells (HSCs) and pre-leukemic stem cells can be identified and molecularly profiled by combining single-cell transcriptomics with lineage tracing using both nuclear and mitochondrial somatic variants While mutational status discriminates between healthy and cancerous cells gene expression distinguishes stem cells and progenitor cell populations Our approach enables the identification of LSC-specific gene expression programs and the characterization of differentiation blocks induced by leukemic mutations we demonstrate the power of single-cell multi-omic approaches in characterizing cancer stem cells CSCs constitute an important driver of relapse but their low division rates make them difficult to target therapeutically Tools that permit the confident identification and characterization of CSCs are therefore urgently needed Characterizing gene expression differences between HSCs pre-LSCs and LSCs would be a valuable step towards that goal Green line segments correspond to genes in the mitochondrial genome the application of these methods to characterize LSCs has not been demonstrated and in particular requires the ability to reliably detect clonal expansion events associate clinically relevant coding mutations to clones with high confidence and draw statements on gene expression changes between clones a workflow that amplifies nuclear mutations from cDNA a computational tool that achieves high-confidence clonal assignments and de novo discovery of clones using mitochondrial marker mutations when available MutaSeq data from four AML patients allows us to distinguish HSCs we identify transcriptomic consequences of leukemic and pre-leukemic mutations relevant to stem cells we characterize the contribution of different leukemic and pre-leukemic clones to healthy and disease-specific bone marrow populations with unprecedented detail our results demonstrate cancer stem cell identification and characterization by simultaneous mapping of genomic and mitochondrial mutations in single-cell transcriptomes While our data do not provide statistical evidence for an effect of target gene length or sequence complexity on dropout these results demonstrate that MutaSeq efficiently covers the mitochondrial genome in single-cell RNA-sequencing experiments and provides improved coverage of genomic target sites compared to Smart-seq2 it requires no changes to existing Smart-seq2 pipelines except for the addition of targeting primers during cDNA amplification g Volcano plot of the log10 expression change (Log FC) in n = 569 AP1-high CD34+ blasts vs plotted against corrected p-values from MAST using a model that accounts for differences in library quality and patient identity/batch (see the Methods section Single-cell gene expression data analysis) AP1-high CD34 + blasts were chosen for this comparison since AP1-low blasts appear to constitute an intermediate state between Healthy-like HSC/MPPs and AP1-high blasts h Log-normalized expression of FOS and JUN on the uMAP from panel a i Venn diagram displaying genes with significant overexpression in AP1-high CD34+ blasts and CD34− blasts compared to all other cells from the data set since mitochondrial genes are consistently highly expressed MutaSeq still permits a qualitative analysis using genomic mutations alone (see below) our approach allows for the identification of putatively leukemic and healthy clones and can assign cells to clones with high confidence if mitochondrial somatic variation is present These results suggest that this clonal expansion event is independent of the leukemia and associated with the acquisition of unrelated nuclear mutations We also take note of a putative non-leukemic clone in P1 marked by a single mitochondrial variant (5492T>C). With one exception, all cells carrying this variant are positive for the T-cell marker CD3 (Figs. 2b, 4a) this variant was likely acquired in a T-cell precursor or T-cell clone although we cannot formally exclude that it corresponds to a T-cell-specific RNA editing event these results demonstrate that our approach can identify and characterize clones de novo without prior knowledge of nuclear genomic mutations The mitoClone package implements all routines for clonal clustering and mutation calling Our results demonstrate that indeed these transcription factors appear to be relevant in all all four leukemia samples could be stratified into stem cells all patients retain cells highly similar to healthy HSCs leukemic cells had retained the ability to contribute to the erythroid lineage this activity was restricted to the pre-leukemic and non-leukemic clones and P3 were observed in a cell state that is highly reminiscent of healthy HSCs/MPPs on a molecular level and retains the ability to contribute to various lineages we investigated the molecular effects of distinct mutations in detail the consequences of specific leukemic mutations were commonly studied in mouse models MutaSeq data allows us to compare gene expression between clones differing only in a single mutation thereby elucidating the specific effects of that mutation on human hematopoiesis see figure source data for number of single cells underlying each group and see the Methods section Data Visualization these results demonstrate the ability of MutaSeq and mitoClone to delineate developmental and molecular effects of clonal evolution caused by leukemic and pre-leukemic mutations we have described a joint single-cell transcriptomics and clonal tracking approach (MutaSeq and mitoClone) for characterizing LSCs charting their differentiation capabilities and mapping the molecular consequences of oncogenic mutations While single-cell gene expression profiling permits the identification of cells with a stem-cell signature clonal tracking using genomic and mitochondrial mutations allows for a clean separation between healthy and cancerous clones We have demonstrated this approach in the context of acute myeloid leukemia and we propose that similar approaches may be applied to other types of cancers By applying our approach to bone marrow samples from four AML patients the LSC population in this patient might be rare among CD34+ cells Studies in larger cohorts will be required to assess how generally applicable these findings are This advance is owed to three crucial aspects of experimental design the use of mitochondrial variants enables the confident assignment of cells to clones a quantitative analysis of gene expression specific mitochondrial genetic markers for pre-leukemic and leukemic sub-clones allele frequencies of leukemic and pre-leukemic mutations were around 50% indicating dominance of a single leukemic clone sub-clonal genomic mutations were observed but not associated with mitochondrial variability this patient was only 18 years old and exhibited a leukemia possibly driven by a “catastrophic” triplication of chromosome 8 the buildup of mitochondrial variants accumulated during normal ageing as well as unknown factors affecting mitochondrial mutation rates might all contribute to the presence of mitochondrial marker mutations These capabilities expand the potential applications of our approach to the study of clonal dynamics during ageing and oncogenesis beyond the hematopoietic system Future work will focus on the inclusion of full-length coverage of the mitochondrial genome in droplet-based single-cell RNA-seq platforms The AML samples were collected from diagnostic bone marrow aspirations at the University hospitals in Heidelberg Germany after obtaining informed written consent Bone marrow mononuclear cells were isolated by density gradient centrifugation and stored in liquid nitrogen until further use All experiments involving human samples were conducted in compliance with the Declaration of Helsinki and all relevant ethical regulations and were approved by the ethics committees of the medical faculties Heidelberg and Heidelberg-Mannheim of the University of Heidelberg the Bioethics Internal Advisory Committee (BIAC) at EMBL and the CRG bioethics committee (CEIC-Parc de Salut Mar) the candidates for targeting were hand-selected from this list with a focus on cancer relevant genes K562 cells were purchased from ATCC (catalog number CCL-243) and cultivated in RPMI-1640 (Thermo 21875034) supplemented with 10% FBS and P/S the largest number of targets that efficiently avoids dimer formation was selected Nextera adapters were added to all primers designed accordingly (fwd: GTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG Bone Marrow mononuclear cells from patient P1 were stained and Lin- or Lin-CD34 + single cells were index-sorted into ultra-low attachment 96-well plates (Corning) containing 100 µL StemSpan SFEM media (Stem Cell Technologies) Media was supplemented with penicillin/streptomycin (100 ng/mL) l-glutamine (100 ng/mL) and the following human cytokines (all from Peprotech): SCF (20 ng/mL) and processed as detailed in the following One microliter was then transferred into a PCR with Nextera indexing primers (Supplementary Data 4) and amplified with 98 °C 3 min The following set of routines are implemented in the mitoClone package available form https://github.com/veltenlab/mitoClone and documented further in the package vignettes the result from this step is simply a list of genomic sites that are likely to display genetic variability across single cells The vignette “Variant calling and blacklist creation of the mitoClone package” provides further recommendation for the choice of filtering parameters PhISCS provides a maximum likelihood phylogenetic tree not all intermediate evolutionary steps are represented by cells present in the biological sample (for example there are few or no cells displaying the SRSF2 mutation the order of the nodes in the maximum likelihood tree is to some extent arbitrary and driven by noise; even if there is some statistical support for a specific order it may be attractive in practice to merge mutations into clones so as to obtain a biologically meaningful We therefore implemented the clusterMetaclones function The maximum likelihood tree is split into contiguous linear branches (e.g. mt:7527DEL and nuc:EAPP constitute one such branch) all nodes are then swapped with each other and the likelihood of the data given the altered structure is calculated using the PhISCS model: Mcg indicates whether according to the model α is the allelic dropout rate and β is the false-positive rate The branch is then split into clones such that within each clone the average difference in log-likelihood incurred by swapping nodes was smaller than 1 per cell This threshold is set arbitrarily to obtain a practically useful grouping of mutations into clones The vignette “Computation of clonal hierarchies and clustering of mutations” of the mitoClone package provides further practical recommendations The same model was used to compute the likelihood of clonal assignments for each cell. For the analysis in Supplementary Fig. 3b this estimate was then transformed to bits of information using the Kullback–Leibler distance: For all quantitative analyses of clones (differential expression testing constribution of clones to cell types) cells with a likelihood of clonal assignment of <0.8 were removed Allele count tables were created for each site as described above a beta-binomial model with the same probability for mutant in all cells was compared to a beta-binomial model with a different probabilities for mutant in each clone using Akaike’s Information Criterion Differential expression testing was performed using MAST65 using a linear model containing the variable of interest (e.g. additional covariates accounting for patient and cell type For the display of gene expression values only data were normalized according to the Seurat defaults (i.e. divided by the total count of RNA in the cell multiplied by a scale factor of 10,000 and log-transformation) Statistical analyses were performed using R 3.6.2 Statistical details for each experiment are provided in the figure legends FlowJo v10 TreeStar was used for the analysis of flow cytometry data Further information on research design is available in the Nature Research Reporting Summary linked to this article Tumour heterogeneity and cancer cell plasticity Identification of pre-leukaemic haematopoietic stem cells in acute leukaemia Leukaemia ‘firsts’ in cancer research and