Home>"Movement Parties of the Far Right" new book co-authored by Pietro Castelli Gattinara Movement Parties of the Far Right. Understanding Nativist Mobilization, by Pietro Castelli Gattinara and Andrea L In an era of traditional political party decline this book explores a new phase of nativist mobilization in which street politics plays an increasingly important role Pietro Castelli Gattinara and Andrea Pirro delve into the hybrid and transitional nature of far-right movement parties collective actors that contest elections like political parties and mobilize in the protest arena like social movements Movement parties offer an exceptional object of study since they challenge the conventional distinction between institutional and non-institutional politics Examining the 'production structure' of ten movement parties across nine European countries the authors identify key factors that affect their engagement in protest activity and external mobilization of these collective actors using unique empirical material including quantitative data on far-right protest mobilization spanning over a decade and qualitative interviews with high-ranking officials.The book provides fresh insights into how the far right spreads its influence and relates to non-institutional politics making it essential reading for anyone concerned about the way in which nativist collective actors transform society from the ground up A compelling study looking at the relationship between electoral politics and grassroots activism Movement Parties of the Far Right illuminates the complex organizational and strategic choices underlying far-right mobilization Pietro Castelli Gattinara is MSCA Fellow at the Centre for European Studies and Comparative Politics Sciences Po and Associate Professor at the Université Libre de Bruxelles where he holds the Chair in Digital Political Communication He earned his PhD in 2014 from the European University Institute and has held research and teaching positions at the Scuola Normale Superiore he directs the ECPR Summer School on 'Concepts and Methods for Research on Far-Right Politics' His research focuses on political cleavages in Europe and the relationship between media and collective action Pirro is Assistant Professor in the Department of Political and Social Sciences He is editor of the journal East European Politics and editor of the book series 'Routledge Studies in Extremism and Democracy' His research focuses on far-right politics Follow UsOpen Access HAL Bluesky LinkedIn X SoundCloud Address / phone 27, rue Saint Guillaume - 75337 Paris Cedex 07 Phone: +33 (0)1 45 49 50 50 | +33 (0)1 42 22 31 26 Gattinara and its beautiful hills have a two-hundred-and-ninety-million-year geological history: we are in one of the first DOCGs in Italy to be born the terroir is decidedly distinctive and gives birth to a Nebbiolo of great character From here you go to Valsesia and its mountains and it was precisely Romagnano that was the first independent stop for a very young couple in the restaurant industry before arriving in Gattinara and giving birth to the cozy Osteria Contemporanea While perhaps the name chosen is not exactly original (google to believe) the gastronomic idea of Agnese Loss and Davide Saglietti who was born in a very small town in Trentino near San Martino di Castrozza began to hang out in kitchens at a very early age Her main stops are first a pastry shop not far from home and a hotel in Madonna di Campiglio then at Alberto Gipponi da Dina in Gussago one of the most original players in contemporary cuisine The two young people met in 2019 in Vernante to the Piccolo Principe at the Grand Hotel Principe di Piemonte in Viareggio to the Gallo Cedrone at the Masè family's Hotel Bertelli in Madonna di Campiglio Agnese was 20 and Davide was 26: "It was a bit crazy after the seasons together we wanted to move to Langhe but after the lockdown there was so much instability So we started in Davide's mom's restaurant the first in Valsesia." Davide continues: “We started there the idea of finding something new came to us in February on Valentine's Day 2022: there was only a table for 2 'either we're going to be employees or we're moving from here.'" The search is fruitful and in May the couple finds then a slaughterhouse and finally a restaurant A little place that these guys knew how to make warm and welcoming so much so that they were noticed very soon by the Michelin guide with a recommendation: wine list already two hundred and fifty labels strong and a tasty cuisine complete the work then (although it must be said that people who have an idiosyncrasy for the fifth quarter) Dad was a cook for a few years and always cooked anything When we left we wanted to be a little more relaxed and propose traditional things Offal however did well right from the start." Then she tells us a funny anecdote: “As a child I was terrified of Santa Claus there is a photograph they managed to take only because mom put a plate of tripe in my hand one focused on Agnese's gastronomic mission and the other accessible to anyone who does not appreciate it for example with the very Piedmontese "ravioli del plin ai tre arrosti e fondo bruno" which is pasta filled with three types of roast meats and their stock that Agnese brings back home with a Trentingrana sauce with 24 months of seasoning Also delicious is the spring char with yogurt and dill lemon and skyr are gourmet; also very successful are the green bagnet square ravioli with garlic cream and veal tongue ragu for a dessert that sees them offered in tempura with a refreshing passion fruit sorbet and cocoa crumble Schwarzwald (black forest): chocolate and black cherry sphere fiordilatte ice cream and black cherry gel Website Do you want to discover the latest news and recipes of the most renowned chefs and restaurants in the world La nostra società utilizza inoltre cookie funzionali per registrare informazioni sulle scelte dell’utente e per consentire una personalizzazione del Sito; ad esempio Questi cookie possono essere installati dalla nostra società o da Terze parti In caso di disabilitazione di questi cookie la qualità e l’esperienza di navigazione potrebbe non essere soddisfacente Questi cookie sono installati da social media per consentire la condivisione dei contenuti del presente Sito Essi sono in grado di monitorare la navigazione compiuta anche in altri siti e creano un profilo dell’utente sulla base dei suoi interessi Ciò potrebbe avere un impatto sul contenuto e messaggi visualizzati sugli altri siti visitati non sarà possibile utilizzare o visualizzare questi strumenti di condivisione per l’installazione e l’uso di tali cookie occorre il consenso dell’utente Per maggiori informazioni consulta la pagna cookies policy has bought a majority stake in the Bianchi winery For seven generations, the Pasquero-Elia family has made wine for their Paitin label in Barbaresco. They’ve also acted as stewards of the Serraboella vineyard, a menzioni geografiche aggiuntiva (MGA) long-lived Nebbiolos from their Sorì Paitin parcel This year they will release wines from outside Barbaresco for the first time thanks to a new partnership with the Bianchi family in Alto Piemonte “Great terroirs are not simply made of expert winemakers and powerful grapes,” said Luca Pasquero-Elia who runs the Paitin winery with his father Alto Piemonte has every single aspect needed for the recipe.” This is the second recent expansion for Paitin. In 2018, Luca convinced the family to purchase vineyards in the Basarin MGA across the valley from Serraboella Additional parcels farmed in Faset and Albesani bring Paitin’s total vineyard area to 47 acres when Luca convinced Giovanni and Silvano to venture 100 miles north to Alto Piemonte purchasing a majority stake in the historical Bianchi estate in Sizzano The Bianchi holdings consist of 22 acres: 12 in Sizzano and 5 acres each in Gattinara (in the Valferana single vineyard) and Ghemme (the Barragiole single vineyard) They are making three wines in the “Monte” range The white and rosé will be available in the United States in a few months Monte Bianco Colline Novaresi is 100 percent Erbaluce and Monte Rosa Rosato Costa della Sesia is 100 percent Nebbiolo while Monte Rosso Colline Novaresi is a blend of Nebbiolo (95 percent) and Vespolina (5 percent) The vineyard-designated Nebbiolos from Gattinara and Ghemme will be released at a later date Wine has been the Bianchi family’s focus since 1785 The connection between the two families goes back to when Silvano Pasquero-Elia met Paolo Bianchi at enology school “The relationship intensified while I was visiting the winery in 2021 in one of my northern Piedmont trips and I sensed their need for support,” said Luca we understood there was space for a joint venture and early 2022 we finalized an agreement.” The Pasquero-Elia family helped out with the 2022 harvest and Giovanni has overseen the farming and Silvano and Luca have vinified the wines Alto Piemonte attracted the trio for a number of reasons They felt the more northerly location of the vineyards could better adapt to climate change; they sought to broaden their Nebbiolo sensibility; and they recognized the quality of the terroir The Paitin team are the second Langhe winery family to see the potential of Alto Piemonte Roberto Conterno of Giacomo Conterno invested in Nervi innovation can be led by introducing new terroir a perspective we rarely explored given that until 2018 the vineyards were property of the family for more than 100 years,” said Luca but pushing it further to Alto Piemonte was a challenge and I have full support from Giovanni and Silvano.” Stay on top of important wine stories with Wine Spectator’s free Breaking News Alerts. Consumers got the chance to taste dozens of outstanding wines in Chicago, with upcoming … The owner of Stoller and Chehalem wineries was devoted to the future of Willamette Valley … Inside the first U.S. location of the French luxury retailer, guests can enjoy fine wine at … Phase one of the Viticulture and Winery Technology program’s new home, funded by a $10 … The Tuscan wine company has purchased a minority stake in Tenute delle Terre Nere; De … While the White House has paused tariffs on foreign wines at 10 percent for now, the trade … ShareSaveLifestyle DiningThe Real Story Behind That BottleByLiza B. Zimmerman Forbes contributors publish independent expert analyses and insights 11:46am ESTShareSaveThis article is more than 5 years old.Orchard at sunset The region has a limited 250 acres under vine compared with more than close to 5,000 acres in the Barolo zone compared with $100 or more for some top Barolo crus The Travaglini Gattinara bottle kind of bends inward It also seems that the top of the bottle seems to wiggle up like a chimney flue its design almost resembles that iconic as that straw-wrapped Chianti bottle However there is very little info on the streets about how it was invented and for what reason it was molded in this unusual way So I was happy to get some insider information from current lady of the household as to why the bottle was designed as it is This wine was launched in 1958 with the 1952 vintage Older wines can typically collect sediment when cellared The genius of this bottle is that is can be laid on its side and used as a decanter is that the original bottle maker experienced a fire that transformed all the bottles the winery continued to produce them that way The most intriguing idea is that the bottle was tailored to suit one of its highest profile consumers and biggest fans: Pope Saint John XXIII who was in the Vatican in the late 1950s and was left handed So another idea about the shape of this bottle is that it was specifically crafted to fit easily into his left hand which just celebrated its 50th anniversary a few years ago Please upgrade your browser to improve your experience Non-members can add the privileges at checkout through our 30 day free trial By continuing I accept the Terms & Condition and Privacy Policy. I would like to receive Newsletter from MICHELIN Guide Save lists of your favorite restaurants & hotels Don't miss our new features for slow travelers - Experience a different Italy Discover Italy Through the Eyes of a Local with Dolcevia.com insider perspective on Italy’s lesser-known treasures Elisabeth has been weaving her expertise from living in Genoa offering a unique perspective that resonates with the independent American traveler Her expertise stems from co-managing a tour company that specialized in bespoke US and Canadian adventures combined with a European degree in Travel Management and professional certification now brings you the essence of Slow Travel and Slow Food Dive deep into Italy's undiscovered locales and savor experiences that stay true to the heart of Italian culture Get the latest updates and exclusive insights directly to your inbox Send your questions using either our contact form or directly at info@dolcevia.com or use our Contact us form General Inquiry: +(39) 3737710105Itinerary support: +(39) 339 641 2517 This year is a collaboration between various places in the region in Piedmont such as Acqui Terme Various wine events will take place as part of Città di Vino 2024 The unique collaboration between cities such as Acqui Terme Ghemme and many others illustrates an innovative approach to the promotion of wine regions but an entire region unites under the flag of Alto Piemonte – Gran Monferrato with each municipality making its own unique contribution to the whole This symbiosis has not only attracted the attention of the European Commission of Recevin but has also shed light on the collective efforts needed to earn such recognition The title ‘European Wine City 2024’ is not just an accolade; it is a testament to the commitment to sustainability quality and the Slow Food and Slow Wine movements which are deeply rooted in Piedmontese culture These movements emphasize the importance of local production sustainable farming practices and nurturing traditional methods all essential elements that form the basis of wine production in this region Upcoming events in 2024 will undoubtedly highlight the diversity and quality of the wines from Alto Piemonte – Gran Monferrato Note to our valued travelers: While we sometimes feature sponsored links to support our platform any commission we earn from hotel and activity bookings with our affiliates doesn't influence our dedication to providing you with genuine and well-researched travel advice We strive to offer the most accurate and up-to-date information but kindly understand that travel details and recommendations are based on personal opinions and can change without prior notice we encourage you to supplement our insights with your own research and seek additional advice when planning your journeys Dolcevia® is a registered trademark - 2024-2025 Copyright Dolcevia.com Print Everybody knows that Barolo and Barbaresco from the Piedmont area of Italy are ground zero for the finicky yet fascinating grape Nebbiolo still within Piedmont but northeast of Turin Gattinara lapsed into obscurity many decades ago but now some conscientious and quality-driven producers are bringing it back into the limelight This wine proves there is reason to explore this tiny pocket of Piedmont It tastes of dried plums and dark cherries laced with spice and the wine seems to pick up weight the longer it’s open Pop the cork on this to enjoy with grilled meats or duck breast tortellini and pasta with chicken livers or a simple pork ragù Where to find it: Manhattan Fine Wines in Manhattan Beach, (310) 374-3454; the Wine Connection in San Diego, (877) 667-9463; and Wine Exchange in Orange irene.virbila@latimes.com S. Irene Virbila is a former restaurant critic and wine columnist for the Los Angeles Times. She left in 2015. Food World & Nation Subscribe for unlimited access Site Map all mainly making Nebbiolo in a variety of fascinating ways.When Roberto Conterno invested last year in another winery in the much lesser-known area of Alto Piemonte eyebrows were raised not just in Italy but around the world The amount he paid for a 90% stake in Nervi was undisclosed but the word was that it was in excess of €5m for 27 hectares and not one made on a whim but due to strong evidence that the hill district of Alto Piemonte is a region with all the credentials to produce high quality Nebbiolo Alto Piemonte has long been associated with viticulture with the Romans planting vines there in the second century BC It had as many as 40,000 hectares under vine until phylloxera struck in the late 19th century Later came further loss of vineyards with the industrialisation of the valley floors with the area becoming and still remaining a key centre for the Italian textile industry and its world-famous brands only 800 hectares are under vine in its two DOCGs (Gattinara and Ghemme) and its eight DOCs (Boca It says much for Alto Piemonte that Conterno wanted to buy vineyards there Nervi may be the oldest winery to be founded in the region including an ideal microclimate and complex They are all shielded from cold northern winds by Monte Rosa fresh winds from the Alpine glaciers bring down high afternoon temperatures and increase the diurnal range Gattinara’s rocky vineyards are located mostly on very steep hillsides the soils of Alto Piemonte are very acidic which as the AWRI has shown results in lower yields Taste Alto Piemonte weekend festival is official opened at the end of March Eager to promote the region, the Consorzio di Tutela Nebbioli Alto Piemonte laid on a Taste Alto Piemonte weekend festival in the historic old town of Novara at the end of March All ten appellations were represented with over 50 producers showing their wines The little white wine they make is from Erbaluce a varietal with fresh acidity and citrus-like fruit while the majority of black grapes grown are Nebbiolo Many producers like to blend it with small percentages of Vespolina Most of the top Gattinara producers make wines from 100% Nebbiolo while a number of Ghemme wineries like to add up to 15% Vespolina to soften Nebbiolo’s notoriously powerful tannins A 100% 2017 Vespolina from Cascina Preziosa (Coste della Sesia DOC) was very appealing – spicy red fruit with unobtrusive tannins The best examples of Nebbiolo came from Gattinara and Ghemme Fara and Colline Novaresi were also tasted (more on them later) the Antoniolo ‘Osso San Grato’ 2014 was complex with clear mineral notes The Nervi ‘Vigna Molsino’ 2014 was another upper premium quality single vineyard Nebbiolo with silky tannins The Vegis Stefano ‘Vegis’ 2014 and the Caligaris Luca ‘Gattinara’ 2012 each possessed very attractive fruit while the Cantina Delsignore ‘Borgofranco’ 2012 and the Il Chiosso ‘Galizja’ 2012 were similarly excellent All these wines were 13-13.5% with fine tannins that were very well integrated The Ca’ Nova Riserva 2009 had fabulous fruit with approachable tannins terrific concentration and a long finish (great value at €30 RRP); the Torraccia del Piantavigna ‘Vigna Pelizzane’ 2011 had lovely fruit and intensity with very nicely meshed tannins; the Vigna Ronco Maso ‘Ghemme’ 2008 and the Mazzoni ‘ai Livelli’ 2009 were two other impressive Nebbiolo single varietals while two wines with 10-15% Vespolina – the Miru ‘Vigna Cavenago’ 2011 and the Pietraforata ‘Ghemme’ 2012 – showed particularly well which was established as a DOC as far back as 1969 is another appellation with considerable pedigree a chronicler named Pietro Azario from Novara wrote that Boca wine was “famous since the ancient times.” Its soil profile – mainly volcanic rocks resulting from an explosion of a volcano in Valsesia – is the key Poderi Garona and Poderi ai Valloni each add 20% Vespolina and 10% Uva Rara to 70% Nebbiolo to produce a worthy blend Lessona DOC wineries tend to prefer 100% Nebbiolo Noah and Cassina Pietro are all quality producers (if you’re travelling there La Prevostura does delicious lunches at weekends crafts excellent Nebbiolo at the family’s castle two producers whose wines impressed were Madonna dell’Uva and Enrico Crola Many other unmentioned estates are producing excellent wines in Alto Piemonte As prices rise inexorably for the wines of Langhe where a hectare of vines costs between €1.5 to 2 million others may well follow Conterno’s example in buying vineyards in Alto Piemonte Its days as a forgotten gem look to be over The Buyer TVClick below to watch The Buyer's library of online debates, videos and webinars. Don’t miss the latest drinks industry news and insights Sign up for our award-winning newsletters and get insider intel and trends delivered to your inbox every week An ancient winegrowing area is making a comeback after a long hiatus—and garnering acclaim Alto Piemonte is located in the northeastern corner of the Piedmont region of Italy at the foot of the Alps It comprises four provinces and 10 appellations—Gattinara and Valli Ossolane—in which the Nebbiolo grape The Romans colonized this area in the 2nd century BC and the wines became quite famous long before the region’s other Nebbiolo-based wine Everything changed at the beginning of the 20th century with the arrival of phylloxera The countryside was ravaged: People sought work in nearby textile factories and vineyard areas shrank from around 45,000 hectares to a few thousand A similar catastrophe occurred throughout most of northern Italy including Prosecco in the Veneto and Barolo in the Langhe made heroic comebacks in the 