Ready to start planning your care? Call us at 800-525-2225 to make an appointment
Our scientists pursue every aspect of cancer research—from exploring the biology of genes and cells
Our highly-specialized educational programs shape leaders to be at the forefront of cancer care and research
Adults: 800-525-2225
Children & Teens: 833-MSK-KIDS
our experts provide the care and support you need
Refer a patient
Memorial Sloan Kettering was founded in 1884
and today is a world leader in patient care
Age is considered the most important risk factor for cancer
That’s because genetic mutations build up in cells over years and decades
and ultimately drive the development of cancer
Now a study from researchers at Memorial Sloan Kettering Cancer Center (MSK) and their collaborators provides new evidence about how advanced age can also be protective against cancer. The study, conducted in a mouse model of lung cancer, was published in Nature on December 4
“We know that as people get older, they’re more likely to get cancer,” says study first author Xueqian Zhuang, PhD, a postdoctoral fellow in the lab of senior study author Tuomas Tammela, PhD, at MSK’s Sloan Kettering Institute
“But there’s still a lot that’s unknown about how aging actually changes the biology of cancer.”
lung cancer is diagnosed in most people around age 70
the incidence rate starts to come down again
“Our research helps show why,” she adds
“Aging cells lose their capacity for renewal and therefore for the runaway growth that happens in cancer.”
To investigate why cancer incidence peaks in the early senior years and then starts to decline again
the MSK research team studied a genetically modified mouse model of lung adenocarcinoma
a common type of lung cancer that accounts for about 7% of all cancer deaths worldwide
One of the things that makes it challenging to study aging in laboratory models is that mice take two years to develop to an age that’s equivalent to 65–70 years in people
making experiments a lengthy and resource-intensive proposition
The scientists found that as the mice get older
More NUPR1 makes the cells in the lungs function as if they are iron deficient
“The aging cells actually have more iron
but for reasons we don’t yet fully understand
they function like they don’t have enough,” Dr
Since the cells in the older mice functioned as though they didn’t have enough iron
they lost some of their ability to regenerate
And because that regenerative capacity is directly linked to the rise of cancer
the older mice developed far fewer tumors than their younger counterparts
this effect could be reversed by giving the older mice additional iron or by reducing the amount of NUPR1 in their cells
“We think this discovery may have some immediate potential to help people,” Dr
especially following the COVID-19 pandemic
live with insufficient lung function because their lungs didn’t fully heal from an infection
Our experiments in mice showed that giving iron can help the lungs regenerate
and we have really good ways of delivering drugs directly to the lungs — like asthma inhalers.”
But this is also where the double-edged nature of the discovery comes into play
By restoring the ability of the cells in the lungs to regenerate
one is also increasing the tissue’s ability to develop cancer
“So this type of approach might not be appropriate for people who are at a high risk of developing cancer,” he adds
The team’s findings also have important implications for therapies based on a type of cell death called ferroptosis
and there are a number of ferroptosis-inducing small molecule compounds
as well as drugs previously approved by the FDA
that are being investigated for their potential to kill cancer cells
Older cells are far more resistant to ferroptosis than younger cells because they function as if they don’t have enough iron
This means treatments that target ferroptosis may not be as effective in older patients as they are in younger ones
“One of the things that we showed exploring all of this iron biology is that ferroptosis is tumor suppressive
as everybody suspected — but much more profoundly in younger animals,” Dr
this says that because the biology of cells changes with aging
So doctors might need to really be careful in clinical trials
to look at the effects in both older and younger patients.”
the research ultimately has an even bigger takeaway
“What our data suggests in terms of cancer prevention is that the events that occur when we’re young are probably much more dangerous than the events that occur later,” he says
or from other obvious carcinogenic exposures are probably even more important than we thought.”
and Yuna Landais of the Victor Chang Cardiac Research Institute
Wong of the Victor Chang Cardiac Research Institute and University of New South Wales; Alexander Ferrena and Deyou Zheng of the Albert Einstein College of Medicine; Simon Joost
Carrasco of MSK and Weill Cornell Medicine; Yang Zhao and Thomas Pisanic of Johns Hopkins University; Joo-Hyeon Lee of the University of Cambridge
U.K.; Pekka Katajisto of the University of Helsinki
Soto-Feliciano of the Massachusetts Institute of Technology; and Tiffany Thomas of Columbia University
This work was supported by a Mark Foundation for Cancer Research Emerging Leader Award; the GO2 Foundation for Lung Cancer; and by MSK’s Cancer Center Support Grant from the National Cancer Institute (P30-CA008748)
Additional support was provided by the New York Stem Cell Science NYSTEM (C32559GG) from the Center for Stem Cell Biology at MSK; the Druckenmiller Center for Lung Cancer Research at MSK; Hope Funds for Cancer Research; The Alan and Sandra Gerry Foundation; a National Health and Medical Research Council Investigator Grant (GNT2009309); an ARC Discovery Project (DP200100250); a Snow Medical Fellowship; Josie Robertson; the American Cancer Society; Rita Allen; and the V Foundation
The work also relied on MSK’s Integrated Genomics Operation Core (funded by Cycle for Survival and the Marie-Josée and Henry R
and Histology Core Facilities at the Sloan Kettering Institute
as well as the Victor Chang Cardiac Research Institute Innovation Centre
Tammela is a scientific advisor with equity interests in Lime Therapeutics
His spouse is an employee of and has equity in Recursion Pharmaceuticals
The Tammela Laboratory receives funding from Ono Pharma unrelated to this work
where her spouse is a co-founder of and equity holder
The other authors declare no competing interests
Read the article: “Ageing limits stemness and tumorigenesis by reprogramming iron homeostasis,” Nature
JKMM Architects unveils Finland’s first hybrid football stadium
a highly anticipated addition to Tampere’s Tammela district
Designed in collaboration with the City of Tampere and Pohjola Rakennus
the architectural team conceived the stadium as a miniature city
combining sports facilities with residential
The 13,500-square-meter venue seats 8,000 spectators and meets UEFA category 4 standards
hosting elite matches such as the Europa League and national team games while accommodating 15,000 attendees for concerts and public events
its suspended steel canopies blending with the residential rooftops
images by Tuomas Uusheimo
Tammela stadium replaces the original Tammela football pitch, a historic venue dating back to the 1930s. Instead of relocating, the new structure densifies the site while respecting its heritage. Helsinki-based JKMM Architects’ competition-winning design
integrates the stadium with a hybrid block spanning nearly 50,000 square meters
The development comprises five residential buildings
weaving into the district’s urban fabric
Apartments in the residential buildings offer diverse layouts
with upper levels providing views of the field or surrounding cityscape
while a light art installation by artists Tommi Grönlund and Petteri Nisunen animates the canopy undersides
evoking the energy of football with dynamic
JKMM Architects unveils Finland’s first hybrid football stadium
Central to Tampere’s urban renewal goals
JKMM Architects prioritizes sustainability
Existing structures from the old stadium were repurposed for other city fields
The central location encourages public transport use
while the block is connected to district heating and cooling networks
Light-colored roof materials reduce urban heat and air pollution
while the compact hybrid design maximizes land use.
Tammela Stadium’s design is defined by its tectonic approach
where architectural and structural elements coalesce
and suspended canopy structures ensure robust yet refined forms
supported by tension cables and steel pylons
flexes to carry snow loads and seasonal shifts
while the stadium’s green artificial turf takes center stage as a symbol of Finnish football culture
and spectators are positioned for optimal flow
while visiting team supporters have a dedicated northeast entrance
Parking and service areas are tucked into the basement
The stadium offers year-round functionality
serving local clubs like Ilves Tampere and hosting diverse events
Ground-level commercial spaces add vibrancy to the Tammela area
further cementing its role as a community hub
the 13,500-square-meter stadium seats 8,000 spectators and meets UEFA category 4 standards
Tammela Stadium accommodates up to 15,000 attendees for concerts and public events | image by Hannu Rytky
the stadium replaces the original Tammela football pitch | image by Hannu Rytky
the new structure densifies the site while respecting its heritage | image by Hannu Rytky
brick-clad residential buildings frame the stadium
elevated courtyards are nestled between the structures
the development comprises five residential buildings
architect: JKMM Architects | @jkmmarchitects
floor area: 11,631 square meters (3,435-square-meter heated space)
seating capacity: 8,000 (15,000 for concerts)
Juha Mäki-Jyllilä (founding partners) Alli Bur
extensive team of architects and designers contributing to housing
geotechnical engineering: A-Insinöörit
electrical and audiovisual design: Ramboll Finland Oy
landscape design: VSU maisema-arkkitehdit Oy
photographers: Hannu Rytky | @hrytky, Tuomas Uusheimo | @onarchitecture
AXOR presents three bathroom concepts that are not merely places of function
but destinations in themselves — sanctuaries of style
JKMM Architects' Tammela Stadium has been announced as the winner of this year’s Finlandia Prize for Architecture by the journalist Antti Kuronen and Association of Finnish Architects (SAFA)
The multipurpose stadium was constructed in 2023 and covers 509,193 square feet with a capacity of 8,000 people for sporting events and 15,000 for concerts
Samuli Miettinen led the firm’s design team
which impressed the noted war correspondent for its response to challenging site parameters and ability to promote sustainability and a "peaceful coexistence for all."
Kuronen commented: "In creating the stadium
the designers at JKMM Arkkitehdit have made a bold and fresh contribution to Finnish urban design and urban culture
Tammela Stadium is less a monument or a piece of architectural eye candy and more a secret destination
whose existence only becomes apparent as you actually enter it
A first-time visitor might well pass here without ever realising they are in the presence of a well-appointed sporting venue
Tammela Stadium makes a bold and fresh contribution to Finnish urban design."
The 2024 pre-selection jury included Professor Jenni Reuter (Chair)
architects Harri Hautajärvi and Kirsi Korhonen
500,000€ Prize / Free registration / DUBAI URBAN ELEMENTS CHALLENGE
UNESCO ANCIENT THEATRE: Valorising an Extraordinary Historical Heritage
viewed from the research vessel Kronprins Haakon
While antibiotics are the linchpin of modern medicine we continue to face a global “antimicrobial crisis,” the authors wrote
as more and more resistant strains of bacteria are evolving
while the rate of discovery of fundamentally new antibiotics has been much slower
researchers have looked for antibacterial compounds in natural products
“A considerable number of antibacterial agents are derived from bacterial metabolites
numerous known compounds that impede bacterial virulence stem from bacterial metabolites
soil actinobacteria have produced 80% of all currently licensed antibiotics
on the seafloor or within the microbiome of marine organisms have received far less attention as possible sources of antibiotics
even more so with respect to virulence-modifying compounds.”
Focusing the search on actinobacteria in other habitats could thus represent a promising strategy
especially if this search could yield novel molecules that neither kill bacteria outright nor stop them from growing
but only reduce their “virulence” or capacity for causing disease
This is because it is hard for targeted pathogenic strains to evolve resistance under these conditions
“Inhibiting bacterial virulence is a well-studied alternate method to the more traditional killing of microorganisms or inhibiting their growth,” the scientists explained
the idea is to inhibit the action of virulence-causing molecules using pharmaceutical interventions
the treated pathogens would then remain incapable of causing symptoms
and thus selection pressure for resistance would not form so easily.” And it’s likely that such drugs
would have fewer adverse effects on normal flora
which are affected adversely by drugs that inhibit bacterial growth or viability in general
Tammela and colleagues developed a suite of methods that can test for the antivirulence and antibacterial effect of hundreds of unknown compounds simultaneously
“Our aim was to design and validate an isolation and automated screening workflow for use with fractions from microbial cultures and explore the presence of virulence-inhibitory compounds within marine bacterial fractions and their potential application for drug development as the complex nature of extracts and extract fractions may interfere with screens that have been developed and validated using pure chemical compounds only.”
Aug 2020 [Yannik Schneider]They targeted an EPEC strain that causes severe
diarrhea in children under the age of five years
EPEC isolates have also been shown to display many different forms of antimicrobial resistance
EPEC causes disease by adhering to cells in the human gut
EPEC injects so-called “virulence factors” into the host cell to hijack its molecular machinery
“EPEC virulence is caused by it adhering to enterocytes and causing lesions in the intestinal epithelium characterized by the destruction of microvilli
a phenomenon called attaching and effacing (A/E) lesions,” the team wrote
“Among the secreted factors is the translocated intimin receptor (Tir) which is critical for A/E lesion formation,” they wrote
The team tested compounds derived from four species of actinobacteria
isolated from invertebrates sampled in the Arctic Sea off Svalbard during an expedition of the Norwegian research vessel Kronprins Haakon in August 2020
and their contents separated into fractions
against EPEC adhering to cultured colorectal cancer cells
and further tests were carried out on the bioactive fractions to identify the relevant compounds
“Three bioactivity screening methodologies were used for each extract,” the team further explained
“These included 1) testing for their capacity to inhibit the translocation of Tir
2) their capacity to prevent actin pedestals
and 3) their capacity to inhibit the growth of EPEC in liquid culture … recognized active fractions were then studied further to narrow down their possible mechanism of action and to elucidate the chemical structure of the active compounds.”
