2025) – Utah Royals FC announces defender Tatumn Milazzo has been placed on the season-ending injury list
Milazzo suffered a torn ACL in training on March 21 and has since undergone successful surgery
She will work closely with the Utah Royals medical staff during her recovery
Milazzo was on track to make her Royals debut after recovering from a preseason knock
she was tipped to be a prominent part of the Royals defense this season
The Royals’ next home match is on Friday, April 11 against Portland Thorns, with kickoff at America First Field at 8:00 p.m. MT. Tickets are available at https://www.rsl.com/utahroyals/tickets/
Javascript must be enabled for the correct page display
College of Arts and Sciences
Reverend Forrest Pritchett Honored at SRTF Signature Event
Physician Assistant Graduate Leads with Advocacy and Service
Renovation for New Innovation Hub in Walsh Library
Charter Day: Honoring Service and St. Elizabeth Ann Seton
Chief Judge Michael A. Chagares' 87 Named Keynote Speaker
NY to the late Anna and Joseph Salvatore Milazzo
He was in the graduating class of 1952 at Brooklyn Tech High School
Salvatore began working for Bell Atlantic in Manhattan
moving up the ranks throughout the years and finally retiring as Assistant Vice President
He served his country honorably in the US Army during the Korean War
He served as councilman and police commissioner for Matawan
Salvatore enjoyed spending time with his family
and his brothers Stephen Edward Milazzo and Joseph Robert Milazzo
Surviving is his loving wife JoAnn Milazzo
his children Deborah Milazzo Battaglia of LA
A committal service will be offered on Saturday
January 18 at 12 noon at Holmdel Cemetery & Mausoleum
The family would also like to invite friends to join them at the 4:30pm Mass at St
In lieu of traditional remembrances, Salvatore’s family asks with gratitude that donations in his memory be made to the Wounded Warrior Project (www.WoundedWarriorProject.org)
For messages of condolences, or to share a favorite memory of Salvatore, please visit his page of tribute at www.HolmdelFuneralHome.com
Your name will appear next to the candle you light.Your condolence may need to be approved before it appears on this page
It may not appear immediately once submitted
Upload attachment (Allowed file types: jpg
and website in this browser for the next time I comment
Δdocument.getElementById( "ak_js_1" ).setAttribute( "value"
It looks as though you’ve already said that!' + '
Your condolence may need to be approved before it appears on this page
Thank you for leaving a condolence..Your comment has been submitted for moderation
Salvatore Joseph Milazzo, 92, of Freehold, died on Monday, January 13. Salvatore was born and raised in Queens, NY to the late Anna and Joseph Salvatore Milazzo. He was in the graduating class of 1952 at Brooklyn Tech High School. After high school, Salvatore began working for Bell Atlantic in Manhattan, moving up the ranks … Read More
Δdocument.getElementById( "ak_js_2" ).setAttribute( "value"
Designed and produced by ©document.write(new Date().getFullYear()); MKJ Marketing|Privacy Policy|Sitemap
This website is using a security service to protect itself from online attacks
The action you just performed triggered the security solution
There are several actions that could trigger this block including submitting a certain word or phrase
You can email the site owner to let them know you were blocked
Please include what you were doing when this page came up and the Cloudflare Ray ID found at the bottom of this page
The son of Frank Milazzo and Nancy Lehman was born on February 25
He was the owner/operator of Tre Sorelle Junior Golf Academy
formerly known as Hudson Valley Junior Golf Academy
where he was able to pass on his passion of the game to countless children and young adults over the years
He was also an avid fisherman and loved to follow the Mets and the GreenBay Packers
Raymond is survived by his wife Janna and his three daughters
and Jessica; his sister Dody and her husband Al; his sister Barbara and her husband Scott; and his brother Frank and his partner Deb
He is also survived by several nieces and nephews: Alexander
as well as several great-nieces and nephews
Raymond was predeceased by his mother Nancy Wilhelm
A memorial service will be announced at a later date
Funeral arrangements are honorably entrusted to Zygmunt-Murtie Funeral and Cremation Service (845-477-8240 or zmmemorials.com)
The concept album for the new musical will be released in January
Grammy and Tony Award nominee AnnMarie Milazzo announced the upcoming release of a new concept album, “The Shape of Things: Songs From Joy The Musical.” As the title suggests, the record, which will be released on Jan. 17 by Joy Machine Records, will include a selection of songs from the musical that is currently in development