1960s and ’70s Alto Piemonte languished in the shadows—until recently Alto Piemonte has been experiencing a renaissance that started off slowly about 10 years ago when the region began receiving greater recognition for its unique expressions of quality Nebbiolo wines Its resurgence ramped up more significantly over the last five years While production numbers have not increased dramatically a combination of factors has led to greater visibility and a major rise in popularity—in particular among importers and wine buyers in the U.S and an adviser to many others—who’ve made it their mission to increase the region’s visibility “I love these wines,” says Jenni Guizio, the wine director at Maialino in New York City an upscale Italian restaurant that dedicates three pages of its 80-page list to Alto Piemonte with some vintages that go back to the 1950s and ‘60s “There’s a lot of market presence by rock stars of the region like Cristiano Michael Nelson, the sales strategy manager for Grand Cru Selections a New York City-based import and distribution company that brings in four labels from Alto Piemonte—all associated with Garella—attributes the uptick in interest and sales of the region’s wines to a growing enthusiasm for a greater diversity of quality Nebbiolo wines “More than just an economical alternative to Langhe Nebbiolos,” says Nelson “I think people seeking terroir-driven wines are attracted by the exposure to a whole new dimension of the grape variety—one with more finesse and tenderness in early drinking that demonstrates the area’s distinctly different soils.” The first consortium of producers in the region was formed in 1999. The Consorzio Tutela Nebbioli Alto Piemonte in Ghemme initially focused on nine individual appellations the appellations had been somewhat isolated and completely autonomous The Valli Ossolane DOC was created—and added to the consortium—in 2009 (The Carema DOC is often placed under the Alto Piemonte heading but it’s actually located in the Canavese area of the province of Turin not technically part of the Alto Piemonte designation.) The region’s most distinguished appellations are the Gattinara and Ghemme DOCGs “There has been much progress, especially during the past 10 years,” says Lorella Zoppis, the president of the Consorzio and the proprietor of her family’s prestigious Antoniolo winery in Gattinara which produces about 55,000 bottles annually (including three single-vineyard Gattinaras) from 14 hectares of vineyard “The volcanic origin of Alto Piemonte and its proximity to the mountains Zoppis adds that there’s a lot of excitement in the area today “Many young people are turning to viticulture and bringing new energy “Our biggest challenge right now is adequately representing 10 very different appellations and 130 member-producers—large and small old and new—each of which has its own particular exigencies.” Oliver McCrum, the president of Oliver McCrum Wines an import and distribution company based in Berkeley has been following the region’s progression for over 20 years The McCrum portfolio specializes in Italian producers and currently lists four Alto Piemonte wineries “I knew the potential was there—long winemaking tradition and an amazingly complex terroir,” says McCrum “but most of the wines I tasted [early on] were McCrum’s Alto Piemonte “revelation” occurred about 10 years ago when he tasted a wine at Tenute Sella in Lessona “It was clearly traditional in style,” says McCrum and [it] beautifully expressed the particular terroir of Lessona—austere yet generous Nebbiolo with a touch of spicy Vespolina from sandy soil and high altitude that gave the wine firm structure with a delicate Cleanliness and precision are also cited by Marina Olwen Fogarty, who along with her brother, Francis, now manages the Antonio Vallana winery in Maggiora that their great-grandfather started in 1937 “My brother and I worked alongside our parents and grandparents since we were little kids,” she says except that now we can be more precise and exacting We harvest into small crates so the grapes don’t get bruised and [we] carefully monitor all the phases of fermentation and evolution of the wine prior to release.” Greater attention to detail and a general upgrade in winemaking practices are taking place throughout the area but the impact would be minimal if no one knew about Alto Piemonte “We get out there and talk about our wines—and I frequently travel abroad to promote them,” says Fogarty “Our parents’ generation had a chip on their shoulders; they referred to our wine as Nebbiolo of the North and tried to sell it as a cheap alternative to Barolo Annual production figures for Alto Piemonte are not readily available—and the ones that are can be difficult to decipher Weather-related vintage variations can have dramatic effects on production levels from one year to the next and official tallies of exports to foreign markets (including the U.S.) But statistics don’t tell the entire story the timing seems just right for a substantial Alto Piemonte comeback “Consumers know Nebbiolo and are looking for other expressions of it,” says McCrum “but they’re also open to unknown varieties like Vespolina and sommeliers like the [region’s] extreme diversity of soils—from volcanic rock to marine sand.” “the savvy wine drinker’s perception is that Alto Piemonte wines have more freshness and elegance than Barolo or Barbaresco due to the cooler climate age-worthy wines of great complexity that still represent value.” “While our climate is still generally cool,” says Garella “vintages have been getting riper since the ’90s and this is helping make our wines a bit fuller Where will Alto Piemonte wines go from here “There’s a lot of interest from wineries and investors outside the area,” says Zoppis “and we expect a 10 to 15 percent increase in vineyard plantings throughout Alto Piemonte’s 10 appellations over the next 5 years.” When third-generation Barolo producer Roberto Conterno, the proprietor of the renowned Giacomo Conterno winery in Monforte d’Alba purchased the historic Nervi estate in Gattinara in 2018 it was widely perceived as a validation of the entire area McCrum has seen signs of vineyard speculation and suspects that many favorable sites will rise in value points out that “so much vineyard area was lost and is now completely covered with forest It would take a huge investment to recover those areas and a long time for them to become productive Garella is encouraging the producers he works with to buy promising vineyard sites while they can “It was fortunate that Alto Piemonte slept through the ’80s and ’90s so we didn’t have to go through that phase of over-oaked focusing on our territory and how best to express it in our wines—then effectively communicating it to the rest of the world.” Don’t miss the latest drinks industry news and insights—delivered to your inbox every week These six regions in Texas, Washington, and California—including one AVA that has already been approved—have exciting potential for the U.S. wine industry As vines are pulled and grapes left unpicked across California, farmers blame tax loopholes, import incentives, and sluggish demand. Now, some ask, can tariffs provide much-needed relief? The fresh, fruit-forward profile of classic Provence rosé calls for reductive winemaking, but some producers are turning to a more oxidative approach to add complexity to their wines There’s no right way to space a vineyard, but winemakers and researchers nonetheless have strong—and often opposing—views on the best way to approach vine density SevenFifty Daily is a Provi publication. Learn more about how Provi simplifies the complex process of ordering, selling, and promoting wholesale alcohol between buyers, distributors, and suppliers. SevenFifty Daily is an award-winning online magazine about the business and culture of the beverage alcohol industry covering all three tiers of the alcohol industry. everywhere.What really mattersIn a world with too much noise and too little context We don’t flood you with panic-inducing headlines or race to be first We focus on being useful to you — breaking down the news in ways that inform We rely on readers like you to fund our journalism Will you support our work and become a Vox Member today An expert explains recent (and maybe soon-to-be) far-right victories in Europe by Jen Kirby helping to oust the center-left from power and giving the far right a potential role in the next government These shifts are happening as Europe enters another precarious moment: a war on the continent that is increasingly unpredictable and an inflation and energy crisis that will deepen as winter approaches and the historical origins and reasons for the far right’s recent successes in each of those countries are unique the far right shares certain trends across Europe — and is not all that different from what is happening in Brazil associate professor of political communication at Université Libre de Bruxelles and Marie Curie Fellow at Sciences Po said that the far right is a global movement and a global ideology even though one of the core tenets of these parties is a kind of nativism That translates into a rejection of migration but also of the social and cultural changes taking place within societies The “woke” culture wars may look different in the US or Italy but they are a feature of the modern far-right “New ideas coming from abroad are considered a danger to the nation-state,” Castelli Gattinara said “We see that quite strongly when it comes to civil rights and Vox spoke with Castelli Gattinara about this iteration of the far right how it has gained legitimacy in Europe and elsewhere and what the specific developments in Italy and Sweden might mean for those countries — along with Europe which is: What is going on with the far right in Europe right now The main point about the far right at the European level is that it’s not the story of a resurgence The story of the far right in Europe is very much a story of continuity What we have seen and what we are seeing in different countries are new variants of an old story of something we have been seeing for quite a few decades Political scientists tend to analyze the trajectory of the far right in waves We are now in probably the fourth wave of far right politics in Europe considering the first wave as the interwar period The subsequent waves were periods in which a number of far right parties and movements were emerging both in the south and in the north of Europe They were fringe parties with very clear ideas and very clear-cut ideologies but they remained at the margin of their political systems those parties have generally gained access to representative institutions they have actually become completely mainstream The distinction between what is the mainstream right and what is the far right is less and less clear I believe it’s also more difficult to set apart the European model from what we’re seeing in the US and in other parts of the world the distinction is becoming less and less clear This is a global phenomenon within democracies It is a much broader phenomenon of radicalization of mainstream right ideas especially with respect to some topics such as ethnic diversity The positions of the far right have now been actually endorsed by mainstream right parties There’s no easy way to synthesize it It’s a complex sociopolitical mechanism there are at least two main channels: one through the media and one through party and political competition Another party mechanism is coalition building or alliance building. That’s what we’re seeing in Sweden where a moderate party that won the election will get the support of a radical right party to form of government Or even more explicitly in the Italian case the mainstream right and the radical right are in a coalition that is absolutely long-lasting and has been brought about by a mix of far-right political actors and commercial media around political Islam — and the media often participate to construct those problems and the wave of refugees in Europe in 2015 that the far right tried to capitalize on I am wondering if migration is still very much a motivating electoral factor for these parties — or if they have morphed to embrace something different I still think migration plays a crucial role Perhaps migration is a bit limited as an issue But what is really the core ideological tenet of those actors is nativism; is the idea that country states should be inhabited exclusively by so-called native people; is the idea that there are homogeneous communities and that any type of contamination from abroad would impoverish the sort of natural purity of the nation-state new ideas coming from abroad are considered a danger to the nation-state We see that quite strongly when it comes to civil rights and A number of far right parties in Europe today are focused on so-called “woke” culture she stressed the importance for her that she is Italian but she stands in opposition to the idea of gender equality It sounds like the backlash to “woke” ideology is becoming a cross-border phenomenon then Absolutely. Again, the far right is a global movement and a global ideology. We have seen through the years a lot of interconnection and transnationalism in the way in which these ideas have diffused. If you look at India, some of the anti-Islamic narratives that have been developed by Modi built upon a long-lasting panic about Islam that has been developed in the US and in Europe The Italian far right has been inspired by Trump and translated those narratives and those campaigns within the Italian system has a very different colonial past and a very different history of race relations So that is an adaptation of the same narrative by non-far right political parties Connected to some of the culture war stuff has been the rejection of the EU and the “bureaucrats in Brussels”-type thing I’m wondering how far-right parties in Italy and within other European countries are approaching the EU right now There are a number of far right parties in Europe that have been and are openly Euro-skeptic, meaning they reject the EU as a political project while idealizing a not very well-specified Europe of the peoples or Europe of the nations. In the south of Europe, and particularly in Italy, the opposition to the EU has always been mainly a campaign issue and not a concrete policy I want to talk about Italy for a second. The prediction right now is that the far right will take power That alliance has been going for more than 20 years so when I’m speaking about the blurring between the far right and the mainstream right that is perhaps the perfect example The only party that never accepted any compromise is Giorgia Meloni’s Fratelli d’Italia She’s the only leader the Italian electorate does not perceive to have already tested She is the only one that has not yet deceived the Italian electorate That’s her biggest ace to play at the next election She has correctly understood that what the Italians challenge now is the idea of the establishment Meloni manages to present herself as opposed to the political establishment as a credible politician because she has been in politics for a very long time What would it mean if she does become the leader of Italy — for Italy the post-fascist party founded in the 1940s The symbolic link with the fascist past is extremely strong and extremely important the likely government will be just a reconfiguration of the same coalition that we have been seeing for the past 20 years Fratelli d’Italia has retrieved up a considerable amount of the old personnel of Berlusconi’s parties of the old ministers of Berlusconi’s governments it will be a reboot of the Berlusconi years — which is not necessarily good news — but with a much stronger attention to some of the issues that are at the core of our far-right ideologies But then when it comes to our economic policy it will be basically the old wine that we have already seen for 20 years with the Berlusconi governments And that makes me wonder a bit about Sweden but will need the far-right Sweden Democrats to govern What does it mean for governance when we have these types of alliances a convergence on those issues prior to the elections as they come to perhaps share responsibilities within a government then we can see some of those policies actually materialize What we have seen in other counties is this will in no way contain the growth of the Sweden Democrats It will actually hollow out the support for the moderates one would expect that Sweden Democrats will confirm their electoral scores in the years to come by becoming even more legitimate and central to the Swedish political system These elections are happening as Europe is in the middle of crisis — the war in Ukraine How do you think some of these electoral successes for the far-right might influence this moment The EU has been in a crisis since its very foundation There’s always a new crisis affecting European Union politics The politics of Europe are always a politics of crisis we’re seeing something that may be partly different because of the energy crisis and inflation which might trigger important transformations in public opinion it has become more difficult for foreign parties to take direct inspiration from the figure of Vladimir Putin Understand the world with a daily explainer plus the most compelling stories of the day, compiled by news editor Sean Collins. The end of the de minimis exemption, briefly explained. How a terrorist attack put the neighbors on the armed conflict. His administration is great at breaking things — but it’s failing in its bigger goal. Trump’s “51st state” talk brought Canada’s Liberals back from the dead — and undermined a key American alliance. It could be a brand-new day for Canadian politics. Metrics details An Author Correction to this article was published on 16 August 2023 This article has been updated Genome-wide clustered regularly interspaced short palindromic repeats (CRISPR)-based knockout screening is revolting the genetic analysis of a cellular or molecular phenotype in question but is challenged by the large size of single-guide RNA (sgRNA) library Here we designed a minimal genome-wide human sgRNA library which is composed of 21,159 sgRNA pairs assembled based on a dedicated selection strategy from all potential SpCas9/sgRNAs in the human genome These sgRNA pairs were cloned into a dual-gRNA vector each targeting one gene resulting in a compact library size nearly identical to the number of human protein-coding genes The performance of the H-mLib was benchmarked to other CRISPR libraries in a proliferation screening conducted in K562 cells We also identified groups of core essential genes and cell-type specific essential genes by comparing the screening results from the K562 and Jurkat cells the H-mLib exemplified high specificity and sensitivity in identifying essential genes while containing minimal library complexity emphasizing its advantages and applications in CRISPR screening with limited cell numbers the sgRNA library size remains a stringent barrier to the application of CRISPR-based knockout screening systems sgRNA library is designed with inherent redundancies to reduce sgRNA off-target effects and achieve equal representation and performance across all target genes the redundant sgRNAs library is widely used and challenges the feasibility of a CRISPR-based knockout screening system Those libraries are designed with different rules contain varying numbers of sgRNAs and target genes we designed the minimal human genome-wide sgRNA library (H-mLib) by utilizing a dual sgRNA CRISPR/Cas system with novel selection strategies The performance of H-mLib was validated by K562 cell fitness screening Screening results demonstrated the outperforming specificity and efficiency of the H-mLib library guaranteeing the reliability and feasibility of H-mLib for further application Combined with Jurkat cell fitness screening we expanded the human core-essential gene list and defined cell-type specific essential genes Design and property of H-mLib sgRNA library (a) sgRNA design workflow of H-mLib sgRNA library The process involves iterative annotation and filtration of candidate sgRNAs to identify the most effective sgRNAs The final selected sgRNAs and their target genes after the iterative process were shown in the dotted box (b) Constructs and schematic illustration of the dual-sgRNA system used by H-mLibA (left) and H-mLibB(right) I Synthesized oligonucleotide of H-mLibA and H-mLibB II The construct of sgRNA oligo and the backbone plasmid which contains U6 promoter and expresses mKate2 According to the utilization of opposite restriction endonuclease sgRNAs could clone into a specified plasmid III Human transfer RNA Gln (tRNA-Gln) was constructed into the plasmid too the tRNA processing system allows pairwise sgRNA expression in a single cell (c) Library size and target gene number of H-mLib and other reported CRISPR/Cas9 libraries The name of each sgRNA library is shown vertically on the left and the corresponding number of target genes is displayed in the histogram on the right horizontally The library size and average sgRNA number per gene were shown in dot plot on the left corresponding to library names horizontally (d) CDD target rate and gene off-target rate of H-mLib and other reported CRISPR/Cas9 libraries The bar plot on the top shows the percent of sgRNAs target CDD region in each sgRNA library The bar