treatment Age-related clonal hematopoiesis associated with adverse outcomes Clonal hematopoiesis and blood-cancer risk inferred from blood DNA sequence Clonal hematopoiesis and evolution to hematopoietic malignancies Mechanisms of disease: cancer stem cells–targeting the evil twin Targeting leukemic stem cells by breaking their dormancy Therapeutic targeting of acute myeloid leukemia stem cells CD96 is a leukemic stem cell-specific marker in human acute myeloid leukemia Dysregulated gene expression networks in human acute myelogenous leukemia stem cells CD47 is an adverse prognostic factor and therapeutic antibody target on human acute myeloid leukemia stem cells Prospective separation of normal and leukemic stem cells based on differential expression of TIM3 a human acute myeloid leukemia stem cell marker Stem cell gene expression programs influence clinical outcome in human leukemia A 17-gene stemness score for rapid determination of risk in acute leukaemia GPR56 identifies primary human acute myeloid leukemia cells with high repopulating potential in vivo BCAT1 restricts αKG levels in AML stem cells leading to IDHmut-like DNA hypermethylation with and without candidate driver mutations Genomic classification and prognosis in acute myeloid leukemia Human haematopoietic stem cell lineage commitment is a continuous process Transcriptional heterogeneity and lineage commitment in myeloid progenitors Population snapshots predict early haematopoietic and erythroid hierarchies Single-cell transcriptomics uncovers distinct molecular signatures of stem cells in chronic myeloid leukemia Developmental and oncogenic programs in H3K27M gliomas dissected by single-cell RNA-seq Single-cell RNA-seq reveals AML hierarchies relevant to disease progression and immunity Somatic mutations and cell identity linked by genotyping of transcriptomes A general approach for detecting expressed mutations in AML cells using single cell RNA-sequencing G&T-seq: parallel sequencing of single-cell genomes and transcriptomes Unravelling intratumoral heterogeneity through high-sensitivity single-cell mutational analysis and parallel RNA sequencing Integrated genome and transcriptome sequencing of the same cell Lineage tracing in humans enabled by mitochondrial mutations and single-cell genomics Single-cell lineage tracing by endogenous mutations enriched in transposase accessible mitochondrial DNA Identifying genes whose mutant transcripts cause dominant disease traits by potential gain-of-function alleles PhISCS: a combinatorial approach for subperfect tumor phylogeny reconstruction via integrative use of single-cell and bulk sequencing data COSMIC: the catalogue of somatic mutations in cancer Subtype-specific regulatory network rewiring in acute myeloid leukemia Tracing the origins of relapse in acute myeloid leukaemia to stem cells DNA methylation disruption reshapes the hematopoietic differentiation landscape MLLT3 regulates early human erythroid and megakaryocytic cell fate Therapeutic targeting of preleukemia cells in a mouse model of NPM1 mutant acute myeloid leukemia Mutant NPM1 maintains the leukemic state through HOX expression Mutant nucleophosmin and cooperating pathways drive leukemia initiation and progression in mice Massively parallel single-cell chromatin landscapes of human immune cell development and intratumoral T cell exhaustion TSGene 2.0: an updated literature-based knowledgebase for tumor suppressor genes Lareau, C. A. et al. Massively parallel single-cell mitochondrial DNA genotyping and chromatin profiling. Nat. Biotechnol. https://doi.org/10.1038/s41587-020-0645-6 (2020) Rapid large-scale expansion of functional mesenchymal stem cells from unmanipulated bone marrow without animal serum Li, H. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. Preprint at arXiv https://arxiv.org/abs/1303.3997 (2013) Sensitive detection of somatic point mutations in impure and heterogeneous cancer samples ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data A fast algorithm for the maximum clique problem Smart-seq2 for sensitive full-length transcriptome profiling in single cells Full-length RNA-seq from single cells using Smart-seq2 Large-scale low-cost NGS library preparation using a robust Tn5 purification and tagmentation protocol Reliable detection of subclonal single-nucleotide variants in tumour cell populations A global reference for human genetic variation Efficient integration of heterogeneous single-cell transcriptomes using Scanorama Comprehensive integration of single-cell data Dimensionality reduction for visualizing single-cell data using UMAP McInnes, L., Healy, J. & Melville, J. UMAP: uniform manifold approximation and projection for dimension reduction. Preprint at arXiv https://arxiv.org/abs/1802.03426 (2018) Batch effects in single-cell RNA-sequencing data are corrected by matching mutual nearest neighbors MAST: a flexible statistical framework for assessing transcriptional changes and characterizing heterogeneity in single-cell RNA sequencing data ggplot2: Elegant Graphics for Data Analysis (Springer Velten, L., Story, B. A. & Steinmetz, L. M. Dataset for the manuscript “Identification of leukemic and pre-leukemic stem cells by clonal tracking from single-cell transcriptomics”. figshare https://doi.org/10.6084/m9.figshare.12382685.v1 (2021) Velten, L., Story, B. A. & Steinmetz, L. M. PrimerDesign package v1.0. https://doi.org/10.5281/zenodo.4443088 (2021) Velten, L., Story, B. A. & Steinmetz, L. M. mitoClone package v1.0. https://doi.org/10.5281/zenodo.4443074 (2021) Download references We thank Niko Beerenwinkel for discussions and Andreas Gschwind for contributing code for primer design We thank the members of the Steinmetz and Haas labs for discussions and support and we thank the EMBL and DKFZ Genomics core facilities and the EMBL flow cytometry core facility for technical support This project was financially supported by the Deutsche José Carreras Leukämie Stiftung grant DJCLS 20R/2017 (to L.V. the Emerson foundation grant 643577 (to L.V and L.M.S.) and the German Bundesministerium für Bildung und Forschung (BMBF) through the Juniorverbund in der Systemmedizin “LeukoSyStem” (FKZ 01ZX1911D to L.V. were further supported by Emmy Noether Fellowship RA 3166/1-1 (DFG) were supported by a Max-Eder Grant (German Cancer Aid 70111531) were supported by the Gutermuth Foundation is an endowed professor of the Deutsche José Carreras Leukämie Stiftung (DJCLS H 03/01) These authors contributed equally: Lars Velten The Barcelona Institute of Science and Technology European Molecular Biology Laboratory (EMBL) Swiss Federal Institute of Technology (ETH) Zurich Department of Biosystems Science and Engineering Heidelberg Institute for Stem Cell Technology and Experimental Medicine (HI-STEM gGmbH) Deutsches Krebsforschungszentrum (DKFZ) and DKFZ-ZMBH Alliance Molecular Medicine Partnership Unit (MMPU) University of Heidelberg and European Molecular Biology Laboratory (EMBL) Berlin Institute for Medical Systems Biology Max Delbrück Center for Molecular Medicine in the Helmholtz Association developed MutaSeq and performed single-cell RNA-seq experiments with assistance by J.M. developed mitoClone and analyzed the data with contributions from R.F wrote the manuscript with contributions from P.H.M. collected samples and performed initial sample characterization All authors have read and commented on the manuscript is co-founder of Sophia Genetics and Levitas Bio and consultant for several companies on genetic analysis All other authors declare no competing interests Peer review information Nature Communications thanks the anonymous reviewer(s) for their contribution to the peer review of this work Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations Download citation DOI: https://doi.org/10.1038/s41467-021-21650-1 Anyone you share the following link with will be able to read this content: a shareable link is not currently available for this article Sign up for the Nature Briefing: Cancer newsletter — what matters in cancer research We have the address for the funeral home & the family on file If you're not happy with your card we'll send a replacement or refund your money Charles Joseph Velten, age 89, of Pierce City, MO died on Friday, April 1, 2016, at his home near Pierce City, MO. Mr. Velten was born in St Louis, MO on Monday, March 21, 1927. He was the son of A.J. and Rose (Kuklenski) Velten. Mr. Velten... View Obituary & Service Information The family of Charles Joseph Velten created this Life Tributes page to make it easy to share your memories Send comfort and support when it's needed most Sign up for our daily email affirmations by entering your information below Metrics details Factor analysis is a widely used method for dimensionality reduction in genome biology with applications from personalized health to single-cell biology Existing factor analysis models assume independence of the observed samples an assumption that fails in spatio-temporal profiling studies a flexible and versatile toolbox for modeling high-dimensional data when spatial or temporal dependencies between the samples are known MEFISTO maintains the established benefits of factor analysis for multimodal data but enables the performance of spatio-temporally informed dimensionality reduction and separation of smooth from non-smooth patterns of variation MEFISTO can integrate multiple related datasets by simultaneously identifying and aligning the underlying patterns of variation in a data-driven manner we apply the model to different datasets with spatial or temporal resolution including an evolutionary atlas of organ development a single-cell multi-omics atlas of mouse gastrulation and spatially resolved transcriptomics Such designs and datasets pose new analytical challenges and opportunities including the need to account for spatio-temporal dependencies across samples that are no longer invariant to permutations; deal with imperfect alignment between samples from different data modalities and missing data; identify inter-individual heterogeneities of the underlying temporal and/or spatial functional modules; and distinguish spatio-temporal variation from non-smooth patterns of variations spatio-temporally informed dimensionality reduction could enable more accurate and interpretable recovery of the underlying patterns by leveraging known spatio-temporal dependencies rather than by solely relying on feature correlations a flexible and versatile method for addressing these challenges while maintaining the benefits of previous factor analysis models for multimodal data MEFISTO takes as input a dataset that contains measurements from one or more feature sets (for example as well as one or multiple sets of samples (for example In addition to these high-dimensional data each sample is further characterized by a continuous covariate such as a one-dimensional temporal or two-dimensional spatial coordinate MEFISTO factorizes the input data into latent factors thereby recovering a joint embedding of the samples in a low-dimensional latent space the model yields a sparse linear and therefore interpretable mapping between the latent factors and the observed features in terms of view-specific weights Formulated within a probabilistic framework MEFISTO naturally accounts for missing values for arbitrary combinations of views and thereby provides a correspondence between time points across sample groups including imputation as well as interpolation and extrapolation along the spatio-temporal axis It also allows for identification of molecular signatures that underlie the latent factors as well as clustering and outlier identification at the level of samples (for example an individual with distinct temporal trajectories) Illustration of the input data covering gene expression measurements for 7,696 orthologous genes from five species (groups) and five organs (views) across 14–23 developmental stages Correspondences of stages between species are not given and are learnt by the model Percentage of variance (var.) explained by MEFISTO in the gene expression data for each species and organ The barplot (top) shows the percentage of variance explained by all of the factors and the heatmap (bottom) shows the values for individual factors Scatterplot showing the embedding of the samples given by the first two factors Samples are colored