The researchers found two unknown compounds with strong antivirulence or antibacterial activity: one from an unknown strain (called T091-5) of the genus Rhodococcus
and another from an unknown strain (T160-2) of Kocuria
The compounds showed two complementary types of biological activity
One by inhibiting the formation of “actin pedestals” by EPEC bacteria
a key step by which the pathogen attaches to the host’s gut lining
The other by inhibiting EPEC from binding to the Tir receptor on the host cell’s surface
a step necessary to rewire its intracellular processes and cause disease
Aug 2020 [Yannik Schneider]Unlike the compounds from T160-2
the compound from T091-5 didn’t slow down the growth of EPEC bacteria
This means that T091-5 is the most promising strain of the two
as EPEC is less likely to ultimately evolve resistance against its antivirulence effects
“ … the specific inhibition of enteropathogenic Escherichia coli (EPEC) virulence could offer an alternative to conventional antibiotic-based approaches
helping to mitigate the issue of antimicrobial resistance over the long term,” the investigators stated
the authors determined that the active compound from T091-5 was most likely a phospholipid: a class of fatty phosphorus-containing molecules that play important roles in cell metabolism
“Our findings include the bioassay-guided identification
and isolation of a large phospholipid and a likely antimicrobial peptide
demonstrating the usefulness of this approach in screening for compounds capable of inhibiting EPEC virulence,” the investigators wrote
“We show that this workflow can indeed recognize bioactive compounds in these microbial fractions,” they stated
“The next steps are the optimization of the culture conditions for compound production and the isolation of sufficient amounts of each compound to elucidate their respective structures and further investigate their respective bioactivities.”
Copyright © 2025 Sage Publications or its affiliates
including those for text and data mining and training of large language models
Official magazine of the Royal Geographical Society (with IBG)
By Bryony Cottam
the Norwegian Parliament approved a government plan to open a large part of its seabed to mining exploration
a team of scientists led by Päivi Tammela was analysing samples taken from microbes found in the Arctic sea
contain previously undiscovered compounds that could one day become new drugs for dangerous bacteria
‘I would say the deep ocean is a highly promising source of new discoveries.’
From these samples, Tammela and her colleagues have identified two new compounds that could be used to target a type of E
Coli that causes severe – and sometimes deadly – diarrhoea in children under five
a professor of pharmaceutical biology at the university
explains that as antibiotics aren’t selective about the bacteria they target
they aren’t recommended for the treatment of intestinal infections caused by bacteria such as E
‘You’re potentially killing all the beneficial microbiota in your gut
it’s generally better understood that taking multiple courses of antibiotics actually does a lot of harm
and can have really long-lasting effects.’ The other problem
Coli causing your infection could already be resistant to antibiotics
Antimicrobial resistance is already a global crisis
It is currently responsible for 1.27 million deaths every year and
this number could reach 10 million by 2050
While the global overuse and misuse of antibiotics
the crisis has been compounded by very few new antibiotic discoveries in recent decades
In an attempt to tackle the rising problem of antibiotic resistance
Tammela’s research has focused on compounds with antivirulence effects
Unlike traditional antibiotics that kill or inhibit the growth of bacteria
antivirulence drugs effectively disarm them
‘When you expose a bacterial population to an antibiotic that kills them
there’s always a few with mutations that survive and start a new
‘Because antivirulence compounds are not intended to kill a bacterium
we avoid this selective pressure that causes it to evolve in a certain direction
We are just preventing it from causing disease.’
It will be a long time before we find out whether these two
newly-discovered compounds can be used to develop new antivirulence drugs
but Tammela’s research has made it easier for other scientists searching for solutions to the antimicrobial crisis in the deep ocean
She and her colleagues are the first to trial a new
time-saving process that analyses hundreds of unknown compounds simultaneously and in greater detail than commonly used methods
‘We are constantly looking for new chemical compounds that could be used as drugs or pharmaceuticals,’ says Tammela
‘Our key message from our paper is that it really pays off to use more advanced technology to look at these samples.’
70 per cent of all licenced antibiotics have been derived from bacteria in the soil
We’re only just starting to look for useful products that can be developed from microscopic life – an activity known as bioprospecting – in Earth’s other environments
Yet scientists are already concerned that human activities
such as the development of deep sea mining
could disrupt ecosystems and organisms that are yet to be discovered
Filed Under: Science & Environment Tagged With: Arctic, Global Health
Click Here for SUBSCRIPTION details
Want to access Geographical on your tablet or smartphone
Android or PC/Mac image below to download the app for your device
Copyright © 2025 · Site by Syon Media
– The stadium entity has been successfully adapted to the existing urban structure
Construction is based on extensive reconciliation of different materials and hybrid construction of demanding structures enabled by load-bearing concrete structures
The stadium block has been founded on reinforced concrete piles and with support structures on challenging
– The end result of the Tammela Stadium project is extremely unique and successful
even though it was long-lasting and challenging in many respects
We received a stadium that is successful in terms of the cityscape and functionality
at a central location with good transport connections
A special feature of the Tammela Stadium are the suspended canopies of more than 100 metres in length
which serve as a shelter for the end stands
The glass entrances at the ends of the stadium protect the field from wind and maintain a spatial connection to the environment
while creating a microclimate inside the stadium
The column-free construction ensures unobstructed views of the entire field from all seats
The inclined columns built at each corner of the stadium are supported by load-bearing concrete structures or concrete anchors
the competition jury wants to encourage investments in the quality of the environment and construction through both technical and architectural means
and commercial services has required architectural and structural innovation
– The implementation of open-minded ideas was successful thanks to good cooperation between the parties
Awarded for the design and implementation were The City of Tampere/Tilapalvelut as the developer
JKMM Architects Oy for architectural design
Ramboll Finland Oy for structural planning
and contractors Pohjola Rakennus Oy Finland
The Finnish Concrete Structure of the Year competition is organised by Betoniteollisuus ry and has been organised since 1970
The award is given to a building project that best represents concrete construction in Finland
The jury of the competition includes members from the Finnish Association of Architects
the Finnish Association of Construction Engineers and Architects (RIA)
the Finnish Organisation of Civil Engineers (RIL)
Suomen Betoniyhdistys ry (“Finnish Concrete Association”)
Betoniteollisuus ry (“Concrete Industries of Finland”)
The football stadium has approximately 8,000 seats and offers space for up to 15,000 people for concerts
The hybrid block consists of a football field
and residential buildings and business premises built on the sides of the stadium
as well as a parking facility and shopping centre located under the stadium
You are on the official website of the City of Tampere.
E-mail[email protected]
Metrics details
Here we show that mouse and human lung adenocarcinomas display hierarchical features with two distinct subpopulations
one with high Wnt signalling activity and another forming a niche that provides the Wnt ligand
The Wnt responder cells showed increased tumour propagation ability
suggesting that these cells have features of normal tissue stem cells
Genetic perturbation of Wnt production or signalling suppressed tumour progression
Small-molecule inhibitors targeting essential posttranslational modification of Wnt reduced tumour growth and markedly decreased the proliferative potential of lung cancer cells
leading to improved survival of tumour-bearing mice
These results indicate that strategies for disrupting pathways that maintain stem-like and niche cell phenotypes can translate into effective anti-cancer therapies
Prices may be subject to local taxes which are calculated during checkout
An integral program for tissue renewal and regeneration: Wnt signaling and stem cell control
Repair and regeneration of the respiratory system: complexity
Lung development: orchestrating the generation and regeneration of a complex organ
The R-spondin/Lgr5/Rnf43 module: regulator of Wnt signal strength
Lineage tracing reveals Lgr5+ stem cell activity in mouse intestinal adenomas
Unlimited in vitro expansion of adult bi-potent pancreas progenitors through the Lgr5/R-spondin axis
SOX2 controls tumour initiation and cancer stem-cell functions in squamous-cell carcinoma
Defining the mode of tumour growth by clonal analysis
Tumour heterogeneity and cancer cell plasticity
RSPO2 enhances canonical Wnt signaling to confer stemness-associated traits to susceptible pancreatic cancer cells
A rare population of CD24+ITGB4+Notchhi cells drives tumor propagation in NSCLC and requires Notch3 for self-renewal
The cancer stem cell niche: how essential is the niche in regulating stemness of tumor cells
Recent clinical advances in lung cancer management
Diminished WNT → β-catenin → c-MYC signaling is a barrier for malignant progression of BRAFV600E-induced lung tumors
Wnt/β-catenin signaling accelerates mouse lung tumorigenesis by imposing an embryonic distal progenitor phenotype on lung epithelium
Wnt signaling pathway in non-small cell lung cancer
WNT/TCF signaling through LEF1 and HOXB9 mediates lung adenocarcinoma metastasis
Targeting Wnt-driven cancer through the inhibition of porcupine by LGK974
Genome-scale transcriptional activation by an engineered CRISPR–Cas9 complex
A transcriptional response to Wnt protein in human embryonic carcinoma cells
The angiocrine factor Rspondin3 is a key determinant of liver zonation
Frizzled 2 and frizzled 7 function redundantly in convergent extension and closure of the ventricular septum and palate: evidence for a network of interacting genes
Wnt pathway inhibition via the targeting of frizzled receptors results in decreased growth and tumorigenicity of human tumors
Therapeutic targeting of tumor-derived R-Spondin attenuates β-catenin signaling and tumorigenesis in multiple cancer types
Stage-specific sensitivity to p53 restoration during lung cancer progression
Analysis of lung tumor initiation and progression using conditional expression of oncogenic K-ras
Induction of medulloblastomas in p53-null mutant mice by somatic inactivation of Rb in the external granular layer cells of the cerebellum
Uncoupling cancer mutations reveals critical timing of p53 loss in sarcomagenesis
Generation of primary tumors with Flp recombinase in FRT-flanked p53 mice
A robust and high-throughput Cre reporting and characterization system for the whole mouse brain
Adenomatous polyposis coli (APC) is required for normal development of skin and thymus
Screening for tumor suppressors: loss of ephrin receptor A2 cooperates with oncogenic KRas in promoting lung adenocarcinoma
A global double-fluorescent Cre reporter mouse
Identification of stem cells in small intestine and colon by marker gene Lgr5
Cell of origin of small cell lung cancer: inactivation of Trp53 and Rb1 in distinct cell types of adult mouse lung
Conditional mouse lung cancer models using adenoviral or lentiviral delivery of Cre recombinase
The differential effects of mutant p53 alleles on advanced murine lung cancer
Toolkit for evaluating genes required for proliferation and survival using tetracycline-regulated RNAi
Constitutive transcriptional activation by a β-catenin-Tcf complex in APC−/− colon carcinoma
Development and applications of CRISPR–Cas9 for genome engineering
Compact and highly active next-generation libraries for CRISPR-mediated gene repression and activation
A modular assembly platform for rapid generation of DNA constructs
Enzymatic assembly of DNA molecules up to several hundred kilobases
Lentiviral vectors to probe and manipulate the Wnt signaling pathway
DNA targeting specificity of RNA-guided Cas9 nucleases
Genome engineering using the CRISPR–Cas9 system
Rapid modelling of cooperating genetic events in cancer through somatic genome editing
Rapid and efficient one-step generation of paired gRNA CRISPR–Cas9 libraries
The molecular signatures database (MSigDB) hallmark gene set collection
Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles
PGC-1α-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes
EBSeq: an empirical Bayes hierarchical model for inference in RNA-seq experiments
Replacing suffix trees with enhanced suffix arrays
Identification of common molecular subsequences
ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data
SSW library: an SIMD Smith–Waterman C/C++ library for use in genomic applications
Integrative genomics viewer (IGV): high-performance genomics data visualization and exploration
Understanding the New Statistics: Effect sizes
Self-renewing diploid Axin2+ cells fuel homeostatic renewal of the liver
Download references
Sharp for critical reading of the manuscript and T
Papagiannakopoulos for helpful discussions; H
Clevers for Lgr5CreER/+ mice; Janssen Pharmaceuticals for human tissue; J
Bronson for expertise in animal pathology; Y
Levine for massively parallel sequencing expertise; L
Weissman for Lgr5 CRISPR gene activation sgRNA sequences; A
Li for help with generation of TCGA data catalogues; M
Cormier and the Hope Babette Tang (1983) Histology Facility for histology support; S
Yee for administrative support; and the Swanson Biotechnology Center for excellent core facilities
This work was financially supported by the Transcend Program and Janssen Pharmaceuticals
by the Cancer Center Support (core) grant P30-CA14051 from the National Cancer Institute
is supported by the National Cancer Institute (K99 CA187317)
the Hope Funds for Cancer Research and the Maud Kuistila Foundation
is a Howard Hughes Medical Institute Investigator
Koch Institute for Integrative Cancer Research
University of Massachusetts Medical School
performed all types of experiments reported in the study; F.J.S.-R
performed CRISPR gene activation experiments and analysed CRISPR-mutated loci; N.M.C
performed gene expression analysis and N.M.C
performed cell culture experiments; M.C.-B
developed and used microcomputed tomography analysis methodology; W.X
conducted bioinformatic analyses; F.J.S.-R.
wrote the manuscript with comments from all authors
The authors declare no competing financial interests
Clevers and the other anonymous reviewer(s) for their contribution to the peer review of this work
Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations
qRT–PCR analysis of the Wnt target genes Axin2 (m) and Lgr5 (n) in 3D cultures of sublines of a KP LUAD cell line (TT5764) expressing the CRISPR-activator system driving expression of Rspo2 (Rspo2-a)
Data are mean ± s.d.; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; n.s.
