2025) – Utah Royals FC announces defender Tatumn Milazzo has been placed on the season-ending injury list Milazzo suffered a torn ACL in training on March 21 and has since undergone successful surgery She will work closely with the Utah Royals medical staff during her recovery Milazzo was on track to make her Royals debut after recovering from a preseason knock she was tipped to be a prominent part of the Royals defense this season The Royals’ next home match is on Friday, April 11 against Portland Thorns, with kickoff at America First Field at 8:00 p.m. MT. Tickets are available at https://www.rsl.com/utahroyals/tickets/ Javascript must be enabled for the correct page display College of Arts and Sciences Reverend Forrest Pritchett Honored at SRTF Signature Event Physician Assistant Graduate Leads with Advocacy and Service Renovation for New Innovation Hub in Walsh Library Charter Day: Honoring Service and St. Elizabeth Ann Seton Chief Judge Michael A. Chagares' 87 Named Keynote Speaker             NY to the late Anna and Joseph Salvatore Milazzo He was in the graduating class of 1952 at Brooklyn Tech High School Salvatore began working for Bell Atlantic in Manhattan moving up the ranks throughout the years and finally retiring as Assistant Vice President He served his country honorably in the US Army during the Korean War He served as councilman and police commissioner for Matawan Salvatore enjoyed spending time with his family and his brothers Stephen Edward Milazzo and Joseph Robert Milazzo Surviving is his loving wife JoAnn Milazzo his children Deborah Milazzo Battaglia of LA A committal service will be offered on Saturday January 18 at 12 noon at Holmdel Cemetery & Mausoleum The family would also like to invite friends to join them at the 4:30pm Mass at St In lieu of traditional remembrances, Salvatore’s family asks with gratitude that donations in his memory be made to the Wounded Warrior Project (www.WoundedWarriorProject.org) For messages of condolences, or to share a favorite memory of Salvatore, please visit his page of tribute at www.HolmdelFuneralHome.com Your name will appear next to the candle you light.Your condolence may need to be approved before it appears on this page It may not appear immediately once submitted Upload attachment  (Allowed file types: jpg and website in this browser for the next time I comment Δdocument.getElementById( "ak_js_1" ).setAttribute( "value" It looks as though you’ve already said that!' + ' Your condolence may need to be approved before it appears on this page Thank you for leaving a condolence..Your comment has been submitted for moderation Salvatore Joseph Milazzo, 92, of Freehold, died on Monday, January 13. Salvatore was born and raised in Queens, NY to the late Anna and Joseph Salvatore Milazzo. He was in the graduating class of 1952 at Brooklyn Tech High School. After high school, Salvatore began working for Bell Atlantic in Manhattan, moving up the ranks … Read More Δdocument.getElementById( "ak_js_2" ).setAttribute( "value" Designed and produced by ©document.write(new Date().getFullYear()); MKJ Marketing|Privacy Policy|Sitemap This website is using a security service to protect itself from online attacks The action you just performed triggered the security solution There are several actions that could trigger this block including submitting a certain word or phrase You can email the site owner to let them know you were blocked Please include what you were doing when this page came up and the Cloudflare Ray ID found at the bottom of this page The son of Frank Milazzo and Nancy Lehman was born on February 25 He was the owner/operator of Tre Sorelle Junior Golf Academy formerly known as Hudson Valley Junior Golf Academy where he was able to pass on his passion of the game to countless children and young adults over the years He was also an avid fisherman and loved to follow the Mets and the GreenBay Packers Raymond is survived by his wife Janna and his three daughters and Jessica; his sister Dody and her husband Al; his sister Barbara and her husband Scott; and his brother Frank and his partner Deb He is also survived by several nieces and nephews: Alexander as well as several great-nieces and nephews Raymond was predeceased by his mother Nancy Wilhelm A memorial service will be announced at a later date Funeral arrangements are honorably entrusted to Zygmunt-Murtie Funeral and Cremation Service (845-477-8240 or zmmemorials.com) The concept album for the new musical will be released in January Grammy and Tony Award nominee AnnMarie Milazzo announced the upcoming release of a new concept album, “The Shape of Things: Songs From Joy The Musical.” As the title suggests, the record, which will be released on Jan. 17 by Joy Machine Records, will include a selection of songs from the musical that is currently in development Milazzo also released a music video of the album’s title track with production by Sonny Paladino and music supervision by Andy Einhorn “The Shape of Things” offers a glimpse at “Joy,” a biographical musical about the life of Joy Mangano the entrepreneur and inventor behind the Miracle Mop Milazzo has previously provided vocal arrangements for Broadway shows such as “Spring Awakening,” “Next to Normal” and “If/Then” as well as orchestrations for the 2017 revival of “Once on This Island”and vocal design for “Almost Famous” and “A Beautiful Noise.” She is also developing a stage musical based on Amy Bloom’s novel “Lucky Us,” in collaboration with 16-time Grammy Award winner David Foster “Making this record was an opportunity for me to get back to my roots in the recording studio working with my band and doing the thing I love most — writing and singing songs,” Milazzo said in a statement “Joy” has been in development with a book by Tony Award-winning producer Ken Davenport and music direction by Paladino Editor’s note: This eulogy was written and read at the funeral of Dr who was a registered nurse at Brooks Memorial Hospital from 1973 to 2007 It was my privilege to have worked with Dr Richard Milazzo over these many years and over many patients It is my honor to tell you this story of a true hero in the medical profession and in life itself It was the summer of 1973 and the city of Dunkirk — especially Brooks Memorial Hospital — were anticipating the arrival of the newest member of its medical staff For months “the talk of the town” centered around the new doctor setting up his office and opening his practice His reputation preceded him … he was smart had been the Chief Resident at Meyer Memorial Hospital in Internal Medicine … and was the son of “OLD” Dr a well-known practicing urologist in the community The locals were beside themselves and in an unheard of event “Young Milazzo” hung his “shingle” out with a practice that was booked solid from day one and beyond Milazzo earned his reputation as a great doctor from the minute he walked in the hospital Not only did he have office hours four days a week but a full schedule seeing his medical/surgical inpatients on two floors each split into sections: 2A 3B; there were also patients to care for in the four-bed Intensive Care Unit; in addition he was also required to take turns with his fellow Internal Medicine colleagues covering a two-week rotation as “Medical Doctor on Call” in the ER Being medical on call often meant having to leave patients in the office to run to the ER to treat a very sick patient there was no actual doctor in the ER; the ER nurses evaluated the patient and hunted down the patient’s doctor for orders to treat until he got to the ER This left office patients backed up until late afternoon and into early evening Then there were evening rounds to check on hospital patients again before finally heading home…But WAIT There’s a patient for you to see that’s a possible admission It is little wonder that this punishing pace wore “Young Milazzo” down The winter and flu season were especially punishing and looked like he could use a bed in the hospital Yes,on rare occasions he was so sick he HAD to stay home and there was no one left to care for the patients In 1973 it was a four-bed unit … pretty small … but some of the magic that was worked in that unit was amazing He was not only a great doctor to his patients but treated the nursing staff with a level of respect we had never experienced explaining procedures and the “whys” of treatment in ways that were easy to understand and apply to everyday patient care He knew how hard we worked and was always quick to give us an appreciative word of confidence He enriched our professional lives in wonderful ways and lifted each of us up individually and personally No question we asked him was considered unimportant He was funny and could always make a patient . Rich would guide the development of a new 10-bed ICU Milazzo was always willing to help us … his specialty was Internal Medicine but if we were desperate for help in the ER and he just happened to be in the hospital Milazzo was paged STAT to the ER he never called to inquire about the patient he just showed up to help for whatever the emergency happened to be a patient arrived who was having a heart attack He did not have a doctor and it was my job to get him one I was supposed to follow the medical on call schedule I knew Rich was the best guy for the job so I paged him STAT to the ER took one look at the semi-responsive patient and said: “Are you sure he’s a patient of mine?” I crossed my fingers and said: “All I can say is his last words were “Call Milazzo!” so I guess he’s your patient now!” Rich just shook his head and went to work caring for the patient who ended up in ICU he used to shake his head a lot when I took care of his patients he asked me how I thought of doing these things What is the best thing I can do for this patient That’s why I call YOU!” We remembered that story and laughed about it when we had breakfast after Mass last Sunday (Sept no matter the patient’s age or problem One day I called him for help in the ER … an 8-month old patient was in trouble Rich looked like he was going to fall over when he saw the little infant on the cart … but he stayed with us and talked with the baby’s doctor to get him to come in to care for the child Another time in ICU he got the desperate call from me again I had a young 25-year-old patient who had been sick for a long time His surgeon had left the hospital for home I was flushing his stomach with ice water to hopefully stop the bleeding but it was not helping I was never so happy to see anyone in my life than Rich Milazzo when he walked in and assessed the situation with me The patient’s doctor was notified again and again God love Rich…he hung in there with me for at least 1 ½ hours until the surgeon finally showed up and the patient was taken directly to surgery One day in the ER I needed to talk with him about a patient of his The ER doctor had seen him and wanted to admit him This was before the days of cell phones…Rich had a beeper I paged him and left a message to call me in the ER No response…15 minutes later I beeped him again: “Rich call me!” No response…beeped him again: “Rich…don’t make me come and hunt you down!” Literally 5 seconds later he calls laughing hysterically along with the nurses in ICU He said: “I didn’t answer because I just wanted to hear what you were going to say in your next message!” He had such a great sense of humor it’s time to reveal his all time favorite sport … bike riding And ride and ride he did … everywhere peddling locally and way beyond for over 50 years traveling through most of Chautauqua County Most of the doctors had a parking spot at the hospital Rich had a bike rack at the bottom of the ER ramp When the weather was bad he’d park it inside the hospital rode what became the First “Bicycle Tour de Chautauqua” to the Hotel Lenhart in Bemus Point They had such a good time the boys were joined in 1974 by Dr Rich Goodman and Steve Warner for a longer “tour.” One hundred miles was the limit per day The bikers were on their way to Salamanca … they could not ride from Jamestown to Salamanca on Interstate 86 so they took old Route 17 which was officially closed to traffic through the reservation There were ruts and gaps in old pavement sections Milazzo’s front wheel got caught in one of them and sent him flying He was unable to ride the distance to Salamanca loaded him and his bike in their patrol truck and took him to Salamanca General Hospital where he was stitched up by Dr considering the bikers were trespassing on posted land Best part of the story is that Rich recovered to ride again Rich had many other talents…and they were NOT hidden! composer of his own original song accompanied by hysterically funny lyrics (“Bob’s Buns”) Elizabeth Ann Seton choir for years “after Maureen roped me into singing at the Christmas Eve Mass and then bailed on me!” Pressed into service at a family talent night number Rich was dressed up to play the part of Dr he played his part perfectly and had everyone rolling in the isles with laughter Rich Milazzo was not “just” a doctor to his patients then my Mom’s and then my Dad’s and one day asked if she could “adopt” him said “of course.” From that day on Rich became Mom’s “son,” and as a result She was so proud to have a doctor in the family and always introduced him as “my son the doctor!” Rich treated her like a queen When I took Mom for her checkups she would always ask Rich if he noticed anything “new and different” about her He knew what was coming and always played along Mom would pretend to be all upset that he didn’t notice her efforts…”What do you mean you can’t tell I dressed up and put a bra on for my visit today!” He came to birthday parties At one of the picnics I told him to look around to see if anything looked familiar All of these people are your patients!!” He probably had half of Dunkirk-Fredonia in his office at one time or another some of his patients refused to see anyone else in his absence…even to their own detriment One day I triaged a patient I knew very well I asked why she waited so long to get help…she said she didn’t like the doctor she was supposed to go to and thought she could hold out until Rich returned I said: “He’s not due back for a week!” She recovered The many acts of kindness and instances where Rich went “over and above” are legendary … stories of figuring out what was wrong with a patient that no one else was able to do checking a patient and finding just the slightest abnormality that led to discovering a serious condition and eventually a cure No one will ever know all he did to help others … and he would never want us to know … but God does … and He has everyone of them written in His book … the home visits the house calls he made out of the