Milazzo also released a music video of the album’s title track
with production by Sonny Paladino and music supervision by Andy Einhorn
“The Shape of Things” offers a glimpse at “Joy,” a biographical musical about the life of Joy Mangano
the entrepreneur and inventor behind the Miracle Mop
Milazzo has previously provided vocal arrangements for Broadway shows such as “Spring Awakening,” “Next to Normal” and “If/Then” as well as orchestrations for the 2017 revival of “Once on This Island”and vocal design for “Almost Famous” and “A Beautiful Noise.” She is also developing a stage musical based on Amy Bloom’s novel “Lucky Us,” in collaboration with 16-time Grammy Award winner David Foster
“Making this record was an opportunity for me to get back to my roots in the recording studio
working with my band and doing the thing I love most — writing and singing songs,” Milazzo said in a statement
“Joy” has been in development with a book by Tony Award-winning producer Ken Davenport and music direction by Paladino
Editor’s note: This eulogy was written and read at the funeral of Dr
who was a registered nurse at Brooks Memorial Hospital from 1973 to 2007
It was my privilege to have worked with Dr
Richard Milazzo over these many years and over many patients
It is my honor to tell you this story of a true hero in the medical profession and in life itself
It was the summer of 1973 and the city of Dunkirk — especially Brooks Memorial Hospital — were anticipating the arrival of the newest member of its medical staff
For months “the talk of the town” centered around the new doctor setting up his office and opening his practice
His reputation preceded him … he was smart
had been the Chief Resident at Meyer Memorial Hospital in Internal Medicine … and was the son of “OLD” Dr
a well-known practicing urologist in the community
The locals were beside themselves and in an unheard of event “Young Milazzo” hung his “shingle” out with a practice that was booked solid from day one and beyond
Milazzo earned his reputation as a great doctor from the minute he walked in the hospital
Not only did he have office hours four days a week
but a full schedule seeing his medical/surgical inpatients on two floors each split into sections: 2A
3B; there were also patients to care for in the four-bed Intensive Care Unit; in addition
he was also required to take turns with his fellow Internal Medicine colleagues
covering a two-week rotation as “Medical Doctor on Call” in the ER
Being medical on call often meant having to leave patients in the office to run to the ER to treat a very sick patient
there was no actual doctor in the ER; the ER nurses evaluated the patient and hunted down the patient’s doctor for orders to treat until he got to the ER
This left office patients backed up until late afternoon and into early evening
Then there were evening rounds to check on hospital patients again before finally heading home…But WAIT
There’s a patient for you to see that’s a possible admission
It is little wonder that this punishing pace wore “Young Milazzo” down
The winter and flu season were especially punishing
and looked like he could use a bed in the hospital
Yes,on rare occasions he was so sick he HAD to stay home
and there was no one left to care for the patients
In 1973 it was a four-bed unit … pretty small … but some of the magic that was worked in that unit was amazing
He was not only a great doctor to his patients
but treated the nursing staff with a level of respect we had never experienced
explaining procedures and the “whys” of treatment in ways that were easy to understand and apply to everyday patient care
He knew how hard we worked and was always quick to give us an appreciative word of confidence
He enriched our professional lives in wonderful ways and lifted each of us up individually and personally
No question we asked him was considered unimportant
He was funny and could always make a patient .
Rich would guide the development of a new 10-bed ICU
Milazzo was always willing to help us … his specialty was Internal Medicine but if we were desperate for help in the ER
and he just happened to be in the hospital
Milazzo was paged STAT to the ER he never called to inquire about the patient
he just showed up to help for whatever the emergency happened to be
a patient arrived who was having a heart attack
He did not have a doctor and it was my job to get him one
I was supposed to follow the medical on call schedule
I knew Rich was the best guy for the job so I paged him STAT to the ER
took one look at the semi-responsive patient and said: “Are you sure he’s a patient of mine?” I crossed my fingers and said: “All I can say is his last words were “Call Milazzo!” so I guess he’s your patient now!”