by the inferred common developmental time Learnt factor values as a function of the inferred developmental time Points correspond to individual factor values and the lines and shaded zones correspond to the mean and variance of the underlying latent process that generates the factor values The bars at the top indicate the estimated smoothness along development and the sharedness across species of the factor Learnt correlation structure across species for each latent factor in d a computational framework that opens up the application of multimodal factor analysis to temporal or spatially resolved datasets We found that the ability to explicitly account for spatial or temporal dependencies is especially helpful in datasets with a larger number of missing values or when high-dimensional measurements are sampled irregularly across different sample groups or views MEFISTO adds substantial value in cases in which extra- or interpolation of temporal or spatial trajectories is required and/or when the temporal covariate and the associated measures are imperfectly aligned across datasets We focused on applications of MEFISTO to temporal and longitudinal studies These studies are rapidly gaining relevance both in basic biology and biomedicine the model is also readily applicable to two-dimensional covariates as illustrated in the application to multimodal single-cell data and the application to Visium gene expression arrays Future developments could focus on extensions to enable spatial alignment across datasets as well as the deployment of specific noise models directly account for over-dispersion in sequencing data without the need for preprocessing or help to distinguish biological and technical zeros in the measurements by incorporating an explicit model of zero-inflation although MEFISTO is based on a probabilistic factor analysis framework the concept of explicitly modeling spatial and temporal covariates could also be incorporated into other classes of latent variable models which has been successfully applied to recover additive non-negative signatures which are increasingly used to infer a non-linear decomposition of the data other side-information could be considered to inform the factorization including clinical markers or known dependencies between molecular features and additionally provides alignment functionalities and an explicit model of intergroup heterogeneity As input MEFISTO expects a collection of matrices where each matrix ${\bf{Y}}^{m,g}$ corresponds to a group g =1,…,G and view m =1,…,M with Ng samples in rows and Dm features in columns Each sample is further characterized by a covariate $\bf{C}^g \in {\Bbb R}^{C \times N_g}$ that represents the model additionally accounts for the covariate ${\bf{C}}^g$ Each factor value $z_{nk}^g$ is modeled as a realization of a Gaussian process where the covariance function κk models the relationship between groups as well as along the covariate The first term in this covariance function captures the covariance of the discrete sample groups g while the second term describes the covariance along values of the covariate which provide a continuous characterization of each sample We choose a low-rank covariance function for 𝜅G and a squared exponential covariance function for 𝜅C the hyperparameters of the model give insights into the smoothness of a factor (sk between 0 (non-smooth) and 1 (smooth)) and the group relationships specific to a latent factor (${\bf{K}}^G$) that can be used to cluster the groups or identify outliers An overall sharedness score per factor is calculated by the mean absolute distance to the identity covariance matrix in the off-diagonal elements and the parameters were optimized using Adam optimizer Feature values at missing time points were predicted from the resulting posterior Data were simulated as above with only the two smooth factors (given that univariate Gaussian processes are restricted to modeling temporal patterns in the data) as well as a single group and 100 features per view gene expression data in 2–20 randomly selected species–time combinations (out of a total of 82) were masked in three four or all organs and the model was retrained on these data as described above The experiment was repeated ten times and the mean squared error was calculated on all masked values For the comparison with univariate Gaussian processes we restricted the experiment to 1,000 randomly selected genes of mouse brain and masked a varying fraction of these features at randomly sampled time points (out of 14) factor stability was evaluated using the Pearson correlation of the factors on the masked data to the corresponding factor on the full data To compare the factor weights of MEFISTO to associations with known covariates we trained a linear mixed-effect (LME) model for each sOTU with time point and the covariate of interest as fixed effects and infant as the random effect We subsequently extracted the LME model coefficient as effect size estimates and compared them to the factor weights of MEFISTO and markers annotated for mouse brain were used for the enrichment analysis Further information on research design is available in the Nature Research Reporting Summary linked to this article Using probabilistic estimation of expression residuals (PEER) to obtain increased power and interpretability of gene expression analyses SomaticSignatures: inferring mutational signatures from single-nucleotide variants Deciphering signatures of mutational processes operative in human cancer with applications to sparse principal components and canonical correlation analysis Tensor decomposition for multiple-tissue gene expression experiments A multivariate approach to the integration of multi-omics datasets Multi‐omics factor analysis: a framework for unsupervised integration of multi‐omics data sets MOFA+: a statistical framework for comprehensive integration of multi-modal single-cell data Metagenes and molecular pattern discovery using matrix factorization Gene expression across mammalian organ development A longitudinal big data approach for precision health Visualization and analysis of gene expression in tissue sections by spatial transcriptomics Gaussian Processes for Machine Learning (University Press Group Limited SpatialDE: identification of spatially variable genes Statistical analysis of spatial expression patterns for spatially resolved transcriptomic studies Modeling cell–cell interactions from spatial molecular data with spatial variance component analysis Temporal probabilistic modeling of bacterial compositions derived from 16S rRNA sequencing Hierarchical Bayesian modelling of gene expression time series across irregularly sampled replicates and clusters Computing and visualizing dynamic time warping alignments in R: the dtw package In UAI ’13: Proceedings of the Twenty-Ninth Conference on Uncertainty in Artificial Intelligence (eds Nicholson P.) 282–290 (Association for Computing Machinery It is all in the noise: efficient multi-task Gaussian process inference with structured residuals In NIPS ’13: Proceedings of the 26th International Conference on Neural Information Processing Systems (eds Burges et al.) 1466–1474 (Association for Computing Machinery Insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1) in cancer Organogenesis relies on SoxC transcription factors for the survival of neural and mesenchymal progenitors Delayed parturition and altered myometrial progesterone receptor isoform A expression in mice null for Krüppel-like factor 9 Developmental expression of glial fibrillary acidic protein mRNA in the rat brain analyzed by in situ hybridization Evolution of the human cold/menthol receptor PanglaoDB: a web server for exploration of mouse and human single-cell RNA sequencing data What is the evolutionary fingerprint in neutrophil granulocytes? and diet shape microbiome maturation during early life Context-aware dimensionality reduction deconvolutes gut microbial community dynamics Natural history of the infant gut microbiome and impact of antibiotic treatment on bacterial strain diversity and stability Multi-omics profiling of mouse gastrulation at single-cell resolution scNMT-seq enables joint profiling of chromatin accessibility DNA methylation and transcription in single cells McInnes, L., Healy, J. & Melville, J. UMAP: uniform manifold approximation and projection for dimension reduction. Preprint at https://arxiv.org/abs/1802.03426v1 (2018) The accessible chromatin landscape of the human genome Computational assignment of cell-cycle stage from single-cell transcriptome data Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles A linear mixed model spline framework for analysing time course ‘omics’ data Functional Data Analysis (Springer Science & Business Media Gaussian-process factor analysis for low-dimensional single-trial analysis of neural population activity In NIPS ’08: Proceedings of the 21st International Conference on Neural Information Processing Systems (eds Koller Variational Gaussian-process factor analysis for modeling spatio-temporal data In NIPS ’09: Proceedings of the 22nd International Conference on Neural Information Processing Systems (eds Bengio Temporal alignment and latent Gaussian process factor inference in population spike trains In NIPS ’18: Proceedings of the 32nd International Conference on Neural Information Processing Systems (eds et al.) 10466–10476 (Association for Computing Machinery Gaussian process prior variational autoencoders In NIPS ’18: Proceedings of the 32nd International Conference on Neural Information Processing Systems (eds Bengio et al.) 10390–10401 (Association for Computing Machinery GP-VAE: deep probabilistic time series imputation Proceedings of Machine Learning Research 108 Qiu, L., Chinchilli, V. M. & Lin, L. Deep latent variable model for learning longitudinal multi-view data.; Preprint at https://arxiv.org/abs/2005.05210v2 (2020) Äijö, T. et al. Splotch: robust estimation of aligned spatial temporal gene expression data. Preprint at bioRxiv https://doi.org/10.1101/757096 (2019) Computationally efficient convolved multiple output Gaussian processes Fast nonparametric clustering of structured time-series Clustering gene expression time series data using an infinite Gaussian process mixture model GPyTorch: blackbox matrix–matrix Gaussian process inference with GPU acceleration et al.) 7587–7597 (Association for Computing Machinery Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 Interactive Tree Of Life (iTOL) v5: an online tool for phylogenetic tree display and annotation JASPAR 2020: update of the open-access database of transcription factor binding profiles Argelaguet, R., Arnol, D., Bredikhin, D. & Velten, B. MOFA2. Bioconductor https://doi.org/10.18129/B9.bioc.MOFA2 Bredikhin, D., Kats, I. & Stegle, O. Muon: multimodal omics analysis framework. Preprint at bioRxiv https://doi.org/10.1101/2021.06.01.445670 (2021) Download references Cardoso-Moreira for feedback on the evo-devo application and I Kats for helpful comments on the implementation was funded by the BMBF (COMPLS project MOFA no was supported by the Darwin Trust fellowship was supported by funding from EMBL and the BMBF (COMPLS project no The Stegle research group was further supported by core funding from EMBL the German Cancer Research Center and the European Commission (ERC project DECODE Open access funding was provided by the German Cancer Research Center (DKFZ) Division of Computational Genomics and Systems Genetics European Bioinformatics Institute (EMBL-EBI) Collaboration for joint PhD degree between EMBL and Heidelberg University analyzed the data and generated the figures wrote the paper with input from all of the authors The authors declare no competing interests Peer review information Nature Methods thanks Georg Gerber and the other reviewers for their contribution to the peer review of this work Lin Tang was the primary editor on this article and managed its editorial process and peer review in collaboration with the rest of the editorial team b) Assessing the inference of factor smoothness (a) and sharedness (b as defined based on the covariance of a factor across groups Methods) on simulated data for varying simulation parameters (panels Solid lines and dots show the average scores inferred by MEFISTO intervals indicate the standard error of the mean across ten