blue and from the goodness of his heart the stops to dying patients to comfort and encourage them or to just hold their hand for one last time I know first hand about two of those last visits because they were to my Mom and Dad Rich’s generosity to others also extended itself outside of the United States He once made a trip to Honduras to bring medical care and medicine to those with nothing God is good and we were blessed to get him back home safe and sound over the top happiness and at times heartbreakingly painful difficulties I thank God for His everlasting Presence in our lives and His great gift of FAITH to believe in things we cannot see or humanly comprehend I’ve always believed that God puts us with the people He wants us to be with according to the Plan He has for each of us I thank God every day for blessing us with 80 years worth of the presence and goodness of Rich Milazzo in our lives Having been raised above the McGraw Funeral Home you come…your life’s work is over and all the “treasure” you can take is the love you gave and your good works performed on earth I have no doubt God was there to help Rich carry all of his There’s a stampede to Heaven’s Gate Peter has to stand aside to avoid getting trampled They are all fighting over who will be the FIRST to hug him and welcome him to his Heavenly Home…this day receiving his eternal reward for his steadfast faith and all the good he has done on earth Copyright © 2025 Ogden Newspapers of New York | https://www.observertoday.com | PO Box 391 A sign marks the entrance of Harriman-and-West Airport in North Adams An attempt by Jennifer Macksey to appoint a new member to the embattled North Adams Airport Commission stalled on Tuesday The Harriman-and-West Airport hangar saga arrived at North Adams City Council Tuesday as Michael Milazzo and City Councilor Peter Breen questioned Mayor Jennifer Macksey's decisions NORTH ADAMS — Airport Commission drama spilled over into City Council Chambers on Tuesday Michael Milazzo — the man who, in 2020, allegedly vandalized a hangar he used to occupy at Harriman-and-West Airport — brought a lawyer to the City Council meeting to express his dismay over his bid for the hangar being accepted After a stunning vote in October where the Airport Commission accepted Milazzo’s bid for the hangar — despite the fact he may have been responsible for the yearslong state and city money — the commission later walked back its decision Two members of the commission resigned as a result of the controversy.  were at the forefront of the monthslong drama and took precedence during the council meeting when Milazzo and Macksey got into a heated exchange over her role in the commission's ultimate decision.  Members of the public were able to comment on Macksey’s new appointment of Doug Herrick to the commission which has been put on hold until the city solicitor issues an opinion on whether City Council has to confirm the appointment Milazzo and his lawyer said Macksey's dealings with commission members included an ultimatum: rescind the hangar vote While Macksey refrained from entering a “shouting match” during the meeting she disputed Milazzo’s declarations after the fact The perceived flaws in process were enough for councilor Peter Breen to call for an investigation into former Airport Commissioner Michael McCarron’s resignation and what the latter of whom was originally the lone vote against awarding Milazzo the hangar lease both resigned from the commission following the fallout of the hangar debate last year.  After the commission had originally accepted Milazzo’s hangar bid sending a letter to the commission citing a "procedural defect" in its decision to award the lease despite recommendations to the contrary by a committee it established to review the matter.  Macksey argued in her letter that the commission should not be choosing sides in ongoing litigation that directly pertains to the lease The city also was disappointed with the fact that its initial request for proposals received only one response: Milazzo's Shortly after receiving the mayor’s letter, McCarron resigned “due to conflicts of interest outside of the commission, and the stress and anxiety from the pressure coming from city officials to influence my decisions while on the commission,” according to his resignation letter, obtained by The Eagle the commission rescinded its decision to award the lease to Milazzo Milazzo’s attorney Ryan Smith told City Council members on Tuesday that he conducted his own investigation into the matter of McCarron's resignation as well as "conduct of certain city officials." He then went on to ask the council to conduct its own investigation into why Smith and Milazzo claimed that the city overstepped “The two commissioners that have already resigned were told ‘You either vote the way we want you to vote Macksey interrupted to vehemently deny this claim At the moment there is no evidence to support his assertions Morandi in particular had been opposed to Milazzo’s application from the beginning Macksey said she met with commissioners individually and reiterated what she’d said in her letter: The requests for proposals process had flaws and the commission created a review committee then entirely ignored the committee’s conclusions I would ask you to rescind,” Macksey said she told the commissioners Macksey pushed back against the idea that if commissioners didn’t go along with her they’d be forced to resign. To her point commissioner Robert Grandchamp remained on the commission and did not change his vote from favoring Milazzo’s bid either time remaining a steadfast "yes" before and after the letter from Macksey “They resigned on their own accord,” she said of McCarron and Morandi.  Sten Spinella can be reached at sspinella@berkshireeagle.com or 860-853-0085 The city solicitor's opinion was a win for Mayor Jennifer Macksey but she's still facing threats of legal action from Michael Milazzo as he claims she forced commissioners sympathetic to him to resign rather than vote in favor of him leasing a hangar at the airport Research from the city solicitor on an airport commission issue found that the city's charter does not require council approval Two brick Victorian mansions that were condemned in 2017 now belong to the city Sadie Jean Sworzen is not your average toddler Two new billboards from local nonprofit Hoosic River Revival seek public input on the flood chute modification effort and HRR announces it has brought on an outside engineering firm to help parse the U.S Savoy has postponed its annual town meeting from May 8 until sometime in June as the town's finances are not yet in order The annual town election will still be held on May 14 the state Department of Conservation and Recreation could soon expand its Savoy Mountain State Forest reach into Adams Seeking his sixth term on the Select Board incumbent Joe Nowak is being challenged by Jay Meczywor and Jerome Socolof Your browser is out of date and potentially vulnerable to security risks.We recommend switching to one of the following browsers: Get up-to-the-minute news sent straight to your device USA; Chicago Red Stars defender Tatumn Milazzo (23) controls the ball against the NJ/NY Gotham FC during the first half at Red Bull Arena made 17 appearances in 2024 for Chicago but those appearances didn’t turn into larger amounts of minutes as the season wore on her numbers went down as the season progressed The former South Carolina defender did manage 13 starts in 2024 while occupying both the left and right back spots for head coach Lorne Donaldson Passing was where Milazzo struggled mightily in 2024 as she completed the lowest percentage of medium and long passes of her NWSL career, per fbref Through all the struggles that she dealt with in 2024 Milazzo still provided an edge to a Red Stars team that didn’t have that in volume at any portion of the pitch She still has value as an NWSL player even though she wasn’t put in positions throughout the 2024 season to prove that The Orland Park native’s 2025 contract option was declined and she'll be a free agent for the first time in her career. Milazzo's ability to play all over the defensive backline should make her a popular target for NWSL clubs this offseason Follow @soccer_ontap on X for more Chicago Stars FC news and updates! the Chicago Cubs rebounded in a big way with a 9-2 win over the San Francisco Giants in the first game of the series and Justin Thomas headline the 72-player field at Philadelphia Cricket Club's Wissahickon Course in Flourtown but fans classifying him as a tight end is not the proper way to forecast his role in Ben Johnson's offense RHP Gavin Hollowell will take Imanaga's place on the active roster Don't miss these special Sundays during the White Sox's 125th season celebration 2025) - Utah Royals FC announces the signing of free agent Tatumn Milazzo The defender most recently appeared for NWSL side Chicago Stars FC Milazzo has signed a two year deal with URFC locking her in through the 2026 season joins URFC after four seasons with the Chicago Stars FC The Illinois native center back logged 1,133 minutes throughout 17 matches in her fourth year with her home club last year Milazzo has 70 career NWSL appearances including NWSL Challenge Cup and NWSL playoff matches with four career goals "Tatumn is an excellent defender who has won various individual awards for her accomplishments with Chicago" said Sporting Director Kelly Cousins "We are excited to welcome her to the club and are eager to see her impact on and off the field." Milazzo scored her first professional goal on October 10 2021 scoring from outside the box against OL Reign in a 3-2 loss Milazzo notched 14 appearances that included three playoff appearances as the Red Stars made a run to the NWSL championship before falling to Washington Spirit 2-1 After a 2 goal season in 22 regular season appearances in 2022 Milazzo signed a contract extension with the Red Stars through the 2024 season The American would start in Chicago’s 2-1 extra time loss to San Diego Wave in the first round of the 2022 playoffs Prior to signing as a professional with Chicago Milazzo played four years at the University of South Carolina winning Southeastern Conference titles in 2016 In 2017 Milazzo helped the Gamecocks reach their first Women’s College cup appearance making the semi-finals before falling to Stanford Milazzo played 80 matches and scored 3 goals as a Gamecock as her senior season was cut short after tearing her ACL Milazzo made her comeback to soccer joining the Chicago Stars 2021 pre-season squad moving her way up to the supplemental roster two months later on April 5 Four days later Milazzo would make her professional debut in a NWSL Challenge Cup match subbing on in the 87th minute in a 0-0 draw A doctor who had been a fixture in the Dunkirk-Fredonia community for decades has died passed away unexpectedly on Tuesday afternoon after his car was struck by a tow truck in Wethersfield in Wyoming County He stopped at the Hermitage Road intersection and started to cross the highway Milazzo pulled into the path of a 2022 Ram tow truck driven southbound on Hermitage Road Wyoming County sheriff’s deputies said The tow truck struck his Subaru on the driver’s side door and both vehicles went off the roadway He was pronounced dead at the scene by the county coroner the primary care doctor had been treating patients in Dunkirk and Fredonia for 54 years He graduated from State University of New York at Buffalo in 1969 and was affiliated with Brooks-TLC Hospital System though he says it went deeper when it came time to choose what branch of medicine he would pursue “I really like the intellectual challenges of internal medicine where you basically cover all of the different specialties,” he said Milazzo says he still studies and researches medical journals “almost every night” to make sure he is continually offering the best care to his patients “I have patients I have seen for more than 40 years,” he says “I went into this because I wanted to help people if I have a visit where I feel like I haven’t helped the person I feel bad about it — that’s a wasted visit for me.” Milazzo wasn’t ready to retire and was motivated to keep learning and keep serving his patients “I have developed a lot of relationships with many of my patients,” he said with a laugh “At least once a week I’ll have a patients say ‘don’t retire until I die,’ which I don’t know how to take that.” Indulge in Broadway buzz like never before with "The Weekly Dose of Joel: Everything Broadway and More." This podcast, brought to you by the Broadway Podcast Network and Broadway Time, delivers the latest news, theater history, and exclusive interviews with Broadway stars, all in one podcast! Don't miss out on your front-row seat to the magic of Broadway! © Broadway Podcast Network The tan airplane hangar with red trim at the Harriman-and-West Airport that was completely rebuilt A 2021 police report named two suspects for vandalizing the hangar — Brian Doyle and Michael Milazzo Mayor Jennifer Macksey is requesting the Airport Commission rescind their decision to lease the hangar to Milazzo Damage to the interior of a hangar at Harriman-and-West Airport in North Adams following vandalism in late 2020 A 2021 police report named two suspects — Brian Doyle and Michael Milazzo Mayor Jennifer Macksey is requesting the Airport Commission rescind their decision to lease the now-rebuilt hangar to Milazzo Mayor Jennifer Macksey's letter to the commission is a strong intervention from Macksey who has mostly kept her distance from the issue of the Harriman-and-West Airport hangar — and Michael Milazzo's proposal after he allegedly caused the initial damage to the hanger — until this point NORTH ADAMS — City Hall has taken exception to the Airport Commission’s decision last week to lease a newly rebuilt hangar to Michael Milazzo In a letter sent to the commission on Monday Mayor Jennifer Macksey urged the commission to rescind last week’s vote “based on procedural defects.” Chair Marc Morandi clearly read into the record the recommendation of the review committee … which was to reject the sole proposal,” Macksey wrote made it clear that she believes they made their decision without following proper procedure and fully considering Milazzo's application to lease the hangar The letter to the commission is a strong intervention from Macksey who has mostly kept her distance from the issue of the Harriman-and-West Airport hangar — and Milazzo's proposal after he allegedly caused the initial damage to the hangar — until this point the commission put out a call for bids to lease the hangar.  