Rich just shook his head and went to work caring for the patient who ended up in ICU
he used to shake his head a lot when I took care of his patients
he asked me how I thought of doing these things
What is the best thing I can do for this patient
That’s why I call YOU!” We remembered that story and laughed about it when we had breakfast after Mass last Sunday (Sept
no matter the patient’s age or problem
One day I called him for help in the ER … an 8-month old patient was in trouble
Rich looked like he was going to fall over when he saw the little infant on the cart … but he stayed with us and talked with the baby’s doctor to get him to come in to care for the child
Another time in ICU he got the desperate call from me again
I had a young 25-year-old patient who had been sick for a long time
His surgeon had left the hospital for home
I was flushing his stomach with ice water to hopefully stop the bleeding but it was not helping
I was never so happy to see anyone in my life than Rich Milazzo when he walked in and assessed the situation with me
The patient’s doctor was notified again and again
God love Rich…he hung in there with me for at least 1 ½ hours until the surgeon finally showed up and the patient was taken directly to surgery
One day in the ER I needed to talk with him about a patient of his
The ER doctor had seen him and wanted to admit him
This was before the days of cell phones…Rich had a beeper
I paged him and left a message to call me in the ER
No response…15 minutes later I beeped him again: “Rich
call me!” No response…beeped him again: “Rich…don’t make me come and hunt you down!” Literally 5 seconds later he calls laughing hysterically along with the nurses in ICU
He said: “I didn’t answer because I just wanted to hear what you were going to say in your next message!” He had such a great sense of humor
it’s time to reveal his all time favorite sport … bike riding
And ride and ride he did … everywhere
peddling locally and way beyond for over 50 years
traveling through most of Chautauqua County
Most of the doctors had a parking spot at the hospital
Rich had a bike rack at the bottom of the ER ramp
When the weather was bad he’d park it inside the hospital
rode what became the First “Bicycle Tour de Chautauqua” to the Hotel Lenhart in Bemus Point
They had such a good time the boys were joined in 1974 by Dr
Rich Goodman and Steve Warner for a longer “tour.” One hundred miles was the limit per day
The bikers were on their way to Salamanca … they could not ride from Jamestown to Salamanca on Interstate 86 so they took old Route 17 which was officially closed to traffic through the reservation
There were ruts and gaps in old pavement sections
Milazzo’s front wheel got caught in one of them and sent him flying
He was unable to ride the distance to Salamanca
loaded him and his bike in their patrol truck and took him to Salamanca General Hospital where he was stitched up by Dr
considering the bikers were trespassing on posted land
Best part of the story is that Rich recovered to ride again
Rich had many other talents…and they were NOT hidden!
composer of his own original song accompanied by hysterically funny lyrics (“Bob’s Buns”)
Elizabeth Ann Seton choir for years “after Maureen roped me into singing at the Christmas Eve Mass
and then bailed on me!” Pressed into service at a family talent night number
Rich was dressed up to play the part of Dr
he played his part perfectly and had everyone rolling in the isles with laughter
Rich Milazzo was not “just” a doctor to his patients
then my Mom’s and then my Dad’s
and one day asked if she could “adopt” him
said “of course.” From that day on Rich became Mom’s “son,” and as a result
She was so proud to have a doctor in the family and always introduced him as “my son
the doctor!” Rich treated her like a queen
When I took Mom for her checkups she would always ask Rich if he noticed anything “new and different” about her
He knew what was coming and always played along
Mom would pretend to be all upset that he didn’t notice her efforts…”What do you mean you can’t tell
I dressed up and put a bra on for my visit today!” He came to birthday parties
At one of the picnics I told him to look around to see if anything looked familiar
All of these people are your patients!!”