plot on the bottom shows the percent of genes containing sgRNAs that may have off-target sites on the genome (e) SNP frequency at each site of sgRNA (1–20) and PAM (21–23) sequence in H-mLib and other reported sgRNA libraries The lower SNP frequency at position 11–23 of H-mLib contributes to the lower off-target possibility Each of these two parallel libraries composed a minimal set of the best-performed sgRNAs targeting the full set of human genes which could also be used as independent replicates in the whole-genome CRISPR screening These results suggest that the existing genome-wide CRISPR/Cas9 libraries still have room for optimization and may miss some sgRNA candidates Schematic of K562 CRISPR/Cas9 knockout screening using H-mLibA, H-mlibB, and Brunello libraries. The oligonucleotides of H-mLib and Brunello containing a different number of sgRNA were cloned into plasmids and transduced into K562 cells through lentivirus. Cells were collected at five different time points. Benefiting from the small library size and dual-sgRNA system, the number of plasmids and viruses required for H-mLibAand H-mLibB were four times less than Brunello’s. Genome-wide CRISPR/Cas9 knockout screens in the K562 cell line To reach a 500 × coverage screening experiment H-mLibA and H-mLibB require approximately 11 million cells while Brunello requires approximately 38 million and Brunello libraries on different time points The quality scores of replicates were directly related to the overall reliability of an experiment H-mLibA and H-mLibB have the same quality scores across all time points and are much higher than Brunello after Day 10 (c) ROC-AUC analysis of individual sgRNAs targeting essential (solid line) and non-essential (dashed line) gene sets in the H-mLibA and Brunello library screened in K562 cells at time point day 4 Although different algorithms got variable results H-mLibA and H-mLibB performed remarkably well than Brunello These results would be valuable for identifying specific therapeutic targets the H-mLab had outperformed efficiency on not only gene knock speed but also total gene deletion rare the minimal library size offers the greatest cost savings and best expandability in the future CRISPR-based knockout screening is an emerging technology that enables systematic genetic analysis of a cellular or molecular phenotype in question. Here, we design an optimized minimal genome-wide human sgRNA library, termed H-mLib. Comparative data indicate that H-mLib has the smallest library size, yet second-largest targeting gene numbers (Fig. 1c) The library size has been minimized through an improved sgRNA design strategy and utilizing a dual-gRNA delivery system in which two sgRNAs are employed to target a single gene significantly contributing to reducing the library size we set up a series of cutoffs and identified 16 and 12 cell-type specific essential genes in the K562 and Jurkat cell lines which may provide valuable insights for targeted therapeutic interventions The size of the H-mLib allows screening when the number of cells are limited and the smaller screening scale also saves cost According to the K562 and Jurkat fitness screening the H-mLib also demonstrated good screening efficiency reflected by dropping out of genes in earlier time points than other libraries the minimal-sized and efficient sgRNA library added a valuable module to the CRISPR screening toolbox and provided more opportunities to identify critical genes in biomedical researches we search sgRNAs with no more than ten (≤ 10) target sites and retain those that could be annotated to a single gene a primary pool of 918,668 sgRNAs was generated Pearson’s correlation was calculated and the highest correlation coefficients were set as score weights for each score The final ON-score was the sum of the weighted score of AIdit_ONs score sgRNAs are removed if any SNP sites were deposited in positions 11–20 (5′–3′) or in the PAM sequence Then the remaining sgRNAs of each gene are sorted in descending order according to the ON-score and the conserved domain target sgRNAs will be carried out first and all sgRNAs were selected if the total number of sgRNA is less than 10 The top 10 sgRNAs were divided into two sgRNA groups according to the enzyme cut site number: unique target and multiple target sgRNAs are sorted by OFF-score in ascending order After filtering out the recognition sites of BsmBI and AarI the best four ranked sgRNAs were selected and constructed into two separate dual knock-out libraries namely H-mLibA which contains the top two sgRNAs and H-mLibB which contains the remaining two we added the same 500 non-target 20-nt sequences on the human genome as the negative control The 50 uL Golden Gate Assembly (GGA) reaction of H-mLibA was set as follows: 50 fmol of backbone The 50 uL GGA reaction of H-mLibB was set as follows: 50 fmol of backbone The GGA condition of each library was set as (1) 90 cycles of 37 °C 5 min and 22 °C 5 min; (2) 65 °C 30 min; (3) 37 °C 3 h an additional 1 ul of Esp3I and AarI was added to the reaction right before the 3 h 37 °C incubation three 50 ul reactions and one negative control reaction were performed following the same condition except without adding the inserts The GGA reaction products were purified with 0.8 × AMPure XP beads (Beckman A63882) and then dialysis on the MFMillipore™ Membrane Filter (Sigma 2 ul GGA products were electroporated (Eppendorf 2510 1700 V) with 25 ul electrocompetent cells (Lucigen One reaction was performed for the sample and one reaction was performed for the negative control The tube with the transformation mixture was recovered for 1 h at 37 °C then spread on two 25 cm × 25 cm LB-ampicillin plates and incubated for 20 h at 30 °C Plasmids were extracted using QIAGEN Plasmid Plus Midi Kit (QIAGEN 12945) according to the manufacturer's instructions The product was called the GGA1 plasmid library The second GGA was performed under the same condition except for another restriction enzyme AarI and Esp3I were used for H-mLibA and B The molar ratio of the GGA1 library and the ‘human Gln-tRNA vector’ (The vector and map will be available in addgene) is 1:3 three 50 ul reactions and one negative control reaction were performed and plasmid library extraction were performed the same way as the preparation for the GGA1 library K562-Cas9 cells were cultured in 1640 medium with 10% FBS and 1 μg/ml blasticidin on confluency of 0.5 million/ml in shaking incubators at 120 rpm cells were transduced by lentivirus pools in two biological replicates at a low MOI (~ 0.3) Transduction was performed with enough cells to achieve a representation of at least 500 cells per sgRNA per replicate transduction efficiency was detected by makte2 fluorescent proteins through flow cytometer Makte2 positive cells representing × 500 coverage of each sgRNA library were centrifuged and stored at − 80 °C which were used as starting reference cells (day 0) The other cells were still cultured and selected by puromycin at 2 μg/ml puromycin for the first 4 days and then at 1 μg/ml puromycin for the next 20 days The same number of sgRNA-expressing cells as day 0 were collected on days 4 and these time points were marked as day 4 Jurkat-Cas9 cells were cultured and screened in the same manner as K562 Customized references were used according to the sources of the NGS libraries The successfully aligned reads were assigned to the designed sgRNA-pairs and corresponding genes by a custom Perl script The read counts were calculated and used for downstream analysis A gene with BF above the threshold that hits three cutoffs was defined as effectively essential A Correction to this paper has been published: https://doi.org/10.1038/s41598-023-40304-4 A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity RNA-guided human genome engineering via Cas9 High-resolution CRISPR screens reveal fitness genes and genotype-specific cancer liabilities Genetic screens in human cells using the CRISPR-Cas9 system CRISPR screening of porcine sgRNA library identifies host factors associated with Japanese encephalitis virus replication The CRISPR system and cancer immunotherapy biomarkers in Biomarkers for Immunotherapy of Cancer 301–22 (Springer CRISPR/Cas9-based genetic screening to study T-cell function in T-Cell Receptor Signaling 59–70 (Springer Genome-wide CRISPR screens in primary human T cells reveal key regulators of immune function Prioritization of cancer therapeutic targets using CRISPR–Cas9 screens CRISPR-Cas orthologues and variants: Optimizing the repertoire specificity and delivery of genome engineering tools Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9 Identification and characterization of essential genes in the human genome Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system An in-library ligation strategy and its application in CRISPR/Cas9 screening of high-order gRNA combinations Genome-wide CRISPR-Cas9 screening in mammalian cells Optimised metrics for CRISPR-KO screens with second-generation gRNA libraries Genome-scale CRISPR-Cas9 knockout screening in human cells Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library Genetic screens in isogenic mammalian cell lines without single cell cloning Improved vectors and genome-wide libraries for CRISPR screening Evaluation and design of genome-wide CRISPR/SpCas9 knockout screens a deep learning-based model with high generalization performance Deep sampling of gRNA in the human genome and deep-learning-informed prediction of gRNA activities Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR CDD: A conserved domain database for the functional annotation of proteins and CRISPR-knockout genetic screens 356626 (2018) Evaluation of CRISPR/Cas9 site-specific function and validation of sgRNA sequence by a Cas9/sgRNA-assisted reverse PCR technique Minimal genome-wide human CRISPR-Cas9 library A genome-wide CRISPR screen identifies a restricted set of HIV host dependency factors A CRISPR-based screen identifies genes essential for West-Nile-virus-induced cell death A CRISPR dropout screen identifies genetic vulnerabilities and therapeutic targets in acute myeloid leukemia GenomeCRISPR—A database for high-throughput CRISPR/Cas9 screens Identification of pathways modulating vemurafenib resistance in melanoma cells via a genome-wide CRISPR/Cas9 screen CRISPR screens guide the way for PARP and ATR inhibitor biomarker discovery (2021) Genome-wide CRISPR/Cas9 screen towards identification of the lacritin homeostasis receptor Optimization and initiation of a genome-wide forward genetic death screen for the lacritin receptor complex using the brunello CRISPR/Cas 9 sgRNA library A pan-CRISPR analysis of mammalian cell specificity identifies ultra-compact sgRNA subsets for genome-scale experiments Measuring error rates in genomic perturbation screens: gold standards for human functional genomics Improved analysis of CRISPR fitness screens and reduced off-target effects with the BAGEL2 gene essentiality classifier Receiver operating characteristic (ROC) area under the curve (AUC): A diagnostic measure for evaluating the accuracy of predictors of education outcomes MAGeCK enables robust identification of essential genes from genome-scale CRISPR/Cas9 knockout screens ScreenBEAM: A novel meta-analysis algorithm for functional genomics screens via Bayesian hierarchical modeling A permutation-based non-parametric analysis of CRISPR screen data Control of intracellular heme levels: Heme transporters and heme oxygenases A T-to-G transversion at nucleotide -567 upstream of HBG2 in a GATA-1 binding motif is associated with elevated hemoglobin F Analysis of the human tissue-specific expression by genome-wide integration of transcriptomics and antibody-based proteomics Evidence for geno-phenotypic correlations in MEN1 syndrome Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system CRISPR/Cas9-enabled multiplex genome editing and its application BEDTools: A flexible suite of utilities for comparing genomic features Database resources of the national center for biotechnology information GenomeCRISPR-a database for high-throughput CRISPR/Cas9 screens gkw997 (2016) Cutadapt removes adapter sequences from high-throughput sequencing reads pROC: An open-source package for R and S+ to analyze and compare ROC curves The Cancer Cell Line Encyclopedia enables predictive modeling of anticancer drug sensitivity Download references We thank the Flow Cytometry Facility and Genomics Facility of the Westlake Biomedical Research Core Facilities and Laboratory of Animal Resource Center of Westlake University for their assistance in conducting this work Bing Huang for their valuable assistance and advice These authors contributed equally: Yangfan Zhou and Lixia Wang Westlake Laboratory of Life Sciences and Biomedicine conceived the project and designed the experiments performed experiments with the help of Z.Y. The authors declare no competing interests Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations Reprints and permissions Download citation DOI: https://doi.org/10.1038/s41598-023-38810-6 Anyone you share the following link with will be able to read this content: Sorry, a shareable link is not currently available for this article. Sign up for the Nature Briefing: Translational Research newsletter — top stories in biotechnology, drug discovery and pharma. Please enable JS and disable any ad blocker Winemakers estimate some vineyards suffered damage to 100 percent of vines A series of violent storms with high winds moved through the Italian wine region of Gattinara in Piedmont this past week pelting vineyards with hail and inflicting damage to the vines and young grape clusters in some parcels The June 29 weather brought hail stones the size of hazelnuts for about 5 minutes, vintners report, shredding leaves and breaking grape skins. "In Gattinara there was a violent storm, which unfortunately adds to the strong storm of the previous week," said Alessia Travaglini, export manager of her family's estate leaving behind little or nothing in some areas." but storms have been increasing in intensity in recent years which scientists believe is due to climate change The devastation is particularly acute when the nascent grape clusters are not strong enough to withstand adverse conditions Lorella Zoppis, co-proprietor at Antoniolo noted there hadn't been the type of destruction seen since 1971 almost every year now there are hail episodes," she told Wine Spectator "Usually the damage is limited and to some single areas In this case it has hit almost everything in the territory of Gattinara Despite the immediate negative impact on the vineyards it requires a few weeks to determine how the vines will rebound and what the actual losses may be there will be no single-vineyard Gattinara from the 2021 harvest At Nervi Conterno, the historic estate acquired by Roberto Conterno in 2018 the "estimate is an average loss around 80 percent even though as of today it is difficult to tell," Conterno said all the most important vineyards have been hit hard," said Zoppis we believe that the 2021 production will be limited to rosato Coste della Sesia Nebbiolo and Gattinara riserva unless the vineyards perform real miracles in the months to come." Travaglini's vineyards are spread around the appellation a saving grace given the difficult conditions "We are one of the most fortunate wineries because we differentiate our production by owning vineyards on all the hills of Gattinara," said Travaglini the damage in some areas is equal to 90 or 100 percent where we have some of our most important crus and luckily part of the cluster can be saved." Stay on top of important wine stories with Wine Spectator's free Breaking News Alerts. Read one of the UK’s favourite restaurant critics Enjoy wine expert Jancis Robinson’s peerless column of news Enjoy Alice's popular HTSI column about drinks and bar culture Learn what's new and trending according to our our award-winning HTSI food columnist Essential digital access to quality FT journalism on any device Complete digital access to quality FT journalism with expert analysis from industry leaders Complete digital access to quality analysis and expert insights complemented with our award-winning Weekend Print edition Terms & Conditions apply Discover all the plans currently available in your country See why over a million readers pay to read the Financial Times Metrics details CRISPR knockout (KO) screens have identified host factors regulating severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) replication we conducted a meta-analysis of these screens which showed a high level of cell-type specificity of the identified hits highlighting the necessity of additional models to uncover the full landscape of host factors we performed genome-wide KO and activation screens in Calu-3 lung cells and KO screens in Caco-2 colorectal cells followed by secondary screens in four human cell lines including AP1G1 adaptin and ATP8B1 flippase some of the identified genes also modulate Middle East respiratory syndrome coronavirus (MERS-CoV) and seasonal human coronavirus (HCoV) (HCoV-NL63 and HCoV-229E) replication with AP1G1 likely regulating TMPRSS2 activity at the plasma membrane These results demonstrate the value of multiple cell models and perturbational modalities for understanding SARS-CoV-2 replication and provide a list of potential targets for therapeutic interventions loss-of-function CRISPR KO screens and gain-of-function CRISPRa screens in several cell lines including physiologically relevant human Calu-3 cells and Caco-2 cells of lung and colorectal adenocarcinoma origin followed by secondary screens in these cell lines and in Huh7.5.1 and A549 cells Well-known SARS-CoV-2 host-dependency factors were identified among top hits such as ACE2 and either TMPRSS2 or cathepsin L (depending on the cell type) We characterized the mechanism of action of the top hits and assessed their effect on other coronaviruses and influenza A orthomyxovirus this study provides insights into the coronavirus life cycle by identifying host factors that modulate replication and might lead to pan-coronavirus strategies for host-directed therapies The top 20 genes from each cell line are included with genes considered a hit in another cell line if the average z-score was >3 these analyses suggest that there is a strong cell-type specificity in the identified hits and that individual cell models are particularly suited to probe different aspects of SARS-CoV-2 host factor biology The only gene that scored with both perturbation modalities was ACE2 emphasizing that different aspects of biology are revealed by these screening technologies Schematic of secondary library design and screen strategy Cumulative distribution plots analyzing overlap of top hits between primary and secondary screens Putative hit genes from the primary screen are ranked by mean z-score and classified as validated hits based on mean z-score in the secondary screen using a threshold of greater than 3 for KO or less than −3 for activation Heatmap comparison of top resistance and sensitization hits from secondary KO screens across cell lines Heatmap comparison of top resistance and sensitization hits from secondary activation screens across cell lines The red and dark red dashed lines represent 50% and 80% inhibition Source data showing a pan-coronavirus role of these genes arguing for a common and late role of ATP8B1 in the coronavirus replicative cycle these data strongly suggested that AP1G1 regulates Spike priming by regulating TMPRSS2 levels at the plasma membrane The red and dark red dashed lines indicate 50% and 80% inhibition (a–e) and the green and dark green dashed lines indicate 150% and 300% increase in infection efficiency The red and the dark red (b–d) dashed lines represent 50% and 80% inhibition CD44 or PLAGL1 in limiting SARS-CoV-2 entry remains to be elucidated The green and dark green dashed lines indicate 150% and 300% increase in infection efficiency genome-wide screens in physiologically relevant lung adenocarcinoma Calu-3 cells and KO screens in colorectal adenocarcinoma Caco-2 cells which are essential for SARS-CoV-2 replication and other coronaviruses our study characterized new antiviral genes some with potent and/or broad anti-coronavirus activity by using secondary libraries based on the hits retrieved from published screens and our screens and screening in four human cell lines (A549-ACE2 we further confirmed the reproducibility and strong cell-type specificity of the hits identified in viability-based whole-genome screens These results emphasize the value of considering multiple cell models and perturbational modalities (both CRISPR KO and CRISPRa) to better unravel the full landscape of SARS-CoV-2 host factors with shared hits including host-dependency factors adaptins AP1G1 and AP1B1 This comparison emphasizes the reproducibility of CRISPR screens conducted across different labs while further highlighting that the cellular model is the primary source of variability which may suggest a role of AAGAB via the regulation of AP-1 complex here AP1B1 and AAGAB are crucial host-dependency factors in Calu-3 cells for all coronaviruses studied here AP1B1 or AAGAB impacted SARS-CoV-2 entry and this could be abrogated by exogenous (trypsin-mediated) priming of SARS-CoV-2 Spike This suggested that the adaptins are important regulators of Spike priming Further work will be necessary to fully elucidate the role