The commission then accepted Milazzo's application against the recommendation of its own committee consisting of two commission members and city officials Stacy Abuisi and Kathy Eade he and Doyle would run an airplane maintenance business together in the refurbished hangar the Office of the Inspector General's Procurement Hotline said the proposal was "conditional and should be rejected on that basis.” “Because no board or commission of the City of North Adams should ignore recommendations of a committee established by it and especially should not disregard recommendations from the state agency entrusted with overseeing procurement issues I respectfully request that this matter go back to the Commission for reconsideration,” Macksey writes “This procedural failure requires remedy.” The mayor contends that the commission should have deliberated over the OIG “rather than ignoring it,” discussed the committee’s recommendations Macksey also weighed in on the possibility of leasing a brand new hangar to the people accused of causing extensive damage saying that responsibility for the unsanctioned and unsafe partial demolition of the hangar “has never been ascertained.” along with other individuals involved with the original hangar lease are currently in litigation over responsibility for the damage,” Macksey writes.  The letter advises against taking action favoring one side over another given the context Macksey said that after watching a recording of the commission meeting it looked as if Milazzo lobbied commission members to award him the lease before the meeting “To the extent any deliberations occurred outside of the Airport Commission meeting this is a potential violation of the Open Meeting Law," Macksey said.  Milazzo has not responded to repeated requests for comment from The Eagle Milazzo previously admitted he brought the excavator to the hangar and later removed it but denies responsibility for carrying out the damage Destruction to the hangar — blowing out one wall and causing major damage to three others — disabled the electrical system Former hangar co-owners Derek and Jackie Rougeau have alleged to North Adams police and airport officials that their former business partners and hangar co-owners Doyle and Milazzo were responsible for the damage to the hangar But nothing ever came of the 2021 police report Interim Police Chief Mark Bailey said that because Milazzo and Doyle were co-owners of the hangar at the time the police couldn’t charge them with destruction of property because they were destroying their own property Quality local journalism needs your support Access this story and all of our stories with 24/7 unlimited access Subscribe now for 99¢ Subscriber Sign In | Return Home but it comes after he was the lone "no" vote regarding a lease application for the airport's Northeast Hangar North Adams Mayor Jennifer Macksey is attempting to change Morandi's mind Despite efforts by the mayor to get him to change his mind former North Adams Airport Commission Chair Marc Morandi's resignation is now official forcing the group to recalibrate ahead of a major decision the man accused of vandalizing a now-refurbished hangar at Harriman-and-West Airport will not get to lease the same hangar after all following intervention from the mayor and the commission chair's resignation Michael McCarron resigned late November 2024 "due to conflicts of interest outside of the commission and the stress and anxiety from the pressure coming from city officials to influence my decisions while on the commission." Damage to a hangar at Harriman-and-West Airport in North Adams Milazzo and Doyle are facing off against Derek Rougeau Dodd Rougeau and Jackie Rougeau in a civil trial part of which concerns how the hangar was vandalized Damage to the interior of a hangar at Harriman-and-West Airport in North Adams following vandalism in late 2020.  a civil trial concerning a vandalized hangar at North Adams Airport raged on all week NORTH ADAMS — A yearslong feud between partners who once owned an airplane hangar together is culminating this week in Berkshire Superior Court Jackie Rougeau and Dodd Rougeau on one side and Michael Milazzo and Brian Doyle on the other The Rougeaus bought the hangar at Harriman-and-West Airport in 2002 and they used it for their aircraft maintenance business the partnership had deteriorated to the point that Milazzo and Doyle sued the Rougeaus and the Rougeaus followed with a counterclaim the airport hangar at Harriman-and-West Airport was damaged with an excavator owned by Milazzo which resulted in a $750,000 rebuild funded through federal Derek and Jackie Rougeau say Doyle and Milazzo damaged the hangar testimony has examined who used an excavator to damage the hangar and why Harriman-and-West Airport management — be it the airport manager or members of the Airport Commission — never addressed the ongoing issues cropping up on its premises between the two sides The civil trial before a jury got underway Feb 18 with lawyers for Doyle and Milazzo presenting their case first. Doyle Lawyers for Doyle and Milazzo say the animosity between both parties started with an alleged affair between Doyle and Jackie Rougeau in 2017. The lawyers have painted the prospect that this is what started Derek Rougeau and his brother Dodd Rougeau harassing their clients Smith showed video of the Rougeaus removing materials from the hangar but did not produce evidence supporting their contention that someone other than Milazzo or Doyle destroyed the hangar with an excavator The lawyers then contended the Rougeaus removed floor grates Derek Rougeau testified that he nailed the doors shut because he was responding to hangar doors inexplicably being left open at night Milazzo testified at length about the Rougeaus’ activity at the hangar before and after the hangar was damaged on Dec But Milazzo acknowledged that he had no proof that someone else had taken his excavator and used it to damage the hangar cast doubt on Milazzo’s narrative that Doyle arrived the morning of Dec Milazzo testified that he brought his excavator to the hangar following an eviction notice from the city in October 2020 all parties had stopped making payments on the property Milazzo said he began an effort to obtain a demolition permit and was attempting to buy the hangar himself Milazzo contended it would take about six months to get the permit and demolish the hangar He said he told the city’s building inspector in frustration that they likely won’t get the whole building because the Rougeaus were in the process of slowly dismantling it Milazzo said he was surprised to find his excavator parked outside when he arrived on Dec “Somebody had run the excavator and damaged the building,” Milazzo said He said he had left his keys to the excavator in its cupholder Milazzo said he did not call the police because of past incidents in which he said police said they were powerless to hold owners of a property responsible for damaging it Asked directly by his attorney whether he demolished the hangar without a permit Milazzo was asked how he planned to remove the excavator since it was parked inside the hangar behind a bifold door The excavator was driven through a wall and parked outside Milazzo had brought the excavator to the hangar expressly for demolition but he didn’t use it for the demolition that occurred he described how the 80-foot bifold door had been pulled and broken and heating tubes were hanging from the ceiling Rougeau reported the damage to the city building inspector left behind at the hangar in the days following the destruction that made lewd remarks about Jackie Rougeau Derek Rougeau reported the damage to the city building inspector immediately He had been working for weeks to secure a demolition permit and was one step away when the vandalism happened The trial testimony is expected to conclude early this week Then it will go to the jury to decide whether damages Bruce Goff has resigned as manager of the Harriman-and-West Airport; neither he nor officials are saying why the jury in a civil trial in Berkshire Superior Court chose not to award damages to any of the involved parties in the North Adams airport hangar dispute.  The tow truck struck his Subaru on the driver’s side door and both vehicles went off the road Brooks-TLC officials expressed they were “saddened” to hear the news “If there was ever a doctor who emulated ‘commitment to community,’ it was Dr Milazzo was a well-respected physician in the Dunkirk-Fredonia community – treating patients for over 50 years He had an amazing tenure at Brooks Hospital as a colleague and friend Milazzo’s passing and will miss him more than words can express chief medical officer at Brooks-TLC Hospital System called Milazzo a “truly great doctor and a very dear man He made such a difference in the many lives that he touched My thoughts and prayers are with his family.” “At least once a week I’ll have a patient say Metrics details The conditions supporting the generation of microglia-like cells in the central nervous system (CNS) after transplantation of hematopoietic stem/progenitor cells (HSPC) have been studied to advance the treatment of neurodegenerative disorders we explored the transplantation efficacy of different cell subsets and delivery routes with the goal of favoring the establishment of a stable and exclusive engraftment of HSPCs and their progeny in the CNS of female mice we show that the CNS environment drives the expansion distribution and myeloid differentiation of the locally transplanted cells towards a microglia-like phenotype Intra-CNS transplantation of HSPCs engineered to overexpress TREM2 decreased neuroinflammation Aβ aggregation and improved memory in 5xFAD female mice Our proof of concept study demonstrates the therapeutic potential of HSPC gene therapy for Alzheimer’s disease the benefit of the procedure is still limited by the slow pace and extent at which cell repopulation in different CNS regions occur the mechanisms and the conditions favoring the engraftment and generation of microglia-like cells in the CNS have been extensively studied we challenge further the standard hematopoietic transplantation paradigm by exploiting and combining different HSPC subsets differentially enriched in long-term hematopoietic reconstituting potential and by exploring different cell-infusion routes to eventually favor the establishment of a robust and exclusive donor engraftment in the CNS of recipients we unveil a key role exerted by the CNS environment in uniquely driving expansion distribution and myeloid differentiation of the locally transplanted HSPCs towards a microglia-like phenotype we then test the therapeutic potential of engineered HSPC transplantation in the CNS in an established murine model of Alzheimer’s disease (AD) obtaining a clear example of efficacy of HSPC gene therapy in an adult onset and a proof of benefit associated with an innovative approach that determines a CNS-restricted engraftment of the genetically modified transplant progeny cells BU-treated mice transplanted IV with ∆NGFR/Cherry Lin- cells were used as term of comparison Source data (a–d) are provided as a Source Data file f Representative laser scanning confocal microscope microphotographs of IF-stained brain sections from mice co-transplanted with Lin- both ICV and IV at 90 days pTX [n = 5 slices from n = 3 mice] ICV-derived cells (green signal) are stained with (e) anti-GFP antibody IV-derived cells (red signal) with anti- ΔNGFR antibody and (f) Iba1 for microglia cells (arrows indicate representative co-localizations of Iba1 and GFP/ΔNGFR signals) Images were acquired at Leika SP2 confocal microscope a Short-term HSPC biodistribution in the bone marrow (BM) 5 and 14 days post-transplant (pTX) in IV (black) ICV (green) and ITL ( pink) transplanted mice as measured by flow cytometry [n = 3 mice/group across n = 2 experimental replicates] 2-way ANOVA followed by Tukey post-hoc test pTX (p* = 0.0351 Source data (a) are provided as a Source Data file Distribution of GFP+ donor-derived cells analyzed at 14 days (b) and 30 days pTX (c) in the brain of representative IV ICV or ITL transplanted mice (single transplantations) [n = 4 slices from n = 3 mice/group] Images were acquired at 25x magnification using Leica SP5 confocal microscopy after tissues clearing labeled with GFP (green signal) or with ΔNGFR/Cherry (blue signal) in representative mice transplanted with Lin- HSPCs via ICV + IV or ITL + IV or IV only delivery (as indicated) and analyzed at 45 (d) [n = 4 slices from n = 3 mice/group] or 90 days pTX (e) [n = 3 slices from n = 4 mice/group] Images were acquired at Delta Vision Olympus Ix70 for brain reconstruction The corresponding masks (b–e) were generated accordingly using Fiji software f Graphs showing the proportion of the total area covered by the progeny of IV injected cells vs the progeny of cells injected ICV or ITL and labeled with GFP of mice sacrified at 90 days pTX [n = 4 mice/group] g High resolution confocal z-stacks of selected brain regions (with 5 µm step size) of IV ICV or ITL transplanted mice at the indicated time points [n = 3 slices from n = 2 mice/group] Images were acquired at 25x magnification and processed using Fiji open source software these findings were confirmed independently from the timing of IV cell transplant and the combination of cell source adopted indicating that the route of cell administration is the most relevant factor affecting the regional distribution of the transplant-derived cells d Correlation between the number intersection radii and the sum intersections for microglia-like cells derived from HSPCs co-transplanted in the CNS (ICV or ITL) and IV and retrieved in the indicated brain regions The vertical and horizontal dashed lines divide the graphs in four quadrants to highlight subpopulations with different complexity for highly complex cells characterized by high sum of intersections and high number of intersecting radii; LL = lower left quadrant for cells with low complexity; UL (upper left) and LR (lower right) quadrants for cells displaying intermediate complexity between the LL and UR quadrant e Histograms displaying the percentage of cells retrieved in each of the four quadrants highlighted in d ITL and IV co-injected cells in the total and indicated regions h Representative laser scanning confocal microscope microphotographs of brain sections showing the expression of selected microglia genes in the brain of intra-CNS co-transplanted mice [n = 5 slices from n = 2 mice/group] detected with RNAscope Tissues were hybridized with probes for Tmem 119 (g) or TGFBR (h) gene (white dots) and their expression was analyzed within CNS (green) or IV co-injected cells (red) Nuclei were counterstained with DAPI (blue) Sall1 expression was lower in TAµ versus µ cells further supporting the hypothesis of a differential state of maturation of the two subpopulations we analyzed endogenous microglia retrieved from busulfan-treated mice injected ICV with PBS (sham control) to exclude with the reported results that the procedure per se could significantly affect the gene expression profile of resident microglia In this setting we observed some differences that might be associated with a response to the conditioning regimen this being the only difference when comparing endogenous microglia from untreated vs transplanted animals Notably, in situ RNA analysis of selected genes on cryostatic brain sections by RNAscope assay confirmed the expression of representative above-mentioned genes by the ICV/ITL derived cell progeny (Fig. 4g, h) we generated microglia-like cells with a signature reminiscent of microglia a Experimental scheme of TREM2_LV HSPCs transplantation in 5xFAD mice mock/GFP transplanted 5xFAD mice and WT controls in the elevated plus maze (EPM) (b) analyzed monthly from 4 to 12 months and in the Morris Water Maze (MWM) test in the hidden platform (c) and reversal platform trial (d) at 12 months (n° mice/group/time point b: N ≥ 7; c: N ≥ 12; d: N ≥ 9) Data values (b–d) are shown as MEAN ± SEM [n = 4 experimental replicates] e VCN calculated by ddPCR on DNA from the brain of 5xFAD treated animals [GFP: n = 9 Statistics: unpaired T test: not significant (P-value: 0.3881) f Correlation between VCN and TREM2 expression measured by SYBR Green qPCR on brain from transplanted mice [n = 6] and on the liquid culture progeny of the infused HSPCs (reference) on brain from treated 5xFAD mice (Mock/GFP and TREM2) and controls (WT) at >12months [n° slices/mouse: g Data from mock and GFP mice are indicated by clear versus green dots i IHC on brain slices showing the extent of neuroinflammation (Iba1 and GFAP staining) retrieved in mock vs TREM2 5xFAD transplanted mice at 12 months j Quantification of Aβ deposits in the CTX and HPC of TREM2 transplanted animals (brain VCN > 0.5) compared to GFP/Mock animals [n > 3 slices/mouse asterisks indicate significance at unpaired t-test (CTX p** = 0.0012; HPC p** = 0.0016) k IHC on brain slices showing the extent of Aβ deposits in the HPC and CTX of TREM2 and mock/GFP Tx 5xFAD mice at 12 months a Representative epifluorescence microscope image reconstruction of a LV_TREM2 transplanted 5xFAD mouse showing the enrichment of transduced cells (identified through RNAscope with WPRE-specific probe Images were captured at a 20x magnification N = 5 brain slices from n = 2 mice were analyzed b Representative laser scanning confocal microphotographs of the cortex and hippocampal region from the brain of 5xFAD TREM2 transplanted mice (top and central figure) analyzed in a or in a WT mouse (bottom) used as negative control to demonstrate the specificity of Aβ amyloid and WPRE Images were captured at a 40x magnification with a 1.5x digital zoom using a Leica SP5 scanning confocal microscope c Representative laser scanning confocal microphotographs of the cortex and hippocampal region from the brain of a representative TREM2 transplanted mouse showing that reactive Iba1+ microglia/myeloid cells localized in close proximity to beta amyloid plaques are immunopositive for CD68 d Single channels of the ROI highlighted in the dashed square in c e Representative laser scanning confocal microphotographs of the hippocampal region from the brain of 5xFAD TREM2 transplanted mice showing the presence of WPRE probe positive signal in CD68 positive cells in proximity of beta amyloid plaques f Single channels of the ROI highlighted in the dashed squares in e g Orthogonal view of the cell highlighted by the arrow in f Images in c-g were analyzed in N = 4 brain slices from n = 3 mice these data provide clear proof of the therapeutic potential of HSPC gene therapy in a pure neurodegenerative condition as well as evidence of therapeutic benefit associated to a CNS-restricted engraftment of engineered hematopoietic cells by challenging further the hematopoietic cell transplantation paradigm we unveiled a key role exerted by the CNS environment in uniquely driving expansion we also provided a clear example of the therapeutic potential of this approach that determines a CNS-restricted engraftment of the genetically modified transplant progeny cells in a multifactorial neurodegenerative condition for the administration of the conditioning protocol which is essential to favor robust CNS-engraftment of the transplant progeny cells or for HSPC manipulation and transplantation if the transcriptome of mature microglia could be affected by CNS signaling it is plausible to assume that intra-CNS injected HSPCs may differentiate toward microglia faster than upon IV administration The olfactory bulb was characterized by high but equal presence of both IV and intra-CNS cell progenies in the combinatorial transplants with no morphological differences supporting the hypothesis that this neurogenic area may play a crucial role in the recruitment of engrafted cells independently from the route of cell injection as demonstrated by the short term biodistribution study by which a downregulation of canonical genes associated with resident microglia was observed at later time points (12–13 months post-transplant) we here provided experimental proof of concept of the therapeutic potential of intra-CNS HSPC gene therapy for AD in a severe animal model of the disease we selected TREM2 as a relevant therapeutic transcript specifically intended at enhancing a disease-specific function of transplant-derived microglia-like cells for this study upon ICV transplantation of HSPCs from 5xFAD mutant mice transduced with a LV encoding the human TREM2 cDNA under the control of a moderate-strenght promoter a CNS-restricted engraftment of the TREM2-expressing cells was observed up to 12 months post-transplant in busulfan myeloablated 5xFAD recipients This resulted in substantial disease-modifying effects: a significant amelioration of the behavioral and histopathological disease manifestations was observed with improved performance of the treated versus control mice at the Elevated plus maze and Morris Water Maze tests as well as reduction of neuroinflammation (astrogliosis and microgliosis) The phenotypic effects observed were accompained by a LV-dose dependent decrease of Aβ-deposits in treated mice as compared to mock treated controls using a WPRE ISH probe as strategy to specifically identify the LV-transduced cells in brain sections we documented a preferential distribution of the TREM2 expressing cells in brain regions associated to β amyloid deposits such as the cortex and hippocampal area and in particular a localization of CD68+TREM2+ cells in an activated state in the close proximity of amyloid plaques despite the proof-of-concept nature of our findings will require proper adaptation of protocols in a clinical development plan in the presence of anticonvulsant prophylaxis during conditioning administration no short- or long-term neurotoxic effects of busulfan were noticed at least phenotypically as per regular daily observation and at behavioral studies nor obvious and severe signs of neural damage were observed at histopathological observation of the treated and control mice Although specific neurotoxic effects of busulfan across epileptogenic and/or other neural circuits in this Alzheimer’s disease models remain undefined at the microscopic evaluation such effects have not compromised treatment outcomes nor treated and control mice overall performances this work unveiled a key role exerted by the CNS environment in uniquely driving expansion distribution and myeloid differentiation of locally transplanted HSPCs towards a microglia-like phenotype and showed the robust potential of intra-CNS HSPC gene therapy for exerting specific therapeutic effects in the CNS paving the way for the design of ad hoc gene therapy strategies to treat severe neurodegenerative disorders The specific protocols covering the studies described in this paper were performed in compliance with all relevant ethical regulations and were explicitly approved by the Italian Ministry of Health an internal ethical committee at San Raffaele Hospital (IACUC 573) and the Dana Farber Animal Facility Institutional Animal Care and Use Committee (IACUC 15-031) Experiments performed on wild type C57BL/6 mice or C57BL6/Ly5.1 mice (hereafter called CD45.2 or CD45.1 respectively) were obtained from Jackson Lab or Charles River and maintained at San Raffaele Hospital and at the Dana Farber Animal Facility Experiments performed on 5xFAD mice (#034840-JAX) were obtained from Jackson Lab and maintained at the ARCH animal Facility at Boston Children’s hospital (approved by the Institutional Animal Care and Use Committee (IACUC 17-06-3455) and at Fondazione Istituto di Ricerca Pediatrica Città della Speranza (IRPCDS) animal facility (IACUC 46/2023-PR) Animals used in the study were housed within temperature and humidity ranges appropriate for the species to which they can adapt with minimal stress and physiologic alteration Light in animal holding rooms provided for both adequate vision and neuroendocrine regulation of diurnal and circadian cycles The following LVs were used: pCCLsin.cPPT.humanPGK.GreenFluorescentProtein.Wpre for CNS injected cells (GFP-LV) pCCLsin.cPPT.humanPGK.DeletedNerveGrowthFactorReceptor.Wpre (ΔNGFR-LV) or pCCLsin.cPPT.humanPGK.mCherryProtein.Wpre (mCherry-LV) for IV injected cells A fraction of the transduced cells was cultured for 10 days in vitro in order to assess transgene expression by cytofluorimetric analysis Transduced cells were injected via the tail vein or directly in the CNS by means of ICV or ITL injection into seven/eight-week-old conditioned C57BL6/J female mice 24 h after the fourth busulfan dose (25 mg/kg x four days at different concentration according to the different experimental settings CNS injected cells (Lin- 0.3 × 106/mouse); IV injected cells (Lin-1 × 106; BM 3 × 106; KSL 0.5 × 106) 8 weeks old 5xFAD mice were transplanted ICV with 0.3 × 106 Lin- cells obtained from 5xFAD donors (6–8 weeks old) and transduced at MOI 100 with a TREM2 expressing LV (pCCLsin.cPPT.humanPGK.Trem2.Wpre) as described above 2.0 × 106 BM cells from 5xFAD donors were provided IV for hematopoietic rescue Mice were conditioned with 25 mg/kg of busulfan for 4 days prior to transplant and provided with Diazepam to avoid seizures Diazepam solution (available at 5 mg/mL) was provided daily in the drinking water starting for a total of 10 days with progressive decreases in drug dose (0.25 mg/kg used for the first 8 days then dose decreased in the two following days to 0.125 mg/kg −0.063 mg/kg and removed) 5xFAD mice transplanted with 0.3 × 106 GFP-transduced Lin-cells ICV were used as control ICV transplantation was performed by surgery upon anesthesia (ketamine (100 mg/kg) and xylazine (10 mg/kg) was fixed with ear bars in a stereotactic frame and the skin was disclosed longitudinally Bregma was visualized and coordinates were recorded −0.5 mm anterior) were adjusted before the cranial bone was enclosed under visual control with a drill head of 0.7 mm diameter Five µl of the cell suspension (0.3 × 106 cells) were injected through a 10 µl Hamilton syringe upon insertion into the brain 2.5 mm distal from the cranial bone animals received a single dose of atipamezole (1 µl/g) and were maintained in sterile conditions ITL transplantation was performed under anaesthesia with isoflurane (4% induction A 10 µl Hamilton syringe connected to a 30-gauge needle containing 5 µl of cell suspension was introduced into the intervertebral foramen between L5 and L6 through the intact skin Slow administration of 0.3 × 106 cells/mouse was performed once the proper position of the needle was confirmed by tail flick reflex injection of atipamezole (1 μl/g) as analgesic and returned to the cage Prophylactic Antibiotic (Gentamycin Sulfate 80 mg/250 mL) was administered via the drinking water for 2 weeks following conditioning and transplantation Mice were euthanized under deep anesthesia by extensive intra-cardiac perfusion with cold PBS for at least 10–15 min/mouse after clumping the femur The procedure was stopped only when complete liver blanching was observed to avoid contamination with circulating blood cells Organs were then collected and differentially processed BM cells were collected from the clumped femur as described Brain was removed and the two hemispheres were differently processed one hemisphere was fixed for 24 h in 4% PFA embedded in OCT compound and stored at −80 °C after equilibration in sucrose gradients (from 10 to 30%) cells from the other hemisphere were mechanically disaggregated to obtain a single cell suspension in 20 ml of GKN/BSA buffer (8 g/L NaCl The same protocol was used to process the spinal cord Cells from BM and CNS tissues (brain and spinal cord) were analyzed by FC upon re-suspension in blocking solution (PBS 5%FBS 1%BSA) and labeling at 4 °C for 15 min with the following specific antibodies: rat PE anti-mouse CD45 (BD Pharmingen) 1:100; rat APC anti-mouse CD45 (BD Biosciences) 1:150; rat Brilliant Violet 510 anti-mouse CD45 (BioLegend) 1:150; rat Pacific Blue antimouse CD45.2 (Bio Legend) 1:100; mouse PE anti-Mouse CD45.1 (BD bioscience) 1:100; rat APC anti-mouse CD11b (eBioscience) 1:100; mouse Alexa Fluor 647 anti-Human CD271 (NGF receptor) (BD Pharmingen) 1:30; rat APC 780 anti-mouse CD11b (eBioscience) 1:100; rat APC 780 anti-mouse CD117(c-kit) (eBioscience) 1:100; rat PE-Cy7 anti- mouse Ly-6A/E Sca-1 (Sca-1) (BD Bioscence) 1:150 7-AAD (1 mg/ml) (Sigma-Aldrich) or DAPI was added to the cells prior to analysis for dead cell exclusion Samples were analyzed by LSR Fortessa (Beckton Dickinson) Brains were serially cut in the sagittal planes on a cryostat in 15 µm sections Then sections were incubated over night with primary antibodies diluted in PBS 10% NGS at 4 °C as follows; rabbit anti Iba1 (Wako) 1:100; chicken anti-GFP (Abcam) 1:250; rabbit anti GFP (Invitrogen) 1:100; mouse PE anti-human CD271 (NGF Receptor) (BD Pharmingen) 1:50; rabbit anti-cherry (Abcam) 1:100 The secondary antibodies goat IgG anti-Chicken Alexa Fluor 488 goat IgG anti-Mouse Alexa Fluor 546 (Molecular Probes Invitrogen) were diluted 1:500 in the same blocking solution used for primary antibodies staining and incubated with sections for 2 h at room temperature Nuclei were stained with Topro III (Molecular Probes Invitrogen) 1:1000 in PBS or by DAPI (Roche) 1:30 in PBS air dried and mounted with Fluorsafe Reagent (Calbiochem) Not transplanted mice were used as negative controls for the reporter transgene staining Incubation with secondary antibody alone was