Over the past year the pandemic has forced all of us to become our own personal MacGyver: maneuvering ordinary things—and in our case workflows—in unpredictable and innovative ways to get the job at hand completed Watson Library had a collection of publications from the Galleria Martano that had been gifted to us by the inimitable Liliana Dematteis While most of us were working from home cataloging electronic books in a home-accessible PDF format this collection was languishing in the library awaiting cataloging Cover image from a Galleria Martano exhibition catalog: Hannah Höch, Hannah Höch 1889-1978: Collage (Stuttgart: Dr At that point few staff members were allowed in the library and those folks were busy processing months of unopened boxes of books and periodicals so while cataloging 135 books was not a high priority for those going onsite I was longing for a task that involved handling an actual physical item we decided to find a way to bring the books and the cataloger together Photographic reproduction from: Pierluigi Fresia, Pierluigi Fresia: Stasera La Luce È Cambiata: Galleria Martano, 9 Aprile-15 Maggio 2010 (Torino : Martano the thought of shipping books in order to have a cataloger work on them at home would be ridiculous A more efficient workflow is to have both book and cataloger in the same location where the books could more swiftly be moved about through a workflow that includes marking them as received sending them to conservation for any treatment as needed This workflow is more readily done in one building but… with a pandemic and social distancing measures in place old ways of doing things go out the window the technical services department put their heads together and came up with a plan to have the books carefully shipped to me through UPS Ground service I would catalog them from the comfort of my own home Three books from the Galleria Martano collection unwrapped from their acid-free paper covering The books arrived in four boxes—each with a plastic bag swaddling the books with bubble wrap padding Within the bags were several small groupings of books elaborately wrapped in acid-free paper It was like Christmas morning for a bibliophile green camping table set up next to my desk where I would assiduously unwrap the books and examine them A selection of titles from the Documenti Martano series (1967 to 1994) While artists’ books are always a pleasure to catalog because of their range of physical formats I also found this exhibition catalog collection to be quite fascinating The completeness of the collection allows for a unique examination into the historical development of a specific art gallery within a particular city It also offers a bibliographic snapshot of the artistic Zeitgeist of Turin from the 1960s to 2010s A selection of titles from Documenti Martano/Due series (1967 to1975) The Galleria Martano was founded in 1965 in Turin by Liliana Dematteis and her husband Martano directed the gallery until his death in 1971 but sagaciously suspended exhibition activity for a year During the early 1970s she collaborated with Maurizio Fagiolo Dell’Arco by sponsoring a series of contemporary art conferences that were meant to embrace the entire art world: art critics the gallery had two locations in Turin—one on Lungo Po Cadorna The original Galleria Martano location had a more traditional exhibition program while the Galleria Martano/Due focused on Futurism and abstract art Dematteis has stressed the gallery’s keen interest in publishing avant-garde artists’ work which had been suppressed from the 1920 to the 1940s due to the Italian fascist regime the gallery revived its exhibitions in the direction of conceptual art and historical photography the gallery relocated to via Principe Amedeo where the focus was on artists such as Marco Gastini the gallery kept in sight both the art historical past of Turin and the art of the present-day Turin always looking to submit to the public view previously unexamined Dematteis remained in charge until the gallery closed its doors in 2013 Reproduction of a Man Ray photograph of Meret Oppenheim from a Galleria Martano exhibition catalog: Ida Gianelli, Meret Oppenheim (Firenze: Alinari Reproduction of a photographic self-portrait by Florence Henri from: Florence Henri, Florence Henri: Una Riflessione Sulla Fotografia (Torino: Martano The Galleria Martano publications can be found in Watsonline under the name of the gallery in an author search or by the series title under a title search Watson Library is indebted to Liliana Dematteis for giving to us such an incredible collection for future research The Galleria Martano books are re-boxed and ready to be shipped back to the Thomas J This website is using a security service to protect itself from online attacks The action you just performed triggered the security solution There are several actions that could trigger this block including submitting a certain word or phrase You can email the site owner to let them know you were blocked Please include what you were doing when this page came up and the Cloudflare Ray ID found at the bottom of this page If the Rangers are going to make a run at the postseason they need Mike Minor to keep doing what he’s been doing this year the American League is rife with interesting story lines Although the Astros are likely going to run-away with the West (ok one of the intriguing developments going into the summer is the other Texas-based AL team as the Rangers have positioned themselves to potentially be buyers at this year’s trade deadline en route to their first potential postseason berth since 2016 and most projection systems had them a near-90 loss team Texas is playing well through the first ~40 percent of the season The Rangers are currently 36-32 coming off a series split with the sputtering Red Sox The surprises have been all over the lineup and on the mound led by two unlikely starting pitchers that few expected to be impact-players Earlier this week, my colleague Kenny Kelly profiled veteran journeyman Lance Lynn’s excellent year Lynn is playing well despite bouncing around between