Lgr5 and Lgr6 transcripts in sublines of a KP LUAD cell line stably expressing shLgr4
Note minimal effects of the indicated shRNAs on other Lgr5 family members
n = 3 technical replicates per condition; representative data from three experiments carried out in different cell lines
Formation of 3D tumour spheroids of sublines of a KP LUAD cell line expressing the indicated shRNAs in response to 1 μg ml−1 Rspo1 (b
representative data from three experiments carried out in different cell lines
No difference in cell morphology (f) or growth rate (g) in sublines of a KP LUAD cell line expressing shLgr4
shLgr6 or control shLuciferase (shLuc) over six days in two-dimensional cell culture
Data are mean + s.d.; *P < 0.05; **P < 0.01; ***P < 0.001; Student’s two-sided t-test (a) or two-way ANOVA (c
All experiments were performed three times
each time with a different KP LUAD cell line
a, Schematic representation of the lentiviral vector46 used to transduce a KPT LUAD cell line
tdTomato and 7TCF::Luciferase signals at baseline (0 h) and 48 h after treatment with 10 mg per kg per day LGK974 or vehicle
Red arrows indicate two subcutaneous tumours with reduced 7TCF-dependent bioluminescence in response to 48 h of LGK974 treatment
Suppression of 7TCF-driven bioluminescence by LGK974 relative to the tdTomato signal in mice with subcutaneous transplants of the KPT LUAD cell line stably expressing the 7TCF::Luciferase-PGK-Puro lentivirus
three mice per group; representative data from two independent experiments
Data are mean ± s.d.; Student’s two-sided t-test
Haematoxylin and eosin (HE) or β-catenin staining in KP adenomas or in adenocarcinomas
Immunofluorescence for β-catenin (red) and porcupine (green) in a KP LUAD
arrowheads) in KP lung adenomas or adenocarcinomas
Immunofluorescence for porcupine (green) in an autochthonous grade 3 KPT adenocarcinoma
Arrowheads indicate peritumoural porcupine+ cells
CD11b (green) and porcupine (red) immunofluorescence in a peritumoural region
Immunohistochemistry for β-catenin or porcupine in human LUAD
Arrowheads indicate cells with nuclear β-catenin
65 human LUAD tumours in two tissue microarrays were analysed
Comparison of PORCN gene expression in tumours versus normal tissue in the TCGA lung adenocarcinoma cohort: Empirical cumulative density function (CDF) plots of standardized gene expression values are shown
A right-shift indicates relatively higher expression
with P values indicated to assess statistical significance (Kolmogorov–Smirnov test)
Qualitative analysis of mutations introduced by sgPorcn.2 in vivo
base pair (indicates the size of the insertion or deletion); INS
Ratio indicates frequency of event across the 15 samples analysed
not significant; Student’s two-sided t-test (a
Immunofluorescence for GFP (green) and EpCAM (red) in a subcutaneous transplant established from a single-cell clone of a KPT;Lgr5CreER/+ cell line
Immunofluorescence for GFP (green) and porcupine (red) in a subcutaneous transplant established from a single-cell clone of a KPT;Lgr5CreER/+ cell line
Data are representative of four replicate experiments
each with a different KP;Lgr5CreER/+ cell line
ISH for Lgr5 mRNA (purple) in KP;Pdx1::Cre PDAC
Representative of three PDAC tumours analysed
Immunofluorescence staining for GFP (green) in a tdTomato+ (red) autochthonous KP;Lgr5GFP-CreER/+;Rosa26tdTomato/+;Pdx1::Cre PDAC
Quantification of primary spheroids containing EdU+ cells per 100 Lgr5+tdTomato+ or Lgr5−tdTomato+ primary mouse PDAC cells plated
Data are mean ± s.d.; *P < 0.05; Student’s two-sided t-test
Immunofluorescence staining for GFP (green) and porcupine (red) in autochthonous KP;Lgr5GFP-CreER/+;Pdx1::Cre PDAC
Note juxtaposition of Lgr5+ and porcupine+ cells in the tumours
Representative data from six KP;Lgr5GFP-CreER/+;Pdx1::Cre PDAC tumours analysed
Immunofluorescence staining for GFP (green) and porcupine in an autochthonous ApcΔ/Δ;Lgr5GFP-CreER/+intestinal adenoma
note juxtaposition of Lgr5+ and porcupine+ cells in the tumours
Immunohistochemistry for porcupine (brown) in human colorectal adenocarcinoma
Five human colorectal adenocarcinoma samples were analysed
Qualitative analysis of mutations introduced by sgLgr4 or sgLgr5 in vivo
base pair (indicates size of insertion/deletion); INS
Ratio indicates frequency of event across all samples analysed
qPCR analysis of Rspo gene expression in 16 KP LUAD tumours
Tumours were collected at 16 weeks after initiation with adenoviral Cre
Note the Rspo1 transcripts in endothelial cells
qPCR for Rspo1 and Rspo3 in tdTomato+ tumour cells (tumour)
CD31+ endothelial cells and the rest of the cells (stroma) in microdissected KPT LUAD tumours following sorting
The expression of Pecam1 (which encodes CD31) was found to be >400-fold enriched in the CD31+ fraction compared to the stroma (not shown)
representative of two replicate experiments
Heatmap showing relative expression levels of Porcn and the 19 mouse Wnt genes on the basis of the qPCR analysis in sorted tdTomato+ KP LUAD cells (T) versus tdTomato− stromal cells (S) in microdissected tumours collected at 20 weeks after tumour initiation (a time point when most tumours are adenocarcinomas)
Volcano plot of qPCR array gene expression analysis showing statistically significant differentially expressed genes (in red
x axis is the log2 fold change (tumour/stroma) and y axis is the –log10P value of the differential enrichment (two-sided t-test)
Wnt7a and Wnt7b gene expression in KP tumours microdissected at 9 weeks (adenomas) or 20 weeks (adenocarcinomas) after initiation with adenoviral Cre
Comparison of WNT gene expression in tumours versus normal tissue in the TCGA lung adenocarcinoma cohort: Empirical CDF plots of standardized gene expression values for WNT5A and WNT7B are shown
Heatmap showing relative expression levels of Lrp5
Lrp6 and nine mouse Fzd genes on the basis of the qPCR analysis in sorted tdTomato+ KP LUAD cells (T) versus tdTomato− stromal cells (S) in microdissected tumours collected at 20 weeks after tumour initiation (a time point when most tumours are adenocarcinomas)
qPCR analysis of eight Fzd receptors in KP tumours microdissected at 9 weeks (adenomas) or 20 weeks (adenocarcinomas) after initiation with adenoviral Cre
Data are mean ± s.d.; *P < 0.05; Student’s two-sided t-test (b
qPCR analysis of Axin2 and Lgr5 transcripts in KP LUAD tumours two weeks after treatment with 10 mg per kg per day LGK974 or vehicle
Treatment was started at 11 weeks after tumour initiation
Quantification of μCT data showing change in tumour volume compared to baseline (obtained at 76 days after tumour initiation
dashed line) after four weeks of 10 mg per kg per day LGK974 or vehicle control
Recipient mouse lungs four weeks after orthotopic GEMM-DA of 50,000 primary tdTomato+ (red) mouse LUAD cells
Donor mice bearing autochthonous KPT LUAD tumours were treated for two weeks with LGK974 or vehicle (starting at 84 days after tumour induction)
The recipient mice were treated with LGK974 or vehicle for four weeks
tdTomato+ tumours in sections from lungs in c containing EdU+ cells (white arrowheads) or not containing EdU+ cells (yellow arrowheads)
Quantification of EdU+ (black) or EdU− (grey) tumours per section through the lungs depicted in c
representative data from three replicate experiments
Data are mean ± s.d.; *P < 0.05; Student’s two-sided t-test (a
This file contains additional discussion on the differences between R-spondin and Wnt ligand stimulation
This file contains Supplementary Tables 1-4
Download citation
Anyone you share the following link with will be able to read this content:
a shareable link is not currently available for this article
Lung adenocarcinomas are aggressive tumours which are associated with poor treatment outcome
Tyler Jacks and colleagues now show that lung adenocarcinomas display two distinct subpopulations of tumour cells
One of these shows high levels of Wnt signalling and gives rise to the second one that produces Wnt ligands
The latter population fuels tumour growth of the former
showing that lung cancer cells can produce their own niche
These findings shed new light on the mechanisms underlying intratumoural heterogeneity which may have therapeutic implications
Sign up for the Nature Briefing: Cancer newsletter — what matters in cancer research
About us | Advertise with us | Contact us
Posted: 20 November 2023 | Drug Target Review |
Eliminating AT1-like cells in experimental models has shown potential to improve KRAS inhibitor treatment for lung adenocarcinoma
Memorial Sloan Kettering Cancer Center (MSK) scientists have gained a new understanding of lung cancer cells’ ‘memories’ which suggests a new strategy for improving treatment
Research from the lab of cancer biologist Dr Tuomas Tammela demonstrates that some lung cancer cells keep a ‘memory’ of the healthy cell where they originated from
This could be exploited to make KRAS inhibition more effective
The study focused on lung adenocarcinoma
a type of non-small cell lung cancer that is the most frequent type of lung cancer in the US and responsible for seven percent of all cancer deaths
This cancer is often driven by mutations in the KRAS gene
The study’s co-first author Zhuxuan “Zoe” Li
a doctoral student in the Tammela lab at MSK’s Sloan Kettering Institute
cancer driving KRAS proteins were considered ‘undruggable.’” She continued: “Within the last few years
Food and Drug Administration approved the first KRAS inhibitors
and most patients’ cancers eventually acquire resistance to the drugs and come back.”
discovered valuable information about lung cancer cells that remain after treatment with a KRAS inhibitor
They suggest that separately targeting these cells alongside treatment with a KRAS inhibitor could help prevent recurrence
Oxygen is absorbed into the lungs
and carbon dioxide released via air sacs called alveoli
The lining of the alveoli is made from two different types of cells: alveolar type 1 (AT1) and alveolar type 2 (AT2)
with a large surface to facilitate gas exchange between the lungs and the bloodstream
secrete compounds that are crucial for the health and function of the lungs
They also aid in maintaining and repairing the lungs by dividing to create replacement AT1 cells
Dr Tammela described them as “stem cells with a day job.” Lung cancer cells usually develop from AT2 cells
These cancer cells adopt some ‘remembered’ properties of the AT1 cells that AT2 cells differentiate into when they are playing their stem cell role
KRAS has an essential role in regulating cell growth and division in healthy cells. However, when the gene becomes mutated, it can lead to excessive cell proliferation
KRAS inhibitors can switch off this explosive growth
but they still leave behind cancer cells that are not sensitive to the drug
This gives the cancer the opportunity to develop new mutations to resist the drugs’ effects
The scientists used genetically engineered mouse models, mice implanted with patient-derived tumours and tumour samples from patients to study determine the mechanisms of this resistance
They found that the cancer cells that remained after treatment were AT1-like cells
and they have the capacity to reignite the cancer’s runaway growth
we found that if you get rid of these AT1-like cells
it greatly improves the treatment response to KRAS inhibitors,” Dr Tammela said
Eliminating those cells in experimental models is fairly easy
but doing so in the clinic will require further research
Dr Tammela explained: “Now that we’ve done these proof-of-concept experiments
the next step would be to find surface proteins that are unique to these AT1-like cells and then develop a therapeutic that can bind to them and kill them.”