independent trials and dashed lines the values used in the simulation per factor (colors) (c,d) Comparison of interpolation performance to univariate Gaussian processes in terms of mean squared error of imputation (c) and memory and time requirements (d) for varying simulation parameters (panels intervals indicate standard error of the mean across ten independent trials Factor values as a function of time before (a) and after (b) alignment (a) shows the factor values (y-axis) against the developmental stages without alignment across species (x-axis) (b) shows the factor values (y-axis) against the developmental stages with alignment across species (x-axis) (c,d,e) show a latent embedding given by the factor values for each species- time point combination for Factor 1 (x-axis) and Factor 2 (y-axis) colored by unaligned times (c) (a) Gene sets at a false discovery rate of 5% that are enriched in the weights of Factor 1 in at least 4 organs Dots are colored by organ and indicate the significance of a gene set (x-axis) based on a parametric t-test with multiple testing correction using Benjamini-Hochberg procedure as implemented in MOFA2 Gray bars indicate the number of organs with significant enrichment (b) Top 10 genes (y-axis) with highest absolute mean weight across organs Dots indicate the absolute weight per organ (colors) Symbols on the right indicate the sign of the weights (c) Gene expression along the inferred developmental time in all organs (columns) for the top 3 genes of panel (b) (a) Genes with highest absolute weight (x-axis) for the three organs with highest variance explained by Factor 1 Symbols on the right in each panel indicate the sign of the weight (b) Gene expression trajectories along the inferred developmental time for the top 3 genes of the corresponding panel in (a) (a) Genes with highest absolute weight (x-axis) for the three organs with highest variance explained by Factor 2 (a) Genes with highest absolute weight (x-axis) in Testis on Factor 3 Symbols on the right indicate the sign of the weight (b) Gene expression trajectories along the inferred developmental time for the top 3 genes in (a) (c) Top ten enriched gene set of the Molecular Signatures Database (MSigDB) in the weights of Factor 3 Colors indicate the negative logarithm of the adjusted p-values (per organ and factor) based on a parametric t-test with multiple testing correction using Benjamini-Hochberg procedure as implemented in MOFA2 Shown are violin plots of the weights (n = 7,696) in the model for each organ (panels) separated by whether they have previously been identified as having changed developmental trajectories for human compared to rodents or rabbit (x-axis) the largest and smallest value within the 1.5 interquartile ranges from the hinges (end of whiskers) and outliers (dots) Shown are violin plots of the weights (n = 7,696) in the model for each organ (panels) separated by whether they have previously been identified as having changed developmental trajectories for opossum compared to the other mammals (x-axis) The x- and y-axis denote the spatial coordinates the colors indicate the inferred factor values Bars below show the inferred smoothness scores for each factor (b) Genes with highest absolute weight for the corresponding factor in (a) Symbols on the right of each panel indicate the sign of the weight (c) Normalized gene expression values (colors) across space for the gene with the highest absolute weight on the corresponding factor in (a) Download citation DOI: https://doi.org/10.1038/s41592-021-01343-9 Sorry, a shareable link is not currently available for this article. Sign up for the Nature Briefing: Microbiology newsletter — what matters in microbiology research, free to your inbox weekly. Patricia A VeltenBirth date: May 15 Metrics details The recovery of objects obscured by scattering is an important goal in imaging and has been approached by exploiting ballistic photons or penetrating wavelengths Common methods use scattered light transmitted through an occluding material although these fail if the occluder is opaque Light is scattered not only by transmission through objects but also by multiple reflection from diffuse surfaces in a scene This reflected light contains information about the scene that becomes mixed by the diffuse reflections before reaching the image sensor This mixing is difficult to decode using traditional cameras Here we report the combination of a time-of-flight technique and computational reconstruction algorithms to untangle image information mixed by diffuse reflection We demonstrate a three-dimensional range camera able to look around a corner using diffusely reflected light that achieves sub-millimetre depth precision and centimetre lateral precision over 40 cm×40 cm×40 cm of hidden space The light detected on an image sensor is composed of direct light that travels directly from the light source to an object in the line of sight of the sensor and indirect light that interacts with other parts of the scene before striking an object in the line of sight Light from objects outside the line of sight reaches the sensor as indirect light it is difficult to exploit this non-line-of-sight light exploit the coherence of light to determine the time of flight light that has undergone multiple diffuse reflections has diminished coherence We demonstrate an incoherent ultrafast imaging technique to recover three-dimensional (3D) shapes of non-line-of-sight objects using this diffusely reflected light We illuminate the scene with a short pulse and use the time of flight of returning light as a means to analyse direct and scattered light from the scene We show that the extra temporal dimension of the observations under very high temporal sampling rates makes the hidden 3D structure observable With a single or a few isolated hidden patches pulses recorded after reflections are distinct and can be easily used to find 3D positions of the hidden patches the reflected pulses may overlap in both space and time when they arrive at the detector The loss of correspondence between 3D scene points and their contributions to the detected pulse stream is the main technical challenge We present a computational algorithm based on backprojection to invert this process We introduce the new problem of recovering the 3D structure of a hidden object and we show that the 3D information is retained in the temporal dimension after multi-bounce interactions between visible and occluded parts We also present an experimental realization of the ability to recover the 3D structure of a hidden object thereby demonstrating a 3D range camera able to look around a corner The ability to record 3D shapes beyond the line of sight can potentially be applied in industrial inspection in situations where direct imaging of a scene is impossible The calibration spot in a streak image (highlighted with an arrow) The calibration spot is created by an attenuated beam split off the laser beam that strikes the wall in the field of view of the camera It allows monitoring of the long-term stability of the system and calibration for drifts in timing synchronization The 3D geometry of the occluded target is thus encoded in the streak images acquired by the camera and decoded using our reconstruction algorithm The recorded streak images lack correspondence information we do not know which pulses received by the camera came from which surface point on the target object a straightforward triangulation or trilateration to determine the hidden geometry is not possible An illustrative example of geometric reconstruction using streak camera images The object to be recovered consists of a 2 cm×2 cm size square white patch beyond the line of sight (that is The patch is mounted in the scene and data is collected for different laser positions The captured streak images corresponding to three different laser positions are displayed in the top row Shapes and timings of the recorded response vary with laser positions and encode the position and shape of the hidden patch (b) Contributing voxels in Cartesian space consider the choices of contributing locations The possible locations in Cartesian space that could have contributed intensity to the streak image pixels p these three ellipse sections are also shown in (a) bottom left in Cartesian coordinates If there is a single world point contributing intensity to all 3 pixels The white bar corresponds to 2 cm in all sub-figures We use a backprojection algorithm that finds overlayed ellipses corresponding to all pixels Here we show summation of elliptical curves from all pixels in the first streak image (d) Backprojection using all pixels in a set of 59 streak images the patch location and 2-cm lateral size are recovered The individual ellipses from each of the three pixels p the intersection of three ellipses uniquely determines the location of the hidden surface patch that contributed intensity to the three camera pixels we do not know whether or not light detected at two pixels came from the same 3D surface point We call the resulting 3D scalar function on voxels a heatmap Because values at the voxels in the heatmap are the result of summing a large number of streak image pixels the heatmap contains low noise and the noise amplification associated with a second-derivative filter is acceptable The first step of our imaging algorithm is data acquisition. We sequentially illuminate a single spot on the diffuser wall with a pulsed laser and record an image of the line segment of the wall with a streak camera. Then, we estimate an oriented bounding box for the working volume to set up a voxel grid in Cartesian space (see Methods) we record the summation of weighted intensities of all streak image pixels that could potentially have received contributions of this voxel based on the time of flight We store the resulting 3D heatmap of voxels The backprojection is followed by filtering We compute a second derivative of the heatmap along the direction of the voxel grid facing away from the wall we compute a confidence value for each voxel by computing local contrast with respect to the voxel neighbourhood in the filtered heatmap we divide each voxel heatmap value by the maximum in the local neighbourhood we apply a soft threshold on the voxel confidence value We estimate the oriented bounding box of the object in the second step by running the above algorithm at low spatial target resolution and with down-sampled input data. Details of the reconstruction process and the algorithm can be found in the Methods as well as in the Supplementary Methods Demonstration of the depth and lateral resolution (a) The hidden objects to be recovered are three letters The 'I' is 1.5 cm wide and all letters are 8.2 cm high (b) 9 of 60 images collected by the streak camera (c) Projection of the heatmap created by the back projection algorithm (d) Filtering after computing second derivative along depth (z) The colour in these images represents the confidence of finding an object at the pixel position (e) A rendering of the reconstructed 3D shape Depth is colour coded and semi-transparent planes are inserted to indicate the ground truth The depth axis is scaled to aid visualization of the depth resolution The reconstruction is affected by several factors such as calibration The sources of calibration errors are lens distortions on the streak camera that lead to a warping of the collected streak image measurement inaccuracies in the visible geometry and measurement inaccuracies of the centre of projection of the camera and the origin of the laser the impact of static calibration errors would be reduced The sensor introduces intensity noise and timing uncertainty The reconstruction of 3D shapes is more dependent on the accuracy of the time of arrival than the signal-to-noise ratio (SNR) in received intensity Improving the SNR is desirable because it yields faster capture times the SNR could be significantly improved by using an amplified laser with more energetic pulses and a repetition rate in the kilohertz range and a triggered camera but fewer measurements for light collection could significantly reduce signal independent noise such as background and shot noise the signal strength drops dramatically (∝1/(r2r3)2) and the size of the hidden scene is therefore limited A configuration where laser and camera