of the adaptins in coronavirus entry and to determine whether they are necessary for the proper expression and/or localization of TMPRSS2 at the plasma membrane Whether ATP8B1 could play a similar role in coronavirus replication remains to be determined mucins were proposed to trap viruses before they can access to their receptors which would be consistent with the effect we observed on viral entry here our study revealed a network of SARS-CoV-2 and other coronavirus regulators in model cell lines physiologically expressing ACE2 and TMPRSS2 the main natural targets of SARS-CoV-2 in the respiratory tract co-express ACE2 and TMPRSS2 which highlight the importance of the models used here Further characterization work on this newly identified landscape of coronavirus regulators may guide future therapeutic intervention The secondary KO library (CP1658) targets 559 genes including 500 intergenic controls and an average of ten guides per gene The sgRNAs were cloned into pRDA_118 (Addgene The CRISPRa secondary library included genes that scored with a mean z-score greater than 3 or less than −3 in the primary Calu-3 activation screen, as well as manually selected hits from the primary KO screens (Supplementary Data 7) The secondary CRISPRa library (CP1663) targets 452 genes The sgRNAs were cloned into pXPR_502 (Addgene A custom secondary Cas12a-CRISPR KO library (CP1660) was designed with a total of 2,736 sgRNA constructs with four guides per gene (with two guides per gene on each construct) (Supplementary Data 6) A total of 500 intergenic control sites targeted by 250 constructs with two guides per construct were also included The sgRNAs were cloned into pRDA_052 (Addgene All cell lines were regularly screened for the absence of mycoplasma contamination using Lonza MycoAlert detection kit Cells were transduced with guide RNA expressing LentiGuide-Puro or XPR_502 (as indicated) or the secondary libraries (CP1658 or CP1663 see above) and selected with antibiotics for at least 10 days For CRISPR-Cas12a-mediated gene disruption Calu-3 cells stably expressing Cas12a were generated by transduction with RDA_174 and selected and then transduced with the CP1660 library and selected Lentiviral vector stocks were obtained by polyethylenimine (PEI) or Lipofectamine 3000 (Thermo Fisher Scientific)-mediated multiple transfections of 293T cells with vectors expressing Gag-Pol the Env glycoprotein at a ratio of 1:1:0.5 The culture medium was changed 6 h after transfection and vector containing supernatants harvested 36 h later filtered and used directly or stored at −80 °C Transduction was performed by cell incubation with the LV in the presence of polybrene (4 µg ml−1) for a few hours spin infection was performed for 2 h at 30 °C and 1,000 g to improve transduction efficiencies Antibiotics were added 24–48 h after transduction A549-ACE2 and Huh7.5.1-ACE2 cells were transduced with LX_311-Cas9 lentiviral vector at a high m.o.i Transduced cells were selected and reamplified (for 10–15 days; that is to at least the starting amounts) before SARS-CoV-2 challenge at m.o.i pelleted by centrifugation and frozen down for subsequent genomic DNA (gDNA) extraction Massive CPEs were observed 3–5 days after SARS-CoV-2 infection and cells were kept in culture for 11–13 18–27 and 30–34 days in total before harvest and gDNA extraction The primary screens were performed in biological replicates (that is with independently generated KO cell populations) as follows: the screens in Vero E6 cells were performed in biological duplicates the first of which was then further divided into three technical replicates (that is independent screens performed with the same KO population); the screens in Calu-3 cells were performed in biological quadruplicates and the screens in Caco-2 cells in biological duplicates 120 million Cas12a-expressing Calu-3 cells or 120 million Cas9-expressing Calu-3 A549-ACE2 and Huh7.5.1-ACE2 were transduced with our CRISPR KO secondary library (CP1658 for Cas9 40 million cells were either challenged with SARS-CoV-2 (m.o.i 0.005) or harvested and frozen down for subsequent gDNA extraction CPEs were observed 3–5 days after SARS-CoV-2 infection and cells were kept in culture for 8–11 days or 13–15 days for Cas9 and Cas12a-based screens Each secondary screen was performed in independent biological duplicates with the exception of the Cas12a screen for which one replicate could not be analyzed due to poor sequencing quality A549-ACE2 and Huh7.5.1 cells were transduced with dCas9-VP64 (pXPR_BRD109)-expressing lentiviral vectors at a high m.o.i CPEs were observed 3–5 days after SARS-CoV-2 infection and cells were kept in culture for 11–17 days before gDNA extraction A549-ACE2 and Huh7.5.1-ACE2 were transduced with our CRISPRa secondary library (CP1658) and the screens were performed in the same conditions as above with CPEs 3–5 days after infection and cells kept in culture for 10–13 days before gDNA extraction the corresponding authors provided raw read counts guide-level read counts were retrieved from sequencing data We log-normalized read counts using the following formula: All correlations were calculated using the Python package scipy Cumulative distribution plots were generated as explained in Supplementary Note 5 mNG and NLuc SARS-CoV-2 were amplified in Vero E6 cells (m.o.i 0.005) in serum-free media; supernatants were harvested at 48–72 h after infection when CPEs were observed and cleared by centrifugation Viral supernatants were titrated by plaque assays in Vero E6 cells Typical titers were 3x106–3x107 plaque-forming units per milliliter Genome sequences of our viral stocks were verified through deep sequencing (Eurofins) Simian and human cell infections were performed at the indicated m.o.i (calculated from titers in Vero E6 cells) in serum-free DMEM and 5% serum-containing DMEM The viral input was left for the duration of the experiment Viral supernatants were frozen down at −80 °C before titration by plaque assays on Vero E6 cells Cells were trypsinized and percentage of cells expressing mNG scored by flow cytometry (NovoCyte ACEA Biosciences) after fixation in PBS1X-2% paraformaldehyde (PFA) or cells were lysed in Passive Lysis buffer and NLuc activity measured using an Envision plate reader (Perkin-Elmer) or lysed in RLT buffer (Qiagen) followed by RNA extraction and RT-qPCR analysis HCoV-229E-Renilla was a gift from V. Thiel57 and amplified for 5–7 days at 33 °C in Huh7.5.1 cells HCoV-NL63 NR-470 was obtained through BEI Resources (National Institute of Allergy and Infectious Diseases NIH)) and amplified for 5–7 days at 33 °C in LLC-MK2 simian cells Viral stocks were harvested when cells showed >50% CPEs Viruses were titrated through TCID50 and typical titers were 1.8x109 TCID50 ml−1 and 106 TCID50 ml−1 for HCoV-229E-Renilla and HCoV-NL63 Infections of Calu-3 were performed at m.o.i 300 for HCoV-229E-Renilla (as measured on Huh7.5.1 cells) and m.o.i 0.1 for HCoV-NL63 (as measured on LLC-MK2 cells) and infection efficiency was analyzed 2–3 days later by measuring Renilla activity (HCoV-229E-Renilla) or 5 days later by RT-qPCR (HCoV-NL63) cell supernatants were collected and the virus was further amplified on Huh7 cells frozen down and titrated by the TCID50 method A/Victoria/3/75 virus carrying a NLuc reporter gene generation and production have been described53 Viruses were amplified on MDCK cells cultured in serum-free DMEM containing 0.5 μg ml−1 L-1-p-Tosylamino-2-phenylethyl chloromethyl ketone (TPCK)-treated trypsin (Sigma-Aldrich) Stocks were titrated by plaque assays on MDCK cells (typical titers were 107 plaque-forming units per milliliter) IAV-NLuc challenges were performed in 96-well plates in serum-free DMEM for 1 h and the medium was subsequently replaced with DMEM containing 10% FBS and NLuc activity was measured with the Nano-Glo assay system (Promega) and an Infinite 200 PRO plate reader (Tecan) Calu-3 cells were incubated with SARS-CoV-2 at an m.o.i washed twice with PBS and then treated with Subtilisin A (400 μg ml−1) in Subtilisin A buffer (10 mM Tris/HCl (pH 8.0) 150 mM NaCl and 5 mM CaCl2) to get rid of the cell surface-bound viruses before washes Qiagen) and RdRp RT-qPCR to measure the relative amounts of internalized viruses spun at 1,000 g for 10 min and stored at −80 °C incubated 20 min at 37 °C in FACS buffer (PBS1X-2% BSA) containing a 1:20 dilution of spike RBD-mFc followed by secondary anti-mouse Alexa Fluor 488 incubation (Thermo Fisher Scientific; 1:1,000 dilution) and several washes in FACS buffer Flow cytometry was performed using NovoCyte (ACEA Biosciences) and analyzed using FlowJo software Cells were lysed in lysis buffer (10 mM Tris 1 M (pH 7.6) EDTA 1 mM and deoxycholate 0.1%) supplemented with sample buffer (50 mM Tris-HCl (pH 6.8) resolved by SDS-PAGE and analyzed by immunoblotting using primary antibodies against ACE2 (ProteinTech 21115-1-P; diluted 1:1,000) followed by horseradish peroxidase-conjugated anti-rabbit or anti-mouse immunoglobulin antibodies (Thermo Fisher Scientific; 1:2,500) or using an anti-GAPDH antibody conjugated to horseradish peroxidase (Sigma-Aldrich G9295; 1:5,000) and chemiluminescence Clarity or Clarity Max substrate (Bio-Rad) Unprocessed immunoblot images are available as Source Data Cells were treated or not with camostat mesylate (Sigma-Aldrich) at a concentration of 100 μM at 37 °C for 1 h placed on ice and incubated with wild-type SARS-CoV-2 (m.o.i Cells were extensively washed with PBS1X to remove the unbound viruses (and the ‘inputs’ were collected by lysis in RLT buffer) before TPCK-treated trypsin (Sigma-Aldrich) treatment with wild-type SARS-CoV-2 and VSV pseudoparticles) exogenous priming of spike was achieved by incubation with TPCK-treated trypsin at 100 μg ml−1 in serum-free DMEM at 37 °C for 10 min Cells were washed with 5% FCS-DMEM to neutralize the trypsin and cultured in 5% FCS-DMEM in the presence of 100 μM camostat or not cells were lysed in RLT buffer at 7 h after infection Qiagen) and SARS-CoV-2 RdRp RNAs measured by RT-qPCR cells were lysed 30 h after infection in Passive Lysis buffer and Firefly luciferase activity was measured with the luciferase assay system (Promega) and the Infinite 200 PRO plate reader (Tecan) For multiple-round SARS-CoV-2 mNG experiments exogenous priming of spike was achieved with the continuous presence of TPCK-treated trypsin (at 5 μg ml−1) in serum-free medium Cells were trypsinized 24 h or 48 h after infection (for + camostat and CTRL conditions and the percentage of cells expressing mNG was scored by flow cytometry (NovoCyte ACEA Biosciences) after fixation in PBS1X-2% PFA Statistical analyses were performed using Prism software or Excel (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001). Experiments were performed in biological replicates, and the exact number of repeats is provided in the figure legends and/or Supplementary Data 17 Further information on research design is available in the Nature Research Reporting Summary linked to this article The datasets generated during and/or analyzed during the current study have been deposited to the Gene Expression Omnibus (primary screen data: GSE175666; secondary screen data: GSE193834) Additional data are available from the corresponding authors on reasonable request Requests for material should be addressed to C.G. or J.G.D. or Addgene (for the plasmids with an Addgene number). Source data are provided with this paper Identification of a novel coronavirus in patients with severe acute respiratory syndrome Coronavirus as a possible cause of severe acute respiratory syndrome Epidemiology and cause of severe acute respiratory syndrome (SARS) in Guangdong Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor Human coronavirus NL63 employs the severe acute respiratory syndrome coronavirus receptor for cellular entry Angiotensin-converting enzyme 2 is a functional receptor for the SARS coronavirus Crystal structure of NL63 respiratory coronavirus receptor-binding domain complexed with its human receptor A pneumonia outbreak associated with a new coronavirus of probable bat origin Efficient activation of the severe acute respiratory syndrome coronavirus spike protein by the transmembrane protease TMPRSS2 utilizes cathepsin L to infect ACE2-expressing cells Characterization of spike glycoprotein of SARS-CoV-2 on virus entry and its immune cross-reactivity with SARS-CoV Inhibitors of cathepsin L prevent severe acute respiratory syndrome coronavirus entry TMPRSS2 expression dictates the entry route used by SARS-CoV-2 to infect host cells Baggen, J. et al. Genome-wide CRISPR screening identifies TMEM106B as a proviral host factor for SARS-CoV-2. Nat. Genet. https://doi.org/10.1038/s41588-021-00805-2 (2021) Identification of required host factors for SARS-CoV-2 infection in human cells Genome-scale identification of SARS-CoV-2 and pan-coronavirus host factor networks Genetic screens identify host factors for SARS-CoV-2 and common cold coronaviruses Genome-wide CRISPR screens reveal host factors critical for SARS-CoV-2 infection A genome-wide CRISPR screen identifies host factors that regulate SARS-CoV-2 entry Rebendenne, A. et al. SARS-CoV-2 triggers an MDA-5-dependent interferon response which is unable to control replication in lung epithelial cells. J Virol https://doi.org/10.1128/JVI.02415-20 (2021) Optimized libraries for CRISPR-Cas9 genetic screens with multiple modalities LY6E impairs coronavirus fusion and confers immune control of viral disease Defensive properties of mucin glycoproteins during respiratory infections: relevance for SARS-CoV-2 The cell surface mucin MUC1 limits the severity of influenza A virus infection Plante, J. A. et al. Mucin 4 protects female mice from coronavirus pathogenesis. Preprint at bioRxiv https://doi.org/10.1101/2020.02.19.957118 (2020) AAGAB controls AP2 adaptor assembly in clathrin-mediated endocytosis Wan, C. et al. AAGAB is an assembly chaperone regulating AP1 and AP2 clathrin adaptors. J. Cell Sci. https://doi.org/10.1242/jcs.258587 (2021) COVID-19 severity correlates with airway epithelium–immune cell interactions identified by single-cell analysis A vesicular stomatitis virus Replicon-Based Bioassay for the Rapid and Sensitive Determination of Multi-Species Type I Interferon Measuring SARS-CoV-2 neutralizing antibody activity using pseudotyped and chimeric viruses Simultaneous treatment of human bronchial epithelial cells with serine and cysteine protease inhibitors prevents severe acute respiratory syndrome coronavirus entry TMPRSS2 activates the human coronavirus 229E for cathepsin-independent host cell entry and is expressed in viral target cells in the respiratory epithelium The spike protein of the emerging betacoronavirus EMC uses a novel coronavirus receptor for entry and is targeted by neutralizing antibodies The Role of the Clathrin Adaptor AP-1: Polarized Sorting and Beyond Cell-type-resolved quantitative proteomics map of interferon response against SARS-CoV-2 Critical Role of Type III Interferon in Controlling SARS-CoV-2 Infection in Human Intestinal Epithelial Cells The role of the cell surface mucin MUC1 as a barrier to infection and regulator of inflammation Mucins in the mucosal barrier to infection Genetic and transcriptional evolution alters cancer cell line drug response Biering, S. B. et al. Genome-wide, bidirectional CRISPR screens identify mucins as critical host factors modulating SARS-CoV-2 infection. Preprint at bioRxiv https://doi.org/10.1101/2021.04.22.440848 (2021) putative aminophospholipid translocases with a role in human disease Multilevel proteomics reveals host perturbations by SARS-CoV-2 and SARS-CoV.Nature 594 TMEM41B and VMP1 are scramblases and regulate the distribution of cholesterol and phosphatidylserine Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex Optimization of AsCas12a for combinatorial genetic screens in human cells The interferon-inducible isoform of NCOA7 inhibits endosome-mediated viral entry Growth of human hepatoma cells lines with differentiated functions in chemically defined medium Robust hepatitis C virus infection in vitro A nanoluciferase SARS-CoV-2 for rapid neutralization testing and screening of anti-infective drugs for COVID-19 Reverse genetics of SARS-related coronavirus using vaccinia virus-based recombination propagation-defective middle east respiratory syndrome coronavirus as a vaccine candidate A simple method of estimating fifty per cent endpoints12 Generation of SARS-CoV-2 spike pseudotyped virus for viral entry and neutralization assays: a 1-week protocol Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR Replication of human coronaviruses SARS-CoV HCoV-NL63 and HCoV-229E is inhibited by the drug FK506 Diagnosis value of SARS-CoV-2 antigen/antibody combined testing using rapid diagnostic tests at hospital admission Inorganic phosphate export by the retrovirus receptor XPR1 in metazoans Roy, P. PriyankaRoy5/SARS-CoV-2-meta-analysis: bidirectional genome-wide CRISPR screens reveal host factors regulating SARS-CoV-2, MERS-CoV and seasonal HCoVs (Zenodo, 2022). https://doi.org/10.5281/zenodo.6499838 Download references Van der Werf from the French National Reference Centre for Respiratory Viruses (Pasteur Institute France) for providing us with SARS-CoV-2 BetaCoV/France/IDF0372/2020 (isolated by X Bichat Hospital); the World Reference Center for Emerging Viruses and Arboviruses and UTMB investigator P Yong Shi for the mNeonGreen and NLuc reporter SARS-CoV-2; V Thiel for Renilla reporter HCoV-229E; BEI Resources De Francesco for the generous provision of reagents Chable-Bessia and all CEMIPAI BSL-3 facility members for setting up excellent working conditions for SARS-CoV-2 handling This work was supported by the French National Research Agency (ANR) under the ANR-RA COVID program (grant ANR-20-COV6-0001 to C.G.); a European Research Council (ERC) Starting Grant under the European Union’s Horizon 2020 research and innovation program (grant agreement 759226 to C.G.); the Institut National de la Santé et de la Recherche Médicale (INSERM) (C.G and M.W.); the Fondation Centre National de la Recherche Scientifique (CNRS) (C.G Institut des Sciences Biologiques du CNRS and Montpellier University (C.G and O.M.); 3-year PhD studentships from the Ministry of Higher Education and Research (A.R. and J.M.); 4th-year PhD funding from the Fondation pour la Recherche Médicale (B.B and J.M.); NIAID grant R21AI157835 (J.G.D.); and the COVID program from CNRS (L.D.) a member of the national infrastructure France-BioImaging supported by the French National Research Agency (ANR-10-INBS-04) and the CEMIPAI BSL-3 facility These authors contributed equally: Boris Bonaventure performed the computational analysis; A.R. performed the BSL-2 and BSL-3 experiments; M.A.A. provided spike RBD-mFc for ACE2 staining and J.T and K.E.K did the mass spectrometry analyses; F.G.d.G provided overall supervision along with S.B wrote the manuscript with input from all authors BioNTech and Pfizer; J.G.D consults for and has equity in Tango Therapeutics J.G.D.’s interests were reviewed and are managed by the Broad Institute in accordance with its conflict-of-interest policies The other authors declare no competing interests Nature Genetics thanks Zharko Daniloski and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Peer reviewer reports are available Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations Pearson’s correlation coefficient r is indicated Volcano plot showing the top genes conferring resistance (right blue) to SARS-CoV-2 when knocked out in Calu-3 cells This screen did not have any sensitization hits The gene-level z-score and –log10(FDR) were calculated after averaging across replicates blue) to SARS-CoV-2 when overexpressed in Calu-3 cells red) to SARS-CoV-2 when knocked out in Caco-2 cells Comparison between gene hits in Calu-3 KO and activation screens Dotted lines indicated mean z-scores of -3 and 2.5 or 3 for each screen Proviral and antiviral genes are indicated in blue and red Scatter plots showing gene-level z-scores for each secondary activation screen with top resistance and sensitization hits annotated (A549-ACE2 Scatter plots showing mean z-scores comparing each secondary activation screen to each secondary KO screen for each cell line with top resistance and sensitization hits annotated (A549-ACE2 Scatter plot showing the gene-level z-scores of genes when knocked out using Cas12a in Calu-3 cells The top genes conferring resistance to SARS-CoV-2 are annotated and shown in blue The top genes conferring sensitivity to SARS-CoV-2 are annotated and shown in red Only one replicate is shown as the second replicate had low sequencing quality Scatter plots showing mean z-scores comparing each Cas9 to Cas12a secondary KO screens for Calu-3 cells with top resistance and sensitization hits annotated Calu-3-Cas9 cells were stably transduced to express 2 different sgRNAs (g1 Cells were infected with SARS-CoV-2 bearing the mNeonGreen (mNG) reporter and the infection efficiency was scored 48 h later by flow cytometry The cell line/screen in which the candidates were identified is indicated below the graph; data from 2 independent experiments are shown and AAGAB depletion efficiency in Calu-3 KO cell populations A representative immunoblot is shown out of 3 independent experiments; GAPDH serves as a loading control SARS-CoV-2-induced cytopathic effects in KO cell lines Cells were infected by SARS-CoV-2 at MOI 0.005 and ~5 days later stained