The study was published in Cancer Discovery
Related topicsCancer research, Drug Development, Drug Targets
Related conditionsLung adenocarcinoma (LAUD)
Related organisationsMemorial Sloan Kettering Cancer Center (MSK), MSK’s Sloan Kettering Institute
Related peopleDr Tuomas Tammela (MSK’s Sloan Kettering Institute), Dr Xueqian Zhuang (MSK), Zhuxuan Li (MSK’s Sloan Kettering Institute)
By Drug Target Review
Cancer research, Drug Development, Drug Targets
Lung adenocarcinoma (LAUD)
Memorial Sloan Kettering Cancer Center (MSK), MSK’s Sloan Kettering Institute
Dr Tuomas Tammela (MSK’s Sloan Kettering Institute), Dr Xueqian Zhuang (MSK), Zhuxuan Li (MSK’s Sloan Kettering Institute)
All subscriptions include online membership
giving you access to the journal and exclusive content
By Dr. Pooja Hingorani (Senior Medical Director of Oncology Early Development at AbbVie)
By Alessio Zoccoli, Carlos N Velez, Remco Jan Geukes Foppen, Vincenzo Gioia
Comment * document.getElementById("comment").setAttribute( "id"
"ad98543042ef8a419d4cc4031332f1d8" );document.getElementById("a3f6228d48").setAttribute( "id"
Write for us | Advertise with us
Drug Target Review is published by: Russell Publishing Ltd.Court LodgeHogtrough HillBrasted
© Russell Publishing Limited, 2010-2025. All rights reserved. Terms & Conditions | Privacy Policy | Cookie Policy
Website development by e-Motive Media Limited
Necessary cookies enable the core functionality of the website
These cookies do not store any personal information
You may disable these by changing your browser settings
but this may affect how the website functions
CookieTypeDurationDescriptioncookielawinfo-checkbox-advertising-targetingpersistent1 yearThe cookie is set by GDPR cookie consent to record the user consent for the cookies in the category "Advertising & Targeting".cookielawinfo-checkbox-analyticspersistent1 yearThis cookie is set by GDPR Cookie Consent WordPress Plugin
The cookie is used to remember the user consent for the cookies under the category "Analytics".cookielawinfo-checkbox-necessarypersistent1 yearThis cookie is set by GDPR Cookie Consent plugin
The cookie is used to store the user consent for the cookies in the category "Necessary".cookielawinfo-checkbox-performancepersistent1 yearThis cookie is set by GDPR Cookie Consent WordPress Plugin
The cookie is used to remember the user consent for the cookies under the category "Performance".PHPSESSIDsession1 yearThis cookie is native to PHP applications
The cookie is used to store and identify a users' unique session ID for the purpose of managing user session on the website
The cookie is a session cookies and is deleted when all the browser windows are closed.viewed_cookie_policypersistent1 yearThe cookie is set by the GDPR Cookie Consent plugin and is used to store whether or not user has consented to the use of cookies
It does not store any personal data.zmember_loggedsession1 yearThis session cookie is served by our membership/subscription system and controls whether you are able to see content which is only available to logged in users
Advertising and targeting cookies help us provide our visitors with relevant ads and marketing campaigns
CookieTypeDurationDescriptionadvanced_ads_browser_widthpersistent1 monthThis cookie is set by Advanced Ads and measures the browser width.advanced_ads_page_impressionspersistent2 yearsThis cookie is set by Advanced Ads and measures the number of previous page impressions.advanced_ads_pro_server_infopersistent1 monthThis cookie is set by Advanced Ads and sets geo-location
It is used by cache busting in Advanced Ads Pro when the appropriate visitor conditions are used.advanced_ads_pro_visitor_referrerpersistent1 yearThis cookie is set by Advanced Ads and sets the referrer URL.bscookiepersistent2 yearsThis cookie is a browser ID cookie set by LinkedIn share Buttons and ad tags.IDEpersistent2 yearsThis cookie is set by Google DoubleClick and stores information about how the user uses the website and any other advertisement before visiting the website
This is used to present users with ads that are relevant to them according to the user profile.li_sugrpersistent3 monthsThis cookie is set by LinkedIn and is used for tracking.UserMatchHistorypersistent1 monthThis cookie is set by Linkedin and is used to track visitors on multiple websites
in order to present relevant advertisement based on the visitor's preferences.VISITOR_INFO1_LIVEpersistent5 monthsThis cookie is set by YouTube
Used to track the information of the embedded YouTube videos on a website
Analytics cookies collect information about your use of the content
and in combination with previously collected information
CookieTypeDurationDescriptionbcookiepersistent2 yearsThis cookie is set by LinkedIn
Vimeo will drop third party cookies to enable the video to play and to see how long a viewer has watched the video
This cookie does not track individuals.wow.anonymousIdpersistent2 yearsThis cookie is set by Spotler and tracks an anonymous visitor ID.wow.schedulepersistent20 minutesThis cookie is set by Spotler and enables it to track the Load Balance Session Queue.wow.sessionpersistent20 minutesThis cookie is set by Spotler to track the Internet Information Services (IIS) session state.wow.utmvaluespersistent20 minutesThis cookie is set by Spotler and stores the UTM values for the session
UTM values are specific text strings that are appended to URLs that allow Communigator to track the URLs and the UTM values when they get clicked on._gapersistent2 yearsThis cookie is set by Google Analytics and is used to calculate visitor
campaign data and keep track of site usage for the site's analytics report
It stores information anonymously and assign a randomly generated number to identify unique visitors._gatpersistent1 minuteThis cookies is set by Google Universal Analytics to throttle the request rate to limit the collection of data on high traffic sites._gidpersistent1 dayThis cookie is set by Google Analytics and is used to store information of how visitors use a website and helps in creating an analytics report of how the website is doing
The data collected including the number visitors
and the pages visited in an anonymous form
Performance cookies include cookies that deliver enhanced functionalities of the website
CookieTypeDurationDescriptioncf_ob_infopersistent1 minuteThis cookie is set by Cloudflare content delivery network and
in conjunction with the cookie 'cf_use_ob'
Published in 4/2024 - Colour
Article
Four new-builds and one refurbishment project are in the running for this year’s Finlandia Prize for Architecture
The latest Finlandia Prize for Architecture shortlist
an opportunity to speculate about what the choice of candidates might reveal about the current state and future of Finnish architecture
the winner will be chosen by a non-architect selector
their own personal likes and private preferences
The jury charged with selecting the shortlist consists exclusively of professional architects
ideally placed to accurately sniff out the choicest architectural gems each year
a total of 47 buildings have been shortlisted
among them Helsinki University Main Library (Anttinen Oiva 2012)
the Löyly building housing a public sauna and restaurant (Avanto 2016)
Helsinki’s Central Library Oodi (ALA 2018)
That none of the above projects went on to win speaks volumes about just how unpredictable the selection process can be
is made up of five candidates: four new-builds and one refurbishment project
What immediately jumps out upon surveying the shortlist is how extremely well the Tampere region has fared this year
having bagged as many as three spots on the list
the first ever candidate from within the city itself
a joint venture between Tampere and its neighbouring Kangasala and the Hyytiälä Forestry Field Station in Juupajoki
has this year had to settle for just one candidate in the form of the Tapiola Church refurbishment project
is a new building for the Step Education in Järvenpää
Although much of the development that has taken place in Finland in recent years has been heavily concentrated in the country’s growth centres
only Tammela Stadium is located in a densely-built urban setting
Representing the opposite end of the spectrum is Hyytiälä Forestry Field Station with its idyllic rural setting
exerts a new and serenely white influence over a somewhat higgledy-piggledy campus
while the new Lamminrahka neighbourhood has gained its first ever landmark in the form of the newly built school
the most visible sign that the garden city’s iconic church has undergone a refurbishment is its new entrance
Although much of the development in recent years has been heavily concentrated in the growth centres
a handful of architectural practices have managed to bag multiple shortlist spots year after year
Overwhelmingly topping the nominations leaderboard is JKMM
who bagged yet another nomination this year
The shortlist also features two other past winners: last year’s number one
who won in 2016 with their Puukuokka Housing Block
who have received the nod on more than one occasion too
we do have a first-time nominee in Raudanko + Kankkunen
in light of the other names on the shortlist
particularly prevalent in Finnish school and nursery buildings
is again a visible presence on the shortlist
thanks to Lastu and the Hyytiälä Forestry Field Station
Both feature visually striking CLT interiors
But given that the main prize last year went to the Martta Wendelin Daycare Centre
surely we’re due something new and exciting on the timber construction front
a secondary school and cultural centre in Tuusula designed by AOR Architects
which uses laminated logs on a scale that has never really been seen before
And what about the aesthetic side of things
Does the shortlist tell us something about the kind of architecture we can expect to see in the next few years
all the shortlisted works represent confident
skillful design that draws on the modernist tradition
rely on the “authentic” natural colour of the materials used.
Tammela Stadium and Hyytiälä Forestry Field Station both have the sort of tectonic quality that is rarely seen in Finnish architecture
With its 100-metre long suspended roof structures and sculptural concrete pillars
while the forest station’s archetypal form recalls Gottfried Semper’s theories on the fundamental elements of architecture
those elements consist of an elevated platform
both rely on symmetry while deliberately disrupting it: the stadium’s convex roof is compromised by the high-rise residential buildings towering above it complete with irregular window placement
while at the forest station a series of symmetrical blocks wrap around the outdoor space
Tammela Stadium and Hyytiälä Forestry Field Station both have the sort of tectonic quality that is rarely seen in Finnish architecture
Lastu and Lamminrahka School Centre represent an entirely different approach
They consist of seemingly randomly interlinking volumes between which a series of open public spaces are created
the whiteness of the roof and external walls both highlight its geometric form and set it apart from its neighbours
a series of materials choices have been employed to break up the vast mass
By far the most modernist of the shortlisted candidates is Tapiola Church
an outstanding example of modern sacral architecture in Finland that dates back to 1965
A number of Finlandia Prizes have already been awarded to refurbishments of our modern architectural classics
will Aarno Ruusuvuori’s ascetic concrete design wow Antti Kuronen like his predecessors were bowled over by the rhythmical majesty of Käärmetalo
the heroic flair of the Olympic Stadium and the light-filled interiors of Jyväskylä University Library
The answer will be revealed in early October
when the winner of this year’s Finlandia Prize for Architecture is announced
Kristo Vesikansa is the Editor-in-Chief of the Finnish Architectural Review
Interview
built next to the Finlandia Hall during its renovation
has been designed in accordance with the principles of circular economy construction and reverse building design
It is also the first big completed project for three architecture students
Rainer Mahlamäki sees at least three factors that explain the modest international visibility of contemporary Finnish architecture
The photos in the article show the 11 Finnish buildings that have been shortlisted for the Mies van der Rohe Award
The decade-long engagement and consultation process that preceded the launch of Helsinki’s new central library Oodi meant that building came heavily laden with expectations
Subscribe
Read on to discover our latest interviewee’s answers for The Luxury Lifestyle List
We caught up with Enly Tammela, the leading fashion model and visionary founder behind the premium ENLY candle brand
Enly’s dedication to her craft keeps her name on everyone’s lips
and campaigns for distinguished multi-million dollar clients such as Ralph Lauren
Enly has called New York City her home for the last decade
I drive quite a bit in the city and having a big car just makes me feel safe
My choice of car is a Mercedes Benz G-Class
I do have a little crush on the convertible right now
It is also perfect for a little getaway and it is always fun to drive
My favourite destination for some time has been St Barths
recently I traveled to Turks and Caicos and fell in love with the Amanyara hotel
It was unbelievably beautiful with white sand
I like to think that I can live without any gadget but if I had to pick one it would be my phone just because having a new business requires me to use my phone more than before
But I am definitely not a tech/gadget person
I love interacting with people in real life
I love their quality and comfort that comes with a little kick of colour
texture and effortless look but still makes me feel sexy
My go to brand for essentials such as tank tops
perfect little black dresses and custom pieces is Travis Taddeo
I love supporting brands that have soul and authenticity
I don’t like flying even though it has been a very big part of my whole life
My favourite flying experience is definitely a Blade seaplane to the Hamptons just because it’s short and sweet
I never thought that I would be into watches but I treated myself to a Rolex a few years ago and I have been wearing it ever since and I love it
Something more feminine like gold Panthere de Cartier
I have been going there for so many years and have become very friendly with the team
They always take good care of me and seat me and my pup Strawberry at my favourite table
A perfect glass of Beaujolais while watching Sex and the City
I love supporting local small businesses because they are the heart of what New York City is about
Through my business I plan on giving back to charities that are supporting children’s education and artistry
Open image viewerIlves were not expected to beat Austria Vienna
Image: IMAGO/Branislav Racko/ All Over PressYle News1.8.2024 11:04Ilves Tampere pulled off a shock win over Austria Vienna to go through to the third qualifying round of the Uefa Conference League
in the best result a Finnish club has achieved in European football so far this season
They had won the first leg 2-1 last week at Tammela
The second leg on Wednesday evening was a real thriller
with Ilves levelling the tie on aggregate three times before winning a penalty shootout 5-4
scoring all five of their kicks and substituting their goalkeeper specifically for penalties right at the end of extra time
Otso Virtanen had been injured in the first leg and replaced by Ville Seppä
but was brought on for penalties and saved the final kick from Dominik Fitz
Ilves are now set to play Swedish team Djurgården in the third qualifying round
who are 3-0 up after their first leg against Progrés from Luxembourg
Users with an Yle ID can leave comments on our news stories. You can create your Yle ID via this link. Our guidelines on commenting and moderation are explained here
Scientists at the Sloan Kettering Institute, the Koch Institute at MIT, and the Klarman Cell Observatory at the Broad Institute have identified an unusual cell state that emerges early in tumor evolution and supports a cancer’s ability to outwit chemotherapy
Cancer’s knack for developing resistance to chemotherapy has long been a major obstacle to achieving lasting remissions or cures
While tumors may shrink soon after chemotherapy
Scientists once thought that unique genetic mutations in tumors underlay this drug resistance
nongenetic changes in cancer cells to explain their adaptability
For example, one way that cancer cells can develop resistance is by changing their identity. A prostate cancer cell that is sensitive to hormone-blocking therapy might morph into a cell type that does not require the hormone for its growth
Rather than specific mutations driving them
identity changes like these come about through changes in gene expression — cells turning specific genes on or off
a single tumor can become very different in its cellular makeup
This heterogeneity creates challenges for treatment
since a single drug is unlikely to work against so many different cell types
A new study from a team of researchers at the Sloan Kettering Institute
the Koch Institute for Integrative Cancer Research at MIT
and the Klarman Cell Observatory at the Broad Institute finds that this tumor heterogeneity can be traced to a common source: a particularly flexible cell state that is characteristic of a subset of cells in a tumor and can generate many other diverse cell types
“The high-plasticity cell state is the starting point for much of the heterogeneity we see in tumors,” says Tuomas Tammela, an Assistant Member in the Cancer Biology and Genetics Program at SKI and the corresponding author on the new paper, published July 23 in the journal Cancer Cell
“It’s kind of like a busy intersection of many roads: Wherever a cell wants to end up identity-wise
it has to go through this cell state.”
Because this cell state produces nearly all the cellular heterogeneity that emerges in tumors
it is an attractive target for potential therapies
The particular tumors the researchers examined were lung cancer tumors growing in mice. Jason Chan
a physician-scientist doing a fellowship in the Tammela lab and one of the paper’s lead authors
says finding this unusual cell state was a surprise
“This highly plastic cell state is something completely new,” he says
we didn’t know what it was because it was so different
It didn’t look like normal lung cells where the cancer came from
and it didn’t really look like lung cancer either
It had features of embryonic germ layer stem cells
he and his colleagues found these cells in every tumor they examined
which suggested that the cells were doing something biologically very important
The researchers identified these highly plastic cells by employing a relatively new laboratory technique called single cell RNA sequencing (scRNA-Seq)
This technique allows researchers to take “snap shots” of individual cells’ gene expression profiles — revealing which genes are on or off
By performing scRNA-Seq on tumors as they grew over time
they were able to watch when and how different cell types emerged over the course of a tumor’s evolution
the researchers were able to create a kind of map of which cells came from which other cells
“The map contains major highways and little dirt roads,” Dr
“The high-plasticity cell state that we identified sits right in the middle of the map
and it has even more paths coming out.”