performed in order to exclude the background signal Samples were analyzed with a confocal microscope (Zeiss and Leica TCS SP2; Leica Microsystems Radiance 2100; Bio-Rad) (λexcitation = 488 Fluorescent signal was processed by Lasersharp 2000 software Images were imported into Adobe Photoshop CS 8.0 software and processed by using automated level correction a fluorescence microscope Delta Vision Olympus Ix70 was used for the acquisition of the images which were then processed by the Soft Work 3.5.0 software Images were then imported into the Adobe Photoshop CS 8.0 software and reconstructed The branching analysis was performed with ImageJ software using an automatic Macro developed in the lab for standardizing the procedure on multiple individual cells (comprised between 20 and 80) from different brain region of transplanted mice Cells were identified according to the expression of different fluorescent markers (GFP/Cherry/∆NGFR) and validated reproducing the same analysis on Iba-1+ stained cells Automated Sholl analysis was performed by applying the same strategy to study the radial distribution of microglia branches around the cell body The sum intersections and number of intersection radii were selected as parameters to characterize donor derived cells in terms of complexity and spatial extension of the cell arborizations a mask was created from splitted channel images by using Fiji program The positive signal was then converted in colored spotted signal to differentially mark CNS vs IV transplanted cells a deeper analysis was conducted on splitted channel images upon removal of background noise and identification of region In particular tissues were a) soaked in Starting Solution overnight at 4 °C; b) transferred to Solution A at 37 °C for 24 h followed by three 20-minute washes in distilled water at 4 °C; c) immersed in Solution B at 37 °C for 24 h followed by four 30-minute washes in distilled water at 4 °C; d) stained with Nuclei staining solution (DAPI 10 µg/ml in distilled water) for 2 h at 4 °C followed by three 10-minute washes in distilled water at 4 °C; e) placed in Mounting Solution at 37 °C for 24 h and then stored at room temperature for imaging A z-stack of 400–500 μm thickness (with 20 μm intervals) was obtained in both the UV and FITC channels to visualize the DAPI-stained nuclei and GFP+ cells A composite image was generated through stitching Four partially overlapping acquisitions were performed focused on four different brain subregions (forebrain Full brain was reconstructed by manually merging the four acquisitions (with GIMP v.2.10.8 open-source software Selected brain regions of interest were acquired at high-resolution on the z-axis by capturing a z-stack image of 400–500 μm thickness (with 5 μm intervals) at 25x magnification with a Leica SP5 scanning confocal microscope For the analysis of microglia enriched genes cryostatic brain sections were processed and stained using the RNAscope 2.0 kit (cat#310095 following the Fixed-frozen tissue sample preparation and pre-treatment protocol according to manufacturer instructions Perfusion and post-fixation in paraformaldehyde were performed as described above After equilibration in 30% phosphate buffered sucrose solution 14 µm thick brain sections were mounted onto Superfrost Plus glass slides using a cryostat Detection of Tmem119 and Tgfbr1‐mRNA was performed using the RNAscope® Fluorescent Multiplex Assay with a probe set targeting base pairs 2–1106 of mouse Tmem119‐mRNA (Cat No CA) or base pairs 2257–3252 of mouse Tgfbr1-mRNA (Cat No 406201 washed in PBS and subsequently immersed in boiling 1x Target Retrieval solution for 5 min After washing in distilled water and 100% ethanol for 2 min each the sections were incubated with Protease IV solution for 30 min at 40 °C in a humidified tray After washing in distilled water for 2 min the sections were then hybridized with target probes for 2 hr at 40 °C followed by amplification solutions 1 (30 min) the sections were rinsed in 1x Wash Buffer for 2 min at room temperature the sections were counterstained with 4’,6‐Diamidine‐2’‐phenylindole dihydrochloride (DAPI) for 30 s and coverslipped in PVA‐DABCO Images were acquired at Delta Vision Olympus 10x Brain samples from 5xFAD mice were processed for immunohistochemistry by Neuroscience Associates After equilibration in sucrose gradients (from 10 to 30%) and 24 h treatment with 4% PFA samples were embedded in a gelatin matrix using MultiBrain®Technology after curing by immersion in 2-Methylbutane chilled with crushed dry ice and mounted on a freezing stage of an AO 860 sliding microtome The MultiBrain® blocks were sectioned coronally with desired micrometer (μ) setting on the microtome All sections were cut through the entire length of the specimen segment and collected sequentially free floating sections were processedd for IF as per internal protocols All incubation solutions from the blocking serum onward use Tris buffered saline (TBS) with Triton X-100 as the vehicle; all rinses are with TBS After a hydrogen peroxide treatment and blocking serum the sections were immunostained with the primary antibodies (i.e anti-Iba1 and incubated overnight at room temperature Vehicle solutions contained Triton X-100 for permeabilization a biotinylated secondary antibody was applied After further rinses Vector Lab’s ABC solution (avidin-biotin-HRP complex) was applied then treated with diaminobenzidine tetrahydrochloride (DAB) and hydrogen peroxide to create a visible reaction product the sections were mounted on gelatin coated glass slides The identification of LV-transduced cells in the tissues of transplanted 5xFAD mice was performed through in-situ hybridization for WPRE on 20 μm brain slices The protocol was optimized to allow the co-detection of WPRE as well as amyloid beta CD68 and Iba1 (stained with immunohistochemistry) on the same tissue slice a standard immunohistochemistry protocol was performed brain sections were blocked for 1 h at RT in blocking buffer (NGS 10% or BSA 3% The primary antibodies used were Mouse anti-B-Amyloid (1:500 the sections were incubated with Biotinylated Goat anti-Mouse IgG (H + L) (1:200 Biotinylated Goat anti-Rat IgG (H + L) (1:200 Vector Labs) or Biotinylated Donkey anti-Rabbit IgG (H + L) (1:200 followed by 30’ incubation at RT with HRP-streptavidin conjugate (1:100 Before starting the in-situ hybridization protocol AB64212) was used following manufacturer’s instructions to saturate any available biotin-binding surface in the tissue Slices were fixed with PFA 4% and left to dry O/N at RT In-situ hybridization was performed using the RNAscope Probe WPRE-04 (Biotechne initially blocking peroxidases through the RNAscope H2O2 followed by protease treatment according to the manufacturer instructions (ACD 322381) and subsequently amplifying the target signal with the RNAscope Multiplex Fluorescent Detection Kit V2 (ACD 323110) and associating it with the Cy5 tyramide fluorophore (1:1000 Images were captured at a 40x magnification with a 1.5x digital zoom using a Leica SP5 laser scanning confocal microscope Total RNA was extracted with the RNeasy Plus Micro kit (Qiagen) from sorted myeloid brain populations RNA quantity was determined using QuantiFluor® RNA system and QuantusTM Fluorometer (Promega) cDNA was generated starting from 1 ng up to 100 ng of purified mRNA by using SuperScript VILO Master mix (Thermo Fisher Scientific) cDNA was then pre-amplified using Custom Taqman® PreAmp Pools (Thermo Fisher Scientific) Thermal cycling for cDNA generation and preamplification was performed on T100 Thermal cycler (BIO-RAD) following manufacturer’s instructions Gene expression analysis was performed using a custom design TaqMan-based microfluidic card gene expression assay (Applied Biosystems) Real time PCR was run in standard mode on Applied Biosystems® ViiATM 7 Real-Time PCR System using the following thermal cycling conditions: one cycle at 50 °C for 2 min 40 cycles at 95 °C for 15 s and 60 °C for 1 min (Applied Biosystems) The ViiATM 7 Software v1.2.2 was used to extract raw data The difference (dCT) between the threshold cycle (CT) of each gene and that of the reference gene (mean of HPRT and r18S CTs) was used to determine gene expression Fold change expression of selected microglia genes was calculated by 2−ddCT method The RNA-seq gene expression analysis was performed on additional samples corresponding to different combinations of route of administration (IV The complete design matrix reporting the characteristics of each sample is available as Source data in a Source data file Raw sequencing files were investigated for QC and aligned to the reference mouse genome mm39 (Genome assembly GRCm39) using STAR workflow83 Poorly-detected genes with a cumulative reads count smaller than 10 or measured (reads count>0) in less than two samples were filtered out Gene counts have been modeled using a negative binomial model Normalized data are used for the heatmap representations and are available as Source Data in a Source data file hTREM2 expression was detected on brain tissue extracts by qPCR using a SYBR Green Kit with primers and probe from Thermofisher (Catalog number: 4448892 Primers for hTREM2 were preliminary validated on human THP1 cells a monocytic cell line that constitutively expresses hTREM2 and on BV2 murine cells transduced with the LV_hTREM2 both used as positive controls for hTREM2 expression All values were normalized to the housekeeping gene GAPDH hTREM2 expression was then measured on the brain of animals transplanted ICV with LV-hTREM2 HSCs at sacrifice at 10 months after the transplant ddPCR was performed on genomic DNA extracted respectively from the liquid culture grown in vitro for 14 days post transduction and from the brain tissues by using the DNeasy Blood & Tissue kit (Qiagen) ddPCR was ran in duplicate using 20 ng of gDNA as template ddPCR Supermix for Probes (Bio-Rad Laboratories Inc) and primers specific for HIV Psi region LENTI (FAM fluorochrome forward primer: 5’-TGAAAGCGAAAGGGAAACCA-3’; Reverse primer 5’-CCGTGCGCGCTTCAG-3’; probe: AGCTCTCTCGACGCAGGACTCGGC) and for the murine RPP30-(HEX fluorochrome forward primer: 5’-CCAGCTCCGTTTGTGATAGT-3’ Reverse primer 5’-CAAGGCAGAGATGCCCATAA-3’) Poisson statistical analysis of the numbers of positive and negative droplets yields absolute quantification of the target sequence the elevated-plus maze (EPM) test was performed on the transplanted 5xFAD animals every month from age 4 months until the age of 12 months and the Morris Water Maze (MWM) test at study termination (12 months of mice age) All four arms are elevated 1 meter from the floor with the drop-off detectable only in the open arms The EPM contained two open arms (35.5 cm×6 cm) and two closed arms (35.5 cm × 6 cm) radiating from a central area (6 cm × 6 cm) A 0.5 cm high lip surrounded the edges of the open arms whereas the closed arms were surrounded by 20 cm high walls The EPM was cleaned with Peroxigard before the beginning of the first test session and after each subject mouse was tested with sufficient time for the ethanol odor to dissipate before the start of the next test session the mouse was placed in the central area facing the open arm The mouse was allowed to freely explore for 5 min Trials were videotaped and scored with EthoVision XT video tracking software (version 12.0 circular tub (60 cm depth x 83 cm diameter) was filled to 29 cm deep with water that was approximately 25 °C distinct shapes were places in each of the four quadrants inner walls of the tub to form distinct quadrants Acquisition training (day 1) consisted of 8 trials per mouse with a white platform (10 cm diameter) 0.5 cm above the surface of the water and marked with the red reflector Each training trial began by lowering the mouse into the water close to the pool edge The start location for each trial was alternated in a semirandom order for each mouse Each mouse started in each of the quadrants twice Hidden training (day 2–3) consisted of 20 trials per mouse Each mouse started in each of the quadrants five times For probe testing (day 4) the platform was removed and mice started opposite the position of where the hidden platform had been located Reversal training (day 5 consisted of 1 trials per mouse Mice were allowed a maximum of 90 s to reach the platform a mouse that failed to reach the platform in 60 s was guided to the platform by the experimenter Mice were left on the platform for 5 s before being removed the subject was placed in a cage lined with absorbent paper towels and allowed to rest Time spent in each quadrant and number of crossings over the trained platform location was used to analyze probe trial performance we used Unpaired T-test with Welch’s correction one-way ANOVA followed by Tukey post-hoc test was used; for multiple variable comparisons two-way ANOVA followed by Sidak post-hoc test was applied Details on the exact statistical test used as well as the number of subjects and samples are included in the respective figure legends P-values are reported in the respective figure legends whenever possible or are available as Supplementary information No statistical method was used to predetermine sample size A biological triplicate (independent experiment) was guaranteed in both in vitro and in vivo experiments Blinding analysis was adopted for behavioral testing in AD mice Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article Development and homeostasis of “resident” myeloid cells: the case of the microglia Fate mapping analysis reveals that adult microglia derive from primitive macrophages Microglia: Dynamic Mediators of Synapse Development and Plasticity Synaptic pruning by microglia is necessary for normal brain development Intracerebroventricular delivery of hematopoietic progenitors results in rapid and robust engraftment of microglia-like cells Brain conditioning is instrumental for successful microglia reconstitution following hematopoietic stem cell transplantation Wild-type bone marrow cells ameliorate the phenotype of SOD1-G93A ALS mice and contribute to CNS Outcomes of unrelated umbilical cord blood transplantation for X-linked adrenoleukodystrophy Microglia in the adult brain arise from Ly-6ChiCCR2+ monocytes only under defined host conditions AAV-Mediated Gene Delivery to the Spinal Cord by Intrathecal Injection Hematopoietic Stem-Cell Gene Therapy for Cerebral Adrenoleukodystrophy Lentiviral haemopoietic stem-cell gene therapy in early-onset metachromatic leukodystrophy: an ad-hoc analysis of a non-randomised Design of a regulated lentiviral vector for hematopoietic stem cell gene therapy of globoid cell leukodystrophy Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy Identification of hematopoietic stem