four teams over the last two years Today we take a look at Mike Minor’s sudden surge as a reliable starter a mere year-and-a-half after Texas moved him into the rotation following a season in the Royals’ bullpen Texas’ previously yawn-inducing one/two punch has actually been one of the most effective tandems in baseball this season with Minor leading all pitchers in bWAR and Lynn not that farr off the top-ten Mike Minor’s 4.5 bWAR is nearly a full-win ahead of second-place Hyun-Jin Ryu who is showing his dominance for the first time in years Last season the Rangers signed the 31-year-old Minor to a three-year deal expecting to turn the then-reliever into a starter Coming off a season in which he tossed 77 ⅔ innings out of Kansas City’s bullpen Minor started 28 games and pitched 157 innings for Texas in 2018; he showed particular steps forward in the second half of the season 2018 was a success as far as getting Minor’s innings up from less-than 80 to 157 as he posted an earned run average 11 percentage points better than the league average (a 111 ERA+) and his strikeout rate went down eight percentage points he showed marked improvement as the year progressed 2019 has been an opportunity for Minor to demonstate that 2018 was not a fluke earning his an ERA+ of 195 (or if you prefer His strikeout rate is hovering around 25 percent which is considerably higher than his career 21.8 percent which is right in-line with what we would expect from a league average standpoint and though his walk rate is a tick higher than last year There is one thing that Minor has been good at this season that is not likely to sustain itself through the remainder of the year: his ability to leave men on base and get out of innings His strand rate this season is a sky-high 87.1 percent considerably higher than his 74.6 percent career mark Putting this into the context of the average American League starter we generally would expect that 87 percent to dip down to about 71 percent which obviously would have a major effect on the number of runs scoring against Minor and diving more deeply into Minor’s repertoire we some some subtle changes in his approach he is relying less on his four seam fastball and supplementing it more often with his curveball and changeup Minor has adjusted his pitch selection slightly Here is the breakdown of aggregate pitches thrown since Texas moved him back into the rotation Minor’s contact-against percentages have largely stayed the same between 2018 and 2019 with approximately 20 percent of contact classified as soft The results on the types of balls batters are putting in play against him however has changed pretty substantially Minor generated a near-45 percent flyball rate as batters have generated 34.8 percent flyballs to 43.9 percent on gounders a surprising development in the hitters’ fly-ball revolution days While few would have projected Minor for a career-year on the other-side-of-thirty he’s been pitching very well going back to the second-half of last season Minor held hitters to a paltry .194/.251/.369 slash line For the Rangers to sustain success and make a wild card run they are at the mercy of the top-end of their pitching staff (Minor and Lynn) and are hoping for their offense to continue to perform While they remain an underdog to earn a wildcard spot if the Indians and Red Sox can’t put together a decent winning streak a Texas postseason berth is there for the taking Steven Martano is an Editor at Beyond the Box Score, a Contributing Prospect Writer for the Colorado Rockies at Purple Row, and a contributing writer for The Hardball Times. You can follow him on Twitter at @SMartano by Emilie Sweigart Americas Quarterly (AQ) is the premier publication on politics We are an independent publication of the Americas Society/Council of the Americas PUBLISHED BY AMERICAS SOCIETY/ COUNCIL OF THE AMERICAS This website is using a security service to protect itself from online attacks. The action you just performed triggered the security solution. There are several actions that could trigger this block including submitting a certain word or phrase, a SQL command or malformed data. You can email the site owner to let them know you were blocked. Please include what you were doing when this page came up and the Cloudflare Ray ID found at the bottom of this page. With the announcement of the Mets new ownership group it’s a dream come true for many fans.. but a lesson in being careful what you wish for. On Wednesday afternoon, Bloomberg reported that Fred Wilpon, owner of the New York Mets since August of 2002 will be moving to a minority ownership stake selling up to an 80 percent share in the organization to billionaire Steve Cohen (a current minority owner) and the deal is reported to keep Wilpon as current principal owner at the helm for the next five years Cohen will have more and more influence over the course of the next few years until he ascends to the top position as majority owner in 2024 Cohen is from Long Island, and has been interested in purchasing a Major League franchise for some time. His unsuccessful bid to purchase the Dodgers from the McCourts positioned him to invest in the Mets as a minority owner who founded hedge fund SAC Capital Advisors in the early 90s ethics violations and guilty pleas of fraud and insider trading by the business led to record finds Though the organization paid a then-record fine related to fraud and insider trading Cohen has done exceedingly well financially My esteemed colleague and legal expert Sheryl Ring will have more on Cohen and SAC’s legal troubles in another article it’s not a great look that MLB will overwhelmingly approve an owner implicated in fraudulent finances and insider trading At a time when labor relations are strained and whispers (and shouts) of collusion appear in the press weekly Though it seems the Wilpons have led the Mets for decades, Fred Wilpon only became a majority owner in 2002, when he purchased a 50 percent share from Nelson Doubleday with whom he was a 50/50 partner. In that time, the Mets have had some success on the field, but continued to remain