are very far from the rest of the scene is A loss in received energy can be reduced in two ways The laser beam can be kept collimated over relatively long distances and the aperture size of the camera can be increased to counterbalance a larger distance between camera and diffuser wall translation along the direction perpendicular to the diffuser wall can be resolved with a resolution of 400 μm—better than the full width half maximum time resolution of the imaging system Lateral resolution in a plane parallel to the wall is lower and is limited to 0.5–1 cm depending on proximity to the wall This paper's goals are twofold: to introduce the new challenging problem of recovering the 3D shape of a hidden object and to demonstrate the results using a novel co-design of an electro-optic hardware platform and a reconstruction algorithm Designing and implementing a prototype for a specific application will provide further more specific data about the performance of our approach in real-world scenarios We have demonstrated the 3D imaging of a nontrivial hidden 3D geometry from scattered light in free space We compensate for the loss of information in the spatial light distribution caused by the scattering process by capturing ultrafast time-of-flight information Our reconstruction method assumes that light is only reflected once by a discrete surface on the hidden object without inter-reflections within the object and without subsurface scattering We further assume that light travels in a straight line between reflections Light that does not follow these assumptions will appear as time-delayed background in our heatmap and will complicate A promising theoretical direction is in inference and inversion techniques that exploit scene priors Adaptive sampling can decide the next-best laser direction based on a current estimate of the 3D shape Further analysis will include coded sampling using compressive techniques and noise models for SNR and effective bandwidth Our current demonstration assumes friendly reflectance and planarity of the diffuse wall Our treatment of scattering is different but could be combined with many of these approaches new sensors and nonlinear optics should provide practical and more sensitive imaging devices new techniques should allow us to recover reflectance refraction and scattering properties and achieve wavelength-resolved spectroscopy beyond the line of sight The formulation could also be extended to shorter wavelengths (for example X-rays) or to ultrasound and sonar frequencies The new goal of hidden 3D shape recovery may inspire new research in the design of future ultrafast imaging systems and novel algorithms for hidden scene reconstruction For time-jitter correction, another portion of the beam is split off, attenuated and directed at the wall as the calibration spot. The calibration spot is in the direct field of view of the camera and can be seen in Fig. 2 The calibration spot serves as a time and intensity reference to compensate for drifts in the synchronization between laser and camera as well as changes in laser-output power It also helps in detecting occasional shifts in the laser direction due to the data is discarded and the system is re-calibrated has time decayed burn out and local gain variations We use a reference background photo to divide and compensate The camera is a Hamamatsu C5680 streak camera that captures one spatial dimension with an effective time resolution of 15 ps and a quantum efficiency of about 10% The position and viewing direction of the camera are fixed The diffuser wall is covered with Edmund Optics NT83 diffuse white paint We estimate the oriented bounding box around the hidden object using a lower resolution reconstruction We reduce the spatial resolution to 8 mm per voxel and downsample the input data by a factor of 40 We can scan a 40 cm×40 cm×40 cm volume spanning the space in front of the wall in 2–4 s to determine the bounding box of a region of interest The finer voxel grid resolution is 1.7 mm in each dimension We can use the coarse reconstruction obtained to set up a finer grid within this bounding box we can set an optimized bounding box from the collected ground truth we used this second method in most of the published reconstructions We confirmed that apart from the reconstruction time and digitization artefacts We compute the principal axis of this low-resolution approximation and orient the fine voxel grid with these axes we use a common approach to improve the surface visualization We estimate the local contrast and apply a soft threshold The confidence value for a voxel is V′=tanh(20(V−V0))V/mloc where V is the original voxel value in filtered heatmap and mloc is a local maximum computed in a 20×20×20 voxel sliding window around the voxel under consideration Division by mloc normalizes for local contrast The value V0 is a global threshold and set to 0.3 times the global maximum of the filtered heatmap The tanh function achieves a soft threshold The laser emits a pulse every 13.3 ns (75 MHz) and consequently the reflected signal repeats at the same rate We average 7.5 million such 13.3 ns windows in a 100-ms exposure time on our streak tube readout camera We add 50–200 such images to minimize noise from the readout camera The light returned from a single hidden patch is attenuated in the second Attenuation in the fourth path segment can be partially counteracted by increasing the camera aperture Recall that we direct the laser to various positions on the diffuser wall and capture one streak image for each position. The position of a hidden point s (Fig. 1) is determined with highest confidence along the normal N to an ellipsoid through s with foci at the laser spot Large angular diversity through a wide range of angles for N for all such pairs to create baselines is important The location and spacing of the laser positions on the wall can have a big impact on reconstruction performance one should choose the laser positions so as to provide good angular diversity We use 60 laser positions in 3–5 lines perpendicular to the line on the wall observed by our one-dimensional streak camera This configuration yielded significantly better results than putting the laser positions on few lines parallel to the camera line Scaling up the distances in the scene is challenging because higher resolution and larger distances lead to disproportionately less light being transferred through the scene A less challenging task may be to scale the entire experiment including the hidden object The reduction in resolution to be expected in this scaling should be equal to the increase in size of the hidden object consider a hidden square patch in the scene we require discernible light to be reflected back from that patch after reflections or bounces off other patches light is attenuated by approximately d2/(2πr2) where r is the distance between the source and the destination patch and d is the side length of the destination patch the destination patch is the camera aperture and d denotes the size of this aperture If r and d are scaled together for any path the contributed energy from the source patch to the destination patch does not change This may allow us to scale the overall system to larger scenes without a prohibitively drastic change in performance increasing the aperture size is only possible to a certain extent Our reconstruction method is well-suited for Lambertian reflectance of surfaces Our method is also robust for near-Lambertian surfaces and they are implicitly handled in our current reconstruction algorithm The surface reflectance profile only affects the relative weight of the backprojection ellipses and not their shapes The shape is dictated by the time-of-flight which is independent of the reflectance distribution retroreflective or have a low reflectance make the hidden shape reconstruction challenging mirror-like and retroreflective surfaces limit the regions illuminated by the subsequent bounces and may not reflect enough energy back to the camera They also could cause dynamic range problems Subsurface scattering or extra inter-reflections extend the fall time in reflected time profile of a pulse But the onset due to reflection from the first surface is maintained in the time profile and hence the time delayed reflections appear as background noise in our reconstruction Absorbing low-reflectance black materials reduce the SNR but the effect is minor compared with the squared attenuation over distances Although near-Lambertian surfaces are very common in the proposed application areas reconstruction in the presence of varying reflectance materials is an interesting future research topic Recovering three-dimensional shape around a corner using ultrafast time-of-flight imaging Chapter 1 of Active Electro-Optical System The Infrared and Electro-Optical System Handbook (1993) Gated viewing and high-accuracy three-dimensional laser radar Ballistic 2-D imaging through scattering walls using an ultrafast optical Kerr gate Ultrafast ranging lidar based on real-time Fourier transformation Advanced short-wavelength infrared range-gated imaging for ground applications in monostatic and bistatic configurations Radar detection of moving objects around corners Multipath exploitation with adaptive waveform design for tracking in urban terrain Raskar, R. & Davis, J. 5d time-light transport matrix: what can we reason about scene properties? MIT Technical Report (2008). URL:http://hdl.handle.net/1721.1/67888 Looking around the corner using transient imaging Principles of Computerized Tomographic Imaging Virtual reality mapping system for chernobyl accident site assessment Moonlight in miami: a field study of human-robot interaction in the context of an urban search and rescue disaster response training exercise Vehicle following with obstacle avoidance capabilities in natural environments Optical phase conjugation for turbidity suppression in biological samples Nonlinear self-filtering of noisy images via dynamical stochastic resonance Image transmission through an opaque material Overcoming the diffraction limit using multiple light scattering in a highly disordered medium Focusing and compression of ultrashort pulses through scattering media Fast separation of direct and global components of a scene using high frequency illumination Download references This work was funded by the Media Lab Consortium Members and the Institute for Soldier Nanotechnologies and U.S Army Research Office under contract W911NF-07-D-0004 Veeraraghavan was supported by the NSF IIS Award #1116718 We would like to thank Amy Fritz for her help with acquiring and testing data and Chinmaya Joshi for his help with the preparation of the figures Department of Electrical and Computer Engineering All authors took part in writing the paper The authors declare no competing financial interests Supplementary Figures S1-S8 and Supplementary Methods (PDF 2181 kb) The movie shows the hidden objects described in Figures 3 and 4 and their reconstructions The white mannequin is captured in separate capture runs These reconstructed poses are played as a stop-motion animation This demonstrates reproducibility of the method It also shows to what degree different object features Thresholded three dimensional renderings of the reconstructed object are shown for both the mannequin and the reconstruction of the letters ITI Download citation Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily. Hollie Velten-Lattrell is the designer behind the interior design studio SPACES by Hollie Velten. Her environments are highly bespoke, emotive, elevated yet relaxed, and of a certain mix of genre and era. Off-Beat and Beautiful Wild Instincts Suite Dreams Creative Cabinetry Make It Fashion! Hipstoric Nowstalgia The Dorm — Transformed Grand Entrance All About Artistry Soulful Space Hang Time!: Tidy and Chic House of Hacks A DIY-Buy Paradise The home you love starts here LANSING TWP. – A 20-year-old man has been charged in connection with the death of his father in March David Peter Velten was named in a murder warrant signed Wednesday in 55th District Court who was found dead April 9 in his home on West Michigan Avenue in Lansing Township Police went to the home to check on the elder Velten after friends and neighbors said they had not seen him for days and investigators believe he was struck