cell-specific miRNAs enables gene therapy of globoid cell leukodystrophy Safety of arylsulfatase A overexpression for gene therapy of metachromatic leukodystrophy Hematopoietic stem cell gene therapy with a lentiviral vector in X-linked adrenoleukodystrophy Gene therapy of metachromatic leukodystrophy reverses neurological damage and deficits in mice CRISPR-Cas9 Gene Editing of Hematopoietic Stem Cells from Patients with Friedreich’s Ataxia Gene therapy using haematopoietic stem and progenitor cells Hematopoietic Stem Cell Gene Therapy: Progress and Lessons Learned Lentiviral haemopoietic stem/progenitor cell gene therapy for treatment of Wiskott-Aldrich syndrome: interim results of a non-randomised Hematopoietic Stem Cell Transplantation for Mucopolysaccharidoses: Past Lentiviral Hematopoietic Stem Cell Gene Therapy Corrects Murine Pompe Disease Non-toxic HSC Transplantation-Based Macrophage/Microglia-Mediated GDNF Delivery for Parkinson’s Disease Neuroinflammatory paradigms in lysosomal storage diseases Metallothioneins are neuroprotective agents in lysosomal storage disorders Macrophage enzyme and reduced inflammation drive brain correction of mucopolysaccharidosis IIIB by stem cell gene therapy Hematopoietic stem cell transplantation chemotherapy causes microglia senescence and peripheral macrophage engraftment in the brain Busulfan conditioning enhances engraftment of hematopoietic donor-derived cells in the brain compared with irradiation Plasschaert, R. N. et al. High-throughput analysis of hematopoietic stem cell engraftment after intravenous and intracerebroventricular dosing. Mol. Ther. https://doi.org/10.1016/j.ymthe.2022.05.022 (2022) Phenotypic clustering: a novel method for microglial morphology analysis Automated Sholl analysis of digitized neuronal morphology at multiple scales: Whole cell Sholl analysis versus Sholl analysis of arbor subregions New tools for studying microglia in the mouse and human CNS Identification of a unique TGF-beta-dependent molecular and functional signature in microglia A neurodegeneration-specific gene-expression signature of acutely isolated microglia from an amyotrophic lateral sclerosis mouse model Regulation of microglial phagocytosis and inflammatory gene expression by Gas6 acting on the Axl/Mer family of tyrosine kinases The microglial sensome revealed by direct RNA sequencing Microglia development follows a stepwise program to regulate brain homeostasis Competitive repopulation of an empty microglial niche yields functionally distinct subsets of microglia-like cells Peripherally derived macrophages can engraft the brain independent of irradiation and maintain an identity distinct from microglia A Combination of Ontogeny and CNS Environment Establishes Microglial Identity Genetic Cell Ablation Reveals Clusters of Local Self-Renewing Microglia in the Mammalian Central Nervous System TREM2 - a key player in microglial biology and Alzheimer disease Elevated TREM2 Gene Dosage Reprograms Microglia Responsivity and Ameliorates Pathological Phenotypes in Alzheimer’s Disease Models Missense variant in TREML2 protects against Alzheimer’s disease and neuron loss in transgenic mice with five familial Alzheimer’s disease mutations: potential factors in amyloid plaque formation and reduced anxiety coinciding with axonal degeneration and intraneuronal Abeta aggregation in the 5XFAD mouse model of Alzheimer’s disease A review of the validity and variability of the elevated plus-maze as an animal model of anxiety Woodchuck hepatitis virus post-transcriptional regulatory element deleted from X protein and promoter sequences enhances retroviral vector titer and expression Viral mediated neuropeptide Y expression in the rat paraventricular nucleus results in obesity Sagoo, P. & Gaspar, H. B. The transformative potential of HSC gene therapy as a genetic medicine. Gene Ther. https://doi.org/10.1038/s41434-021-00261-x (2021) The role of microglia in human disease: therapeutic tool or target Efficient Strategies for Microglia Replacement in the Central Nervous System Diverse Requirements for Microglial Survival and Function Revealed by Defined-Medium Cultures Human iPSC-derived mature microglia retain their identity and functionally integrate in the chimeric mouse brain Transnasal transplantation of human induced pluripotent stem cell-derived microglia to the brain of immunocompetent mice Intracerebroventricular Delivery as a Safe Best practices for the use of intracerebroventricular drug delivery devices Human intracerebroventricular (ICV) injection of autologous adipose-derived stromal vascular fraction (ADSVF) for neurodegenerative disorders: results of a 3-year phase 1 study of 113 injections in 31 patients The Evolving Concept of the Blood Brain Barrier (BBB): From a Single Static Barrier to a Heterogeneous and Dynamic Relay Center Isolation and culture of microvascular endothelial cells from murine spinal cord Neurogenic Radial Glia-like Cells in Meninges Migrate and Differentiate into Functionally Integrated Neurons in the Neonatal Cortex The meningeal and choroidal infiltration routes for leukocytes in stroke Effector T-cell trafficking between the leptomeninges and the cerebrospinal fluid Meninges: A Widespread Niche of Neural Progenitors for the Brain Highly regionalized neuronal expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) in rat brain: evidence for its colocalization with neurotransmitters and neuropeptides Restricted proliferation and migration of postnatally generated neurons derived from the forebrain subventricular zone Functional integration of adult-born neurons Cell trafficking through the choroid plexus IFN-gamma-dependent activation of the brain’s choroid plexus for CNS immune surveillance and repair Gosselin, D. et al. An environment-dependent transcriptional network specifies human microglia identity. Science 356, https://doi.org/10.1126/science.aal3222 (2017) Engrafted parenchymal brain macrophages differ from microglia in transcriptome chromatin landscape and response to challenge Effects of long-term and brain-wide colonization of peripheral bone marrow-derived myeloid cells in the CNS Microglia and Microglia-Like Cells: Similar but Different Neuroprotective Properties and Therapeutic Potential of Bone Marrow-Derived Microglia in Alzheimer’s Disease Rescue of Alzheimer’s disease phenotype in a mouse model by transplantation of wild-type hematopoietic stem and progenitor cells Bone marrow-derived microglia play a critical role in restricting senile plaque formation in Alzheimer’s disease Neuroprotective properties of the innate immune system and bone marrow stem cells in Alzheimer’s disease Gene therapy augments the efficacy of hematopoietic cell transplantation and fully corrects mucopolysaccharidosis type I phenotype in the mouse model Lipophilic dye-compatible brain clearing technique allowing correlative magnetic resonance/high-resolution fluorescence imaging in rat models of glioblastoma Team, R. C. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria, https://www.R-project.org/ (2013) Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 In Methods of Behavior Analysis in Neuroscience Frontiers in Neuroscience (eds nd & J Sociability and motor functions in Shank1 mutant mice Download references Valentina Cipolla and Valeria Bortolotto for experimental support on the Alzheimer’s disease project and for supporting the optimization of RNAscope protocol and related analysis We wish to thank Mauro Giuseppe Spatafora (University of Pavia) for the help with confocal microscope acquisitions and Claudia Balducci (“Mario Negri” Institute for Pharmacological Research) for kindly providing the anti-Amyloid beta antibody This work was funded by ERC Consolidator Grant #617162 ERC Proof of Concept 2022 Grant TREM2MICROENGINES and sponsored research agreement funds to AB San Raffaele Telethon Institute for Gene Therapy Dana-Farber/Boston Children’s Cancer and Blood Disorders Center Department of Biology and Biotechnology “L Cellular and Molecular Neuropharmacology lab methodology and writing of the original draft are authors on a patent application related to this work (intracerebral transplantation of engineered HSCs) filed by Boston Children’s Hospital the San Raffaele Hospital and Politecnico of Milano (application no are authors of a provisional patent application related to this work (TREM2 HSC gene therapy for AD) filed by Boston Children’s Hospital and Dana Farber Cancer Institute application no All other authors declare that they have no competing interests Nature Communications thanks the anonymous reviewers for their contribution to the peer review of this work Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations Download citation DOI: https://doi.org/10.1038/s41467-024-52301-w Anyone you share the following link with will be able to read this content: a shareable link is not currently available for this article Sign up for the Nature Briefing newsletter — what matters in science Milazzo has been approved to lease the same hangar A 2022 photo of the then-partially-deconstructed airport hangar at the Harriman-and-West Airport The North Adams Airport Commission approved Michael Milazzo's application to lease the damaged Milazzo and associate Brian Doyle allegedly destroyed the hangar according to a 2021 police report NORTH ADAMS — A familiar face will soon fly out of a refurbished hangar at Harriman-and-West Airport in North Adams He's also accused of previously vandalizing it The North Adams Airport Commission accepted Michael Milazzo’s proposal for the refurbished Northeast Hangar It was rebuilt after it was partially demolished in a manner a police report says was unsafe The Federal Aviation Administration funded $566,644 of the rebuild The commission accepted Milazzo's application against the recommendation of a committee consisting of two commission members and two city officials According to commission Chair Marc Morandi "A discussion took place regarding [the] expectation held by all that we had hoped for more than one response." The committee even reached out to the Office of the Inspector General about the proposal which advised that a proposal cannot set lease terms as Milazzo's did only the request for proposals can do that The result was a formal recommendation to reject all bids and rework the RFP to rebid at a later date Milazzo repeatedly interrupted deliberations during the commission's discussion of the vote at one point noting that the city "on multiple occasions has taken single proposals and moved forward on projects with one proposal." saying that there wasn't enough information in Milazzo's application City Administrative Officer Kathy Eade said that Milazzo was “innocent until proven guilty.” During Tuesday's commission meeting commissioners did not at all discuss the allegations against Milazzo Former hangar co-owners Derek and Jackie Rougeau have alleged to North Adams Police and airport officials that their former business partners and hangar co-owners Brian Doyle and Milazzo were responsible for the damage to the hangar A 2021 police report seems to validate the Rougeaus’ claims Milazzo and Doyle did not face any internal action from airport management or the commission North Adams Police Officer Kelly Wisniowski did not depict such gray areas in her 2021 report about the vandalism which was carried out with an excavator owned by Milazzo as he has admitted during litigation in court proceedings pitting the Rougeaus and Milazzo and Doyle against each other “This partial demolition carried out by Doyle and Milazzo was done in a hazardous manner and without consulting the other owner,” Wisniowski’s report states “Valuable property was unnecessarily and maliciously damaged were put at extreme risk as a result of unsafe work being done near a live gas line which had not yet been disconnected.” Milazzo admitted he brought the excavator to the hangar and later removed it but denies responsibility for carrying out the excavation and it was never concluded how it happened.” Despite the police report and repeated protestations from some who use the airport Milazzo is once again in control of the hangar Milazzo Air LLC offered to pay $24,000 annually to lease the hangar The commission will meet with Milazzo in executive session on Oct Milazzo Air would at first make available space for aircraft storage would become “a full-service piston aircraft maintenance facility including avionics service (not currently available at the North Adams Airport).” Some level of aircraft storage would be available throughout and the venture could create between five and seven jobs The principals in the aircraft maintenance business would be Milazzo and Doyle Both have not responded to requests for comment from The Eagle when asked whether he had a hand in destroying the hangar which is not part of the hangar dispute between the former co-owners separately have accused Doyle and Milazzo of relentlessly harassing them verbally as well as interfering with their gliding and airport operations Milazzo and Doyle have accused Mohawk of being the real harassers North Adams has named September "General Aviation Appreciation Month" as part of an effort to highlight the importance of small airports The city-owned hanger is being renovated and is now unenclosed Scott Balawender said bits of insulation blew into his yard Students Build Professional Skills in the Field New Book Brings Hip-Hop Pedagogy to Classrooms Nationwide newly opened by Amanda Milazzo in Easthampton Amanda Milazzo talks about opening a new dessert bar and cafe called Darlings in Easthampton A Manhattan and a slice of Peanut Layer Cake at Darlings Bar and Cafe EASTHAMPTON — A new member of the Small Oven Bakery family has opened its doors in Easthampton Darlings Bar and Cafe offers an array of rich new desserts and savory snacks from the Small Oven staff alongside a selection of handcrafted cocktails Small Oven and Darlings owner Amanda Milazzo said that the new bar and cafe not only serves as a space for community members to gather in the evenings but has been an outlet for herself and her Small Oven staff who get to explore new creative avenues when making the complex desserts available at Darlings “Before I had opened the bakery and I was just working in service places I always thought it was a really sweet idea to open a dessert bar,” said Milazzo When she found out that the space at the corner of Holyoke Street and Fairfield Avenue in Easthampton was available she knew it was time to realize that dream Milazzo transformed the space into the moody relaxed dessert bar that has already been drawing crowds each night Milazzo said she has been working on making Darlings a reality for about a year now and that