with crystal violet Representative images out of 2 independent experiments are shown Source data Source data Caco-2-dCas9-VP64 (a) and A549-ACE2-dCas9-VP64 (b) cells were stably transduced to express 2 different sgRNAs (g1 or negative controls (CTRL) and selected prior to SARS-CoV-2 mNG infection The percentage of infected cells was scored 48 h later by flow cytometry The mean of relative infection efficiencies are shown for 2 independent experiments Expression levels in COVID-19 versus healthy patients are color coded; the percentage of cells expressing the respective gene is size coded Source data Genes that scored among the top 20 resistance hits and sensitization hits in both screens are annotated and shown in green Supplementary Notes 1 to 4 (and the supplementary note-only references) and additional supplementary Figures 1 and 2 (and their legends) Sequences (and/or references) of all sgRNAs and RT-qPCR primers and probes used in the study Whole-genome CRISPR KO data in Vero E6 cells Meta-analysis of whole-genome CRISPR screens Whole-genome CRISPR KO data in Calu-3 cells Whole-genome CRISPR KO data in Caco-2-ACE2 cells Secondary KO screen data in A549-ACE2 cells Secondary KO screen data in Huh7.5.1-ACE2 cells Secondary KO screen data in Caco-2-ACE2 cells Secondary KO screen data in Calu-3 cells (Cas9-based screen) Secondary KO screen data in Calu-3 cells (Cas12a-based screen) Secondary CRISPRa screen data in A549-ACE2 cells Secondary CRISPRa screen data in Huh7.5.1-ACE2 cells Secondary CRISPRa screen data in Caco-2-ACE2 cells Secondary CRISPRa screen data in Calu-3 cells Exact n numbers and P values (for each KO conditions) from experiments from Figs Mass spectrometry analysis of Calu-3 extracts (total and plasma membrane extracts) Unprocessed western blot from Supplementary Fig Download citation DOI: https://doi.org/10.1038/s41588-022-01110-2 Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily. Full access to our database of more than 425,000 wine ratings Early access to reviews on our editors' favorite just-rated wines The 2024 Bordeaux barrel tastings conclude with Bordeaux whites and sweet dessert wines fro… The 2024 Bordeaux barrel tastings continue with Merlot-based red wines from elite Right … The 2024 Bordeaux barrel tastings continue with Merlot-based red wines from Pomerol and … The 2024 Bordeaux barrel tastings continue in Pessac-Léognan at Château Malartic-Lagravière … The 2024 Bordeaux barrel tastings continue with Cabernet- and Merlot-based Margaux reds at … Two mini-verticals from Bordeaux's Fonbadet and Château Pauillac suggest a bright future … In today’s newsletter: Sterling crashes against the dollar as a coalition led by the post-facist Brothers of Italy triumphs First, the pound, news which belongs in the “life comes at you fast” bucket. On Friday, the value of sterling crashed to below $1.09 in response to Kwasi Kwarteng’s non-budget Kwarteng said he was focused on the “longer term and the medium term” and hinted at further tax cuts to “get this country moving” Well, he’s got it moving all right: the Asian markets heard what he had to say and promptly took the pound to just $1.03, an all-time low against the dollar. For one measure of how bad this is, consider this line from one trader quoted in Graeme Wearden’s story: “It’s a case of shoot first and ask questions later Graeme has the very latest on this news in the business live blog warning of a “volatile day ahead” as European markets open and we’ll return to it in First Edition soon But today’s newsletter is about the latest instalment in another troubling story: the success of the radical right in Europe Last night, a coalition led by the Brothers of Italy – a post-fascist party that blames immigrants for Italy’s economic problems, opposes abortion and gay adoption, and traces its roots to Benito Mussolini’s Italian Social Movement – swept to power in Italy’s elections Party leader Giorgia Meloni is likely to become Italy’s first female prime minister tells us what just happened – and Nimo Omer hears from an expert in the European radical right about how we got here Labour conference | Keir Starmer is seeking to draw new battle lines with Liz Truss by vowing to reinstate the top rate of income tax and ploughing the ensuing billions into the NHS and other public services Starmer said he would not reverse the cut to the basic tax rate from 20% to 19% Iran | Iranians have taken to the streets for a 10th consecutive night to protest against the death of Mahsa Amini in defiance of a warning from the judiciary At least 41 people have died since the unrest began Ukraine | America and its allies will act “decisively” if Russia uses a tactical nuclear weapon in Ukraine US national security adviser Jake Sullivan said on Sunday Sullivan said that “any use of nuclear weapons will be met with catastrophic consequences for Russia” Conservatives | Liz Truss’s chief of staff is understood to have been promised that his company would run the Tories’ next election campaign if he joined her No 10 operation Sources claimed the arrangement was a precondition of Mark Fullbrook taking the job Monarchy | British television channels are in a battle with the monarchy over who controls the historic record of Queen Elizabeth II’s commemorations after Buckingham Palace insisted broadcasters could retain only an hour of footage for future use Giorgia Meloni casts her vote in Rome last night Photograph: Alessandra Tarantino/APWhat happened last night The Brothers of Italy have held strong opinion poll leads for weeks and those figures were borne out by last night’s forecasts an exit poll for Italian broadcaster Rai gave the rightwing coalition 41-45% against 25.5-29.5% for the leftwing bloc The populist Five Star Movement was on 13.5-17.5% “It looks like they [the rightwing coalition] have control of both houses of parliament,” Angela Giuffrida said On a turnout of 64% – about nine points down on the last election in 2018 – “it’s a very good result for the right Now Meloni will get the mandate to form a government.” an expert in European radical right movements who is Marie Skłodowska-Curie fellow at Sciences Po and associate professor at the Université Libre de Bruxelles told Nimo that Meloni has “found a way to strike an equilibrium between being more radical than most of her counterparts “So she’s trying to be more radical than the centre-right parties notably with respect to issues like gender She’s got very radical positions on immigration she’s also built credibility as a politician when it comes to international relations.” He noted that while she has “kept an ambiguous position with respect to Russia and the US” more moderate positions … Rather than campaigning for votes she was basically campaigning on convincing international observers and international markets that she could be a reliable prime minister.” That’s a matter of sheer practicality: as Angela told us last week Italy is the biggest beneficiary of the European Covid-19 recovery fund and Meloni needs that money to revive the country’s economy Castelli Gattinara said there were two distinct aspects to Brothers of Italy’s support: “One is the radical right component and that’s basically the part of the electorate that at different points in Italian history has voted for parties that organised themselves within far-right ideologies But the other component is that citizens are dissatisfied with all other options that are on the table.” Other populist parties have all joined governing coalitions at some point since 2018 he added: “This is simply the option that has not been tested yet by the Italian electorate.” Another aspect of Brothers of Italy’s success: disarray on the left, which has failed to assemble a plausible alternative coalition. For more on that, and a familiar story of how the Democratic party “became a middle-class, professional party and lost touch with the working class,” see this piece in the Observer by Julian Coman “What Meloni’s managed to do is tap into this sense of despondency with the other options,” Angela said “We’re not saying 26% of Italians are all extremists – but there’s this sense of hopelessness.” What we’ve seen in recent years suggests the only way a party like hers stays popular is in opposition.” For more on how Meloni has persuaded working-class voters to turn away from the left, take a look at what Angela told us for this August First Edition How do Brothers of Italy compare with other radical right parties in Europe Castelli Gattinara sees the success of the radical right in Europe as a story of continuity He emphasised that while Brothers of Italy’s popularity is new “there’s not really a rise in far-right politics … a radical right party has been part and parcel of rightwing government coalitions [in Italy] since 1994.” That is different from where “it is absolutely inconceivable for any political party to build up alliances with the Rassemblement National” Nonetheless, the FN’s continuing presence as a force in French politics has led to their ideas “permeating the programmes of other political parties”. And that points to what Italy has in common with other European countries, like Sweden, where a bloc including the far-right Sweden Democrats won power earlier this month. (See this First Edition for more about that) Castelli Gatinarra said: “We are witnessing a general process of the mainstreaming of the far right It has become much more difficult to actually set far-right parties and ideas apart from the ideas and the policies that are proposed by non far-right parties.” Free daily newsletterOur morning email breaks down the key stories of the day telling you what’s happening and why it matters If everything goes smoothly, Meloni would be expected to form a government by the end of October. But while last night was undoubtedly a triumph for Brothers of Italy, it faces a tough road to forming a stable coalition, as Angela explains in this excellent analysis Meloni must retain the support of Matteo Salvini’s League despite Salvini’s bitterness at being outshone by his rival on the far right – and Berlusconi is also rumoured to have reservations With Salvini opposed to sanctions on Russia and Meloni supportive “it will not be easy for her to hold together,” said Angela “Salvini is a difficult character to deal with and he’s collapsed governments twice in the last few years.” “the alliances she’s formed on abortion rights all suggest we’re in for an antagonistic period Martin Farrer tells the troubling story of the Chinese housing market as it crashes in real time it resembles a Ponzi scheme,” Farrer writes “where money taken from new investors is used to pay off existing clients in an ever-decreasing spiral to collapse.” Nimo In the Observer, Peter Pomerantsev has an insightful piece on how Putin’s propaganda – which “drips with the pathos of martyrdom” – may be backfiring at home as news of a “partial” mobilisation sinks in “The war in Ukraine was meant to be a movie The new drama on Boris Johnson’s time in office, This England, will air on Wednesday. But Martha Gill argues that turning political events that happened so recently into a series is not only shortsighted it also risks blurring the lines of fact and fiction Extracts from Alan Rickman’s diaries in Saturday magazine – with more in the Observer – are fascinating on his ambivalence about the Harry Potter movies and enjoyably snarky about quite surprising people John McEnroe tells him “no one likes” Greg Rusedski and as for Labour grandee Charles Clarke: “never trust a man with two-day growth” Tamsin Rose looked into the world of cosmetic injectables Rose spoke to dozens of Australian women who have used these injectables: some spoke of horror stories but others loved the results whether access should be so easy when the risk to mental and physical health is so high Athletics | Double Olympic champion Eliud Kipchoge took 30 seconds off his own world marathon record with yet another extraordinary display in Berlin Kipchoge crossed the line in 2hr 1min 9sec beating second-placed Mark Korir by nearly five minutes Cricket | Pakistan levelled the Twenty20 series with England at 2-2 with three matches to play after a thrilling finish in Karachi England scored 24 in the 18th over to make themselves favourites but lost their last three wickets in six balls The i reports on “jitters” in Tory ranks about a further set of tax cuts for families hinted at by Kwarteng after his mini-budget sparked a market rout The Mail reports most favourably on that mooted fresh round of cuts for families The Times says “Pay pain for workers as public sector squeezed” warning Kwarteng that two years of real-term pay cuts could spell trouble at the next election The Express says “Truss pledges to build world-beating economy” while Metro goes for “Tax wars” with an images of Starmer v Truss The Sun gives Kwarteng a postage stamp of space on the front but its splash is about a Married At First Sight contestant The Telegraph looks abroad for its splash: “US will take ‘catastrophic’ action if Putin uses nuclear weapons” with “Kyiv allies warn Kremlin over Putin’s nuclear attack threats” A formerly sunken boat sits on the shoreline of Lake Mead Photograph: John Locher/APThe secrets of Lake Mead and the drought exposing them Drought and overuse have seen water levels drop more than 170ft since 1983, exposing the secrets lying below the best Saturday magazine content and an exclusive look behind the scenes A bit of good news to remind you that the world’s not all bad The candidates in turn pledge to make family-friendly policies on paternity leave flexible working and childcare provision a high priority One-third of the recipients who have received the grant that is supposed to cover things like childcare when they’re in political meetings Another third are single parents and 20% have children with special educational needs “These are the voices that you are not hearing within politics,” says Creasy “they are bringing direct immediate experience of the barriers that mums are facing Sign up here for a weekly roundup of The Upside And finally, the Guardian’s crosswords to keep you entertained throughout the day – with plenty more on the Guardian’s Puzzles app for iOS and Android Quick crossword Cryptic crossword This article was amended on 26 September 2022 to update the name of Rassemblement National (National Rally), the rebranded name of the far-right party formerly known Front National, in France. Metrics details which differ by a single genetic modification are powerful tools for understanding gene function we present an approach to create isogenic pairs of cells that avoids single cell cloning and screen these pairs with genome-wide CRISPR-Cas9 libraries to generate genetic interaction maps We query the anti-apoptotic genes BCL2L1 and MCL1 identifying both expected and uncharacterized buffering and synthetic lethal interactions while the approaches provide largely overlapping information highlighting an important consideration when employing genetic screens to identify and characterize potential drug targets We anticipate that this methodology will be broadly useful to comprehensively study gene function across many contexts screening all combinations of protein coding genes in the human genome would require approximately 400 million perturbations and 200 billion cells which is equivalent to 5000 concurrent genome-wide screens This scale is exacerbated by the diversity of cell types in which to study such interactions which are available in only a very limited number of cell lines can be purchased from vendors for thousands of dollars and the customized generation of a knockout clone in a cell line of interest costs tens of thousands of dollars there is a great need for approaches that obviate the need to generate single-cell clones and enable the creation of large-scale genetic interaction maps for genes of interest in relevant cell types aureus to conduct genome-wide CRISPR screens in paired mutant cell lines without the need for single-cell cloning; we call this approach “anchor screening” as the single genetic mutant anchors the resulting interaction network as they each have well-established genetic interactions to facilitate benchmarking They are also the subject of intense clinical development allowing for both a comparison between small-molecule inhibition and genetic knockout potentially an expansion of the genotypes beyond BRCA1 and BRCA2 mutant tumors in which these drugs may show efficacy The rich set of resulting genetic interactions shown here coupled with the ease of conducting such screens illustrate the power of this technology there is a need for a simple method to generate cells poised for gene editing and trigger efficient knockout only when ready to begin a genetic screen a Schematic of anchor screens performed with the Brunello library Saur components in purple and Spyo in remaining colors b Timeline by which the screens were executed and performed Illumina sequencing to determine the abundance of each guide a Average log2-fold changes for guides in Meljuso cells for control and BCL2L1 knockout lines Pearson correlation coefficient is indicated b Residuals for guides from the BCL2L1 anchor screen in Meljuso Blue and red lines correspond to lethal and buffering guides respectively Density of all guides is indicated by the gray distribution c Top 13 hits ranked by absolute average Z-score across all BCL2L1 screens Color scale of Z-scores is shown to the right A violin plot representing the distribution of Z-scores is adjacent to the color scale along with two dotted lines representing the cutoffs for gene hits shown The color scale is floored at −5 and ceilinged at 5 d Top 13 hits ranked by absolute average Z-score across all MCL1 screens e Comparison of average Z-scores for all MCL1 and BCL2L1 perturbations screened with the Brunello library Genes with an absolute average Z-score greater than 5 in either condition are labeled When anchoring on BCL2L1 knockout (Fig. 2c), MCL1 scored strongly in both Meljuso (ascending rank 2, Z-score −9.6) and OVCAR8 (ascending rank 2, Z-score −6.1). Conversely, when anchoring on MCL1 (Fig. 2d) BCL2L1 emerged as a top synthetic lethal interaction in both Meljuso (ascending rank 5 Z-score −5.0) and OVCAR8 (ascending rank 1 These relationships were also captured by the small-molecule screens MCL1 was a top sensitizer gene in both Meljuso (ascending rank 2 Z-score −15.9) and OVCAR8 (ascending rank 2 when screened with the MCL1 inhibitor S63845 BCL2L1 scored strongly in both Meljuso (ascending rank 2 Z-score −9.7) and OVCAR8 (ascending rank 1 these genome-wide anchor screens identified the expected synthetic lethal relationship between these genes which were also observed with small-molecule inhibition we saw buffering interactions between BCL2L1 and the pro-apoptotic genes TP53 (average descending rank 1 These genes were also the top three resistance hits for the small-molecule A-1331852 these screens connected several novel and understudied genes to the intrinsic apoptosis pathway via genetic evidence and these are worthy of future biochemical study to determine their mechanism the top correlate of WSB2 co-essentiality is MCL1 (R = 0.47) BCL2 ranks fourth (R = 0.39) and MARCH5 ranks seventh (R = 0.39) the sensitizers uncovered by the anchor screens are supported by orthogonal large-scale datasets a Cluster of top hits from the DepMap co-essentiality network Nodes represent genes and the size of each node is proportional to its average Z-score across all screens Genes with an absolute average Z-score greater than 2 across BCL2L1 conditions are included in the network Edges represent Pearson correlations across co-essentiality profiles in DepMap Edges are drawn between genes with an absolute correlation greater than 0.2 Clustering was done by modularity optimization and a single cluster was chosen for visualization b Cluster of top hits from the STRING network Edges are drawn between genes with a STRING combined score greater than 0.4 c Interactions from DepMap and STRING between the top 20 hits by absolute Z-score Genes are ordered by absolute average Z-score orthogonal network sources reveal a high level of connectivity between the top genes identified by these anchor screens and again saw an enrichment for edges compared to random networks with both STRING and DepMap the top four sensitizer genes were UBE2J2 (Z-score −13.6) and MARCH5 (−9.8); UBE2K ranked tenth (−6.7) WSB2 and BCL2L1 scored as the first (Z-score −7.7) and third (Z-score −6.0) sensitizer hits confirming that the strongest genes observed in Meljuso and OVCAR8 cells reproduce in a third cell line with additional guides a Schematic of Spyo-only approach screened with the secondary library Spyo library perturbations shown in remaining colors averaged across three guides compared to S63845 treatment screened with a secondary library in A375 cells ranked by average absolute Z-score across MCL1 guide conditions c Dose response curves for cells treated with A-1331852 The line range represents one standard deviation for doses where multiple viability measurements were collected d Same as b but for the MCL1 −/−/− knockout clone vs the MCL1 −/−/−/− knockout clone Top two hits ranked by absolute average Z-score and top two differences between single-cell clone conditions are labeled averaged across all guides vs the MCL1 −/−/−/− knockout clone Top six and five hits ranked by absolute