on the head with a hammer Lansing Township Police Chief John Joseph said who had been lodged in the Ingham County Jail on an unrelated home invasion case since March 31 The Ingham County Prosecutor's Office authorized a murder charge on Tuesday Township police Detective Randy Volosky "did a great job with it and the investigation worked out for us," Joseph said "Having the guy (already) lockup up was helpful." Court records list the offense date as March 30 John Velten and his son were estranged at the time but Investigators aren't sure what prompted the assault police said. It was unclear if he is represented by an attorney in the murder case More: Police investigating a possible homicide in Lansing Township More: Ingham County man faces federal charges of possessing, distributing child pornography David Velten is charged with third-degree home invasion in a case investigated by the Ingham County Sheriff's Office Velten was sent for a competency review on April 22 A hearing to determine whether David Velten should stand trial on the murder charge is tentatively set for June 29 Thanks for visiting The use of software that blocks ads hinders our ability to serve you the content you came here to enjoy We ask that you consider turning off your ad blocker so we can deliver you the best experience possible while you are here It was just hours into the investigation of the killing of Phoenix psychologist Emmett Velten when detectives hit evidentiary pay dirt caught on surveillance video from three angles and for a total of more than 45 seconds then walking from the parking lot into Velten’s apartment complex and into the elevator He took the stairwell back to the parking lot Police recovered the vehicle three days later bloody footprint lifted from the apartment Perhaps the most promising lead in Velten’s homicide investigation was delivered by the victim himself He was conscious when police first arrived and lived long enough to tell officers that he had picked up the suspect at CASS yet somewhat private with his friends about his personal life Friend Brad Stacey said Velten had never mentioned picking up strangers for romantic encounters nor could he fathom that would be a part of Velten’s life Police have no record of Velten using prostitutes “… I think he had a pretty typical therapist personality When I think back on my conversations with him the video shows the two entering Velten’s apartment near the 2300 block of North Central Avenue Sometime in the span of 45 minutes after the suspect left Velten emerged from his apartment bleeding from the head and with his pants halfway removed A neighbor found him lying by the elevator and called police Velten told investigators that the man had bound his legs and beat him until he was unconscious He died shortly thereafter at the hospital There were no known items missing from Velten’s apartment and the suspect ditched the stolen vehicle nearly immediately Security guards noticed the RAV4 near North 35th Avenue and West Glendale Avenue shortly after the attack but police were not notified of it until April 27 The video provided a passing depiction of the man: He was clean-cut The suspect’s face was somewhat obscured by pixels and he never seemed to face the right angle but police hoped some of his more distinguishing accessories could help identify him messenger-style bag and wore a neon-green baseball hat Police combed the shelters looking for people who matched They presented a photo lineup to the front desk attendant of Velten’s apartment complex One lead was eventually brought in for questioning but police eliminated him after testing his footprints Velten’s home supplied police with plenty of potential physical evidence an electrical cord and an empty beer bottle to the crime lab but results either came back empty or inconclusive Detectives are now looking to resubmit the beer bottle for more stringent testing Phoenix police Detective Dominick Roestenberg said it’s “very possible” that the suspect wasn’t a local Velten dedicated his life to psychology and enjoyed moderate renown within the recovery community an influential psychologist best known for his pioneering cognitive-behavior therapy methods developed in the 1950s The two continued to work together throughout the decades one on recovery and another on mental health and aging both rooted in the pair’s self-help and psychotherapy techniques Velten's work in academia prompted various moves around the country the University of Alabama and as a clinical professor in the University of California system He maintained a private practice throughout most of his career The last 11 years of his life were spent in Arizona Velten developed a circle of friends within the local psychology and atheist communities and his work was always centered in secular-based ideologies He was a founding member of the SMART recovery method a non-spiritual answer to Alcoholics Anonymous He championed what’s known as “secular humanism,” described by Stacey as “not a stance against religion and helped her along in her own career in therapy Troncoso met Velten when she herself was getting sober everything I was about at that moment,” she said Velten inspired a completely different way for Troncoso to view her interactions with the world He believed everyone was responsible for their own emotions “He didn’t let you get away with anything,” she said Velten had begun a small circuit of speaking engagements around the Valley on how to handle the problems of everyday living said Velten’s easy demeanor helped make him relatable to the audience Velten was a fan of public-based therapy sessions and would often call on one of the audience members toward the end of his speech Stacey recalled one instance in which a volunteer from the audience told Velten he was diagnosed with a mild form of social autism “I think one of the first statements that Emmett made was don’t take your diagnosis too seriously,’ ” Stacey said “It was just his tone with talking: ‘Don’t go by what you’ve been told your flaws are Let’s base everything you do on the fact that you’re a person.’ ” If you have any information regarding this case or any other cold cases police ask that you contact Silent Witness at 480-948-6377 Vancouver Magazine Canada’s First Din Tai Fung: Does Vancouver’s New Spot Live Up to the Hype May’s Best Food Events in Vancouver—Where to Dine This Month Locanda dell’Orso Has a New Chef—and a New Chance to Make a Mark on the City’s Italian Scene Two Vancouver Bars Remain in the Top 50 at the North America’s 50 Best Bars List The World’s Best Bartenders Are Coming to Vancouver—Here’s Where to Find Them Top Drop Is a Wine Nerd’s Dream Come True The Vanmag Guide to Fostering a Pet in Vancouver Know-It All: What Are These Strange Obelisks Doing on Ontario Street The Playlist: Musician Brock Pytel on the Music Podcast and Neil Young Score He’s Loving Right Now BC’s Best-Kept Culinary Destination Secret (For Now) Very Good Day Trip Idea: Eating and Vintage Shopping Your Way Through Nanaimo Weekend Getaway: It’s Finally Ucluelet’s Time in the Spotlight Shop Hop: Suze in Kits Is All About That Little Something Special Buy Local: 15 Vancouver Brands Making Furniture and Home Goods Drink and Get Married: Mijune Pak’s Wedding Was a Bespoke Food Festival John Velten’s bold and fantastical childhood drawings led teachers to push him toward the arts—but instead he started a career as an electrician at the age of 17 “I thought there wasn’t any money in art,” he remembers with 3,800 hours and half an apprenticeship under his belt 60 years into the field who seemed unhappy,” he says a jewellery company that forges Indigenous designs out of precious metals Velten does all of the fabrication himself with a laser machine ring and bracelet holds meaning—the Foundations ring has a beaver motif symbolizing strong beginnings and the Deep Wisdom pendant’s design came from a run-in with an owl Velten works with over 30 Indigenous designers to create wearable art—whether or not metalwork is their thing and that opens up the doors for others,” he says He’s long retired from the electrical field Own your city with Vancouver’s thrice-weekly scoop on the latest restaurant news Vancouver magazine has been your indispensable insider’s guide to the people events and (most importantly) the incredible restaurant scene that make this such a special place to live considered recommendations and insights to every page and digital content piece Whether we’re covering the coolest up-and-coming Vancouver fashion designers the hottest spots to hit on your long weekend Gulf Island getaway or wild and wonderful urban planning solutions we’re on a mission to prove this is So Fun City Andreas Velten, a Morgridge Institute Affiliate with the Medical Engineering Group and assistant scientist with UW–Madison Laboratory of Optical and Computational Instrumentation won a grant for his work in imaging technology through the Air Force’s Young Investigator Research Program (YIP) The Air Force Office of Scientific Research awarded approximately $16.6 million in grants to 57 scientists and engineers from research institutions and small businesses through the program The program aims to foster creative basic research in science and engineering enhance career development skills and opportunities of young researchers and increase recognition of current challenges in science and engineering that support the Air Force mission resolution decreases as the observed object is placed further away from the observer we can read the license plate on the car driving right in front of us but we may barely be able to make out a car driving a mile down the road While this degradation with distance seems inevitable for images it does not happen to time encoded information We can measure the frequency of a radio station accurately as long as its radio waves reach us at all We can measure the spectrum of a star at the other side of our galaxy almost as well as the spectrum of a light bulb in our lab time encoded signals do not degrade as the travel large distances when it is reflected back and forth between parts of a scene transfers information about the geometry of a scene into the time response of the scene Time Encoded Remote Aperture (TERA) imaging uses this information encoded in the time dependence of light coming from a scene to reconstruct images of the scene This time encoded aperture information can travel undistorted over large distances and does not require an imaging system with a large aperture to achieve a high resolution TERA Imaging has potential applications in endoscopic imaging you'll receive the latest news about fearless scientists working to improve human health the Morgridge Institute for Research explores uncharted scientific territory to discover tomorrow’s cures © 2025 Morgridge Institute for Research | 330 N Orchard Street Madison WI | Privacy Policy Give now to help students from every corner of the state experience the joy of discovering science Artificial intelligence created enormous efficiencies in many industries but has yet to in the financial world Martin Velten expresses his conviction the possibilities of AI-driven asset management are so great there'll be no way around it in the future authors comment on economic and financial topics The advent of artificial intelligence (AI) is opening up a new world in wealth management as well one that can be fully tailored to the needs of individual clients AI has already created incredible efficiencies something that's rarely been the case in the financial industry Because AI-driven wealth management is such a new field AI can be used in asset management in two ways: first When it comes to investment recommendations AI can be used to collect and analyze financial data or make predictions about market trends This information can then be used to create investment recommendations tailored to the individual client An AI system can recommend investing in certain asset classes or industries if it predicts they will outperform in the near future «There are several differences between AI-driven asset management and traditional asset management» AI can be used to automate investment management tasks in portfolio management AI can help relieve the burden on human advisors allowing them to focus more on serving their clients and improving