renovating the bar to fit her vision was an “intense” process that began in July and only recently wrapped up not really like a building person,” Milazzo said Darlings prioritizes local ingredients in its offerings From its decadent cakes to its bread and butter everything on the menu is made from scratch in the Small Oven kitchen While the desserts at Darlings aren’t offered at the bakery Milazzo said that the flavor profiles at the dessert bar will be familiar to patrons of Small Oven customers from Easthampton and beyond will have access to the tasty creations of Milazzo and her staff both morning and night “The stuff during the day is very much bread and pastries… Here it’s all about the plating and the composition on the plate,” Milazzo explained “The desserts are tailored toward what we love to eat.” Milazzo said that the Darlings House Tiramisu will always be on the menu which is her “favorite dessert of all time.” Patrons of Darlings can choose to sit and chat at the bar or take advantage of a full-service dining area Milazzo said she plans to open the space as a “quick pickup coffee spot” as well Milazzo said she envisions Darlings being used as a gathering place for future community events Milazzo has felt support and excitement from the community which has backed her throughout her business endeavors Throughout the process of opening Darlings responsible” staff at Small Oven has been incredibly helpful especially as the bakery approaches the holiday season Darlings is currently open Tuesday through Sunday from 5 to 10 p.m you agree with our use of cookies to personalize your experience measure ads and monitor how our site works to improve it for our users Broadway Off-Broadway Off-Off Broadway Cabaret Dance Opera Classical Music Nashville Minneapolis / St. Paul Connecticut Atlanta Chicago Los Angeles WEST END UK Regional Canada Australia / New Zealand Europe Asia Latin America Africa / Middle East TV/Movies Music The BroadwayWorld reviewer picks his favourite immersive shows of 2024 the immersive genre in London and beyond grew and grew and grew with the independent sector overshadowing the biggest names It seems that Punchdrunk has been the king of this jungle since forever but they are in something of a state of artistic limbo since the financial failure of 2022’s The Burnt City was well-received by critics but artistically unambitious by their previous standards Their latest accounts paint a picture of a company cutting back on creative staff looking both at home and abroad for their next ventures and after failing to make scheduled payments on a multi-million pound loan the ingenious Key Of Dreams from Lemon Difficult pulled us into a 24 hour-long adventure of pulsating Lovecraftian horror Two cabaret-style shows (Rhythm & Ruse and The Magicians Table) blended close-up magic Foodies got stuck into the Batman-themed Monarch Theatre while global travel was the theme for Gingerline’s The Grand Expedition Those with a taste for the luxurious boarded Neil Kelso’s Dead On Time to solve a cunning murder-mystery moseying through the Kent countryside as the clues piled up classical or jazz; even the Royal Ballet joined in for their Dark With Excessive Bright Below are thirty of the year’s top immersive shows as described by writers of BroadwayWorld the UK’s leading mainstream source of reviews for this exciting genre “What is the difference between a house and a home? And who gets to write history? Interactive experience 1884 provokes challenging answers to these questions in the context of an almost-forgotten historical event that had significant consequences for two continents.” Full review “Charles Mingus originally intended for his iconic 1963 jazz album Black Saint and The Sinner Lady to be accompanied by dancers and thanks to performance company Clod Ensemble and the Nu Civilisation Orchestra it becomes the inspiration for a vibrant and inclusive show.” Full review talking to the dead is not solely the preserve of spiritualists and mediums Her immersive meditation on grief manifests in the form of nine storylines where the living pour their hearts to those who have passed.”  Full review “Ever wanted to captain a spaceship on a mission to explore strange new worlds seek out new life and new civilisations and perhaps shoot up some enemy ships along the way Parabolic Theatre’s Bridge Command realises every sci-fi geek’s dream.”  Full review “Stepping out from behind the ones and twos Lemon Jelly DJ and club promoter Fred Deakin takes us on an odyssey through his own life and times Club Life was one of the Edinburgh Fringe’s word-of-mouth hits last year an immersive theatre piece that takes his career as a starting point and allows the audience the chance to jump on the dance floor.” Full review “Based on the 2017 hit film about PT Barnum The Greatest Showman Circus Spectacular is a mishmash of circus story and song that somehow manages to do a disservice to all three.”  Full review “Appearing as part of their Festival of New Choreography the Royal Ballet partners with the National Ballet of Canada for this extraordinarily intimate experiment which allows audience to experience the art form in a radical way.”  Full review “If there was an award for the most art forms smooshed into one show comedy and drag wrapped around the classic Die Hard plot is a satisfying mess that somehow (just) works.”  Full review as the nation prepares itself for the Festival of Britain a killer hiding in plain sight and around two hundred passengers-cum-amateur detectives find themselves all aboard the same train It’s fair to say that Dead On Time knows how to set a scene even before we step aboard.”  Full review Full review “Feeling like the wildest circus party in town Fuerza Bruta (Spanish for “brute force”) returned to the Roundhouse with their new show Aven.”  Full review immersive dining specialists Gingerline’s revival of The Grand Expedition leads us on a merry virtual journey around the world all while sat in a hot air balloon gondola.”  Full review Sherlock Holmes and Dr Watson are on the hunt for a mysterious killer in this theatrical dining experience Link “Watching this reboot of Immersive 1984, a thought comes to mind: if, as we’re constantly being informed, we’re all living in the post-privacy, post-truth and post-politics world foretold in 1984, aren’t we already inside an immersive version of George Orwell’s seminal book?”  Full review 15. Jeff Wayne’s Musical Version Of The War Of The Worlds: The Immersive Experience music and mayhem: who could ask for more from an immersive show?” Full review a group of people is summoned to discuss the crimes of a man who swears his innocence Full review “Thanks to some nifty “mixed reality” technology from Tin Drum, the late Japanese composer Ryuichi Sakamoto is brought back to some semblance of life in Kagami.” Full review “With tickets costing £400 each and a Lovecraftian storyline stretching over 24 hours is Lemon Difficult’s The Key Of Dreams the ultimate in immersive theatre?” Full review its clear that The Magicians Table is too cool for school It’s certainly too cool for a helpful apostrophe but it becomes obvious very soon that we’re talking about multiple illusionists including the recently departed Dieter Rotenburg are gathered here to pay tribute to his final trick and enjoy the company of his fellow professionals.” Full review “Deadweight Theatre’s The Manikins: A Work In Progress is many things this is a polished work of hidden depths.” Full review “May Contain Food May Contain You takes audiences on a journey through dance Full review “Almost as secretive and hidden away as the Batcave Soho’s Park Row is a restaurant dedicated to the Caped Crusader an immersive dining experience which combines projections Full review it's just the opposite.’ Attributed to Nobel Prize-winning economist and Ali G interviewee JK Galbraith this is the phrase that rolls around my head as I take on the Crystal Maze-like Monopoly Lifesized a highly entertaining take on arguably art's single greatest monument to the pursuit of personal wealth.” Full review  “Featuring works as diverse as Michael Nyman’s ‘Strong on Oaks, Strong on the Causes of Oaks’ and Felix Mendelssohn’s ‘Overture’ from A Midsummer Night’s Dream Sinfonia Smith Square’s environmentally-minded concert The Orchestral Forest is an enchanting sonic experiment.” Full review “It is not the only impressive immersive show in town but its near-peerless execution and boundless imagination puts it up there with the more well known Punchdrunk.” Full review “On top of an exciting live band and plenty of close-up magic there’s a hefty Punchdrunk pedigree in the creative team behind this Jazz Age theme party.” Full review “As well as the traditional risk of getting picked for a dose of benign audience interaction high-speed flying skates and even some full-frontal near-nudity to contend with.” Full review “Selecting a Ghost is a fantastic example of a site-specific performance with some brilliant actors that struggles to combine the genres of horror and hip hop to make for a fully cohesive show.” Full review “Tucked away in a secret location in the heart of Clerkenwell with the address given only upon booking and its exact plot begged to be kept hush-hush in the press.” Full review “In a sudden lurch away from their epic 2022 creation The Burnt City immersive specialists Punchdrunk’s next effort is a far more cosy affair.” Full review Theatres Trust, the national advisory and advocacy body for theatres, has announced the latest theatres to receive grants through its Small Grants Programme with The Linbury Trust. Acclaimed award-winning actor Rosalie Craig will return to the West End stage this summer to star as June Levant in the London premiere of Good Night, Oscar. In this version of the familiar story, we are whisked away to the 1800s American West. The sparring young men are now gun-touting cowboys, the ball is a barn dance, and the soundtrack is all banjos and whistles. It’s a bold transposition of the star-crossed Verona lovers, but one that works surprisingly well.  function closestickysocial(){document.getElementById("foxsocial").style.display="none";}@media(max-width:1024px){.most-popular,.video-row{display:block;margin-top:25px}}Videos and exclusive discounts on tickets to your favorite shows © 2025 - Copyright Wisdom Digital Media, all rights reserved. Privacy Policy A photo of a vandalized airplane hangar at North Adams Airport shortly after its unsanctioned demolition in December of 2020 a jury awarded no damages in a civil trial that concerned this hangar and a legal personal and commercial dispute between the hangar's former co-owners On Thursday, Judge John Agostini dismissed the legal claim of voluntary waste in a civil trial between to parties over the destruction of the hangar.  PITTSFIELD — A jury has decided the North Adams Airport dispute is a draw On Thursday, the jury in a civil trial in Berkshire Superior Court — featuring counterclaims between Derek Rougeau Jackie Rougeau and Dodd Rougeau on one side and Michael Milazzo and Brian Doyle on the other — chose not to award damages to any of the involved parties At issue was a vandalized hangar which Milazzo and Doyle allegedly demolished without a permit in 2020 Judge John Agostini also dismissed the Rougeaus' legal claim of voluntary waste — that someone has intentionally damaged or destroyed property reducing its value — regarding the hangar because he felt he couldn't rule on it in the context of the suit and the Rougeaus followed with a counterclaim.  Testimony during the trial examined who used the excavator to damage the hangar thanked the jury for their work on the weekslong trial which was the culmination of years of personal and professional drama between the two parties “we don’t agree with everything in the verdict.” “We also respectfully disagree with the trial judge inasmuch as he dismissed several claims that we believe had relatively strong legal and factual merit without putting them to the jury to decide,” Hamdan told The Eagle on Thursday “This included the claim for damage to the hangar.” told The Eagle on Thursday that he feels the judge’s dismissal of the hangar claim means the Rougeaus “don’t have a claim period” as to Doyle and Milazzo being the culprits of the vandalized hangar “The evidence shows a campaign of intimidation and harassment by the Rougeau brothers against Mr Doyle to drive them both out of the hangar and destroy their business,” Smith said Milazzo and Doyle are glad to be able to move on from this and get back to work to move on from this whole chapter," Smith said.  While the jury portion of the trial is concluded Agostini will adjudicate the rest of the case Remaining claims concern financial contribution breach of contract and unfair and deceptive acts Hamdan said the Rougeaus are considering appealing but can’t until Agostini rules on the rest of the case One of the men who was implicated in an investigation into how the hangar was destroyed in late 2020 is the lone applicant to lease the renovated hangar Rebuilding the hangar took hundreds of thousands of federal The post “Monster gobbler taken during youth season” first appeared on MS-Sportsman.com This page is available to subscribers. Click here to sign in or get access. Louisiana’s 2025 turkey season begins March 29 for youth/physically challenged Walker High School Fishing Team member Hunter Holland wants to complete his four-year run as a high school bass angler on a high note.[…] aromatic spices from across the globe.[…] Louisiana sportsmen get a bonus opportunity to hunt squirrels during the spring season that runs May 3-25 with a daily limit of three.