This high-plasticity cell state emerged consistently in a tumor’s evolution and persisted throughout its growth
“it was the only cell state that we found to be present in every single tumor.”
Plasticity — the ability of a cell to give rise to other cells that take on different identities — is a well-known feature of stem cells
Stem cells play important roles in embryonic development and in tissue repair
Many scientists think that cancers arise from specific cancer stem cells
Tammela and colleagues do not think these high-plasticity cells are stem cells
“When we compare the gene expression signature of these highly plastic cells to normal stems cells or known cancer stem cells
They look completely different,” he says
they’re not there at the very beginning of a tumor’s growth
Many prior studies have looked for possible “resistance mutations” — genetic changes that account for a tumor’s ability to resist the effects of cancer drugs
more often the basis of resistance remains a mysterious
The new findings offer a potential solution to the mystery
“Our model could explain why certain cancer cells are resistant to therapy and don’t have a genetic basis for that resistance that we can identify,” Dr
it’s not all the cells in the tumor that are adapting
It’s a subset of the cancer cells that are just more plastic
By combining chemotherapy drugs with new medications that target these highly plastic cells
the researchers think it might be possible to avert the emergence of resistance and provide longer lasting remissions
save lives during surgeries and shield us from fatal infections
That’s why scientists are exploring new sources
Our regular soil might just be the knight in shining armor
Soil is the birthplace of about 70% of all currently licensed antibiotics
specifically a group of organisms known as actinobacteria
the charming little blue-green planet we call home
Many of her nooks and crannies are still unexplored
including a plethora of untapped habitats for actinobacteria
And who knows, these little microbes could hold the key to the next generation of antibiotics
Here’s the best part: these fresh antibiotics might not annihilate bacteria
but they could reduce their ‘virulence’ or disease-causing capability
That’s like turning a fearsome dragon into a harmless lizard
it’s harder for bacteria to fight back
Now, let’s meet the brain behind this revolutionary idea. Dr Päivi Tammela of the University of Helsinki
and her team have developed advanced screening assays to spot these antivirulence and antibacterial metabolites in actinobacteria extracts
They discovered a compound from the Arctic Ocean that can inhibit the virulence of E
coli that wreaks havoc on children under five
This nasty bacterium sticks to cells in the gut and injects destructive ‘virulence factors’ into the host cell
The team then sailed off to the Arctic Sea
to an island called ‘Svalbard,’ aboard the Norwegian research vessel ‘Kronprins Haakon.’
and extracted and separated their cells into fractions
Researchers found two unknown compounds from the strains Rhodococcus and Kocuria which showed strong antivirulence or antibacterial activity
“Here we show how advanced screening assays can identify antivirulence and antibacterial metabolites from actinobacteria extracts,” said Dr Tammela
“We discovered a compound that inhibits enteropathogenic E
coli (EPEC) virulence without affecting its growth
both in actinobacteria from the Arctic Ocean.”
That makes it a promising candidate since E. coli is less likely to evolve resistance against this strain
Tammela and her team found that the active compound was most likely a phospholipid
a fatty molecule crucial for cell metabolism
The discovery of these novel compounds presents a paradigm shift in the pursuit of new antibiotics. By focusing on antivirulence strategies rather than outright bacterial elimination, researchers can potentially reduce the evolutionary pressure that drives antibiotic resistance
This means that we might not only preserve existing antibiotics for longer but also ensure that treatments can evolve alongside ever-adapting bacteria
As the tide of resistance continues to rise
such innovative approaches could safeguard our arsenal of medications
granting us additional time to explore further solutions for the looming antibiotic crisis
As we stand on the brink of this exciting new frontier
the journey ahead demands collaboration across various scientific disciplines
and clinicians must join forces to rigorously test and refine these promising compounds
funding institutions and policy-makers should prioritize research initiatives that explore microbial biodiversity and its potential applications
By promoting an environment of interdisciplinary research and innovation
we can encourage the discovery of even more exciting treatments that could stem the tide of bacterial resistance
keeping our communities safe and healthy for generations to come
The team is now focused on optimizing culture conditions for antibiotic compound production
isolating enough of each compound for further study
and understanding their respective bioactivities
That’s the great thing about science
The study is published in the journal Frontiers in Microbiology
Like what you read? Subscribe to our newsletter for engaging articles
Check us out on EarthSnap, a free app brought to you by Eric Ralls and Earth.com
Metrics details
involves specification of endothelial cells to tip cells and stalk cells
whereas vascular endothelial growth factor receptor (VEGFR)-2 and VEGFR-3 have been implicated in angiogenic sprouting
we found that endothelial deletion of Vegfr3
postnatally led to excessive angiogenic sprouting and branching
and decreased the level of Notch signalling
indicating that VEGFR-3 possesses passive and active signalling modalities
macrophages expressing the VEGFR-3 and VEGFR-2 ligand VEGF-C localized to vessel branch points
and Vegfc heterozygous mice exhibited inefficient angiogenesis characterized by decreased vascular branching
FoxC2 is a known regulator of Notch ligand and target gene expression
and Foxc2+/−;Vegfr3+/− compound heterozygosity recapitulated homozygous loss of Vegfr3
These results indicate that macrophage-derived VEGF-C activates VEGFR-3 in tip cells to reinforce Notch signalling
which contributes to the phenotypic conversion of endothelial cells at fusion points of vessel sprouts
Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene
Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele
Failure of blood island formation and vasculogenesis in Flk-1-deficient mice
Analysis of biological effects and signaling properties of Flt-1 (VEGFR-1) and KDR (VEGFR-2)
A reassessment using novel receptor-specific vascular endothelial growth factor mutants
Lymphangiogenesis: molecular mechanisms and future promise
Ligand-induced vascular endothelial growth factor receptor-3 (VEGFR-3) heterodimerization with VEGFR-2 in primary lymphatic endothelial cells regulates tyrosine phosphorylation sites
VEGF receptor 2/-3 heterodimers detected in situ by proximity ligation on angiogenic sprouts
Cardiovascular failure in mouse embryos deficient in VEGF receptor-3
Distinct genetic interactions between multiple Vegf receptors are required for development of different blood vessel types in zebrafish
Expression of the fms-like tyrosine kinase FLT4 gene becomes restricted to lymphatic endothelium during development
Transgenic induction of vascular endothelial growth factor-C is strongly angiogenic in mouse embryos but leads to persistent lymphatic hyperplasia in adult tissues
Vascular endothelial growth factor receptor-3 in lymphangiogenesis in wound healing
VEGFR-3 and its ligand VEGF-C are associated with angiogenesis in breast cancer
Blocking VEGFR-3 suppresses angiogenic sprouting and vascular network formation
Vascular endothelial growth factor C is required for sprouting of the first lymphatic vessels from embryonic veins
Vascular endothelial growth factor D is dispensable for development of the lymphatic system
Deletion of vascular endothelial growth factor C (VEGF-C) and VEGF-D is not equivalent to VEGF receptor 3 deletion in mouse embryos
VEGF guides angiogenic sprouting utilizing endothelial tip cell filopodia
Dll4 signalling through Notch1 regulates formation of tip cells during angiogenesis
The Notch ligand Delta-like 4 negatively regulates endothelial tip cell formation and vessel branching
Regulation of vascular morphogenesis by Notch signaling
Endothelial tubes assemble from intracellular vacuoles in vivo
The molecular basis of vascular lumen formation in the developing mouse aorta
Tissue macrophages act as cellular chaperones for vascular anastomosis downstream of VEGF-mediated endothelial tip cell induction
M-CSF inhibition selectively targets pathological angiogenesis and lymphangiogenesis
Macrophage diversity enhances tumor progression and metastasis
Notch signalling limits angiogenic cell behaviour in developing zebrafish arteries
The notch ligands Dll4 and Jagged1 have opposing effects on angiogenesis
inducible Cre-recombinase activation in vascular endothelium
VEGF-C is a trophic factor for neural progenitors in the vertebrate embryonic brain
and macrophage recruitment by vascular endothelial growth factor-C in melanoma
A model for gene therapy of human hereditary lymphedema
Endothelial cell adhesion to the extracellular matrix induces c-Src-dependent VEGFR-3 phosphorylation without the activation of the receptor intrinsic kinase activity
Endothelial cells dynamically compete for the tip cell position during angiogenic sprouting
Hematological characterization of congenital osteopetrosis in op/op mouse
Possible mechanism for abnormal macrophage differentiation
Critical role of endothelial Notch1 signaling in postnatal angiogenesis
Convergence of Notch and β-catenin signaling induces arterial fate in vascular progenitors
Foxc transcription factors directly regulate Dll4 and Hey2 expression by interacting with the VEGF-Notch signaling pathways in endothelial cells
Defective valves and abnormal mural cell recruitment underlie lymphatic vascular failure in lymphedema distichiasis
FOXC2 controls formation and maturation of lymphatic collecting vessels through cooperation with NFATc1
Vascular endothelial growth factor receptor 3 is involved in tumor angiogenesis and growth
Endothelial extracellular matrix: biosynthesis
and functions during vascular morphogenesis and neovessel stabilization
VEGFR-3 ligand-binding and kinase activity are required for lymphangiogenesis but not for angiogenesis
Ephrin-B2 controls VEGF-induced angiogenesis and lymphangiogenesis
Ephrin-B2 regulates VEGFR2 function in developmental and tumour angiogenesis
Claudin-like protein 24 interacts with the VEGFR-2 and VEGFR-3 pathways and regulates lymphatic vessel development
Vascular endothelial growth factor receptor-2 and neuropilin-1 form a receptor complex that is responsible for the differential signaling potency of VEGF(165) and VEGF(121)
Targeted deficiency or cytosolic truncation of the VE-cadherin gene in mice impairs VEGF-mediated endothelial survival and angiogenesis
Notch alters VEGF responsiveness in human and murine endothelial cells by direct regulation of VEGFR-3 expression
Vegfc is required for vascular development and endoderm morphogenesis in zebrafish
Targeting exogenous genes to tumor angiogenesis by transplantation of genetically modified hematopoietic stem cells
Isolated lymphatic endothelial cells transduce growth
survival and migratory signals via the VEGF-C receptor VEGFR-3
Generalized lacZ expression with the ROSA26 Cre reporter strain
Essential roles of the winged helix transcription factor MFH-1 in aortic arch patterning and skeletogenesis
Complete and specific inhibition of adult lymphatic regeneration by a novel VEGFR-3 neutralizing antibody
Antivascular endothelial growth factor receptor (fetal liver kinase 1) monoclonal antibody inhibits tumor angiogenesis and growth of several mouse and human tumors
The Notch ligand Jagged-1 is able to induce maturation of monocyte-derived human dendritic cells
Angiopoietin-1 promotes lymphatic sprouting and hyperplasia
Pathogenesis of persistent lymphatic vessel hyperplasia in chronic airway inflammation
Spatially restricted patterning cues provided by heparin-binding VEGF-A control blood vessel branching morphogenesis
Lymphangiogenic growth factor responsiveness is modulated by postnatal lymphatic vessel maturation
Notch restricts lymphatic vessel sprouting induced by vascular endothelial growth factor
Effective suppression of vascular network formation by combination of antibodies blocking VEGFR ligand binding and receptor dimerization
Lymphatic endothelium and Kaposi’s sarcoma spindle cells detected by antibodies against the vascular endothelial growth factor receptor-3
Recessive primary congenital lymphoedema caused by a VEGFR3 mutation
Involvement of the VEGF receptor 3 in tubular morphogenesis demonstrated with a human anti-human VEGFR-3 monoclonal antibody that antagonizes receptor activation by VEGF-C
Functional interaction of VEGF-C and VEGF-D with neuropilin receptors
Heparan sulfate in trans potentiates VEGFR-mediated angiogenesis
Delta-like ligand 4 (Dll4) is induced by VEGF as a negative regulator of angiogenic sprouting
Download references
Pytowski at Eli Lilly for VEGFR-2- and VEGFR-3-blocking antibodies
Jeltsch (Molecular/Cancer Biology Laboratory
Kaijalainen (Molecular/Cancer Biology Laboratory
Finland) for generating mDll4-Fc and mDll4–ECTM–eGFP expression vectors
Alitalo (Institute of Pharmaceutical Sciences
Switzerland) for valuable help with experiments and K
Helenius for critical comments on the manuscript
The Biomedicum Molecular Imaging Unit is acknowledged for microscopy services
Tainola for excellent technical assistance
as well as personnel of the Meilahti Experimental Animal Center (University of Helsinki) for expert animal husbandry
This work was supported by grants from the Academy of Finland
the Association for International Cancer Research
the Louis-Jeantet Foundation and the European Research Council (ERC-2010-AdG-268804-TX-FACTORS)
was supported by personal grants from the Emil Aaltonen Foundation
the Orion-Farmos Research Foundation and the Paulo Foundation
was supported by personal grants from the K
the Ida Montin Foundation and the Orion-Farmos Research Foundation
the Lister Institute of Preventive Medicine
the European Molecular Biology Organization (EMBO) Young Investigator Programme and the Leducq Transatlantic Network ARTEMIS
was supported by an EMBO long-term postdoctoral fellowship
was supported by a Marie Curie FP7 postdoctoral fellowship
Present address: Present addresses: Vascular Biology
Department of Medical Biochemistry and Biophysics
Sweden (L.K.); Lymphatic Development Laboratory
Cancer Research UK London Research Institute
Tuomas Tammela and Georgia Zarkada: These authors contributed equally to this work
Research Programs Unit and Department of Pathology
London Research Institute—Cancer Research UK
Department of Developmental and Molecular Biology
Virtanen Institute and Department of Medicine
Institut National de la Santé et de la Recherche Médicale U833
directed and carried out experiments and data analysis
designed and carried out cell culture and biochemistry experiments
carried out three-dimensional embryoid body sprouting experiments and analysed data; K.H
morphometry of retinal vessels and qRT-PCR
carried out biochemistry experiments and analysed data; W.Z
produced and validated Notch ligand and inhibitor proteins; C.A.F
carried out three-dimensional embryoid body sprouting experiments and analysed data; A.M
carried out retina experiments and analysed data; E.A
provided op/op retinas and carried out genotyping; N.M
analysed retinas of Vegfr3+/LacZ mice; J.W.P
interpreted results and helped write the paper; K.A
is the chairman of the Scientific Advisory Board of Circadian
Download citation
Journal of Experimental & Clinical Cancer Research (2023)
Neuroscience and Behavioral Physiology (2022)
Sign up for the Nature Briefing newsletter — what matters in science
Suggestions or feedback?