a foil to the Yankees near-perennial big-spending Personally distracted and financially affected by the Bernie Madoff Ponzi scheme the Wilpons appeared to put in an austerity plan while they licked their wounds after being bilked out of millions of dollars in Madoffs’ phony funds the Mets made the playoffs just three times in that 17-year stretch Though the new ownership structure started off strong with the acquisition of Carlos Beltran and former Cy Young winner Pedro Martinez it took several years for New York to ascend to the top of the NL East as they finished with a strong 97-65 record and made it to game seven of the NLCS (the infamous Beltran strikeout) It took a further nine years before the Mets made it back to the playoffs and in that time they finished more than 17 games out of first place in six consecutive frustrating and futile seasons On top of the on-field failures following the game seven loss 2008 led to the dismantling of Madoff’s scheme and an austerity program driven by the Mets front office During this period of cheapness and non-competitiveness the Wilpons executed on the grand opening of a new stadium Citi Field (aptly named for a bank that in the process of burning to the ground at the time amidst a broader financial crisis) A fine and much-needed stadium was a great distraction for a team mired in mediocrity that had been playing in an antiquated home park Opening day at Citi Field in 2009 included much fanfare for a team that had been playing in the dilapidated Shea Stadium for decades While Citi Field has a lot of character and great views and good energy there was a distinct and conspicuous absence of Mets history Dodgers fan-boy Fred Wilpon and company opted to celebrate the Brooklyn Dodgers more than the New York Mets or staircase named for any of the Mets greatest players who appropriately and unsurprisingly generated backlash at the affront On the field, the Mets managed to somehow make it to the World Series in 2015 despite being a .500 team in late-July. The 90-win Mets took the Dodgers to the brink in the NLDS, prevailing in five games (sorry Fred), and then had their way with the favored Cubs The Mets met their match in the red-hot run-and-gun Royals Though New York led late in all five games they lost four of them thanks to a bullpen that simply could not keep a lead the Wilpon tenure of ownership will likely go down as a negative period for Mets fans Mired by dozens of games out of first place for many of their years at the helm Mets fans’ inferiority complex in the city and in the division reared its ugly head regularly as the team struggled to retain relevance the new ownership group can allay all fears by spending on good players on the free agent market and locking up strong Whether that is the reality remains to be seen as this may buck the trend for all MLB teams at the moment—a moment when it seems all 30 teams are on an austerity plan Mookie Betts should start taking some grounders because he ought to play second base in the World Series Boston’s offense was a well-oiled machine in both the LDS and LCS combining home run firepower with the ability to advance players bases through singles and doubles They received production from all parts of the lineup with key hits from unlikely players like Christian Vazquez and Jackie Bradley Jr and taking extra bases added to the litany of an offense that never stops where the bottom of the order is just as dangerous as the rest of the lineup Shortly after the Red Sox defeated the Astros in the the fifth game of the ALCS I got to wondering how their barrage of offensive firepower would translate to a National League park one in which the designated hitter disappears The answer was immediately clear to me: put Mookie Betts at second base when playing on the road There are few athletes as gifted as Betts: the guy can bowl a 300 game, solve a Rubik’s cube in less than two minutes, dunk a basketball, and makes spectacular defensive plays in the outfield the position he played when the Red Sox drafted him in 2011 With Dustin Pedroia expected to man the position for the foreseeable future and the lofty expectations that Betts would ascend to the Majors in relatively quick fashion Boston had him split his time between the outfield and second base as Betts has proved to be one of the best right fielders in the game Betts played 14 games at second and 37 games in the outfield Although he only played second base once this season there is no reason to believe he wouldn’t be a fine substitute for Ian Kinsler or Brock Holt who have been the fill-ins for an injured Pedroia Let’s break this down to make this an even easier decision they’re essentially trading-in Kinsler / Holt’s offense for Martinez’ while sacrificing some defensive prowess but let’s take a look at the other side of the ball Martinez played 57 games in the outfield this season Mookie Betts saved Boston 19 runs over the course of his 120 appearances in the outfield Martinez only cost Boston a barely noticeable .05 runs per game this would tell us the Red Sox would sacrifice .2 runs per game by making the defensive switch assuming Betts’ defense at second base was neutral It’s also worth pointing out that Brock Holt’s second base numbers were slightly below average (-3) with Ian Kinsler slightly above average (6) We’re not exactly depriving Ryne Sandberg-edque defense by making this change the numbers blow the doors off the comparatively neutral defensive stats In 150 total games in which Martinez played Based on the sacrifices we saw in defensive metrics getting his bat in the lineup makes up for it nearly ten-fold While it’s obvious that Betts is the better outfielder than J.D two-thirds of the Dodgers offense is right-handed it’s likely that the right side of the field gets less action over the course of the handful of games in Los Angeles furthering the point that there isn’t a ton of risk using this strategy The positives are clearly evident when you look at the value diminished by putting out a weaker right fielder Mookie’s athleticism and history at second base make this a no-brainer