[…] ©2025 Louisiana Sportsman, Inc., All Rights Reserved. Employee Information "The fanship in each community definitely thinks that their community has the most intense fans," says Conshohocken's Liselle Milazzo "But fans of teams like the Eagles and the Bills tend to take things to more of an extreme." Fandom expert Liselle Milazzo from Penn State’s Abington campus shares her insights into Eagles fans ahead of the Super Bowl (photos via Penn State Abington and Getty Images) I first have to ask how on earth someone chooses fandom as their area of expertise I grew up surrounded by the Buffalo Bills fan community because my dad is a proud Buffalo Bills fan And then I developed a fanship for Harry Potter in my teens participating heavily in that fan community visiting sites I saw in pictures in the books And I realized there is a whole world out there of people who are fans of all sorts of things I originally studied the fan communities surrounding Harry Potter And I started studying the fan community surround the Eagles when I moved here in 2023 The Eagles have such a vibrant fan community and once Penn State formally approves my study I look forward to actively recruiting research participants What are commonalities among all these different fan communities People make small to major changes in lifestyle this might mean restructuring your Sundays come football season so that you have time to watch the games Maybe you are suddenly inviting friends over who you wouldn’t normally invite to your home but you will during the season because they are Eagles fans maybe changing your financials so you can afford tickets to games This is actually quite common in fan communities Fans will have objects of interest on display These objects can remind them that they are part of that community A lot of people get a lot of pleasure sharing the same fan interest You might have these social interactions around the water cooler or in a Facebook group or a group chat One other interesting thing about all of these fan communities is that people don’t always have the same level of interest throughout their lives Then you might have fans who watched a few games this season but are now really enthusiastic and excited because of how well the team has done Maybe they are suddenly listening to sports talk on 94.1 when they never would have done that before I think you’re actually pointing to yet another commonality between fan communities when you bring up the diehard versus casual fan some criticism coming from diehard fans of anything when there are all of a sudden newbies joining the pack There are people who feel like they’ve borne all the losses So they can see themselves as the “true fans,” but there is also pushback to that narrative And I think particularly when you have a big celebratory event like the Super Bowl we see more welcoming narratives celebrating our shared identity We like to think that Eagles fans are somehow special or do people in most cities with NFL football teams think the same of their team’s fans The fanship in each community definitely thinks that their community has the most intense fans But fans of teams like the Eagles and the Bills tend to take things to more of an extreme fans like to jump up and down on tables at the local bars until they break Rooting for a team creates a connection between the fan and the team Some academics would use the word “parasocial” to describe this fan-team relationship But there is this relationship between the individual and the thing they are rooting for It feels like an extension of identity when they win a validation of our emotional and financial investment you could go to any park and watch kids playing football and come away with the same feeling I get invited to Eagles games a fair amount I’d just rather watch with diehard fans at a neighborhood bar and all scream at the TV together What’s with these people who are refinancing their houses so they can go to the Super Bowl Some people have a different desire of intensity for that external involvement we spoke about earlier Some people see being at the Super Bowl itself as an act of communitas spontaneous feeling of closeness among other people going through the same experience The sense of closeness is replicable at homes and bars but when you’re at an event as big as the Super Bowl you will all have this intangible memory of this shared cultural experience “I was at the Super Bowl!” And that can come with some social cache within the fan community It can also serve as a badge of honor that you were such a devoted fan that you were willing to go to whatever lengths to get to the Super Bowl And those of us who don’t make it to the Super Bowl, we just run out into the streets in this crazed, spontaneous celebration We need to have that special feeling of closeness there comes this theory of places of memory that’s applied to monuments and museums and historical sites I’m starting to see that there are also newly created places of memory tied to fanship Having a spontaneous celebration on Broad Street creates a new place of memory you will be able to immediately pull up that night And you’ve only been in Philly for a couple of years I can’t wait to go down to Broad Street Sunday night 19 Things You Didn’t Know You Could Do at the Library 30 Must-Visit Pennsylvania State Historical Markers The Grammy Awards: A Philadelphia Timeline of Winners and Memorable Moments Inspired by the life story of entrepreneur and inventor Joy Mangano the musical features music and lyrics by AnnMarie Milazzo AnnMarie Milazzo is releasing a concept album of her musical Joy inspired by the life of entrepreneur and inventor Joy Mangano. The Shape of Things: Songs From Joy the Musical will release January 17 via Joy Machine Records Get a first listen to the album's title track Pre-order and pre-save the album here “Making this record was an opportunity for me to get back to my roots in the recording studio working with my band and doing the thing I love most—writing and singing songs,” says Milazzo in a statement The album was recorded and mixed at Renaissance Studio in NYC The music video features videography by Harry McFann The project sees Davenport and Milazzo stepping into new career areas Davenport is a Tony-winning Broadway producer noted for his work on the 2017 revival of Once On This Island He previously co-wrote (with The Grundleshotz) the book to 2018's short-lived Gettin' the Band Back Together Milazzo is best known as a vocal arranger and orchestrator including on Davenport-produced projects Spring Awakening Take a look at the full track listing below: 1. "Welcome to My World"2. "The Shape of Things"3. "I Got People"4. "Out of Here"5. "The Only Mop You'll Ever Need"6. "We Sell Stories" (with The Doo Wop Project)7. "Walk With Me" (with Drew Gehling)8 Visit JoyTheMusical.com. Brought to you by Playbill Partner Hotels. Gail Kriegel's new play follows a family affected by mental illness. The Tony-winning Best Musical continues at the Walter Kerr Theatre. Noah Himmelstein will direct Matthew Puckett's original musical. Neumann is the Tony nominated choreographer behind Hadestown and Swept Away. Finalists included Cole Escola's Oh, Mary! and Itamar Moses's The Ally. The world premiere opera, based on a play by Gerber, is the second opera by Nottage and Gordon. In the Sondheim revue, one Tony winner is playing the trumpet while the other is channeling Mama Rose. The George Abbott, Douglas Wallop, Jerry Ross, and Richard Adler musical opened May 5, 1955. Thank You!You have now been added to the list. Blocking belongson the stage,not on websites. Our website is made possible bydisplaying online advertisements to our visitors. Please consider supporting us bywhitelisting playbill.com with your ad blocker.Thank you! Follow MLS Multiplex on X (Twitter). Her time with the Chicago Red Stars showed her ability to stand out in one of the most demanding positions in the game She played a total of 1,133 minutes last season alone emphasized the significance of her arrival: “Tatumn is an excellent defender who earned several individual accolades for her achievements with Chicago We’re excited to welcome her to the club and look forward to seeing her impact on and off the field.” Milazzo has peculiarities that distinguish her: combative and with the rare ability to lift the level of the defensive unit performance Milazzo's stats rank her as one of the most reliable players in the NWSL having gathered 70 league appearances between playoff and NWSL Challenge Cup important games She had managed to amass 171 tackles and 115 interceptions in that period with four goals to show she could be effective in front of goal if called upon Her first professional goal arrived in 2021 with a real screamer against OL Reign she made three playoff appearances to advance the Chicago Red Stars to the final in which they lost 2-1 to the Washington Spirit What makes Milazzo's career even more impressive is her resilience she played for the University of South Carolina where she won three Southeastern Conference titles and helped her team reach the 2017 College Cup semifinals But a torn ACL cut her senior season short After surgery and months of rehabilitation she joined the Chicago Red Stars' preseason roster and she made her professional debut in an NWSL Challenge Cup match coming on in the 87th minute of a 0-0 draw © 2025 Minute Media - All Rights Reserved The content on this site is for entertainment and educational purposes only Betting and gambling content is intended for individuals 21+ and is based on individual commentators' opinions and not that of Minute Media or its affiliates and related brands All picks and predictions are suggestions only and not a guarantee of success or profit If you or someone you know has a gambling problem crisis counseling and referral services can be accessed by calling 1-800-GAMBLER Follow MLS Multiplex on X (Twitter). The experienced defender joins after four standout seasons with Chicago Red Stars Please select what you would like included for printing: Copy the text below and then paste that into your favorite email application Louisiana to the late Charles Vincent Baglio and Alex Milazzo (Rachel); great-grandchildren and Jack Milazzo; his brother Freddie Baglio and his wife Cynthia; sister Ann Powell and her husband Lisa Baglio Cullop (Shannon) and Rebecca; and sister-in-law Phyllis Guzzardo and her husband Margaret Ann Micele Baglio; and daughter Marcie Carona; and nephew affectionately known as "Coach Bags," left an indelible mark on the world of sports and education beginning with an impressive 34 years at Independence High School where he served as head coach for 22 years Coach Bags led his team to nine district titles and two state championship appearances but his greatest pride was in mentoring and shaping the young athletes who looked up to him Baglio joined the LSU Tigers as Director of External Relations where he played a key role through three head coaches Known for his sharp mind and competitive spirit Coach Bags also enjoyed an active retirement leaving behind a legacy of inspiration and excellence and great-grandchildren were his pride and joy but his impact will be felt for generations to come Relatives and friends are invited to attend the visitation at Harry McKneely & Son Funeral Home in Hammond The visitation will continue the following day beginning at 9:00 AM until the funeral mass begins at 11:00 AM.  Interment will follow in Colonial Cemetery Harry McKneely & Son Funeral Home and Crematory-Hammond Enter your phone number above to have directions sent via text This site is protected by reCAPTCHA and the Google Privacy Policy and Terms of Service apply Service map data © OpenStreetMap contributors Planes sit on the airfield and runway in October at the Harriman-and-West Airport in North Adams the city's Airport Commission rescinded its decision to award a hangar lease to Michael Milazzo The North Adams Airport Commission rescinded its decision to award Michael Milazzo a lease for a refurbished Northeast Hangar at Harriman-and-West Airport The hangar is the building with the red trim behind the one with the blue roof The interior of a hangar at Harriman-and-West Airport in North Adams was damaged by vandals in late 2020 A 2021 police report named Michael Milazzo as one of the suspects in the incident — but no charges were filed the city Airport Commission rescinded its decision to lease the refurbished hangar to Milazzo A sign marks the entrance of Harriman-and-West Airport in North Adams.  NORTH ADAMS — In October, members of the city's Airport Commission agreed in principle to award a hangar lease to Michael Milazzo During a contentious special meeting Thursday evening the commission appointed a new chair — Jim Haskins — and rescinded its vote to lease the newly refurbished Northeast Hangar to Milazzo and agreed to reissue a request for proposals for the hangar in the future Robert Grandchamp was the lone commissioner not to change his vote The commission ultimately fell in line with Mayor Jennifer Macksey’s recommendation to rescind the lease award to Milazzo who had to be told not to speak out of turn after repeatedly interrupting the meeting to make his displeasure known He had been poised to open a business in the newly renovated hangar at the city-owned Harriman-and-West Airport but the need for those renovations are at the heart of concerns about the commission's decision to grant him the lease Milazzo was the subject of a 2021 police report alleging he and associate Brian Doyle vandalized the hangar with Milazzo’s excavator What resulted was a yearslong rebuild of the hangar using city and the city’s official stance is that it’s still unclear how the hangar was destroyed The hangar's former co-owners remain in litigation with Milazzo and Doyle regarding the damage “I believe each of you have an obligation to try to do the best thing for each taxpayer of the city of North Adams and not the biased thought process of Mayor Macksey,” Milazzo said to commissioners before they voted Thursday “Airport commissions must be free to manage the airport as they see fit without interference from any city administrator.” Former commission Chair Marc Morandi resigned from his position soon after the October meeting at which he was the lone vote against awarding the lease to Milazzo In a letter sent to the commission in October Macksey cited as a "procedural defect" the commission's decision to award the lease despite recommendations to the contrary by a committee it established to review the matter — and it did not provide justification for that decision.  Special Assistant to the Mayor Katherine Eade read a memo to the commission Thursday night from city Procurement Officer Stacy Abuisi “The single proposal identified conditions that would require modifications to the leases but hadn’t specified what they were,” Abuisi wrote and the RFP should be reworked and put out again at a future date.” the airport will begin renting out space in the hangar to people on a wait list to store their aircrafts Airport Manager Bruce Goff said he doesn’t want to kick out any tenants until they have elsewhere to go meaning the RFP and getting more activity in the space may have to wait longer than the city/commission hopes for The city is in the process of rebuilding/refurbishing the hangar A police report shines light on the story behind the damage the feud between four former hangar co-owners and why the city is footing part of the bill.  EDITORIAL: While the letter of the charter says Mayor Macksey does not need councilors' consent on appointments the spirit of good governance suggests she should still avail herself of their advice Get up-to-the-minute news sent straight to your device.