He probably had half of Dunkirk-Fredonia in his office at one time or another
some of his patients refused to see anyone else in his absence…even to their own detriment
One day I triaged a patient I knew very well
I asked why she waited so long to get help…she said she didn’t like the doctor she was supposed to go to and thought she could hold out until Rich returned
I said: “He’s not due back for a week!” She recovered
The many acts of kindness and instances where Rich went “over and above” are legendary … stories of figuring out what was wrong with a patient that no one else was able to do
checking a patient and finding just the slightest abnormality that led to discovering a serious condition and eventually a cure
No one will ever know all he did to help others … and he would never want us to know … but God does … and He has everyone of them written in His book … the home visits
the house calls he made out of the blue and from the goodness of his heart
the stops to dying patients to comfort and encourage them
or to just hold their hand for one last time
I know first hand about two of those last visits because they were to my Mom and Dad
Rich’s generosity to others also extended itself outside of the United States
He once made a trip to Honduras to bring medical care and medicine to those with nothing
God is good and we were blessed to get him back home safe and sound
over the top happiness and at times heartbreakingly painful difficulties
I thank God for His everlasting Presence in our lives and His great gift of FAITH to believe in things we cannot see or humanly comprehend
I’ve always believed that God puts us with the people He wants us to be with
according to the Plan He has for each of us
I thank God every day for blessing us with 80 years worth of the presence and goodness of Rich Milazzo in our lives
Having been raised above the McGraw Funeral Home
you come…your life’s work is over and all the “treasure” you can take is the love you gave and your good works performed on earth
I have no doubt God was there to help Rich carry all of his
There’s a stampede to Heaven’s Gate
Peter has to stand aside to avoid getting trampled
They are all fighting over who will be the FIRST to hug him and welcome him to his Heavenly Home…this day receiving his eternal reward for his steadfast faith and all the good he has done on earth
Copyright © 2025 Ogden Newspapers of New York
| https://www.observertoday.com | PO Box 391
A sign marks the entrance of Harriman-and-West Airport in North Adams
An attempt by Jennifer Macksey to appoint a new member to the embattled North Adams Airport Commission stalled on Tuesday
The Harriman-and-West Airport hangar saga arrived at North Adams City Council Tuesday
as Michael Milazzo and City Councilor Peter Breen questioned Mayor Jennifer Macksey's decisions
NORTH ADAMS — Airport Commission drama spilled over into City Council Chambers on Tuesday
Michael Milazzo — the man who, in 2020, allegedly vandalized a hangar he used to occupy at Harriman-and-West Airport — brought a lawyer to the City Council meeting to express his dismay over his bid for the hangar being accepted
After a stunning vote in October where the Airport Commission accepted Milazzo’s bid for the hangar — despite the fact he may have been responsible for the yearslong
state and city money — the commission later walked back its decision
Two members of the commission resigned as a result of the controversy.
were at the forefront of the monthslong drama
and took precedence during the council meeting
when Milazzo and Macksey got into a heated exchange over her role in the commission's ultimate decision.
Members of the public were able to comment on Macksey’s new appointment of Doug Herrick to the commission
which has been put on hold until the city solicitor issues an opinion on whether City Council has to confirm the appointment
Milazzo and his lawyer said Macksey's dealings with commission members included an ultimatum: rescind the hangar vote
While Macksey refrained from entering a “shouting match” during the meeting
she disputed Milazzo’s declarations after the fact
The perceived flaws in process were enough for councilor Peter Breen to call for an investigation into former Airport Commissioner Michael McCarron’s resignation and what
the latter of whom was originally the lone vote against awarding Milazzo the hangar lease
both resigned from the commission following the fallout of the hangar debate last year.
After the commission had originally accepted Milazzo’s hangar bid
sending a letter to the commission citing a "procedural defect" in its decision to award the lease despite recommendations to the contrary by a committee it established to review the matter.
Macksey argued in her letter that the commission should not be choosing sides in ongoing litigation that directly pertains to the lease
The city also was disappointed with the fact that its initial request for proposals received only one response: Milazzo's
Shortly after receiving the mayor’s letter, McCarron resigned “due to conflicts of interest outside of the commission, and the stress and anxiety from the pressure coming from city officials to influence my decisions while on the commission,” according to his resignation letter, obtained by The Eagle
the commission rescinded its decision to award the lease to Milazzo
Milazzo’s attorney Ryan Smith told City Council members on Tuesday that he conducted his own investigation into the matter of McCarron's resignation
as well as "conduct of certain city officials." He then went on to ask the council to conduct its own investigation into why
Smith and Milazzo claimed that the city overstepped
“The two commissioners that have already resigned were told
‘You either vote the way we want you to vote
Macksey interrupted to vehemently deny this claim
At the moment there is no evidence to support his assertions
Morandi in particular had been opposed to Milazzo’s application from the beginning
Macksey said she met with commissioners individually and reiterated what she’d said in her letter: The requests for proposals process had flaws
and the commission created a review committee
then entirely ignored the committee’s conclusions
I would ask you to rescind,” Macksey said she told the commissioners
Macksey pushed back against the idea that if commissioners didn’t go along with her
they’d be forced to resign. To her point
commissioner Robert Grandchamp remained on the commission and did not change his vote from favoring Milazzo’s bid either time
remaining a steadfast "yes" before and after the letter from Macksey
“They resigned on their own accord,” she said of McCarron and Morandi.