average Z-score for MCL1 guide conditions and the MCL1 −/−/−/− knockout clone f Heatmap of Z-scores for the top five hits from all secondary screens Genes and screens are ordered by mean Z-score These observations underscore the potential difficulty of properly characterizing single-cell clones especially in cancer cell genomes that can be heterogeneous and unstable we see that some of the strongest hits from the −/−/−/− clone have a relatively small or no effect in the anchor screens these differences may be a true biological effect related to the gene dosage of MCL1 this may also be an artifact of single-cell cloning in that each clone contains private mutations or epigenetic alterations it is also possible that long-term adaptation to loss of a gene may occur in a single-cell clone whereas in anchor screening gene disruption is acute anchor screens with BCL2L1 and MCL1 identified both expected and previously uncharacterized partners which were supported by parallel small-molecule screens the STRING and DepMap co-essentiality networks provides additional confidence in the relevance of these interactions and the validity of this approach We additionally demonstrate that a SpyoCas9-only anchor screening approach can effectively identify synthetic lethal hits and may be a preferable approach for researchers who have already validated effective Spyo-guides targeting their gene of interest we screened two MCL1 knockout single-cell clones and although top synthetic lethal hits such as BCL2L1 and WSB2 were consistently observed in both one of the two clones shared fewer top hits in common with either the anchor screens or the small molecule highlighting the challenge of generalization that may emerge when using clonal cell lines a Top hits by average Z-score across all PARP screens and 75th percentiles of Z-scores are represented by the dotted and dashed lines within the violin plot b Venn diagram of curated gene sets included in the analysis c One-sided KS statistic for each gene set for each screen and averages of various conditions The value shown represents the alternative hypothesis that the cumulative distribution of genes in the gene set is greater than the distribution of genes not in the set a Average Z-scores for PARP inhibitors and genetic knockout perturbations b Z-scores for olaparib and talazoparib perturbations screened with the Gattinara library in A375 cells c Box plots of Z-scores for genes in the GO gene set “oxidative phosphorylation.” The box represents the 25th and 75th percentiles; whiskers show 10th and 90th percentiles knockout of PARP1 itself only provided resistance to talazoparib Further work will be necessary to understand the mechanistic basis of this difference both cell context and mode of inhibition may lead to divergent phenotypes that will require additional investigation to understand mechanistic underpinnings a Interactions between the top 20 gene hits from DepMap co-essentiality and STRING network sources Edges are drawn between genes with an absolute correlation greater than 0.2 or a STRING combined score greater than 0.4 b Cluster with Fanconi anemia genes from the DepMap co-essentiality network Genes with an absolute average Z-score greater than 2 across PARP1 conditions are included in the network Edges represent Pearson correlations across co-essenitiality profiles in DepMap c Cluster with Fanconi anemia genes in the STRING network comparisons among MCL1 knockout clones revealed clone-to-clone heterogeneity The success of anchor screens rests heavily on the anchor guide and thus its performance should be validated before beginning such a screening campaign an effective screening strategy will be to perform fewer replicates with any one guide instead employing additional anchor guides to mitigate potential off-target effects of a particular sequence Although our initial screens used Cas9 from both S we subsequently showed that reliance on a single Cas9 can be effective when the perturbation types are the same The use of two different Cas9s will still be needed when orthogonal activities are desired such as overexpression of one gene screened against a knockout library these large-scale screening projects are the result of many dollars and years of effort and it is not trivial for individual researchers with a patient-derived cell line to feed into these pipelines despite the impressive size of these resources many tumor types and specific genetic lesions are still poorly represented the two-pronged approach described here—perform an anchor screen then cluster the hits using co-essentiality data—enables researchers to uncover genetic interactions with a gene of interest in a biologically relevant cell type but still leverage the data from these large-scale maps to interpret and prioritize the resulting hit genes Tumors with mutations in other genes that scored in these screens may also be particularly sensitive to PARP inhibitors comparisons between small-molecule inhibitors and genetic knockout reveal that while there is often substantial overlap the two modes of disrupting a gene are not identical an observation that has important ramifications for potential drug targets identified by genetic screens as the introduction of defined gene edits via homologous recombination is at least an order of magnitude less efficient than the generation of knockout alleles and thus the generation of such isogenic cells has commensurately higher costs Expanding genetic interaction mapping to include various perturbation types and less tractable cell contexts promises to enhance our capacity to uncover gene function Individual sgRNA sequences are provided in Supplementary Table 2 The following vectors were used in the study and are available on Addgene: pXPR_212 (library vector): U6 promoter expresses customizable Spyo-guide; EFS promoter expresses SaurCas9 and 2A site provides puromycin resistance (Addgene 133457) pXPR_213 (anchor vector): H1 promoter expresses customizable Saur-guide; EF1a promoter expresses SpyoCas9 and 2A site provides blasticidin resistance (Addgene 133456) pRDA_186 (Spyo-only anchor vector): U6 promoter expresses customizable Spyo-guide; PGK promoter expresses blasticidin resistance and 2A site provides EGFP (Addgene 133458) lentiCRISPRv2 (pXPR_023): EF1a promoter expresses SpyoCas9 and 2A site provides puromycin resistance; U6 promoter expresses customizable Spyo-guide (Addgene 52961) pRosetta_v2: PGK promoter expresses hygromycin resistance and F2A site provides EGFP (Addgene 59700) pLX_311-Cas9: SV40 promoter expresses blasticidin resistance; EF1a promoter expresses SpyoCas9 (Addgene 96924) pRDA_118 (modified lentiGuide): U6 promoter expresses customizable Spyo-guide; EF1a promoter provides puromycin resistance (Addgene 133459) This vector is a derivative of the lentiGuide vector with a modification to the tracrRNA to eliminate a run of four thymidines pRDA_103: H1 promoter with two Tet operator (TetO) sites expresses customizable Spyo-guide; short EF1a promoter (EFS) expresses SaurCas9 and 2A provides blasticidin resistance (Addgene 133460) pXPR_124: EF1a promoter expresses SpyoCas9 and P2A provides EGFP (Addgene 133461) The pooled genome-wide library targeting human genes with two guides per gene The Brunello library in lentiCRIPSRv2 (Addgene 73179) was used for the all-Spyo approach Oligonucleotide pools were synthesized by CustomArray BsmBI recognition sites were appended to each sgRNA sequence along with the appropriate overhang sequences (bold italic) for cloning into the sgRNA expression plasmids as well as primer sites to allow differential amplification of subsets from the same synthesis pool The final oligonucleotide sequence was thus: 5′-[Forward Primer]CGTCTCACACCG[sgRNA Primers were used to amplify individual subpools using 25 μL 2× NEBnext PCR master mix (New England Biolabs) 5 μL of primer mix at a final concentration of 0.5 μM In cases where a library was divided into subsets unique primers could be used for amplification: 1; AGGCACTTGCTCGTACGACG; ATGTGGGCCCGGCACCTTAA 2; GTGTAACCCGTAGGGCACCT; GTCGAGAGCAGTCCTTCGAC 3; CAGCGCCAATGGGCTTTCGA; AGCCGCTTAAGAGCCTGTCG 4; CTACAGGTACCGGTCCTGAG; GTACCTAGCGTGACGATCCG 5; CATGTTGCCCTGAGGCACAG; CCGTTAGGTCCCGAAAGGCT 6; GGTCGTCGCATCACAATGCG; TCTCGAGCGCCAATGTGACG The resulting amplicons were PCR-purified (Qiagen) and cloned into the library vector via Golden Gate cloning with Esp3I (Fisher Scientific) and T7 ligase (Epizyme); the library vector was pre-digested with BsmBI (New England Biolabs) The ligation product was isopropanol precipitated and electroporated into Stbl4 electrocompetent cells (Life Technologies) and grown at 30 °C for 16 h on agar with 100 μg mL−1 carbenicillin Colonies were scraped and plasmid DNA (pDNA) was prepared (HiSpeed Plasmid Maxi To confirm library representation and distribution the following procedure was used: 24 h before transfection HEK293T cells were seeded in six-well dishes at a density of 1.5e6 cells per well in 2 mL of DMEM +10% FBS Transfection was performed using TransIT-LT1 (Mirus) transfection reagent according to the manufacturer’s protocol 66.25 μL) and LT1 (8.75 μL) was combined with a DNA mixture of the packaging plasmid pCMV_VSVG (Addgene 8454 The solutions were incubated at room temperature for 20–30 min during which time media was changed on the HEK293T cells the transfection mixture was added dropwise to the surface of the HEK293T cells and the plates were centrifuged at 1000 g for 30 min at room temperature plates were transferred to a 37 °C incubator for 6–8 h after which the media was removed and replaced with DMEM +10% FBS media supplemented with 1% BSA A larger-scale procedure was used for pooled library production 1.8e7 HEK293T cells were seeded in a 175 cm2 tissue culture flask and the transfection was performed using 6 mL of Opti-MEM Flasks were transferred to a 37 °C incubator for 6–8 h; after this the media was aspirated and replaced with BSA-supplemented media Virus was harvested 36 h after this media change and Meljuso cells were obtained from the Cancer Cell Line Encyclopedia several years ago and maintained in-house HEK293Ts were obtained over a decade ago from ATCC (CRL-3216) and maintained in-house HAP1 PARP1 knockout single-cell clone (HZGHC003943c006) and the unmodified parental line (item C631) were obtained from Horizon Discovery A375 parental cells from Horizon Discovery used for comparison to MCL1 single-cell knockout clones are catalog number HD PAR-096 (HD clone number 361) MCL1 knockout clone 1F6 was characterized with a genotype of −/−/−/− and is catalog number HD 118-006 (HD clone number 30928) MCL1 knockout clone 1B9 was characterized with a genotype of −/−/− and is catalog number HD 118-005 (HD clone number 30972) We confirmed with the vendor that clone 1B9 would have been characterized as +/−/−/− if a fourth All cell lines were routinely tested for mycoplasma contamination and were maintained without antibiotics except during screens when the media was supplemented with 1% penicillin/streptomycin Cell lines were kept in a 37 °C humidity-controlled incubator with 5.0% CO2 and were maintained in exponential phase growth by passaging every 2–3 days Cells were regularly maintained in antibiotic-free media when cells were maintained in media containing 1% penicillin/streptomycin The following media conditions and doses of polybrene A375: RPMI + 10% FBS; 1 μg mL−1; 1 μg mL−1; 5 μg mL−1 HAP1: IMDM + 10% FBS; 4 μg mL−1; 1 μg mL−1; 5 μg mL−1 Meljuso: RPMI + 10% FBS; 4 μg mL−1; 1 μg mL−1; 4 μg mL−1 OVCAR8: RPMI + 10% FBS; 4 μg mL−1; 1 μg mL−1; 8 μg mL−1 Olaparib (10621) was obtained from Cayman Chemical Co and screened at a dose of 250 nM (in A375) and 500 nM (in OVCAR8) and veliparib (ABT-888) were obtained from Selleckchem Talazoparib was screened at doses of 7.81 nM (in A375) and 1.95 nM (in HAP1) Navitoclax and venetoclax were both used at a dose of 250 nM S63845 was a gift from Guo Wei and was screened at 250 nM A-1331852 (A-6048) was obtained from Active Biochem and was screened at a dose of 250 nM In order to determine an appropriate antibiotic dose for each cell line cells were transduced with the pRosetta_v2 lentivirus such that approximately 30% of cells received the construct cells were seeded into six-well dishes at a range of antibiotic doses (e.g The rate of antibiotic selection at each dose was then monitored by performing flow cytometry for EGFP+ cells the antibiotic dose was chosen to be the lowest dose that led to at least 95% EGFP+ cells after antibiotic treatment for 7 days (for puromycin) or 14 days (for blasticidin and hygromycin) To determine lentiviral titer for transductions cell lines were transduced in 12-well plates with a range of virus volumes (e.g and 800 μL virus) with 3e6 cells per well in the presence of polybrene The plates were centrifuged at 640g for 2 h and were then transferred to a 37 °C incubator for 4–6 h and an equal number of cells seeded into each of two wells of a six-well dish A viral dose resulting in 30–50% transduction efficiency Transductions were performed with enough cells to achieve a representation of at least 500 cells per sgRNA per replicate taking into account a 30–50% transduction efficiency cells were split at a density to maintain a representation of at least 500 cells per sgRNA and cell counts were taken at each passage to monitor growth Puromycin selection was added 2 days post-transduction and was maintained for 5–7 days each replicate was divided into untreated and each at a representation of at least 500 cells per sgRNA Small-molecule doses used for each cell line are described above and frozen promptly for genomic DNA isolation Brunello anchor screens that utilized a Saur-guide as an anchor were established by transducing cells with the pXPR_213 anchor lentiviral vectors which express a customizable Saur-guide off of the H1 promoter pXPR_213-expressing cell lines were selected with blasticidin for 14 days Cell lines expressing pXPR_213 were then transduced with the Brunello library in pXPR_212 in two biological replicates at a low MOI (~0.5) Secondary library anchor screens that utilized an Spyo-guide as an anchor were established by transducing A375 cells with the pXPR_186 anchor lentiviral vectors which express a customizable Spyo-guide off of the U6 promoter blasticidin resistance from the PGK promoter pXPR_186-expressing cell lines were selected with blasticidin and monitored for EGFP expression for 14 days Cell lines expressing pXPR_186 were then transduced with the secondary library in pXPR_023 in two biological replicates at a low MOI (~0.5) Gattinara screens were executed by transducing A375 cells with the lentiviral vector pLX_311-Cas9 which expresses blasticidin resistance from the SV40 promoter and Cas9 from the EF1α promoter pLX_311-Cas9 expressing cell lines were selected with blasticidin for 14 days Cell lines expressing pLX_311-Cas9 were then transduced with Gattinara in pRDA_118 in two biological replicates at a higher-than-typical MOI (~1.0) PARP1 single-cell clone screens in HAP1 were transduced at an early passage with the Brunello library in pXPR_023 in two biological replicates at a low MOI (~0.5) Genomic DNA (gDNA) was isolated using the Machery Nagel NucleoSpin Blood Maxi (2e7-1e8 cells) or Mini (<5e6 cells) kits as per the manufacturer’s instructions The gDNA concentrations were quantitated by Qubit gDNA was divided into 100 μL reactions such that each well had at most 10 μg of gDNA a master mix consisted of 150 μL ExTaq DNA Polymerase (Takara) 50 μL of P5 stagger primer mix (stock at 100 μM concentration) Each well consisted of 50 μL gDNA plus water and 10 μL of a uniquely barcoded P7 primer (stock at 5 μM concentration) For the Spyo-only validation screens in A375 cells and the MCL1 single-cell clones the master mix was modified as follows: 150 μL Titanium Taq DNA Polymerase (Takara) We recommend the latter protocol going forward PCR cycling conditions: an initial 1 min at 95 °C; followed by 30 s at 94 °C for 28 cycles; and a final 10 min extension at 72 °C P5/P7 primers were synthesized at Integrated DNA Technologies (IDT) PCR products were purified with Agencourt AMPure XP SPRI beads according to the manufacturer’s instructions (Beckman Coulter Samples were sequenced on a HiSeq2500 HighOutput (Illumina) Reads were counted by first searching for the CACCG sequence in the primary read file that appears in the vector 5′ to all sgRNA inserts which was then mapped to a reference file of all possible sgRNAs present in the library The read was then assigned to a condition (e.g a well on the PCR plate) on the basis of the 8nt barcode included in the P7 primer the resulting matrix of read counts was first normalized to reads per million within each condition by the following formula: read per sgRNA/total reads per condition × 1e6 Reads per million was then log2-transformed by first adding one to all values which is necessary in order to take the log of sgRNAs with zero reads the log2-fold-change from plasmid DNA (pDNA) was then calculated The log2-fold-changes for each perturbed arm were fit using a natural cubic spline with three degrees of freedom using the log2-fold-changes of the relevant control arm as reference We then used the residual from this fit as a phenotypic measure for each guide In order to determine the significance of synthetic interactions at the gene level we averaged the residuals of guides targeting a gene and then calculated a Z-score for these values by subtracting the average residual and dividing by the standard error of all guides In order to calculate the standard error we took the standard deviation of all guides and divided it by the square root of the number of guides per gene we assume the distribution of residuals is normal and the average and standard deviation of all guides is representative of the population We used absolute correlations for co-essentiality and combined scores for STRING as edge weights for the clustering algorithm Graphs are plotted using the force directed layout in igraph A375 cells were transduced with pLX_311-Cas9 to generate lines stably expressing Cas9 After 2 weeks of selection with blasticidin vectors delivering EGFP and a guide targeting PARP1 were introduced resulting in a heterogeneous population of EGFP-positive and negative cells Three days post-transduction with guide construct cells were treated with varying doses of olaparib The fraction of EGFP-positive cells was monitored for 17 days by flow cytometry (BD Accuri C6 Sampler) upon every cell passage All KS tests and Z-scores were calculated in R Pearson correlation coefficients for density plots were done in Python Further information on research design is available in the Nature Research Reporting Summary linked to this article The read counts for all screening data and subsequent analyses are provided as Supplementary Data. Fastq files of sequencing are available from the Sequencing Read Archive, accession code SRP217813 Any other relevant data are available from the authors upon reasonable request All custom code used for analysis and example notebooks are available on GitHub A global genetic interaction network maps a wiring diagram of cellular function Global genetic networks and the genotype-to-phenotype relationship cerevisiae genome by gene deletion and parallel analysis Functional profiling of the Saccharomyces cerevisiae genome A systematic mammalian genetic interaction map reveals pathways underlying ricin susceptibility Multiplexed barcoded CRISPR-Cas9 screening enabled by CombiGEM Combinatorial CRISPR–Cas9 screens for de novo mapping of genetic interactions Synergistic drug combinations for cancer identified in a CRISPR screen for pairwise genetic interactions Orthologous CRISPR-Cas9 enzymes for combinatorial genetic screens Genetic interaction mapping in mammalian cells using CRISPR interference Mapping the genetic landscape of human cells Bypass of senescence after disruption of p21CIP1/WAF1 gene in normal diploid human fibroblasts Use of isogenic human cancer cells for high-throughput screening and drug discovery Highly efficient endogenous human gene correction using designed zinc-finger nucleases Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery Targeted gene knockout in mammalian cells by using engineered zinc-finger nucleases Gene essentiality and synthetic lethality in haploid human cells A negative genetic interaction map in isogenic cancer cell lines reveals cancer cell vulnerabilities Improving single-cell cloning workflow for gene editing in human pluripotent stem cells HIT-Cas9: a CRISPR/Cas9 genome-editing device under tight and effective drug control Development of drug-inducible CRISPR-Cas9 systems for large-scale functional screening Dual gene activation and knockout screen reveals directional dependencies in genetic networks The BH3 mimetic ABT-737 targets selective Bcl-2 proteins and efficiently induces apoptosis via Bak/Bax if Mcl-1 is neutralized Exploiting selective BCL-2 family inhibitors to dissect cell survival dependencies and define improved strategies for cancer therapy The MCL1 inhibitor S63845 is tolerable and effective in diverse cancer models Mitochondrial E3 ubiquitin ligase MARCH5 controls mitochondrial fission and cell sensitivity to stress-induced apoptosis through regulation of MiD49 protein Inhibition of MARCH5 ubiquitin ligase abrogates MCL1-dependent resistance to BH3 mimetics via NOXA The conserved SOCS box motif in suppressors of cytokine signaling binds to elongins