in a short series Having ALCS MVP Jackie Bradley manning centerfield should assuage fears that Martinez has to cover that much ground having his bat in the lineup every World Series game will be critical for the Red Sox success Please enable JS and disable any ad blocker Assemblyman Michael Cusick (D-Mid-Island) awarded the young winners of his annual Total Fitness Challenge at the College of Staten Island in Willowbrook Wednesday (Photo courtesy of Office of NYS Assemblyman Michael J .st1{fill-rule:evenodd;clip-rule:evenodd;fill:#2a2a2a}By Allie Griffin | agriffin@siadvance.comSTATEN ISLAND -- Students were recently awarded for their commitment to exercising both their bodies and minds On Wednesday evening, Assemblyman Michael Cusick (D-Mid-Island) awarded the young winners of his annual Total Fitness Challenge at the College of Staten Island in Willowbrook an Island-wide summer competition that encourages kids to stay active in the summer months through physical exercise and reading The event is open to students from pre-K through eighth grade whether attending public or private school "The reason I started the annual Total Fitness Challenge is to ensure that our children stay active both mentally and physically over the summer months" said Cusick "I have been a lifelong advocate for living a healthy lifestyle and addressing the rising levels of childhood obesity within our younger generation With video games being a popular hobby of our youth will encourage kids to keep moving over the summer." more than 40 schools and nearly 500 students participated in this year's challenge The competition was sponsored by NFL's Play 60 Program 3rd Matthew Russo- Our Lady of Good Counsel 3rd Sofia Barnes- Our Lady of Good Counsel 1st Alexandra Young- PS 8 2nd Hailey Williams- PS 58 3rd Addison Marrocco- Our Lady Star of the Sea 2nd Ekberg Pacaeco- Staten Island Civic Leadership The overall winning school was PS 29 in in Castleton Corners Use of and/or registration on any portion of this site constitutes acceptance of our User Agreement, (updated 8/1/2024) and acknowledgement of our Privacy Policy, and Your Privacy Choices and Rights (updated 1/1/2025) © 2025 Advance Local Media LLC. All rights reserved (About Us) The material on this site may not be reproduced except with the prior written permission of Advance Local Community Rules apply to all content you upload or otherwise submit to this site YouTube's privacy policy is available here and YouTube's terms of service is available here Ad Choices Volume 12 - 2022 | https://doi.org/10.3389/fcimb.2022.896932 This article is part of the Research TopicInsights into Bee Diseases and Bee HealthView all 6 articles The Oriental hornet (Vespa orientalis) is spreading across the Italian territory threatening the health and wellbeing of honeybees by feeding on adult individuals and larvae and by plundering hive resources Considering the capacity of other hornets in harboring honeybee viruses the aim of this study was to identify the possible role of the Oriental hornet as a vector for honeybee viruses Adult hornets were subjected to macroscopical examination to identify the presence of lesions and to biomolecular investigation to detect the presence of six honeybee viruses: Acute Bee Paralysis Virus (ABPV) No macroscopical alterations were found while biomolecular results showed that DWV was the most detected virus (25/30) In 20/30 samples several co-infections were identified The most frequent (17/30) was the association between DWV and ABPV One sample (1/30) showed the presence of four different viruses namely DWV The detected viruses are the most widespread in apiaries across the Italian territory suggesting the possible passage from honeybees to V by predation of infected adult honeybees and larvae it is still not clear if these viruses are replicative but we can suggest a role as mechanical vector of V little information is available on the presence of honeybee pathogens in V The aim of this study was to assess the presence of six honeybee viruses 30 adult Oriental hornets were collected from three different apiaries located in the Campania region (A= 40°51’17.866”N 14°22’14.671” E; B=40°50’32.898” N 14°4’50.426 E; C=40°52’31.896” N Samples were captured during their predatory activity in the proximity of the hives using a butterfly net All samples were transported in 50 mL tubes to the laboratory of Veterinary General Pathology and Anatomical Pathology of the Department of Veterinary Medicine and Animal Productions University of Naples “Federico II” where they were immobilized with chilling for 5 min at -20°C A 150 base pairs segment of 28s ribosomal RNA of V orientalis was also amplified as a housekeeping gene to ensure the presence of amplifiable cDNA in each sample by using the following primer pair designed on the sequence available on GenBank (KF933071.1): V.Orientalis 28S_1 FW: TGGGATGAACCAAACGCAGA V.Orientalis 28S_1 REV: CTAGTTGCTTCGGCAGGTGA one no template control (NTC) was included as negative control BQCV and gBlocks Gene Fragments (Integrated DNA Technologies USA) mimicking CBPV and KBV intended amplicons were employed as positive controls Amplification products were then migrated by electrophoresis on 2.5% agarose gel in TAE buffer (Tris-Acetate-EDTA) along with a 100 bp molecular marker (Bioline) stained with ethidium bromide and observed under UV with the ChemiDoc gel scanner (Bio-Rad) Ethical review and approval were waived for this study and national implementing decree following the European regulation 2010/63/UE ethical approval is not necessary for invertebrates with the except of Cephalopoda Figure 1 Adult individual of Vespa orientalis showing the typical yellow bands of the abdominal metasoma Macroscopical examination did not reveal any alterations in the examined samples (30/30; 100%) which could have suggested the presence of viral infection PCR results showed that 28/30 (93%) samples were positive for at least one virus while no sample was found positive for CBPV ABPV in 19/30 samples (63%) and BQCV in 13/30 samples (43%) KBV and SBV cDNAs were amplified in 1/30 samples (3%) and 1/30 samples (3%) 28s ribosomial RNA amplification confirmed the integrity of all analyzed cDNAs several co-infections were identified in 20/30 (67%) samples the association between DWV and ABPV was the most frequent (17/30; 56%) One sample (1/30; 3%) showed the presence of four different viruses namely DWV For a comprehensive view of PCR positivity and additional co-infections, see Table 1 Table 1 Detection of honeybee viruses and 28s ribosomal RNA in V.orientalis by multiplex PCR or conspecific feeding in close proximity of rotten fruits or flowers it is still not clear if these viruses are replicative and represent real infections or if the Oriental hornet is an “incidental host” which acquired viruses passively through feeding Future analysis aimed at quantifying the viral load and sequencing of the viral genetic material harbored by both Oriental hornet and honeybees collected from the same apiary Further studies are needed to better understand the role of V The original contributions presented in the study are included in the article/supplementary material Further inquiries can be directed to the corresponding author MM and PM; Writing—Original Draft Preparation All authors read and approved the final version of this manuscript The authors received financial support from the research funding of the Department of Veterinary Medicine and Animal Productions The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher Patrizio Catalano for helping providing the samples and Anastasia Palumbo and Anna Matrone for participating to the experiments CrossRef Full Text | Google Scholar Felis Catus Papillomavirus Type-2 But Not Type-1 Is Detectable and Transcriptionally Active in the Blood of Healthy Cats Distribution and Nesting Biology of Vespa Orientalis L Google Scholar Monitoring Honey Bee Health in Five Natural Protected Areas in Italy Spread of the Invasive Yellow-Legged Hornet Vespa Velutina (Hymenoptera: Vespidae) in Italy Impact of Nutritional Stress on the Honeybee Colony Health Orientali Verso Nord: Insediamento Di Una Popolazione Urbana Di Calabrone Orientale (Vespa Orientalis Linnaeus 1771) a Trieste Atti del Museo Civico di Storia Naturale di Trieste Google Scholar PubMed Abstract | CrossRef Full Text | Google Scholar Development of a Multiplex RT-PCR Assay for the Routine Detection of Seven RNA Viruses in Apis Mellifera Hornets and Honey Bees: A Coevolutionary Arms Race Between Ancient Adaptations and New Invasive Threats Checklist of the Species in the Subfamily Vespinae (Insecta:Hymenoptera:Vespidae) Google Scholar Ćetković A Review of the European Distribution of the Oriental Hornet (Hymenoptera Google Scholar Competition Between the Native and the Introduced Hornets Vespa Crabro and Vespa Velutina: A Comparison of Potentially Relevant Life-History Traits Possible Spillover of Pathogens Between Bee Communities Foraging on the Same Floral Resource Google Scholar Dvořák Oriental Hornet Vespa Orientalis Linnaeus 1771 Found in Mexico (Hymenoptera Google Scholar Genetic Evidence for Coinfection of Honey Bees by Acute Bee Paralysis and Kashmir Bee Viruses as a Potential Biological Vector of Honeybee Viruses CrossRef Full Text | Google Scholar Detection of Deformed Wing Virus in Vespa Crabro Google Scholar Gabín-García Identification of Pathogens in the Invasive Hornet Vespa Velutina and in Native Hymenoptera (Apidae in Bumble Bees (Bombus Terrestris and Bombus Pascuorum) With Wing Deformities Présence en France métropolitaine d’un frelonallochtone : Vespa orientalis Linnaeus Google Scholar Viruses of Commercialized Insect Pollinators PubMed Abstract | CrossRef Full Text | Google Scholar The Northernmost Record of Vespa Orientalis Linnaeu(Hymenoptera: Vespidae) in Peninsular Italy Google Scholar doi: 10.1146/annurev-ento-011118-111942 PubMed Abstract | CrossRef Full Text | Google Scholar Evidence for and Against Deformed Wing Virus Spillover From Honey Bees to Bumble Bees: A Reverse Genetic Analysis Hernández Primera Cita De La Avispa Oriental Invasora Vespa Orientalis Linnaeus 1771 (Hymenoptera: Vespidae) En La Península Ibérica Boletín la Sociedad Entomológica Aragonesa Google Scholar Detection and Replication of Moku Virus in Honey Bees and Social Wasps CrossRef Full Text | Google Scholar Climate Change and Biological Invasions: Evidence CrossRef Full Text | Google Scholar Google Scholar Observations Sur La Biologie De La GuêPe Orientale Vespa Orientalis F CrossRef Full Text | Google Scholar Vespa Velutina: An Alien Driver of Honey Bee Colony Losses CrossRef Full Text | Google Scholar Google Scholar Invasion Success and Management Strategies for Social Vespula Wasps doi: 10.1146/annurev-ento-011118-111812 Google Scholar Fauna Svecica Sistens Animalia Sveciae Regni: Mammalia Google Scholar Google Scholar Emergenza Api Ed Insetti Impollinatori-Quaderni Sulla Sanità Pubblica 4 Google Scholar Deformed Wing Virus in Honeybees and Other Insects doi: 10.1146/annurev-virology-092818-015700 PubMed Abstract | CrossRef Full Text | Google Scholar Ecological Study on Vespine Wasps (Hymenoptera: Vespidae) Attacking Honeybee Colonies: ISeasonal Changes in the Frequency of Visits to Apiaries by Vespine Wasps and Damage Inflicted Especially in the Absence of Artificial Protection ““Vespa and Provespa”,” in The Social Biology of Wasps (New York Google Scholar Google Scholar Infectivity of DWV Associated to Flower Pollen: Experimental Evidence of a Horizontal Transmission Route Detection of Replicative Kashmir Bee Virus and Black Queen Cell Virus in Asian Hornet Vespa Velutina (Lepelieter 1836) in Italy First Detection of Replicative Deformed Wing Virus (DWV) in Vespa Velutina Nigrithorax Google Scholar Native Prey and Invasive Predator Patterns of Foraging Activity: The Case of the Yellow-Legged Hornet Predation at European Honeybee Hives Vespa Velutina: A New Invasive Predator of Honeybees in Europe CrossRef Full Text | Google Scholar Moku Virus; a New Iflavirus Found in Wasps Google Scholar The Spread of Pathogens Through Trade in Honey Bees and Their Products (Including Queen Bees and Semen): Overview and Recent Developments