an aggressive form of cancer that accounts for about 40 percent of U.S
is believed to arise from benign tumors known as adenomas
MIT biologists have now identified a major switch that occurs as adenomas transition to adenocarcinomas in a mouse model of lung cancer
They’ve also discovered that blocking this switch prevents the tumors from becoming more aggressive
Drugs that interfere with this switch may thus be useful in treating early-stage lung cancers
“Understanding the molecular pathways that get activated as a tumor transitions from a benign state to a malignant one has important implications for treatment
These findings also suggests methods to prevent or interfere with the onset of advanced disease,” says Tyler Jacks
director of MIT’s Koch Institute for Integrative Cancer Research and the study’s senior author
The switch occurs when a small percentage of cells in the tumor begin acting like stem cells
allowing them to give rise to unlimited populations of new cancer cells
“It seems that the stem cells are the engine of tumor growth
They’re endowed with very robust proliferative potential
and they give rise to other cancer cells and also to more stem-like cells,” says Tuomas Tammela
a postdoc at the Koch Institute and lead author of the paper
which appears in the May 10 online edition of Nature
the researchers focused on the role of a cell signaling pathway known as Wnt
This pathway is usually turned on only during embryonic development
but it is also active in small populations of adult stem cells that can regenerate specific tissues such as the lining of the intestine
One of the Wnt pathway’s major roles is maintaining cells in a stem-cell-like state
so the MIT team suspected that Wnt might be involved in the rapid proliferation that occurs when early-stage tumors become adenocarcinomas
The researchers explored this question in mice that are genetically programmed to develop lung adenomas that usually progress to adenocarcinoma
they found that Wnt signaling is not active in adenomas
about 5 to 10 percent of the tumor cells turn on the Wnt pathway
These cells then act as an endless pool of new cancer cells
about 30 to 40 percent of the tumor cells begin to produce chemical signals that create a “niche,” a local environment that is necessary to maintain cells in a stem-cell-like state
“If you take a stem cell out of that microenvironment
it rapidly loses its properties of stem-ness,” Tammela says
“You have one cell type that forms the niche
and then you have another cell type that’s receiving the niche cues and behaves like a stem cell.”
While Wnt has been found to drive tumor formation in some other cancers
this study points to a new kind of role for it in lung cancer and possibly other cancers such as pancreatic cancer
“What’s new about this finding is that the pathway is not a driver
but it modifies the characteristics of the cancer cells
It qualitatively changes the way cancer cells behave,” Tammela says
“It’s a very nice paper that points to the influence of the microenvironment in tumor growth and shows that the microenvironment includes factors secreted by a subset of tumor cells,” says Frederic de Sauvage
vice president for molecular oncology research at Genentech
When the researchers gave the mice a drug that interferes with Wnt proteins
they found that the tumors stopped growing
when these treated tumor cells were implanted into another animal
The researchers also analyzed human lung adenocarcinoma samples and found that 70 percent of the tumors showed Wnt activation and 80 percent had niche cells that stimulate Wnt activity
These findings suggest it could be worthwhile to test Wnt inhibitors in early-stage lung cancer patients
They are also working on ways to deliver Wnt inhibitors in a more targeted fashion
to avoid some of the side effects caused by the drugs
Another possible way to avoid side effects may be to develop more specific inhibitors that target only the Wnt proteins that are active in lung adenocarcinomas
The Wnt inhibitor that the researchers used in this study
which is now in clinical trials to treat other types of cancer
The research was funded by the Janssen Pharmaceuticals-Koch Institute Transcend Program
and the Cancer Center Support grant from the National Cancer Institute
This website is managed by the MIT News Office, part of the Institute Office of Communications
Massachusetts Institute of Technology77 Massachusetts Avenue
Metrics details
Traditional cloning methods have limitations on the number of DNA fragments that can be simultaneously manipulated
which dramatically slows the pace of molecular assembly
a Gibson assembly-based modular assembly platform consisting of a collection of promoters and genes
which allows for one-step production of DNA constructs
GMAP facilitates rapid assembly of expression and viral constructs using modular genetic components
as well as increasingly complicated genetic tools using contextually relevant genomic elements
Our data demonstrate the applicability of GMAP toward the validation of synthetic promoters
establishment of inducible lentiviral systems
tumor initiation in genetically engineered mouse models and gene-targeting for the generation of knock-in mice
GMAP represents a recombinant DNA technology designed for widespread circulation and easy adaptation for other uses
These traditional cloning methods rely on the presence of restriction sites in both vector and insert and their prevalence – or lack thereof – can constrain possible assemblies
in particular those involving multiple inserts
overcome these sequence requirements and allow for assembly of multiple inserts in a given reaction
particularly toward the engineering and study of synthetic biology pathways
With these previous advances in synthetic biology circuit design in mind
we sought to develop a modular assembly platform using libraries of promoters
genes and destination vectors applicable towards a broader range of techniques common to biomedical research
such as viral production and gene targeting
we establish a common platform for assembly of genetic tools
ranging from expression and viral constructs to homologous recombination targeting constructs
in order to address questions of increasing biologic complexity
Gibson assembly-based modular assembly platform (GMAP)
genes and backbones from established GMAP-compatible collections are used in a one step isothermal assembly reaction to produce DNA constructs on demand
(B) Schematic of possible orderings of genes and promoters
Promoter A (pA) is flanked by sites 1 and 2
promoter B (pB) is flanked by sites 3 and 4
promoter C (pC) is flanked by sites 1 and 3
gene B (gB) is flanked by sites 4 and 5 and gene C (gC) is flanked by sites 2 and 5
(C) Schematic diagram of experiment using GMAP retroviral backbone
Retroviruses expressing GFP driven by different promoters were assembled using GMAP and used to transduce murine 3T6 fibroblasts or murine lung cancer (KP) cells
human phosphoglycerate kinase 1 promoter; CMV
cytomegalovirus immediate-early promoter; EFS
clara cell secretory protein promoter; UBC
(D) Bar graph shows flow cytometry measurements of median fluorescence intensity (MFI) of GFP from 3T6 and KP cells transduced with GMAP-generated retrovirus
Data are representative of at least three independent experiments
(E) GMAP-generated lentiviruses expressing mTagBFP2-AUTR (i)
or mKO2-CUTR(iii) sensor cassettes were assembled and used to transduce a Cre reporter cell line (3TB)
3TB cells were selected with hygromycin and visualized by confocal microscopy
(F-H) Histograms from 3TB cells expressing mTagBFP2-AUTR (F)
or mKO2-CUTR (H) transfected with three inducible hairpin constructs targeting the A
After transfection 3TB cells were selected with blasticidin
treated with doxycycline and knockdown was assessed by flow cytometry analysis on GFP+ cells
Grey histograms represent cells lines transfected with an inducible shRNA targeting luciferase
one must screen at least three bacterial colonies for two-fragment (not including backbone) reactions and five for four-fragment reactions to have a greater than 99% probability of obtaining at least one correctly assembled colony
These results demonstrate the ability of GMAP to rapidly assemble and functionally test in vitro retroviral and lentiviral constructs using standard genetic components such as synthetic promoters
In vivo applications of GMAP using lentiviral and Rosa26 targeting constructs
(A) K-rasLSL−G12D/+;p53fl/fl mice were infected with GMAP-generated hypoxia response element (HRE):GFP-pGK:Cre or pGK:Cre lentivirus
After 30 weeks tumors were assessed for GFP expression
hypoxia as determined by pimonidazole staining and hematoxylin and eosin (H&E)
(B) Column scatter plot shows quantification of immunohistochemistry shown in (A)
Data are presented as fraction of tumor area that expressed GFP or pimonidazole staining
(C) FACS histogram of KP cells engineered to express CloverCP in the presence of doxycycline and rtTA (VerdeGo) that were transduced with a GMAP-generated pGK:tTR-KRAB-rtTA3-Luc (TRL)-EFS:iRFP670 lentivirus and treated with media (grey histogram) or doxycycline (green line)
Data are representative of at least three independent replicates
(D) Bar graph shows quantification of flow cytometry shown in (C)
p > 0.05; **p = 7.68 × 10−4; ***p = 2.46 × 10−4
(E) Map of a GMAP-generated Rosa26 targeting vector (R26TV) and scheme for knock-in of a Cre-dependent tTR-KRAB-rtTA3-Luc construct into the Rosa26 locus
bovine growth hormone polyadenylation signal; DTA
Relevant primer binding sites (black half arrow) for PCR screening and restriction sites and probe (grey line) for Southern analysis are shown
C57BL/6J-Tyrc-2J ES cells were electroporated with AsiSI-linearized R26TV and subclone genomic DNA was digested with BamHI and probed
yielding a 5.8 kb product for the wild type Rosa26 locus and a 4.8 kb product for the targeted Rosa26 allele
(G) Bioluminescence imaging of C57BL/6J-Tyrc-2J or R26LSL-TRL (clone D1) ES cells transduced with increasing multiplicity of infection (MOI) CMV-Cre adenovirus (Ad-Cre)
(H) Plot shows flow cytometry measurement of iRFP670 expression in C57BL/6J-Tyrc-2J or R26LSL-TRL ES cells transduced with a GMAP-generated tetracycline response element promoter (pTRE):iRFP670-EFS:Cre-2A-GFP lentivirus and treated with doxycycline
**p = 3.71 × 10−3; ***p = 6.51 × 10−4; ****p = 3.60 × 10−5
These results demonstrate the versatility of GMAP to create genetic tools of increasing complexity
in particular toward the rapid validation and generation of knock-in mice
rely on the ease of construction of increasingly more complicated DNA constructs
As genomics and systems biology lead to the identification of novel genes and pathways of interest
efficient assembly of DNA constructs to interrogate these genes and pathways will become increasingly important
Together with its adaptability for various applications and for use by other investigators
GMAP provides a modular assembly platform that simplifies and accelerates this discovery process
All TOPO constructs containing the promoters and genes described herein have been deposited in Addgene
Compatible backbones were created by designing gene blocks (gBlocks) from IDT (Supplementary Table S2) to clone into viral or R26TV constructs such that digestion and gel purification would yield linearized backbones with sites #1 and 5 or sites #2 and 5 terminal
The retroviral backbone (RV 2-5) was created by cloning “RV 2–5 gBlock” into MSCV linearized with BglII and ClaI using Gibson Assembly such that digestion with PmeI followed by PCR purification yields a GMAP compatible backbone
The lentiviral backbone (LV 1–5) was created by cloning “LV 1–5 gBlock” into pLL3 linearized with XmaI and AscI using Gibson Assembly such that digestion with PmeI and BsrGI eliminates the 469 bp spacer sequence between sites #1 and 5
The CAG-driven R26TV LSL backbone (R26TV CAG LSL 2−5) was created by cloning “Rosa26 LSL 2–5 gBlock” into a R26TV LSL-GFP plasmid (Addgene plasmid 16103) linearized with Asc and XmaI such that digestion with PmeI eliminates a 389 bp spacer sequence between sites #2 and 5
This targeting construct has 5′ and 3′ homologous arms of 1.1 and 4.3 kb
TOPO backbones were created by linearizing PCR-BluntII TOPO with BamHI and cloning in “TOPO 1-4 gBlock” or “TOPO 2-5 gBlock” using Gibson Assembly such that digestion with PmeI and NheI eliminates a 361 bp spacer sequence between sites #1 and 4
or digestion with PmeI eliminates a 389 bp spacer sequence between sites #2 and 5
linearized backbones were adjusted to 57nM with Tris-EDTA buffer (pH = 8.0)
All GMAP backbones described herein have been deposited in Addgene
This reaction mix was then transformed into competent bacteria and screened using XmaI
The sequence for blasticidin resistance was PCR amplified and cloned using Gibson Assembly into a pcDNA5 donor vector such that it is inverted and flanked by two sets of incompatible loxP sequences
The inverted and floxed blasticidin resistance sequence was then PCR amplified and cloned using Gibson Assembly into a MSCV pGK-PuromycinR vector such that inverted blasticidin resistance expression is driven by the retroviral LTR (FFiBlast MSCV Puro)
Murine 3T6 fibroblasts were transduced using FFiBlast MSCV Puro
selected in 5 μg/mL puromycin (Life Technologies)
single cell cloned and screened using CMV-Cre adenovirus (Ad-Cre)
A Cre-responsive clone was expanded for in vitro use (3TB)
3TB cells and KP cells were cultured in DMEM (Corning) supplemented with L-glutamine (2 mM)
streptomyocin (100 μg/mL) and 10% fetal calf serum (FCS; Gibco) at 37 °C in a 5% CO2 humidified atmosphere
Embryonic stem (ES) cells were cultured on primary irradiated mouse embryonic fibroblasts in Knockout DMEM (Life Technologies) supplemented with β-mercaptoethanol (100 μM)
leukemia inhibitory factor (200 pg/mL; Amsbio)
CHIR99021 (3 μM; P212121) and PD0325901 (1 μM; Selleck Chemicals) and 15% FCS at 37° in a 5% CO2 humidified atmosphere
Following transduction of 3TB or KP cells with lentivirus or retrovirus
or 20 μg/mL blasticidin (Invitrogen) selection was applied
transfected 3TB cells were treated with 5 μg/mL doxycycline (Sigma) for 48 hr
VerdeGo cells were treated with 1 μg/mL doxycycline for 7 days
ES cells were treated with varying doxycycline for 3 days
40 μg of R26TV was linearized with AsiSI (NEB) and electroporated into 1 × 106 C57BL/6J-Tyr c−2J ES cells with a single pulse of 600V
After 24 hr cells were selected with 300 μg/mL G418 (Life Technologies) for 7 days