B and C and may couple bound proteins to proteasomal degradation Prioritization of cancer therapeutic targets using CRISPR-Cas9 screens Interrogation of mammalian protein complex structure and membership using genome-scale fitness screens High-resolution mapping of cancer cell networks using co-functional interactions A network of human functional gene interactions from knockout fitness screens in cancer cells Project DRIVE: a compendium of cancer dependencies and synthetic lethal relationships uncovered by large-scale Fast unfolding of communities in large networks STRING v11: protein-protein association networks with increased coverage supporting functional discovery in genome-wide experimental datasets The CUL5 ubiquitin ligase complex mediates resistance to CDK9 and MCL1 inhibitors in lung cancer cells Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy PARP inhibitors: synthetic lethality in the clinic Ebola virus entry requires the cholesterol transporter Niemann-Pick C1 Selective loss of PARG restores PARylation and counteracts PARP inhibitor-mediated synthetic lethality BioGRID: a general repository for interaction datasets CRISPR screens identify genomic ribonucleotides as a source of PARP-trapping lesions XRCC1 is specifically associated with poly(ADP-ribose) polymerase and negatively regulates its activity following DNA damage XRCC1 polypeptide interacts with DNA polymerase beta and possibly poly (ADP-ribose) polymerase and DNA ligase III is a novel molecular ‘nick-sensor’ in vitro HPF1/C4orf27 is a PARP-1-interacting protein that regulates PARP-1 ADP-ribosylation activity Mechanistic dissection of PARP1 trapping and the impact on in vivo tolerability and efficacy of PARP inhibitors Genome-wide and high-density CRISPR-Cas9 screens identify point mutations in PARP1 causing PARP inhibitor resistance Stereospecific PARP trapping by BMN 673 and comparison with olaparib and rucaparib Pivotal role of inosine triphosphate pyrophosphatase in maintaining genome stability and the prevention of apoptosis in human cells hSWS1·SWSAP1 is an evolutionarily conserved complex required for efficient homologous recombination repair Shu complex SWS1-SWSAP1 promotes early steps in mouse meiotic recombination Human RAD51 paralogue SWSAP1 fosters RAD51 filament by regulating the anti-recombinase FIGNL1 AAA+ ATPase Two different replication factor C proteins separately control PCNA-CRL4Cdt2-mediated Cdt1 proteolysis during S phase and following UV irradiation The multi-subunit GID/CTLH E3 ubiquitin ligase promotes cell proliferation and targets the transcription factor Hbp1 for degradation RANBP9 affects cancer cells response to genotoxic stress and its overexpression is associated with worse response to platinum in NSCLC patients Mutations in the gene encoding the E2 conjugating enzyme UBE2T cause Fanconi anemia TRAIP is a master regulator of DNA interstrand crosslink repair DNA repair profiling reveals nonrandom outcomes at Cas9-mediated breaks Low incidence of off-target mutations in individual CRISPR-Cas9 and TALEN targeted human stem cell clones detected by whole-genome sequencing The PARP inhibitor olaparib induces significant killing of ATM-deficient lymphoid tumor cells in vitro and in vivo Rees, H. A. & Liu, D. R. Base editing: precision chemistry on the genome and transcriptome of living cells. Nat. Rev. Genet. https://doi.org/10.1038/s41576-018-0059-1 (2018) The igraph software package for complex network research Download references and Xiaoping Yang for producing guide libraries and lentivirus; Olivia Bare and Yenarae Lee for logistics support; Matthew Greene and Tom Green for software engineering support; the Broad Institute Genomics Platform Walk-up Sequencing group for Illumina sequencing; and the Functional Genomics Consortium for funding support We thank Sven Rottenberg (Netherlands Cancer Institute University of Bern) and Steven Jackson (University of Cambridge) for helpful conversations regarding PARP inhibitors These authors contributed equally: Peter C All other authors declare no competing interests Peer review information Nature Communications thanks the anonymous reviewer(s) for their contribution to the peer review of this work Download citation DOI: https://doi.org/10.1038/s41467-020-14620-6 a shareable link is not currently available for this article Sign up for the Nature Briefing: Cancer newsletter — what matters in cancer research passed away February 13 at Cornerstone at Canton After graduation he then served honorably with the U.S Army 7th Infantry Division in the Korean War from 1953-54 and they raised three sons in the Collins family homestead on Independence Street Ed’s banking career began at Norfolk County Trust Company in Stoughton later becoming president of BayBank Credit Corporation During his tenure he also completed the Advanced Management Program at Harvard Business School Ed founded Credit Corporation of New England which he then operated until his retirement Ed was the son of James and Joanne (Caron) Piana He had a tremendous love of the Italian language who hailed from Corsica not far from a quaint town named Piana Ed found that potential genealogical connection intriguing His historic research included an in-depth analysis of the emigration of the “Gattinarese” from Italy to the United States in response to decimation of their farmlands by the “Tempest of 1905.” He published a study of this migration and organized a reunion of the descendants of those immigrants in Massachusetts in 1995 In 2005 he engineered a trip to Gattinara for the 100th anniversary of the Tempest with 50 other descendants There he became an honorary citizen of Gattinara Ed was also deeply committed to veterans’ causes He chaired the Massachusetts Korean War Veterans 50th Anniversary Committee and delivered the welcoming address at the dedication of the Korean War Memorial at the Charlestown Navy Yard on July 27 commemorating the 50th anniversary of the Korean Armistice He also became the editor of the Morning Calm the publication of the Korean War Veterans working to increase recognition of the “forgotten war.” In Canton Ed spearheaded an effort to memorialize fallen soldiers from the town from the Civil War to Vietnam He profiled each of the fallen soldiers in articles for the Canton Citizen secured honorary high school degrees for those who had not been able to complete their education and worked with town leaders to commemorate these heroes with plaques on their home street signs dedicated unwaveringly to his family and friends Ed was the beloved husband of the late Ann P (Collins) and the revered father of James E “Nonno” was adored by his seven grandchildren: Danielle donations may be made in Ed’s memory to St Short URL: https://www.thecantoncitizen.com/?p=73056 ORLANDO, Fla., Jan. 09, 2018 (GLOBE NEWSWIRE) -- Pfister an industry leader in plumbing fixtures and a brand known for thoughtful design today introduced an array of design-forward collections at KBIS booth #W1313 Gattinara and Vitrina bath collections; cutting-edge showerhead technologies; and brand-new finish options Each of these introductions represents Pfister’s unwavering commitment to pushing the boundaries of design and innovation “We pride ourselves in continually elevating the bar for water fixtures with beautiful standout product collections that make a true statement in the customer’s home,” said Jamie Dorman Group Marketing Manager Wholsesale for Pfister “The stunning Rhen collection exudes grace and elegance as it captures the movement of fabric modern aesthetic and Vitrina echoes seagulls in flight Each of these uniquely inspired designs embodies a personality all its own We are thrilled to introduce them at KBIS.” Pfister’s showcase also invited visitors to participate in a social media fundraiser to support the Surfrider Foundation For every attendee who posted a selfie at the booth with the KBIS hashtag #PfisterForGood Pfister chose to support the Surfrider Foundation because of its shared attitude culture and care with all things related to clean water—coastal cleanup Pfister’s newest bath collection launching in Fall 2018 is inspired by the graceful movement of fabric and the alluring curvatures of an hourglass With more than 100 new items exuding this fluid elegance Rhen stands apart in a way no other faucet design has before The collection’s initial muse was an heirloom wedding gown interwoven with flowing drapery details At the early stages of the development process Pfister’s designer studied fabrics to capture the organic movement of the drapery details and then integrated the fluid motion of fabric into the Rhen collection Pfister also revealed the novel peek-a-boo trough Rhen’s petite spout seamlessly delivers water that follows its graceful curvature This unique interpretation of the classic trough coyly gives the user a peek into the waterway Rhen products and accessories include faucets Each piece embodies the sculpturesque design artisan craftsmanship and attention to detail that work together to give this regal collection its breathtaking effect FORTIS GATTINARA AND VITRINA COLLECTIONSAvailable in the summer of 2018 extensive FORTIS Gattinara and Vitrina bath collections will include showering products The Gattinara collection was designed from the concept of organic flowing water from the rocks one would find in the crisp clean streams and lakes near the Italian Alps The Gattinara is a new take on a trough faucet with the mechanism for the trough becoming central to the design of the faucet itself The name comes from the northern Italian wine region of Gattinara modern aesthetic and natural beauty of the faucet The Vitrina collection was inspired by the flowing shape of seagulls in flight seagulls will follow the small boats each day as they leave the dock to fish for the daily catch The designer was inspired by these birds’ fluidity and the profile of their wings to create a collection that feels like it could take flight in spite of its brass construction The name Vitrina means “window” and evokes the image of Lake Orta with its clear-as-glass surface The FORTIS line is exclusive to Ferguson in the US These collections will appear in Ferguson showrooms starting in 2018 SHOWERHEAD TECHNOLOGIESPfister proudly introduced two all-new showerhead technologies: ThermoForce™ and HydroFuse™ ThermoForce™ technology heightens the showering experience by providing the perfect coverage ThermoForce™ is a specially engineered system of four spray nozzles that enhances coverage by creating intersecting cone-shaped streams that provide 320 percent more coverage for a satisfying drenching effect (Coverage is measured in accordance with EPA WaterSense Specifications for Showerheads.) The technology optimizes heat through larger nozzle openings that allow for larger droplets—which retain heat longer—resulting in an invigorating shower ThermoForce™ expertly regulates water pressure to strike an optimal balance between water conservation and an invigorating HydroFuse™ creates a spectacular showcase of water Strategically placed directional nozzles create a dramatic mesh-like spray pattern inspired by the architecture of London’s King’s Cross railway station The streams and center nozzle were engineered to create geometric patterns before they elegantly collide The collision breaks up the water streams into large drenching droplets that retain their soothing temperature longer and offer an increase in coverage NEW FINISH OPTIONSPfister’s showroom is further expanding its range of finishes with the addition of brushed gold Showcasing a sophisticated luster with a flair of luxury the brushed gold finish answers the significant style comeback of warm and opulent finishes as well as the shift in style preferences toward gold-hued details Pfister’s brushed gold is available in two collections and will be available in the new Rhen collection To satisfy the growing demand for matte black finishes Pfister is expanding this existing finish in various kitchen and bath collections including the new Stellen pull-down faucet and the new Rhen collection To learn more about Pfister and its portfolio of styles, technologies and finishes, please visit http://www.pfisterfaucets.com/ ABOUT PFISTERPfister is part of Hardware and Home Improvement (HHI) a major manufacturer and supplier of residential locksets residential builders’ hardware and faucets with a portfolio of renowned brands HHI is a leader in its key markets with #1 positions in U.S HHI has a global sales force and operates manufacturing and distribution facilities in the U.S. HHI is a division of Spectrum Brands Holdings diversified consumer products company and a leading supplier of consumer batteries residential builders’ hardware and faucets lawn and garden and home pest control products Spectrum Brands employs nearly 18,000 employees worldwide and sells to the top 25 global retailers with products in more than one million stores MEDIA CONTACT: Sabrina Suarez, 714-573-0899 x. 227sabrina@echomediateam.com journalist and photographer based in Chicago He specialises in Italian wines and has a blog dedicated to the subject The World of Fine Wine and Quarterly Review of Wines Alto Piemonte, an east-west wine territory in northern Piedmont, has attracted a good deal of critical attention over the past decade, especially with its Nebbiolo-based wines such as Gattinara While quality is impressive with the best examples, there have been too many inconsistent releases, despite many favourable vintages in recent years; new plantings that are still a bit young along with a lack of experience with many winemakers are two important factors at play here. If Alto Piemonte is to garner more acceptance among the trade as well as consumers, it needs an individual who combines excellent wines with a strong personality; given that, Christoph Künzli could be the area’s saviour. Campi Raudii was the Latin name for the area that today includes Alto Piemonte. Settled by Celtic tribes, this northern Piedmont region's viticultural heritage is Etruscan. The cultural mix resulted in powerful red wines made more palatable by barrel aging, a stark contrast to the Roman style of aromatic, sweet whites in the Greek tradition, even after the Romans' decisive victory over the Celts there in 101 B.C. This article was published more than 6 years ago We had a couple of old friends over for a meal two weeks ago One was a white Burgundy – a Chablis and a premier cru – the other a higher priced pinot grigio the lady drank Scotch and a big red wine we all like an old vines zinfandel from Vintages [the LCBO’s premium wine and spirits outlet in Ontario] Two day later I put both white wines back in the wine rack My question is: Does the cooling and re-storing do the wine any harm Our wine rack is not in a cool area of the house I keep a full-size fridge dedicated to white wine humidity-controlled models designed for cellaring wine; I mean the simple fridge kind where you store milk eggs and last week’s Chinese-takeout leftovers Mainly I use it to chill bottles that I need to taste for review purposes (as well as for the occasional tub of leftovers) but frequently I make room for white wines from my cellar that I intend to pour when friends come to dinner If we don’t get around to uncorking them all I take the unopened bottles back down to the basement You don’t want to subject wine to this up-and-down temperature swing very often One or two or even three times might be fine Most people think that it’s the temperature fluctuation itself that does that damage unless you heat the wine so high that you actually cook it The main concern is with the fluid’s expansion and contraction pulling in air through the cork or even through the screw cap (screw caps do not always provide a 100-per-cent airtight seal) Extremely slow exposure to oxygen (over months or years) can benefit wine E-mail your wine and spirits questions to Beppi Crosariol. Look for answers to select questions to appear in the Wine & Spirits newsletter and on The Globe and Mail website Beppi Crosariol will once again be participating as The Globe’s wine expert on both the July 1-11, 2019, Globe and Mail Seine River (Paris and Normandy) Cruise and the July 28-Aug. 7, 2019, Globe and Mail Portugal River Cruise. For details on how to reserve your cabin visit GlobeandMailCruises.com Report an editorial error Report a technical issue Editorial code of conduct Beppi Crosariol was The Globe and Mail's wine and spirits columnist for almost 20 years and enjoys a large following of devoted readers he also wrote a food trends column called The Biting Edge he held a variety of additional positions in the newsroom He was also a regular columnist with Report on Business Magazine he worked as a technology reporter at The Boston Globe and He started his career as a science writer and investigative reporter at the Kingston Whig-Standard Beppi has a master's degree in the philosophy of science from the University of Toronto and was a Knight fellow at the Massachusetts Institute of Technology He has won a National Magazine Award for investigative journalism and five Canadian Science Writers Association awards Welcome to The Globe and Mail’s comment community. This is a space where subscribers can engage with each other and Globe staff. Non-subscribers can read and sort comments but will not be able to engage with them in any way. Click here to subscribe If you would like to write a letter to the editor, please forward it to letters@globeandmail.com. Readers can also interact with The Globe on Facebook and Twitter Welcome to The Globe and Mail’s comment community This is a space where subscribers can engage with each other and Globe staff We aim to create a safe and valuable space for discussion and debate If you do not see your comment posted immediately it is being reviewed by the moderation team and may appear shortly We aim to have all comments reviewed in a timely manner Comments that violate our community guidelines will not be posted UPDATED: Read our community guidelines here We have closed comments on this story for legal reasons or for abuse. For more information on our commenting policies and how our community-based moderation works, please read our Community Guidelines and our Terms and Conditions The Alto Piemonte region is located just below the Italian Alps with Monte Rosa clearly visible on the brightest of days with protruding ‘fingers’ being the valleys of Boca Extreme weather phenomena here are relatively common which describes very well the marginality of the climate – the province of Novara is 1°C cooler on average (12.02°C) and 300mm wetter (1,000mm) than Castiglione Falletto in Langhe this marginality is a terrific advantage for the grapes the main variety in the blend of Alto Piemonte wines acquires a stunning elegance and complexity in the best vintages The area can be clearly defined as ‘heroic viticulture’ giving almost unsurpassed layers of complexity and elegance The wines of Boca are even known for their signature pink grapefruit character More than 600 wines were tasted by senior editor Bruce Sanderson for the Piedmont report in the April 30, 2022, issue of Wine Spectator. For a full analysis of the latest vintage and recommended wines, read “Fortune Favors Barolo.” WineSpectator.com members can find full reviews, with full tasting notes, in the Wine Ratings Search. Discover this New York region with these new reviews of delicious white wines from new and … Over 450 red, white and rosé sparkling wines from around the world were reviewed by Wine … Nearly 475 red and white wines from Oregon were reviewed by Wine Spectator senior editor … More than 150 wines from across the Brunello di Montalcino region of Italy were reviewed by … New reviews of well-priced Cabernet Sauvignon, Chardonnay, sparkling wine and more from … From Alsace to the Alps and beyond, explore these new reviews of Sauvignon Blanc, Riesling … Norske og internasjonale forskningsnyheter CasaPound Italia (CPI) is a street-based far right group which was born with the occupation of a building in Rome and which makes no a secret of its appreciation of Benito Mussolini’s regime Despite its grassroots nature and extreme ideology over the past years CPI acquired national relevance and international media exposure the group opened 94 new local chapters (see Figure 1 below) successfully penetrating mainstream public debates and receiving disproportionate attention by mass media and commentators in Italy and beyond campaigns and brand among mainstream audiences are unprecedented for a fringe group so openly inspired by historical Fascism manage to attract international media attention and influence national politics In the recently published volume CasaPound Italia: Contemporary Extreme Right Politics co-authored with Giorgia Bulli and Matteo Albanese we introduce a theoretical framework to understand how when and why fringe far-right groups may succeed in making their extremist ideologies attractive beyond traditional extreme right circles may obtain high-profile public attention by means of what we call hybridization strategies the strategic combination of organizational features and activities inspired by different political cultures we argue that the success of CPI has to do with the blurring of five main aspects of extreme right politics: ideology we triangulated a wide array of qualitative and quantitative data collected over more than five years of fieldwork in different