Pathogens Spillover From Honey Bees to Other Arthropods PubMed Abstract | CrossRef Full Text | Google Scholar Oriental Hornet (Vespa orientalis) as AFB Disease Vector to Honeybee (Apis mellifera L.) Google Scholar The Detection of Honey Bee (Apis Mellifera)-Associated Viruses in Ants The Status of Honey Bee Health in Italy: Results From the Nationwide Bee Monitoring Network Histopathological Features of Symptomatic and Asymptomatic Honeybees Naturally Infected by Deformed Wing Virus Do Viruses From Managed Honey Bees (Hymenoptera: Apidae) Endanger Wild Bees in Native Prairies Primer Reporte Del Género Vespa Linnaeus (Hymenoptera: Vespidae: Vespinae) En Chile CrossRef Full Text | Google Scholar Santillán-Galicia Transmission of Deformed Wing Virus and Slow Paralysis Virus to Adult Bees (Apis Mellifera L.) by Varroa Destructor Honey Bee Virus Transmission via Hive Products CrossRef Full Text | Google Scholar The Role of Varroa Mites in Infections of Kashmir Bee Virus (KBV) and Deformed Wing Virus (DWV) in Honey Bees The Diversity of Hornets in the Genus Vespa (Hymenoptera: Vespidae; Vespinae) Their Importance and Interceptions in the United States Virus Infections of Honeybees Apis Mellifera Impact of Managed Honey Bee Viruses on Wild Bees PubMed Abstract | CrossRef Full Text | Google Scholar Linking Climate Change and Species Invasion: An Illustration Using Insect Herbivores CrossRef Full Text | Google Scholar The Oriental Hornet (Vespa Orientalis L.): A Threat to the Americas CrossRef Full Text | Google Scholar Bee Viruses: Routes of Infection in Hymenoptera Martano M and Maiolino P (2022) Detection of Honeybee Viruses in Vespa orientalis Received: 15 March 2022; Accepted: 05 April 2022;Published: 04 May 2022 Copyright © 2022 Power, Altamura, Martano and Maiolino. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) distribution or reproduction in other forums is permitted provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited in accordance with accepted academic practice distribution or reproduction is permitted which does not comply with these terms *Correspondence: Karen Power, a2FyZW4ucG93ZXJAdW5pbmEuaXQ= †These authors share last authorship Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher 94% of researchers rate our articles as excellent or goodLearn more about the work of our research integrity team to safeguard the quality of each article we publish {{gallery.imageDetails.images.0.description}} The exhibition entitled "will be held until November 2018"Leonardo Da Vinci Italian pride"Set up in the evocative setting of the Convent of San Francesco in Sorrento On display there are reproductions of Leonardo's masterpieces and his codes in addition to scale and full-scale machines created for this event that honors one of humanity's greatest geniuses the machines on display can be touched and put in motion by visitors: they are indeed all really working Among the inventions exposed are the machines for the flight All were handcrafted by the master Mario Paolucci Reproduction of the is also of great interest first and only autograph painting of Leonardo made at the age of 19 that is the "Leonardo's tile"Representing the face of the Archangel Gabriel and perhaps also a self-portrait of da Vinci himself we earn a commission from qualifying purchases through ticketing links This commission does not entail any additional price for the user The date for the public opening of the Park of Knowledge and Leisure (ie theformer Born Base of Bagnoli in Naples) was set at 5 May 2018 which will take place precisely the weekend that goes from Saturday 5 to Sunday 6 May The initiative stems from the synergy of well 50 associations bells that have helped make the use of such a large space possible hundreds of activities dedicated to young people and adults strongly desired by the Banco di Napoli Foundation for Child Care was born from the desire to give back to Naples a very large area and which wants to become an important center for the city For now the use of the former NATO base is limited to roads and cities but the provision is being made requalification of the numerous buildings that stand out inside the park The party will then be only a first step to bring citizenship closer to the beauty of this important area of the city Wednesday August 29 2018 we celebrate the 60 years of Michael Jackson at the Mostra d'Oltrmare in Naples with the fifth edition of Michael Jackson Day, an unmissable event for all fans of the great pop star. An entire day dedicated to good music and insights on the theme of the event such as conferences and exhibitions that will culminate with a evening concert. The opening of the gates is scheduled at 11.00 to visit the stands and exhibitions organized on the occasion of this great event which, now in its fifth year, is a fixed appointment for many fans. There will also be no lack of food, an area will in fact be set up equipped for eating. In the afternoon you can meet the guests of honor of the evening: i 3T, or the three sons of Tito Jackson, brother of Michael, who will perform in a concert in memory of the king of pop at the Mediterranean Theater of the Mostra d'Oltremare. As an Awin affiliate, we earn a commission from qualifying purchases through ticketing links. This commission does not entail any additional price for the user. when he solicited a $250,000 bribe from a cable television firm a prosecutor charged yesterday at Nussbaum's bribery trial Assistant Queens District Attorney Paul Pickelle also said in opening remarks to the jury that Richard Rubin Manes' former top political lieutenant which sought a Queens cable television franchise in 1981 The bribe was not paid and other firms got the franchise "The people will prove that Michael Nussbaum acting as the henchmen for Donald Manes asked for a $250,000 bribe from a cable company and promised that company that Mr Manes would use his position as borough president of Queens County to see to it that cable franchise was approved," Pickelle said called Simon "an unbelievable man with an ax to grind and a conniver." According to Arkin Nussbaum