business processes it can be used to develop new products more quickly and adapt business models to changing demands There are several differences between AI-driven asset management and traditional asset management AI-driven asset management is much more data-driven than traditional asset management AI systems can use their algorithms to collect and process large amounts of data more quickly and effectively This capability provides AI-based systems with a competitive edge due to higher accuracy in making market predictions This leads to better risk management and therefore higher returns over a long-term investment horizon «AI-based asset managers tend to be more cost-efficient than their traditional counterparts» Another difference in AI-driven wealth management is that it's highly personalized Machine learning and AI systems analyze the data of individual clients and create a suitable investment strategy tailored specifically to that person's needs traditional portfolio management approaches tend to be much more general with their fundamental analysis AI-based asset managers tend to be more cost-efficient than their traditional counterparts That's because their lower fees are ultimately the result of their ability to process large amounts of data more efficiently and rely on machine-learning algorithms rather than human research and performance monitoring which increases the cost of investment advice at traditional firms the use of AI enables a more systematic and consistent approach to investment decisions This helps to achieve higher returns and grow investment portfolios more efficiently sophisticated algorithms can be relied upon to make informed investment decisions based on market trends and data analysis But several challenges also remain for AI technology-driven platforms to be truly successful these systems must be able to store large amounts of data as the data used to make investment decisions is scattered across a wide variety of sources «AI systems can therefore only be as accurate as the data they are fed» Another challenge is that AI systems are expected to generate accurate predictions about market developments This is a difficult task because the future is inherently unpredictable AI systems can therefore only be as accurate as the data they are fed; even small errors in the data can lead to inaccurate predictions it's very important that AI-driven asset managers explain their predictions to clients and fully communicate the benefits of the technology to them This is important in that investors should understand why the AI-powered asset manager recommends selling stocks or buying securities in a company or industry to generate a particular course of action AI companies must be able to generate investment recommendations specifically tailored to the individual client This is a huge challenge because each person's financial situation is unique What works for one person may not work for another simply for regulatory reasons Martin Velten has been a partner at Zurich-based digital asset manager Smart Wealth since the beginning of 2021 he's responsible for sales and servicing fund managers he worked in capital markets at major banks He's developed numerous product innovations and trading areas including the first certificates and guarantee products He's considered a pioneer of the European ETF industry finews.com publishes on its own Web-TV-Channel interviews with well-known figures of Swiss finance. + More on this topic + More on this topic + More on this topic 2022Hollie Velten swapped the old drop ceiling tiles for plywood squares for added warmth in the basement renovation.Photo: Thomas LeonczikSave this storySaveSave this storySaveAll products featured on Architectural Digest are independently selected by our editors we may receive compensation from retailers and/or from purchases of products through these links First, Velten had to address the excessive number of doors in the basement, which made it feel like a creepy fun house how could we integrate them without objectifying them too much How could we let them be a part of the design We landed on color as the tool and really tried to work against typical trendy color blocking and went with color folding instead.” BEFORE: The weird-shaped space posed a challenge Velten met the basement renovation task by folding colors throughout She then maximized function by creating distinct zones for watching TV The result is a fun multiuse space that’s equally compelling for adults and children an affluent borough in North New Jersey with highly rated school districts and lots of Colonial architecture BEFORE: The old kitchenette had a cheesy rustic Italian vibe AFTER: “We were worried [the backsplash] would look too crafty but the paint has a cabinet finish and it just really worked,” Velten admits The before: “It was just a massive basement,” Velten describes. “We were joking and called it a fun house because it just had so many doors and felt very scary. It was damaged in Ida, the storm, so they had already started repairing drywall and knew that they needed to put in a new floor. The kitchenette was probably redone in the late eighties So it had that faux-elegance Tuscan look with manufactured molding and overdone detail.” soft color palette that really spoke to us.” Square footage: Approximately 1,000 square feet “We just played meticulously with where each color would be applied,” Velten says It was more of a soft folding that I think the Bauhaus was so successful in we would fold the light pink on a wall and a half then take that same color into the trim across the room and then balance it with a really deep purple on a small soffit.” “They just got out of Ida,” Velten reasons “A storm that happens once every hundred years could very well happen again next year I won’t do much of anything else for a basement besides LVF It’s just too possible that there’s gonna be damage again “We replaced the drop ceiling tiles with actual plywood tiles,” Velten shares “It just really worked to connect the sky and the ground together AFTER: A built-in storage bench doubles as a reading nook “We wanted to continue the quartz into a custom-cut backsplash but that was really expensive,” Velten admits our carpenters cut a scalloped piece of wood and painted it like the cabinets That was a little hack to create a bespoke look without the expense of countertop material.” Floating shelves, pegboard, built-in bench, and desk: Custom plywood by Virden Home “We always use live-edge so you can see that imperfection and the grain of the wood,” Velten says AFTER: “I love the seating,” Velten says. “I got so excited about the striped cantilever chair. That’s a 1970s Johan Bertil Häggström lounge chair that we found from a dealer in Seattle and shipped it in And it just was the perfect mix of high design and super functional “I always look at lighting as jewelry,” Velten explains The client usually thinks it’s overboard to stack and layer lighting And it just ends up creating such a mood when you can manipulate incandescent lighting at different levels.” Framing: CSM Art & Frame Most insane splurge: “The biggest splurge was the ceiling tiles grounding that northern and southern plane with something organic Sneakiest save: The crafty wood backsplash was the most significant money-saving measure The best part: Velten loves the overall look of the space from the juxtaposition of vintage and contemporary to the blending of colors Velten would make sure to be on-site for a complicated paint job Though everything ultimately went as planned communicating the design from afar was a challenge Final bill: “We usually do work with strict budgets but this one was pretty fluid,” Velten reveals “We bring extra vintage pieces from the studio for the photo shoot and then we leave everything at the client’s home with a purchase order and price stickers We come the next day to collect anything they don’t want This client ended up keeping quite a bit.” which was really to house her laundry,” Velten shares “I wanted to give her something that was modular that she could move around based on what she wants to dry hang It’s also right next to the kids’ craft corner so they could use that for drying their paintings or hanging their aprons and whatnot.” Not a subscriber? Join AD for print and digital access now Affordable Housing in America Through Three People’s Eyes Inside a Party With The White Lotus Cast at a Storied Beverly Hills Home Mark D. Sikes Brings All-American Optimism Home With Pottery Barn Amy Astley’s Entertaining Essentials The Best Airbnbs in Istanbul Are Historic Gems Inside an Italianate-Style New Orleans Mansion That Channels Parisian Glamour Jennifer Aniston’s Houses: Inside the Friends Star’s Multimillion Dollar Real Estate Portfolio This 850-Square-Foot Brooklyn Heights Apartment Is the Epitome of Romance Meet Ficus Interfaith, Two Rising Stars Making Art Furniture From Everyday Refuse Sign up for our daily newsletter to get the best of design in your inbox. led by Partners Kurt Beyer and Telmo Valido to enhance its European investment activity Velten joins the Firm’s broad bench of experienced Operating Partners and will be responsible for driving post-acquisition value creation at One Rock’s portfolio companies through operational and supply chain improvement Velten comes to One Rock with over 25 years of experience working in packaged consumer goods and industrial services industries of which more than half were spent working for Ecolab in Europe and infection prevention solutions and services and implementation of advanced technologies while leading European mergers and acquisitions activities He also held roles as VP Industrial Supply Chain Velten served in numerous positions at Nestlé Waters and Nestlé “We are thrilled to welcome Lutz to our team and look forward to the operational expertise he will provide to our companies,” said R “His deep understanding of operations and supply chain is incredibly valuable as One Rock expands its presence across Europe.” “One Rock’s focus on investing in the manufacturing paired with its expertise in complex transactions uniquely aligns with my background,” said Mr “I look forward to collaborating with my U.S.-based counterparts to enhance the value One Rock continuously seeks to provide to its portfolio companies.” Utilizing the expertise of Operating Partners has been an integral part of One Rock’s strategy since its inception © Copyright 2012 - 2023 | citybiz | All Rights Reserved One UTD alum chose to return to campus after graduating where he now splits his time between work and providing free repairs for student electronics in a bid to reduce waste production. Josef Velten graduated in 2012 with a Ph.D in material science and engineering He returned to UTD to work on campus as a visiting scientist after getting his degree Velten made a post on the UTD subreddit advertising his free device repair services in the Student Union titling the post “Fix-It Friday.” He mostly specializes in small electronics but has also worked on a wide variety of machines some guy had a laptop hinge repair question and didn’t want to buy a new laptop,” Velten said “I asked him to take a few pictures so I could figure it out Consumer goods are not usually the toughest of things especially considering it is cheaper to make them flimsy It’s kind of a questionable thing that I don’t really like and I grew up in an environment where having to repair your things was considered normal You develop an ability to fix things once you can take it apart and assemble it back together.” when Velten tried to set up the “Fix-It-Friday” on campus he was not sponsored by any student organization and was asked to leave Students who were aware of his arrival and purpose to UTD were upset about when Velten was initially shut down Velten was sponsored by the UTD chapter of the Democratic Socialists of America to return to campus it’s against the university’s policy to allow that,” Velten said when I put a call out for someone to bring a sign (for the repair table) so I could at least make it look better I’m sure there is some liability issue that the school has and I understand that they would rather be safe than sorry He said he believes what he is doing is a way of bringing UTD together and encourages students to come visit him and learn Velten