Sten Spinella can be reached at sspinella@berkshireeagle.com or 860-853-0085
The city solicitor's opinion was a win for Mayor Jennifer Macksey
but she's still facing threats of legal action from Michael Milazzo
as he claims she forced commissioners sympathetic to him to resign rather than vote in favor of him leasing a hangar at the airport
Research from the city solicitor on an airport commission issue found that the city's charter does not require council approval
Two brick Victorian mansions that were condemned in 2017 now belong to the city
Sadie Jean Sworzen is not your average toddler
Two new billboards from local nonprofit Hoosic River Revival seek public input on the flood chute modification effort and HRR announces it has brought on an outside engineering firm to help parse the U.S
Savoy has postponed its annual town meeting from May 8 until sometime in June
as the town's finances are not yet in order
The annual town election will still be held on May 14
the state Department of Conservation and Recreation could soon expand its Savoy Mountain State Forest reach into Adams
Seeking his sixth term on the Select Board
incumbent Joe Nowak is being challenged by Jay Meczywor and Jerome Socolof
Your browser is out of date and potentially vulnerable to security risks.We recommend switching to one of the following browsers:
Get up-to-the-minute news sent straight to your device
USA; Chicago Red Stars defender Tatumn Milazzo (23) controls the ball against the NJ/NY Gotham FC during the first half at Red Bull Arena
made 17 appearances in 2024 for Chicago but those appearances didn’t turn into larger amounts of minutes as the season wore on
her numbers went down as the season progressed
The former South Carolina defender did manage 13 starts in 2024 while occupying both the left and right back spots for head coach Lorne Donaldson
Passing was where Milazzo struggled mightily in 2024 as she completed the lowest percentage of medium and long passes of her NWSL career, per fbref
Through all the struggles that she dealt with in 2024
Milazzo still provided an edge to a Red Stars team that didn’t have that in volume at any portion of the pitch
She still has value as an NWSL player even though she wasn’t put in positions throughout the 2024 season to prove that
The Orland Park native’s 2025 contract option was declined and she'll be a free agent for the first time in her career. Milazzo's ability to play all over the defensive backline should make her a popular target for NWSL clubs this offseason
Follow @soccer_ontap on X for more Chicago Stars FC news and updates!
the Chicago Cubs rebounded in a big way with a 9-2 win over the San Francisco Giants in the first game of the series
and Justin Thomas headline the 72-player field at Philadelphia Cricket Club's Wissahickon Course in Flourtown
but fans classifying him as a tight end is not the proper way to forecast his role in Ben Johnson's offense
RHP Gavin Hollowell will take Imanaga's place on the active roster
Don't miss these special Sundays during the White Sox's 125th season celebration
2025) - Utah Royals FC announces the signing of free agent Tatumn Milazzo
The defender most recently appeared for NWSL side Chicago Stars FC
Milazzo has signed a two year deal with URFC locking her in through the 2026 season
joins URFC after four seasons with the Chicago Stars FC
The Illinois native center back logged 1,133 minutes throughout 17 matches in her fourth year with her home club last year
Milazzo has 70 career NWSL appearances including NWSL Challenge Cup and NWSL playoff matches with four career goals
"Tatumn is an excellent defender who has won various individual awards for her accomplishments with Chicago" said Sporting Director Kelly Cousins
"We are excited to welcome her to the club and are eager to see her impact on and off the field."