Cells were plated on Cover Glass Circles (Fisher) at 250 cells/mm2
After 24 h cells were washed with PBS and nuclear staining was accomplished using DAPI (5 μg/mL) or TO-PRO-1 (Invitrogen) prior to fixation with 1% paraformaldehyde (PFA
Electron Microscopy Sciences) and mounting with Vectashield Mounting Medium (Vector Laboratories)
Images were acquired on an Olympus FV1200 Laser Scanning Confocal Microscope and analyzed with ImageJ (NIH
Flow cytometry data were collected after 3–7 days of selection
Cells were trypsinized and fixed with Cytofix/Cytoperm (BD) and read on a BD LSR II HTS-2
Data was analyzed using Flowjo software (Tree Star)
To visualize hypoxic areas by immunohistochemistry
a commercially available hypoxyprobe kit (Hypoxyprobe™-1 Omni) was utilized
Pimonidazole hydrochloride was injected intraperitoneally into tumor-bearing mice at a dose of 60 mg/kg body weight 1 h before euthanasia
Lungs were perfused through the trachea with 4% PFA
transferred to 70% ethanol and subsequently embedded in paraffin
Sections were cut at a thickness of 4 μm and stained with hematoxylin and eosin for pathological examination
Slides were antigen retrieved using Thermo citrate buffer
pH 6.0 and treated with Peroxidase and Alkaline Phosphatase Block (Dako)
primary antibody and anti-rabbit (Vector Labs) HRP-polymer
The slides were developed with ImmPACT DAB Peroxidase (Vector Labs)
counterstained with haematoxylin in a Thermo Gemini stainer and coverslips added using the Thermo Consul cover slipper
The following antibodies were used for IHC: anti-TTF1 / Nkx2.1 (Epitomics
All images were obtained using a Nikon 80i microscope with a DS-U3 camera and NIS-elements software
Primers to detect the R26LSL-TRL allele (R26For, GAAGAGGCTGTGCTTTGGG; R26Rev, ACCACTGGAAAGACCGCGAAGAG) were designed by the Primer3 program (www.http://biotools.umassmed.edu/bioapps/primer3_www.cgi)
PCR amplifications were performed on 50 ng of genomic DNA using Green Taq DNA Polymerase (GeneScript)
Targeted Rosa26 allele yields a 1302 bp product and wild type Rosa26 yields no product
ES cells (1 × 104) were seed in each well of a 48-well and transduced with varying Ad-Cre
150 μg/mL D-Luciferin (Perkin Elmer) was applied and cells were imaged using the IVIS Spectrum Imaging System (Perkin Elmer)
lysed with 30 μL Cell Culture Lysis Reagent (Promega) and supernatant was incubated with Luciferase Assay Reagent (Promega)
Luminescence was measured using a Tecan Infinite M200 PRO Plate Reader
Transduced 3T6 fibroblast subclones (2 × 104) were seed in a 24-well and transduced with Ad-Cre (MOI=100)
20 μg/mL blasticidin was applied and after 4 days cells were washed with PBS and fixed with 1% PFA
stained with 0.5% crystal violet in 2.5% methanol for 30 min and rinsed in dH2O
Statistical analysis was performed using unpaired two-tailed Student t tests in Prism 5 (Graphpad Software)
Data are presented as mean ± standard error of the mean
Accession Codes: The following plasmids were deposited into Addgene: TOPO 2-5
3TB cells and VerdeGo cells are available upon request
A Modular Assembly Platform for Rapid Generation of DNA Constructs
Harnessing homologous recombination in vitro to generate recombinant DNA via SLIC
Ligation-independent cloning of PCR products (LIC-PCR)
Directed PCR-free engineering of highly repetitive DNA sequences
Fast track assembly of multigene constructs using Golden Gate cloning and the MoClo system
A Modular Cloning System for Standardized Assembly of Multigene Constructs
Chemical synthesis of the mouse mitochondrial genome
modular and reliable construction of complex mammalian gene circuits
Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly
One-pot DNA construction for synthetic biology: the Modular Overlap-Directed Assembly with Linkers (MODAL) strategy
A Modular Plasmid Assembly Kit for Multigene Expression
Gene Silencing and Silencing Rescue in Plants
GoldenBraid 2.0: A Comprehensive DNA Assembly Framework for Plant Synthetic Biology
Functional Identification of Optimized RNAi Triggers Using a Massively Parallel Sensor Assay
Hypoxia Response Elements in the Aldolase A
Enolase 1 and Lactate Dehydrogenase A Gene Promoters Contain Essential Binding Sites for Hypoxia-inducible Factor 1
Real-time Imaging of Hypoxia-inducible Factor-1 Activity in Tumor Xenografts
In vivo characterization of a reporter gene system for imaging hypoxia-induced gene expression
Hypoxia-Inducible Factor-1α Promotes Nonhypoxia-Mediated Proliferation in Colon Cancer Cells and Xenografts
Genetic Screens in Human Cells Using the CRISPR-Cas9 System
Genome-Scale CRISPR-Cas9 Knockout Screening in Human Cells
Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus
MiR-150 controls B cell differentiation by targeting the transcription factor c-Myb
Development and Applications of CRISPR-Cas9 for Genome Engineering
The Differential Effects of Mutant p53 Alleles on Advanced Murine Lung Cancer
Simplified mammalian DNA isolation procedure
Download references
Dimitrova for critical reading of the manuscript
Taipale for cloning the HRE:GFP-pGK:Cre lentiviral construct
Bauer for technical assistance using the IVIS Spectrum Imaging System
Cabeceiras for single cell cloning of the VerdeGo cell line and L
This work was supported by the Howard Hughes Medical Institute
MIT Amgen-UROP Program (E.A.G.) and the MIT Peter J
Thales Papagiannakopoulos & Tyler Jacks
RNA Therapeutics Institute and Program in Molecular Medicine
All authors read and approved the manuscript for submission
Download citation
Sorry, a shareable link is not currently available for this article.
Sign up for the Nature Briefing: Translational Research newsletter — top stories in biotechnology, drug discovery and pharma.
The Respect Cup is a soccer tournament designed for children to enjoy sports and to respect other players. PUMA was honored to be a partner of this wonderful event for the fifth time. PUMA’s local brand ambassador Ilaripro was involved and also provided sports equipment for the children.
PUMA is honoured to be a partner of the Respect Cup for the fifth time. Ilaripro brings a lot of joy to the participants with his skillful football tricks and energetic personality. It is heartwarming to see the joy the balls and personalised jerseys bring to the participants.
For us, the Respect Cup is an annual sports day of dreams! We come together to enjoy football, togetherness and a great atmosphere. Every participant gives their best for their team and the best part is that it encourages everyone.
In addition to the Respect Cup, the Saliband Championship of Tammela Elementary Schools for grades 5-6 was held on the Day of Dreams in Eerikkilä. All age groups came together to celebrate the event, either playing field hockey or cheering. A course was also set up along the nature trail where students could test their skills in history, sports or biology.
With this event, we want to encourage children and young people to get active. It is great that we can also enable schools in our region to participate in the Day of Dreams.
Sieh dir diesen Beitrag auf Instagram an Ein Beitrag geteilt von Ilaripro (@ilaripro)
PUMA's Heiko Desens explains the story behind the PUMA Mostro
Greatness starts with the courage to be yourself
Love to run but can’t resist the snooze button? Here's our advice.
SIGN UP FOR OUR NEWSLETTER AND NEVER MISS A STORY
I agree that the PUMA group may use my personal data (including my e-mail address) for promotional and marketing purposes in accordance with the PUMA privacy policy and send information about products of the PUMA group to my e-mail address. I can withdraw my consent at any time in the future by sending an e-mail to catchup@puma.com or via the link in each e-mail.
08 Apr 2025 15:30:00 GMT?.css-1txiau5-AnswerContainer{color:var(--GlobalColorScheme-Text-secondaryText2);}Finland won 3–0 over Hungary on Tue
This is 4 of the UEFA Women's Nations League B Grp
Predicted lineups are available for the match a few days in advance while the actual lineup will be available about an hour ahead of the match
The current head to head record for the teams are Finland 1 win(s)
08 Apr 2025 15:30:00 GMT?Finland won 3–0 over Hungary on Tue
08 Apr 2025 15:30:00 GMT.InsightsHaven't scored in their last 2 matches
Finland is playing home against Hungary at Tammela Stadion on Tue
05 Apr 2025 12:00:00 GMT?.css-1txiau5-AnswerContainer{color:var(--GlobalColorScheme-Text-secondaryText2);}Ilves won 3–2 over HJK on Sat
The current head to head record for the teams are Ilves 5 win(s)
Have scored 13 goals in their last 5 matches
05 Apr 2025 12:00:00 GMT?Ilves won 3–2 over HJK on Sat
05 Apr 2025 12:00:00 GMT.InsightsHave scored 8 goals in their last 5 matches
Ilves is playing home against HJK at Tammela Stadion on Sat
I guess first off it’s good to go back to the basics – you joined HIFK in the summer of 2010
and stayed at HIFK for one and a half season
After my playing career in Germany ended in 2008 I moved back to California to pursue coaching at the University I attended (St
During that time I met my future wife Maija Lähde
as she was playing her final season for the women’s basketball team at St
She was given the opportunity to play on the Finnish national team and also was offered a professional contract to play for Espoo Team (Now Honka)
We realized that we were probably going to spend the rest of our lives together and decided to move to Finland so she could continue to play basketball and also so I could hopefully gain the trust of her family and learn a bit more about her Finnish culture
and after a few tryouts with a couple of clubs in Finland I ended up signing with HIFK
It was the best decision I could have ever made
Do you remember your first impressions of the team
I definitely remember my first training session for HIFK
but I was also very excited because I knew about the traditions and ambitions of the club
but as I walked into the locker room for the first time
I really don’t think they expected me to make the team
I was the only foreign player at the time
and I hadn’t played soccer at a high level for about 2 years
I guess that I made a good enough impression because they offered me a spot on the team a day later after training
and I soon found out that a few of them (Sami and Innu) played college soccer in the US
almost every time I visit in the summer we try to arrange a night for a lot of players from that 2010 team to get together
but usually try to do a night out in the bars in Helsinki
The players from that team really hold a special place in my heart
I think we all bonded so well off the field and that’s why we had so much success on the field
I’m still in touch with a lot of them to this day
one of the other goalkeepers from that team Jens Forsman I consider to be one of my best friends in the world and he’s also the Godfather to my son Kayden
It’s now 10 years since the 10th of October 2010
A date that will long be remembered by HIFK fans
What are your memories from the match against Ilves on that day
it’s crazy to think it’s already been 10 years because in my mind it truly still feels like it happened yesterday
The Ilves game was especially fun because the stadium was full of fans and of course it was the most meaningful game for HIFK in many years
I remember feeling like there was no doubt in my mind we were the best team in the Kakkonen
We were on a streak of I think about 9-10 matches where we didn’t drop any points and the entire team was filled with confidence
We loved playing soccer with each other and you could feel within the team that we were going to do something special in the promotion games
it was one of those situations where Ilves kept putting pressure and pressure
but didn’t score – and then HIFK scored an unforgettable goal when Petri Heinänen headed the ball into Ilves’ net
What was it like in the last minutes of that match
and how was it to see the last goal from the other side of the pitch
I felt like we were controlling most of the match and of course scored a great goal to go ahead early in the game
late in the 2ndhalf Ilves scored a goal to tie the game and the feeling of calm and control became a feeling anxiety
I remember the goal Ilves scored very well because as a goalkeeper those types of moments are unfortunately the ones you remember the most
They continued to pressure our defensive line without success in the final 10 minutes and after feeling like we were going to draw the match late into injury time
Heinänen scored one of the most memorable and special goals of my playing career
The view I had of this moment from the back of the field was incredible because it happened directly in front of Stadin Kingit
The fan section exploded in joy and I even remember some of the players from our bench running onto the field to celebrate the goal
Shortly after that goal the referee ended the match and we all ran to the far side of the field to celebrate with the fans
It was a magical moment in all of our lives but we also realized that we were only half way finished with our ultimate goal of promotion
Then after a few weeks it was time for the match against FC Santa Claus
and how did it feel when Markus Tanner scored the winner in the 86th minute of the match
After we beat Ilves in the first match away
we knew that it would all come down to the home game against Santa Claus
I won’t tell you that we didn’t have any nerves going into the match
but I will tell you that we were very confident that we could win that game on our home field
Markus Tanner (The Fireman) was definitely a fan favorite and after he scored the goal that eventually sent us to the Ykkonen we knew that promotion was possible
I very much remember the final chance Santa Claus had to attack our goal
It was a free kick deep into our half of the field
They sent everyone on their team into our penalty box and I remember thinking if we defend this moment properly we will be champions
I came off my line and punched the ball out of the box and about 20 seconds later we were promoted
It was truly one of the best and most memorable moments of my life
what was your favourite moment at the club
Well obviously my most memorable moment at the club was our promotion to the Ykkonen
there was one other moment that stands out in my mind
With about 3-4 fixtures left in the regular season in 2010 we played an away game against SC Riverball in Joensuu
We were both at the top of the table maybe separated by 1 point at the time
It was a LONG bus drive out to Joensuu and this was the game that would probably decide 1stplace in our division
The team was very motivated and if I remember correctly we won the game 4-0