added that he wishes to make a network of students helping other students with their items which need to be repaired “Hopefully if they want to come down and fix their stuff and hopefully if they are willing to learn and I can teach “This is me trying to live my truth of anti-throwaway culture,” he said. Δdocument.getElementById( "ak_js_1" ).setAttribute( "value" COLUMBUS — A Columbus Police Department officer faces two felony charges months after he allegedly punched a suspect who was handcuffed inside a police vehicle was arrested Tuesday after he turned himself in at the Bartholomew County Jail He is charged with felony battery and official misconduct charges Velten arrested a man after he responded to a fight on Indiana Avenue in Columbus State police said the suspect began hitting his head against the interior of the police vehicle while he was handcuffed in the backseat Officer Velten struck the suspect with his fist while the suspect was still handcuffed inside of the vehicle Officer Velten’s actions caused moderate injuries to the suspect," a release from Indiana State Police said The case was turned over to a special prosecutor following an investigation by ISP According to the Columbus Police Department Velten has remained employed with the City of Columbus in a non-law enforcement position since the investigation began Columbus police will release additional information about Velten's employment status with the city Imaging specialist Andreas Velten is largely responsible for pioneering the science behind the new scattered light imaging system A team of University of Wisconsin researchers have received a major grant from the Department of Defense to further develop a sophisticated piece of optical technology: a camera that can visualize what's around a corner A team of University of Wisconsin researchers have received a major grant from the Department of Defense to further develop a sophisticated piece of optical technology: A camera that can see around corners The idea behind the groundbreaking tech is that light particles from a bright flash can be collected by camera sensors and analyzed to visualize objects hidden from view The team used a laser to fire a pulse of light at an angle toward a far wall resulting in some of the light particles reflecting off the surface and bouncing across objects set up around a corner Those particles eventually bounce all the way back to near the point of origin you can reconstruct an object using a computer," said the imaging specialist Andreas Velten a researcher with the Computational Optics Group Laboratory for Optical and Computational Instrumentation and the Morgridge Research Institute is largely responsible for pioneering the "scattered-light" imaging system Velten's field specializes in using computer processing to take imaging beyond simple visual recreations of what a person could otherwise be able to see — in other words beyond photography in the traditional sense "We want to design imaging systems that allow us to capture information that's beyond the human eye," he said The scattered-light imaging technology is a significant example of such a system It provides a possible answer to an old optical imaging problem — how to get information about environments obstructed from view — and comes with a wide array of potential applications the technology could be used whenever "you need to know what's in a room the camera could be deployed to scan rooms for survivors in an unstable apartment building if a manufacturer wants to examine the inside of a machine with lots of moving parts The applications extend to robotics as well Velten said that this kind of technology could make a huge impact in the effectiveness of self-driving cars He added that NASA had even talked with his team to discuss the potential of the technology to help researchers map out tricky-to-explore caves on the moon it's clear that the theory and technology works The $4.4 million he and his research team will receive from the Defense Advanced Research Projects Agency will now go toward further expanding upon the potential of the idea "In order to make this a feasible technology we need to make a lot of progress," said Velten Part of the team will work on the engineering and design of the technology the lab equipment they're using doesn't translate into something that could be deployable in the real world The hardware will need to become more compact and light — eventually with the idea being that the technology could become integrated into a smartphone there are other theoretical questions about the technology that need to be explored They've solved the problem of visualizing objects that are around a corner the question becomes: What about two corners Become a Cap Times member today and enjoy great benefits Your browser is out of date and potentially vulnerable to security risks.We recommend switching to one of the following browsers: Get up-to-the-minute news sent straight to your device Please enable JS and disable any ad blocker This website uses cookies to improve and promote our services. By continuing to use this website you are agreeing to our Cookie policy. WITH THE RECENT launch of FirstNationsGallery.com, founder and artist John Velten is not only building what he hopes will be the largest collection of Pacific Northwest Indigenous-designed gold and silver jewellery in North America He’s also increasing such artists’ access to the tools and technical savvy they need to bring their culturally significant designs to market providing them with remote and digital-creation assistance and access to precious metals Velten offers emerging and established artists mentorship and the support they need to transform their ideas and sketches into market-ready “It's really to bring more means for artists to be able to monetize their work as well as getting in front of the faces of the consumer audience especially a cultural consumer audience,” Velten says in a Zoom interview with Stir. “With the lack of resources within the First Nations community I created a lot of accessibility for myself like learning how to run a laser machine and create more jewellery And it became one of my main sources of income and the same goes for a lot of other people that I’ve been able to work with.” Sterling-silver Moon Earrings by Grant Pauls says he has always been interested in art and has been creative since a young age “That was my mode of expression,” Velten says. Despite his passion and talent—he received ongoing praise from teachers—Velten experienced hesitation about pursuing a career in the arts he got an electrician’s diploma at age 17 and worked over 3,800 hours in the field before realizing it was not for him A fateful encounter with a friend of a friend linked Velten to respected Tahltan multimedia artist Alano Edzerza. “I quit my job the next day and moved into his place and basically had a full-on arts apprenticeship,” Velten says Velten gained the foundation not only for fine arts but also the necessary knowledge for starting a business Velten studied at the Visual College of Art and Design in downtown Vancouver for 3D modelling and animation and received artistic training and guidance from other local Indigenous artists such as Rick Adkins Portions of Velten’s works have been commissioned by the City of Vancouver Velten says he was not expecting to open a jewellery business; rather The online shop was a product of marrying his background in the digital field and his networks in the arts community Velten is able to provide other Indigenous artists with the resources needed to craft jewellery pieces that become products for retail. FirstNationsGallery.com currently offers over a hundred different products like earrings all created by Indigenous artists from the Pacific Northwest The online shop’s catalogue features works by Mark Preston His experience with jewellery comes from studies of silver carving with well-known master jeweller and carver Phil Janze of Gitskan Nation. “Mark Preston is a really great example of somebody in the older generation who has honed his craft and has been able to produce and digitize a lot of his work,” Velten says such as Grant Pauls of the Tahltan Nation and Shawn Aster use a combination of various jewellery-making techniques to create a range of intricate pieces. Velten’s own jewellery is showcased on the website. A notable piece is the sterling-silver Beaver Ring which he says signifies the establishment of foundation especially for the shaping of community and the education of young minds. The gallery’s artists carry traditional knowledge relating to other crests and symbols and noble being that features prominently in stories throughout the Northwest Coast. Peters was raised in the Coast Salish and Nuu-chah-nulth artistic traditions Velten says his goal with FirstNationsGallery.com is to be able to serve other artists by creating a global distribution channel and an accessible environment to transform their art to jewellery “This will be for not only First Nations artists but all artists who might want to venture into making jewellery by using more advanced and new technology,” Velten says. He notes that artists receive higher earnings from each sale made on the website than they would from an art gallery or museum gift shop More information is at FirstNationsGallery.com. Sena Law is a journalism grad from Langara College in Vancouver she has always had an admiration for the visual arts Sena aspires to uncover the local underground art scene through her writing the inclusive two-day festival sets up in fields and by riverbanks and Claudia Goulet-Blais share insights on the works they’ll have on display In partnership with Burnaby School District 41 exhibitions showcase artworks by elementary and high-school students New video work traverses an interior landscape shaped by the perspectives of artists Min Kim and Mia Wennerstrand North Van Arts exhibition features contemporary works by Daryl Lynne Wood exhibition features more than 420 works from across five degree programs Works by internationally acclaimed mosaic artists Daryl Wood and Maria Abagis to be displayed at CityScape Community ArtSpace Series explores Rotimi Fani-Kayode’s practice through films and lectures with queer Black and African artists and cultural producers B.C.’s Charles Campbell and Tania Willard are also nominated for the Pacific Region in competition for country’s richest visual-art award Z·inc Artist Collective brings deep curiosity and personal experience to meditations on networks that sustain and adapt Email us at hello@createastir.ca and unceded territory of the Coast Salish peoples including the territories of the xʷməθkwəy̓əm (Musqueam) and Səl̓ílwətaʔ/Selilwitulh (Tsleil-Waututh) Nations What is Stir?Support Stir Diversity & Inclusion Advertising RSS FEED Legal | Site Credits We acknowledge the financial support of the Government of Canada .st1{fill-rule:evenodd;clip-rule:evenodd;fill:#2a2a2a}By Staten Island Advance StaffSTATEN ISLAND respected businessman and steadfast family man The lifelong Staten Islander was born in Great Kills He also lived in Dongan Hills and Tottenville before settling in Prince's Bay He served in the Air Force from 1950 to 1954 He spent a year in the NYPD before joining the Fire Department He was first assigned to the Marine Division in Manhattan the catering hall on West Fingerboard Road He adored his family and what he wanted most in the world was for them to be happy Velten enjoyed watching and going to NASCAR races and was an enthusiastic New York Giants football fan were like sons to him," said his daughter He also was preceded in death by his daughters Patricia Sigmon and Tammy Lewandowski; his sister The funeral will be Thursday from the Bedell-Pizzo Funeral Home Use of and/or registration on any portion of this site constitutes acceptance of our User Agreement, (updated 8/1/2024) and acknowledgement of our Privacy Policy, and Your Privacy Choices and Rights (updated 1/1/2025) © 2025 Advance Local Media LLC. All rights reserved (About Us) The material on this site may not be reproduced except with the prior written permission of Advance Local Community Rules apply to all content you upload or otherwise submit to this site YouTube's privacy policy is available here and YouTube's terms of service is available here Ad Choices