cities in Italy integrating open observation during public events as well as content analytical data from music CPI's ideology is not fully entrenched in Fascism but it is not disconnected from it either, as it is indebted to various strands of historical and post-war Fascism, including Destra Sociale and Nouvelle Droite Rather than dismissing all references to inter-war and post-war worldviews, CPI uses the concept of ethnopluralism to attain ideological coherence Ethnopluralism offers a consistent framing of core themes – like social welfare and globalization – as well as issues considered of secondary importance – like gender and the environment Hybridization thus allowed CPI to emphasize its ideological roots in the tradition of the extreme right while avoiding stigmatization as being outdated or openly racist decision-making and recruitment of CPI does not fully conform to either the model usually followed by electoral actors Rather, it combines formal and informal features hierarchic procedures and spaces of socialization merging the organizational practices of social movements with those of formal political parties The coexistence of these two organizational models crucially contributed CPI’s capacity to draw financial resources and personnel from different venues and to offer both conventional and unconventional modes of political participation for militants and sympathizers styles and practices borrowed from different political cultures These include extreme right identifiers (Mussolini, music in the form of ‘identity rock’ and violent narratives and practices) Che Guevara and Karl Marx) and a set of aesthetic codes concerning activist clothing and the group’s imagery This hybrid stylistic repertoire is crucial to CPI’s public profile as it contributes to reducing stigmatization by outsiders; it facilitates the recognisability of the group by potential sympathizers; and it actively sustains the identification of individuals within the group The repertoire of action of CPI combines activism inside and outside the institutional arena grassroots actions and agitprop operations The group does not consider protest tactics a suboptimal option compared to office-seeking strategies CPI seeks to maximize media coverage by transposing the logics of damage into the electoral arena and those of party competition into the grassroots extreme-right milieu The communication strategy of CPI combines the professionalized media-oriented tactics of both political parties and social movements and allows the group to get coverage for both protest and electoral activities in quality media CPI’s variegated media infrastructure has enabled the group to become recognizable not only among far-right sympathizers but also among the broader public Its particular communication style builds on simplified messages and agitprop campaigns meeting the mass media demand for sensationalistic and entertaining stories This hybrid communication repertoire allowed CPI’s fringe narratives to become part of mainstream public debates and media coverage Through hybridization the far right may adapt to liberal democracy with the goal of radicalizing mainstream ideas and audiences This strategy granted CPI leeway for the diffusion of its ideas and campaigns among a wider public than the (restricted) audience responding to right-wing extremist messages our theory may help understand how other fringe far-right groups are drifting into mainstream public debates but all far-right groups need to find resources to sustain collective action Hybridization strategy allow the strategic differentiation of the venues addressed to gather financial resources and potential members combining electoral politics with unionism as well as subcultural activities maximizing the group’s efforts to find resources both financial and in terms of recruitment and membership all fringe groups need to achieve the recognisability necessary to capture wider support Hybridization strategies allow building distinctive group profiles made of a few appearing more extremist than the radical right in the electoral arena but more credible than old-fashioned extreme-right groups in the protest arena The observations included in this volume about CPI’s hybrid politics might thus serve as a first step for further research into electoral and non-electoral manifestations of far-right politics Welcome to the “Right Now!” blog where you will find commentary analysis and reflection by C-REX’s researchers and affiliates on topics related to contemporary far right politics The Center for Research on Extremism, C-REX, is a cross-disciplinary center for the study of right-wing extremism, hate crime and political violence. It is a joint collaboration with five of the leading Norwegian institutions on extremism research hosted by the Faculty of Social Sciences at the University of Oslo Read more blog entries from Right Now! Sciencenorway.no brings you science news from Norway.This is the English version of forskning.no online newspaper on science.Sciencenorway.no har artikler fra forskning.no på engelsk Privacy policy Sciencenorway.no follows the Norwegian Editor’s Code and the Code of Ethics of the Norwegian Press Editor-in-chief / publisher: Aksel Kjær Vidnes+47 922 47 741 / aksel@forskning.noAssistant editor: Alette Bjordal Gjellesvikalette@forskning.no Researcher's Zone: Frithjof Eide Fjeldstad frithjof@forskning.no Ads and market: Preben Forberg+47 413 10 879 / preben@forskning.noAddress: Sandakerveien 24 C / D3 Alto Piemonte is the collective term for several small DOCs in northern Piedmont, situated almost 100 miles northeast of Alba. It includes Boca, Bramaterra, Faro, Gattinara, Ghemme, Lessona and Sizzano. Through the middle of this cluster of vineyards runs the Sesia river. Wines tasted in February 2022 in Alba at the annual Nebbiolo Prima event, the vintage preview organised by Consorzio Albeisa Rome’s Galleria Borghese is launching a three-year partnership with the Italian luxury goods brand Fendi to create an international study centre dedicated to Caravaggio The museum inside a 17th-century villa is one of 20 leading Italian institutions including the Gallerie degli Uffizi in Florence and Museo di Capodimonte in Naples that gained financial independence from central government in 2015 allowing them to cultivate private funders for the first time Fendi has emerged as a prominent cultural patron in the Italian capital in recent years spending €10m on initiatives such as restoring the Trevi Fountain and other historic fountains and opening an exhibition space in its headquarters the refurbished Fascist-era Palazzo della Civiltà Italiana in the EUR district The Rome-based fashion house is to give the Galleria Borghese around €1.3m to establish the new research centre and support a touring display of Caravaggio paintings drawn from the museum’s collection The nascent Caravaggio Research Institute will be based at the museum and aims to create the most comprehensive online database of the artist’s works exhibition and conservation history and diagnostic reports The institute’s relationship with existing studies on the artist and with other research centres and databases is yet to be defined But it will have support from an advisory board that includes some of the most important experts in Caravaggio studies The initiative “seeks to reintroduce within museums the most advanced research to make them producers of culture and not mere producers of blockbuster exhibitions” the museum is sending three of the six works by Caravaggio in its collection on tour: Boy with a Basket of Fruit (around 1593-94) Saint Jerome (around 1605) and David with the Head of Goliath (around 1610) The show will open on 21 November at the J Paul Getty Museum in Los Angeles (until 18 February 2018) before travelling to other museums in the US and East Asia “It is increasingly a fundamental—as well as moral—value for Fendi to promote support and export Italian art in the world,” says the brand’s chief executive Fendi will also sponsor the Galleria Borghese’s survey exhibition of the 17th-century sculptor Gian Lorenzo Bernini which opens tomorrow (1 November-4 February 2018) and celebrates the 20th anniversary of the museum’s reopening in June 1997 The Intesa Sanpaolo bank is providing additional support preview19 January 2018Bernini is guest of honour at patron's villaGalleria Borghese celebrates the 20th anniversary of its reopening with a show that brings together the artist’s entire career preview26 June 2018The Medici touch: exhibition shows how Florence fell for Islamic artSix centuries of city’s connection to Muslim world explored in rare Uffizi and Bargello collaboration Immigration is seen as a major concern by many Europeans opposition to immigration - across the political spectrum - is the issue which most forcefully mobilizes politically It is this Mobilization Against Migration ( MAM ) that gives our project its name It is a paradox that anti-immigration movements whose key concern is opposing mobility across borders and who advocate isolationism strategies and campaigns across borders and in multilateral forums MAM studies contemporary European anti-immigration movements A comprehensive analytical state-of-the-art framing will be followed by a pilot study to trace transnational outcomes in Europe five comprehensive studies of most different cases (Germany including leading scholars with various specialties will be engaged to inform the ambitious multi-methods design with process-tracing as the key methodology aiming for theory development internet (both to map interaction and gather documents) The multidisciplinary team of five draws from globally leading research environments on social movements MAM will engage with users in a Practitioners Exchange from the initial design phase to the ultimate dissemination of findings Through its platforms for engaging both scholars and users research communication is an integral part of the project from day one including an integrated outreach strategy on multiple platforms to reach all relevant audiences A core ambition of the project is to inspire new projects on transnational anti-immigration mobilization while also drawing up and generating interest in a new agenda on the contentious governance of migration Funder: This project is funded by the Research Council of Norway under the VAM Programme Call for Papers for an international symposium & workshop In an extensive book review published in the journal YOUNG Katrine Fangen offers a nuanced assessment of Hate in the Homeland: The New Global Far Right by Cynthia Miller-Idriss (Princeton University Press Professor at the University of Oslo and member of the PRIO project 'Reaching Out to Close the Border: The Transnationalization of Anti-Immigration Movements in Europe (MAM)' was recently interviewed in framtida Journal article in Comparative Political Studies Journal article in Nations and Nationalism Journal article in Journal of Political Ideologies Journal article in Journal of Contemporary European Studies Journal article in Journal of Common Market Studies Journal article in Journal of Ethnic and Migration Studies Book chapter in The Wiley Blackwell Encyclopedia of Social and Political Movements Journal article in Forschungsjournal Soziale Bewegungen Journal article in Zeitschrift für Vergleichende Politikwissenschaft Transnational Contestation and Civic Populism Book review in Norsk sosiologisk tidsskrift Book chapter in Contentious Migrant Solidarity: Shrinking Spaces and Civil Society Contestation Journal article in European Journal of Political Research Journal article in Politics and Governance Book chapter in Riding the Populist Wave: Europe's Mainstream Right in Crisis Book chapter in Crisis & Politicisation: The Framing and Re- framing of Europe s Permanent Crisis Book chapter in The Many Faces of the Far Right in the Post-Communist Space: A Comparative Study of Far-Right Movements and Identity in the Region Journal article in Politiche Sociali/Social policies Journal article in Politiche Sociali / Social Policies Journal article in Agora: Journal for metafysisk spekulasjon The Peace Research Institute Oslo (PRIO) conducts research on the conditions for peaceful relations between states Fashion has always drawn inspiration from many sources Even the esoteric realm of religion—and Catholicism in particular—has long influenced designers Dolce & Gabbana created a line of clothing based on the mosaics in Monreale Cathedral and Cristóbal Balenciaga made garments and evening capes similar in style to clerical copes These designs will soon go on display at the Metropolitan Museum of Art in the Costume Institute spring blockbuster show Heavenly Bodies: Fashion and the Catholic Imagination (10 May-8 October) “Some might consider fashion to be an unfitting or unseemly medium by which to engage with ideas about the sacred or the divine But dress is central to any discussion about religion – it affirms religious allegiances and it asserts religious differences,” says Andrew Bolton the exhibition’s curator and head of the Costume Institute “While religious dress and fashion are two distinct entities governed by different systems of knowledge relying on subtle visual codes to perform specific functions and to express complex ideas about identity dress not only distinguishes hierarchies but also gender distinctions in much the same way as it does in society in general.” and Andrew Bolton at The Met’s Heavenly Bodies: Fashion and the Catholic Imagination press preview in Rome Courtesy of The Metropolitan Museum of Art/@sgpitalia the museum’s most star-studded fundraising event which this year is co-chaired by Amal Clooney the human rights lawyer (and wife of movie star George Clooney) the designer Donatella Versace and Vogue’s editor-in-chief along with the philanthropist Stephen Schwarzman and his wife A preview of the exhibition presented at the Colonna Gallery in Rome on 26 February was attended by Cardinal Gianfranco Ravasi the president of the Vatican’s Pontifical Council for Culture with Anna Wintour dressed in matching colours “You are what you wear,” Ravasi declared at the press launch and God appears in the Bible as a creator but also as a tailor: “The Lord God made tunics of skin for the man and his wife The show also comes at a special time for the Roman Church; not only do many non-Catholics see Pope Francis as a charismatic figure but Catholic aesthetics are at the centre of the recent television success The Young Pope Perhaps that is why the church has been so generous lending around 40 masterpieces from the Sistine Chapel’s sacristy including 12 vestments commissioned by Empress Maria Anna Carolina of Austria for Pope Pius IX are leaving the Holy See for the first time Some last left their papal fortress in 1983 for The Vatican Collections the third most visited exhibition in the Met’s history The collection includes liturgical garments and accessories donated by Isabella II of Spain to Pope Pius IX is adorned with 18,000 diamonds—from the 18th to the 21st century The oldest work is a mantle worn by Pope Benedict XIV (1740-58) the most recent a pair of red shoes that belonged to Pope John Paul II (1978-2005) There are also more than 150 fashion items that date from the beginning of the 20th century up to today These will be displayed together with work from the Met’s Medieval collection in the Byzantine and Medieval art galleries and Robert Lehman Wing of the museum’s Fifth Avenue building as well as in the Met Cloisters farther uptown The exhibition starts in the Byzantine galleries with garments inspired by that period’s architecture and religious art created for his 1991 and 1997 autumn fashion shows and based on the micro mosaics of Ravenna’s Basilica of San Vitale are displayed next to fragments of ancient mosaics and a silver-gilt processional cross dating from AD1000 The exhibition continues in the Medieval galleries focus on objects influenced by the Catholic hierarchy Among the items included in this section is a Valentino piece that cannot be missed designed by Pierpaolo Piccioli for the 2017 haute couture collection which pays homage to the “great cape” worn by cardinals on the church’s most solemn liturgical occasions There is also a chasuble designed by Jean-Charles de Castelbajac for Pope John Paul II visitors can admire garments that draw on the habits of Catholic sisters and nuns and others from the Cult of the Virgin Mary Among these is one created by Yves Saint Laurent for the statue of the Virgin of El Rocío in the Church of Our Lady of Compassion in Paris for Our Lady of Graces in the Parish of Saint Peter the Apostle in Palagianello the objects draw on the cult of the saints and angels including a garment by Elsa Schiaparelli embroidered with the Keys of Heaven (the designer was baptised in St Peter’s Basilica in Rome) The fashion pilgrimage ends at the Met Cloisters which was built using original materials from historic French monasteries and abbeys it provides the perfect setting for pieces based on the costumes of the religious orders including Balenciaga’s single-seam bridal gown from 1967 with masterpieces of ancient art displayed next to modern clothing But the installation also draws clear correlations between the pageantry of the church and the runway religious dress and fashion… are both inherently performative,” Andrew Bolton explains “There are distinct parallels between a fashion show and a church procession both follow an orderly and regulated arrangement; both involve active and passive participants; and both are accompanied by music.” The cardinal identifies four aspects of this: moral “All regions have their own vestments and ornaments that typify religious ceremonies,” Ravasi said at the preview in Rome “These garments are not necessary in themselves because underneath them we wear secular clothes They are ornamental and rich because they represent the transcendental Courtesy of The Metropolitan Museum of Art; Digital “Gianni Versace’s use of religious imagery highlighted its ubiquity in popular culture a defining decorative element of Versace’s final collection,” the exhibition catalogue states including a series of garments made from a specially developed metal-mesh “that draped and clung to the figure like bias-cut silk but also resembled mail” One example is a gold evening dress bisected from neck to hem by a large cross based on a Byzantine gilt-silver processional cross from the Met’s collection Courtesy of the Collection of the Office of Liturgical Celebrations of the Supreme Pontiff this white silk satin mitre was a gift from Italy’s then prime minister Benito Mussolini to commemorate the signing of the Lateran Treaty on 11 February 1929 in which the Italian government officially recognised Vatican City as an independent state and compensated the church for the loss of the Papal States The diplomatic reconciliation would be short-lived as Pope Pius XI became more critical of Mussolini’s totalitarianism denouncing the Fascist regime as one that “snatches the young from the Church and from Jesus Christ and which inculcates in its own young people hatred Domenico Dolce and Stefano Gabbana “drew on the dazzling mosaics of the Cathedral of Monreale in Sicily” a location with a long history for the designers since Dolce was born and raised on the Italian island The church’s tiled icons were meticulously recreated in printed silk jacquard gold embroidery and crystals in a number of garments which features an image of the “the famously beautiful Saint Agatha of Sicily The tradition of red papal shoes is centuries old the colour signifying “the blood of Christ’s Passion and of Catholic martyrs as well as the fire of the Holy Spirit at Pentecost The fancy footwear only became a regular choice with Pope John XXIII (1958-63) and the loafer style was adopted by Paul VI (1963-78) John Paul II (1978-2005) favoured more of a mahogany later in life like these slippers worn by the Polish pope at the end of his pontificate But the tradition may have ended with Benedict XVI (2005-13) whose ruby red shoes led Newsweek to declare: “The Pope Wears Prada” they were by the Italian cobbler Adriano Stefanelli.) When he took up the papacy in 2013 Francis chose to eschew the red shoes for a more humble plain black pair Courtesy of The Metropolitan Museum of Art; Digital Composite Scan: Katerina Jebb The Empress Maria Anna Carolina of Austria commissioned a suite of 12 vestments for Pope Pius IX that drew on copies of well-known religious paintings by Italian artists The wardrobe “narrates the trajectory of human existence from the Fall in the Garden of Eden to redemption through the Passion of Jesus Christ” It took 15 women from Verona’s Istituto Femminile di Don Nicola Mazza—where the students’ “meticulous rendering of figures’ faces and costumes was a specialty”—almost 16 years to complete the suite Home>The Far-Right Protest Observatory provides systematic comparative data on far-right protest events in Europe It offers a comprehensive repository for researchers dynamics and outcomes of protests by far-right groups including crucial details such as location and motive behind each event.Key Features of FARPO: Several studies have already been derived from this data for example on the reasons why the far right takes to the streets in Europe and on the media coverage of these mobilisations Visit www.farpo.eu to access the observatory and start exploring the data