may have "pleaded" Simon's case for a franchise to Manes but he "never effectuated a bribe." "The evidence will cry for an acquittal," Arkin said "He's innocent." Pickelle said Rubin met with Nussbaum and Simon at a diner across Queens Blvd The meeting took place shortly after Simon had retained Nussbaum as his public relations consultant for a $30,000 fee Rubin told Simon that he and Nussbaum were "a team," Pickelle said assault and driving while drunk were lodged yesterday against a 21-year-old driver after his car slammed into a wall near a Bay Ridge intersection killing a 17- year-old girl and injuring two teenagers who were riding with him The impact of the crash killed Shara Martano were treated at Lutheran Medical Center for face cuts and released driven by Steve Kwasny of 58th struck a wall just before midnight Thursday on First Ave Police said bottles of beer were found in the car A spokeswoman for the district attorney said Kwasny was charged with vehicular manslaughter He faces jail time of up to 15 years if convicted 1987 SATURDAY REPORT tracks and producing $40 million in annual revenues cited heart surgery in 1980 and continuing health concerns as reasons for quitting city service after 40 years post filled Former police sergeant and prosecutor Angelo Morelli was named yesterday as Fire Department inspector general who moved to the department's Legal Affairs Division in May Guilty in 2 deaths A 21-year-old Valhalla man was found guilty yesterday in Westchester County Court of vehicular manslaughter in a 1985 Thanksgiving Day car crash that took two lives Radley Herold concluded a two-week nonjury trial by ruling that Benjamin Oderifero's drunken driving had caused the deaths of White Plains residents Elisa Lanera and Rex Pompadur in a car crash i in downtown White Plains on Nov 9 and faces a maximum to 07 years in prison Budget bill gets an OK WASHINGTON -The Senate voted 71-to-21 yesterday to give new life to the Gramm-Rudman budget-balancing law after brushing aside complaints that it would let President Reagan and Congress off the hook until after the 1988 elections The amendment would restore automatic spending cuts Those cuts would give the deficit-reduction program some enforcement for the first time since the Supreme Court outlawed a similar but faulty scheme last year Teachers' pay up WASHINGTON -The average salary of public school teachers reached a record $26,698 in 1986- 87 as the educational reform movement helped them regain ground lost to inflation in the 1970s an American Federation of Teachers review found yesterday The union said the average salary in New Jersey was $28,718 Sri Lanka Tamil rebels refused yesterday to hand over their weapons to Indian peacekeeping troops setting back a plan designed to end this country's ethnic civil war Sinhalese gunmen killed a member of pariiament to protest the peace pact signed this week by Indian Prime Minister Rajiv Gandhi and Sri Lankan PresiI dent Junius Jayewardene From Daily News bureau and wire service reports OTB head quits Henry McCabe president and board chairman of the city's Off-Track Betting Corp submitted his resignation yesterday to Mayor Koch effective Sept Koch called him "a good and decent man," crediting him with installing simulcast racing from STANDING BY HER MAN is Dale Nussbaum went on trial yesterday in Queens for soliciting a bribe from a cable TV company CLARENCE DAVIS DAILY NEWS street to Borough Hall to visit Manes Rubin's no-show case and see you have hired the right peo- eral other prosecutions of Queens pople," Manes told Simon according to litical figures all surfaced after Pickelle's version of events Manes -the long-time Queens Demo- Rubin was never charged in the cable-TV case he has been convicted in an unrelated federal fraud case involving no-show jobs in the state Assembly and has received a five-year prison sentence The bribery charge against Nuss- cratic boss -was exposed as a grafter early last year The Queens cable-TV probe already has led to the perjury conviction of Supreme Court Justice Francis X panic cited in plane crash NEWS WIRE SERVICES MEXICO CITY -Mexican aviation officials yesterday said they suspect that a short circuit and a shift in the cargo of show horses aboard an aged Boeing aircraft caused the plane to crash into a busy highway an inspector with the Mexican Civil Aeronautics Agency the panic that apparently ensued could have caused the 18 horses and 12 people aboard to move A wire service also quoted the wife of flight engineer Forrest Wootten as saying the crew left the cockpit and went to the rear of the plane after the craft went out of control Thursday said her husband told her by telephone that "when they saw it was going to OT crash they removed themselves from the cockpit and went to the back of the That's what saved the crew the fact that they knew what to do in such a short period of time." Rescue and salvage workers toiled through the night and by dawn had cleared most of the wreckage from the six-lane highway that links the capital with its western suburbs and the city of Toluca operated by Belize Air International crashed late Thursday afternoon eight minutes after taking off from Mexico City's international airport a crew of four and 18 thoroughbred horses of the Mexican Equestrian Federation Most of the deaths occurred on the ground as the plane slammed into vehicles and buildings. From the 1 ° July to the 30 September 2018 the Cuma Express line will be activated so you can easily reach the Campi Flegrei Archaeological Park There are eight races a day Sundays and holidays it will be an experimental period that in the future could last for the whole week The project was born with the intention of offering an efficient service that can enhance a monumental network and territorial with a strong vocation tourist and that so far has been penalized for the lack of connections with the rest of Campania These are trains with wagons provided with conditioned air with capacity of 68 numbered seats e 2 disabled seats Also for the summer part the Sorrento Night which starting from the 23 June on