It was a massive step towards what we wanted to accomplish and that game in my opinion was the game that gave us the confidence to win it all
but the bus ride home was even more memorable for me
I truly feel like we became a much closer team after that bus ride and in the end of it became a single unit rather than a collection of individual players
and truly enjoyed every single minute of that ride home after our dominating performance
It was a moment that definitely stands out in my memory and a bus ride that I will never forget
A bit of an oddball question but; do you still get chills when you think of the “USA
USA” chant going off from the fans after a big save
I was the number 3 goalkeeper when I first joined the team
but I believe after 2-3 games of sitting on the bench I was given the opportunity to be the number 1 and start my first match for HIFK
I will never forget the first time I heard the greatest fans in Finnish soccer chant “USA
It was quite unexpected because I didn’t think any of the fans knew who I was or specifically where I came from
I was truly humbled by their support and it made me want to save 100 shots per game so I could hear them shout it more
What have you been up to since leaving HIFK
I really wanted to somehow stay in the sport of soccer
the next logical step for me was to try and find a place I could coach the game I love
Although I never imagined that I would coach on the women’s side of soccer
I was given the opportunity to coach Division 1 Women’s soccer at the University level
It was one of the best decisions I have ever made and now I am entering my 9thyear of coaching at California State University Fullerton
We have won 5 conference championships in the past 8 years and I absolutely love my career in coaching
Do you manage to follow HIFK from California
so we visit Finland every summer and every other Christmas
I try to make it to at least 1 HIFK game every summer with my kids Madeleine (7) and Kayden (4)
It truly brings me great joy to follow HIFK’s success in making it back to the Veikkausliiga and of course I wake up every match day to check their results
I wish there was some way I could live stream their games from California but I have not been able to figure out a reliable way to do that
the club and of course the fans have turned me into a HIFK fan for life
but completely valid in your case: Is there anything you would like to say to the HIFK fans
thank you for your constant support through both the good and of course some of the bad times during my days in Finland
I will never forget the journey we went through in 2010
I think I speak for all of the players that have ever played for HIFK when I say YOU are the lifeline and heartbeat of the club
The energy you bring to EVERY SINGLE MATCH is out of this world and always helps us to give our best effort on the field
you are the ones who make it fun to come to the stadium every single day
I hope to see you all very soon at a HIFK match next summer
They are now prospecting for the precious metal in southern Finland as well as Lapland
Finland is gradually emerging as a significant producer of gold
Europe’s largest gold mine is located at Kittilä in the fells of Finnish Lapland
and now a potential new mine in Häme is stirring interest among mineral companies
A quantity of the coveted soft metal has recently been confirmed at the Satulinmäki claim in Tammela
The Geological Survey of Finland initially detected it
and now Australian mining company Avalon Minerals and Canada’s Nortec Minerals have carried out drilling tests this autumn and are comparing the data with that from the state agency
we’re encouraged,” Avalon CEO Malcolm Norris told Yle
Avalon isn’t the only foreign firm interested in Finland’s gold: other companies from Sweden
Canada and Australia are also hot on the trail
president of the mining industry association
says that Finland is the EU’s largest gold producer
Some 5,500 kilos of that comes from the EU’s largest goldmine in Kittilä
Four mines in Finland now primarily produce gold
are owned by the Australian firm Dragon Mining
Meanwhile other mining companies also produce gold alongside their regular operations
And gold deposits have been found well over 100 other locations around the country
Geologist Markku Tiainen from the Geological Survey says that the Finnish mining industry has only woken up to the idea of mines focusing solely on gold since the turn of the millennium
He says that there are half a dozen promising deposits in Southern Finland alone – but points out that the Tammela seam may take another decade of drilling before it might begin commercial operations
The precious metal has been found in two spots there
with an estimated concentration of up to 10-15 grams per thousand kilos of rock
The Geological Survey says that five grams per thousand kilos is usually considered to be a minimum viable level for a mine
The main deciding factor in the financial feasibility of a potential mine
which now hovers around 1,200 dollars an ounce (or just under 40 euros per gram)
This story is posted on Independent Barents Observer as part of Eye on the Arctic, a collaborative partnership between public and private circumpolar media organizations
Published by: The Independent Barents Observer AS
About us
The Barents Observer follows the Code of Ethics of the Norwegian Press and the document Right and Duties of the Editor
We report under full editorial independence and have no external interference
Donate to our independent journalism
Støtt oss via Vipps: 105 792 - Det betyr mye
newstips@thebarentsobserver.com
atle@thebarentsobserver.com
thomas@thebarentsobserver.com☏ +47-905 73 143
denis@thebarentsobserver.com
georgii@thebarentsobserver.com
liza.vereykina@thebarentsobserver.com
olesia@thebarentsobserver.com
Privacy policy
services and collaboration opportunities for researchers
My research is aimed at finding new microbial drugs
especially from natural substances or derivatives based on natural substances
My colleagues and I are particularly focused on developing new
increasingly efficient tools and techniques
in addition to which we are investigating potential new sites of action in bacteria
The capacity of bacteria to resist the currently available antibiotics is increasing at an accelerating rate
Infections caused by multiresistant bacteria
or bacteria that are able to resist a range of therapies
are already routine in our healthcare system
When resistance spreads among infectious bacteria
treatment becomes more difficult and prolonged
predictions show that the infectious disease situation will become catastrophic
10 million people will die of infections every year by 2050
Glimmers of hope for the future can be generated through the increasingly calculated consumption of antibiotics and investment in the development of novel antibiotics
The astounding qualities of bacteria – in spite of being single-celled and essentially simple organisms
they are peerless in terms of their adaptive ability
Päivi Tammela is a professor of pharmaceutical biology at the Faculty of Pharmacy
Get to know the other new professors.
Predicted lineups are available for the match a few days in advance while the actual lineup will be available about an hour ahead of the match.
The current head to head record for the teams are Ilves 12 win(s), AC Oulu 6 win(s), and 3 draw(s).
Tammela StadionNewsAbout the matchIlves is playing home against AC Oulu at Tammela Stadion on Sat
The current head to head record for the teams are Ilves 12 win(s)
Open image viewerYellow paint was splattered on the columns
walls and stairs of Ateneum's entrance
16:13The entrance to the Ateneum Art Museum in Helsinki was splattered with yellow paint on Saturday
believed to be made with paint or a similar substance
were discovered on the museum's doors
The museum staff notified authorities about the damage around two o'clock on Saturday afternoon
The police are investigating the incident as a case of property damage
The exact sequence of events remains unclear
and it is not yet certain whether there was a single perpetrator or multiple individuals involved
Open image viewerPaint on Ateneum's front door
Image: Linda Tammela / Yle{"@id":"74-20143949","@context":"https://schema.org","image":{"@type":"ImageObject","description":"The paint had spread across a wide area.","copyrightHolder":"Linda Tammela / Yle","url":"https://images.cdn.yle.fi/image/upload/ar_1.0,c_fill,g_faces,h_767,w_767/dpr_2.0/q_auto:eco/f_auto/fl_lossy/39-142254367b082f7d26aa","keywords":""}}Open image viewerThe paint had spread across a wide area
Image: Linda Tammela / YleLocated in central Helsinki
Ateneum is a nationally protected landmark and Finland's oldest art museum
The neo-Renaissance building was designed by architect Theodor Höijer and completed in 1887
Ateneum is part of the Finnish National Gallery
Last autumn environmental activists sprayed the Finnish Parliament with a red dye in protest of Finland's involvement in the peat industry in Sweden.
Open image viewerElias the language robot speaks Finnish
Elias will enrich the teaching of 1st and 2nd grade preschoolers in Tampere
Image: Santeri Holappa / Tampereen kaupunki13.3.2018 16:04Talking robots have become the newest addition to classrooms in Tampere preschools for English
The robots will also be tested with first- and second-year pupils in a few select schools
four robots are to be tested out in classrooms
Three will be small owl-like robots to assist in maths lessons
while the fourth will be a small humanoid robot for language practice
The first mathematics robot arrived in the south-central on Friday and will be tested at the Sorila preschool
The other math robots will be placed at Vahmainen preschool and the Pohjois-Hervanta school
A language robot known as "Elias" will become a feature of Tammela school classrooms
Open image viewerThe mathematics robots bear a resemblance to small owls
Image: Santeri Holappa / Tampereen kaupunkiThe mathematical robot is the first of its kind in Finland
These owl-like robots are produced by the Finnish company AI Robots
They are now being put to the test for the first time in Tampere
The body design of the humanoid robot is French
but the software is designed by a Finnish company
The City of Tampere has acquired the robots to support everyday teaching
The machines will not tire from repetition and they can conform to the skill level of each pupil
The test run in Tampere is aimed at examining children’s experiences and interactions with robots
also interested in how these robots could improve the quality of teaching,” says project manager Marika Korpinurmi
The testing of the robots is part of the Smart Tampere digital programme
an initiative to improve everyday life in Tampere through digital services
Feel like exploring the pub and gastropub scene in Tampere
Here are some of the best places to pop in for a drink or more
Established in the year 1969 and still working under its original name
Salhojankadun pub is Finland’s oldest British-style pub
Their drink selection consists mainly from beers exported from Europe
traditional Pub Pikilinna has been serving great beer for over 20 years
The place is known for their relaxed atmosphere and love for sports
Paapan Kapakka is a legendary jazzpub in the corner of Hämeenkatu and Hatanpään valtatie
the front of pub is full of life with an open area terrace that offers views for the busy street and rapids
the warm milieu invites you to escape from the frost
Olutravintola Konttori is known for its’ vast
fashionable beer selection and continuously changing beers on tap
Friends of sports find themselves there too
O’Connell’s hosts a bunch of live gigs and a unique
If you are looking for that international atmosphere and possibly an extensive selection of beer
Huurupiilo is a pub in Kaleva with a long-lived reputation as a gig and comedy venue
Current owner Patrick and his wife Ansku make sure all their customers feel welcome and at home
and pub quizzes and gigs are still a part of the weekly program
Gastropub Soho offers a traditional pub menu and atmosphere with a mixture of good music and sports
Soho is a homely place to spend an evening out with your friends
Plevna Brewery Pub & Restaurant is creating beer culture in Finland
producing a vast selection of beers made on the premises
Siperia Stout – Finland’s best beer of 2015
A very dark and bitter stout also made it to the Adrian Tierney-Jones book: 1001 beers You Must Try Before you Die
Chosen many times as the best beer restaurant in Finland
Gastropub Tuulensuu is a cozy Belgian-style gastropub with an impressive selection of beer
Start your tasting course with Lindemans Lambik by a small family brewery in Belgium
Tuulensuu is the only place outside the brewery you can enjoy this lambic raw
Thanks to warm friendship between the brewery and the gastropub’s owner
Teerenpeli Beer Restaurant & Brewery’s products won gold medals as the best microbrewery beers in Finland
You beer journey here will be crowned by a smoked lager Suomi 100 Juhlaolut will give a wake-up call for your taste buds
This beer was produced to mark the 100th anniversary of Finland’s independence and immediately found itself in Alko’s centenary selection
With Gastropub Nordic’s origins in the local Gastropub empire
Nordic Brewery produces no-nonsense beers for the slightly more conservative palate
Havu Nordic Ale offered here was one of the two beers in the whole Finland to be honored with the official Finland 100 jubilee mark
you are going to taste one of a hundred of products Finland is proud
On Kauppakatu street you can find a cosy pub called Kievari Kahdet Kasvot
They are specialized in Finnish craft beers and whiskeys and they serve good pub food to go with your excellent beer
Paja Bar pays a tribute to the rock culture of Tampere
some of them uniquely produced for the bar
This is the place to open the world’s Best Mild Dark Ale (2016)
The amber color and berrylike flavor owe to natural rowan berries (picked in the Tampere surroundings!)
Pyynikki Brewhouse is brewery restaurant owned by Pyynikin käsityöläispanimo and Chef Hans Välimäki
The selection is vast in quality and quantity
since all the products of this craft brewery are available in the restaurant
Public House Huurre is working in the same building with Kaleva Brewing Company
which ensures that there is always at least three different “house” beers available from the tap
Sailor’s Bar & Grill serves traditional night grub and beer from near and far
Δdocument.getElementById( "ak_js_1" ).setAttribute( "value"