weekends will link Naples and Sorrento with supplementary rides with last return from Sorrento to 23,39 The ticket price will be at most 10 euro and you can buy them online they include the entrance to the monuments of the Phlegraean area (Flavian Amphitheater Castle-Archaeological Museum and Scavi di Cuma) For the complete table with prices and timetables, consult the official website The third edition of the Festa della Cipolla of Alife will take place from the 30 August to the 2 September 2018 with a rich program of events and entertainment all seasoned with typical dishes of the Matese Regional Park The activities that will take place during the four evenings are promoted by the Gustumas Association Among the events that will take place during the four evenings there will be gods Taste Workshops with free participation the stands of the Mercatino dell'Ortolano where you can buy organic products at 0 km and a gathering of vintage cars and motorbikes The days of the Festival will also be animated by the "Onion Olympics"For adults and children with thematic games and" Popular Games "such as tug-of-war both day and night, to archaeological sites of the ancient Roman colony is scheduled Sunday 2 September 2018 the diving competition for the XMUMX Marmeeting to which the event of the Red Bull Cliff Diving World Series will be added for the first time this year will dive from a platform set at 28 meters on the water level reaching The athletes participating in the competition are 16 the only blue athlete in the Red Bull World Series The final of the Red Bull Cliff Diving World Series Also this year it will be possible attend Marmeeting by sea: on Sunday at 14.45 pm it will start from the port of Amalfi a motor ship direct to the fjord and from which passengers can enjoy the show from a privileged position The preferred means by tourists to move from Marina Grande to the Piazzetta di Capri finally reopened after the long winter break which saw the execution of some improvement work to ensure a more efficient service With the makeover that has been made it is expected that from now on the carriages will be able to carry a greater number of people In addition to the changes that will affect the capacity of wagons cover the time band without interruption from 6.30 in the morning to 21.20 with travel times of 15 minutes The funicular is the fastest way to get from Marina Grande to the center of Capri and vice versa it is the favorite means of visitors to the island because of its own exceptional panoramic views which has made it a real attraction for tourists The Comicon 2019 of Naples does not stop giving emotions to all fans of films and TV series, it was in fact announced a meeting with the protagonists of the Gomorra series, Patrizia and Enzo Sangue Blu, for Saturday April 27, 2019 to the Mostra d'Oltremare The appointment is for Saturday 27 April at 14.00 pm at the auditorium of the Mediterranean Theater at the Mostra d'Oltremare where the special meeting with the actors will take place Cristiana Dell'Anna and Arturo Muselli After conquering the Italian and foreign critics the two artists finally meet the public of their city The fourth season of Gomorrah has recently successfully debuted with an original Sky production and it is thanks to the collaboration of Sky Atlantic Italia that the two actors will be guests of the Comicon 2019 A program of very interesting events proposed by San Severo Chapel in the heart of the historic center of Naples where theatrical guided tours and esoteric itineraries will be held to discover all the secrets of the Chapel The visits will also take place in the evening making the experience even more suggestive Spring brings to the Sansevero Chapel of Naples a very inviting novelty for all history buffs and this magnificent monument in the heart of the city: evening visits with thematic routes there are three proposals for visits and they include the esoteric path "Symbols and secrets of the Sansevero Chapel" the theatrical guided tour “The Testament of Stone” and the visit by the director of the Sansevero Chapel Museum “Raimondo di Sangro: a life at work” The dates proposed are for now six and we remember that to participate is booking is essential on the dedicated online platform that you can find on the official website 20.00 Hours: Symbols and secrets of the Sansevero Chapel 20.00 hours: Raimondo di Sangro: a life at work From Saturday 27 July up to 28 September 2018 every Friday and Saturday from 20,30 to 23,30 it will be possible to visit the illuminated paths in the Vesuvian archaeological sites of Pompei the Antiquarium of Boscoreale and for the first time the Villa S The admissions for these visits will also be at a reduced price it will be possible to delve into the life of the ancient city through a sensory path with the reproduction of voices noises and sounds of moments of everyday life Temples and ancient buildings will be illuminated for the occasion In Oplotis you can visit the Villa of Poppea among the most splendid examples of a villa of the Roman aristocracy and the Antiquarium of Boscoreale four evenings with free admission on the other hand with the possibility of guided tours at 21,00 pm and 22,00 pm The GoEav app launched in these days by theEav with which it will be possible buy tickets from the comfort of your smartphone to use the services of the authority It will also be possible to check the timetables of the races plan trips and stay up to date on any changes in the routes has been designed to make it easier for you to purchase tickets which can be done anywhere and even when the ticket offices are closed The ticket is timed and lasts two hours from the time of purchase The institution guarantees that the payment ticket can be made in a completely safe way and by credit card by loading the electronic purse and many other ways there will be incentives for purchasing tickets Download the app: Play Store (Android) / App Store (iOS) We remind you that the app download is completely free for both operating systems This commission does not entail any additional price for the user.