Milazzo scored her first professional goal on October 10
2021 scoring from outside the box against OL Reign in a 3-2 loss
Milazzo notched 14 appearances that included three playoff appearances as the Red Stars made a run to the NWSL championship before falling to Washington Spirit 2-1
After a 2 goal season in 22 regular season appearances in 2022
Milazzo signed a contract extension with the Red Stars through the 2024 season
The American would start in Chicago’s 2-1 extra time loss to San Diego Wave in the first round of the 2022 playoffs
Prior to signing as a professional with Chicago
Milazzo played four years at the University of South Carolina winning Southeastern Conference titles in 2016
In 2017 Milazzo helped the Gamecocks reach their first Women’s College cup appearance making the semi-finals before falling to Stanford
Milazzo played 80 matches and scored 3 goals as a Gamecock as her senior season was cut short after tearing her ACL
Milazzo made her comeback to soccer joining the Chicago Stars 2021 pre-season squad moving her way up to the supplemental roster two months later on April 5
Four days later Milazzo would make her professional debut in a NWSL Challenge Cup match subbing on in the 87th minute in a 0-0 draw
A doctor who had been a fixture in the Dunkirk-Fredonia community for decades has died
passed away unexpectedly on Tuesday afternoon after his car was struck by a tow truck in Wethersfield in Wyoming County
He stopped at the Hermitage Road intersection and started to cross the highway
Milazzo pulled into the path of a 2022 Ram tow truck driven southbound on Hermitage Road
Wyoming County sheriff’s deputies said
The tow truck struck his Subaru on the driver’s side door and both vehicles went off the roadway
He was pronounced dead at the scene by the county coroner
the primary care doctor had been treating patients in Dunkirk and Fredonia for 54 years
He graduated from State University of New York at Buffalo in 1969 and was affiliated with Brooks-TLC Hospital System
though he says it went deeper when it came time to choose what branch of medicine he would pursue
“I really like the intellectual challenges of internal medicine
where you basically cover all of the different specialties,” he said
Milazzo says he still studies and researches medical journals
“almost every night” to make sure he is continually offering the best care to his patients
“I have patients I have seen for more than 40 years,” he says
“I went into this because I wanted to help people
if I have a visit where I feel like I haven’t helped the person
I feel bad about it — that’s a wasted visit for me.”
Milazzo wasn’t ready to retire and was motivated to keep learning and keep serving his patients
“I have developed a lot of relationships with many of my patients,” he said with a laugh
“At least once a week I’ll have a patients say
‘don’t retire until I die,’ which I don’t know how to take that.”
Indulge in Broadway buzz like never before with "The Weekly Dose of Joel: Everything Broadway and More." This podcast, brought to you by the Broadway Podcast Network and Broadway Time, delivers the latest news, theater history, and exclusive interviews with Broadway stars, all in one podcast! Don't miss out on your front-row seat to the magic of Broadway!
© Broadway Podcast Network
The tan airplane hangar with red trim at the Harriman-and-West Airport that was completely rebuilt
A 2021 police report named two suspects for vandalizing the hangar — Brian Doyle and Michael Milazzo
Mayor Jennifer Macksey is requesting the Airport Commission rescind their decision to lease the hangar to Milazzo
Damage to the interior of a hangar at Harriman-and-West Airport in North Adams following vandalism in late 2020
A 2021 police report named two suspects — Brian Doyle and Michael Milazzo
Mayor Jennifer Macksey is requesting the Airport Commission rescind their decision to lease the now-rebuilt hangar to Milazzo
Mayor Jennifer Macksey's letter to the commission is a strong intervention from Macksey
who has mostly kept her distance from the issue of the Harriman-and-West Airport hangar — and Michael Milazzo's proposal after he allegedly caused the initial damage to the hanger — until this point
NORTH ADAMS — City Hall has taken exception to the Airport Commission’s decision last week to lease a newly rebuilt hangar to Michael Milazzo
In a letter sent to the commission on Monday
Mayor Jennifer Macksey urged the commission to rescind last week’s vote “based on procedural defects.”
Chair Marc Morandi clearly read into the record the recommendation of the review committee … which was to reject the sole proposal,” Macksey wrote
made it clear that she believes they made their decision without following proper procedure and fully considering Milazzo's application to lease the hangar
The letter to the commission is a strong intervention from Macksey
who has mostly kept her distance from the issue of the Harriman-and-West Airport hangar — and Milazzo's proposal after he allegedly caused the initial damage to the hangar — until this point
the commission put out a call for bids to lease the hangar.
The commission then accepted Milazzo's application against the recommendation of its own committee
consisting of two commission members and city officials Stacy Abuisi and Kathy Eade
he and Doyle would run an airplane maintenance business together in the refurbished hangar
the Office of the Inspector General's Procurement Hotline said the proposal was "conditional and should be rejected on that basis.”
“Because no board or commission of the City of North Adams should ignore recommendations of a committee established by it and especially should not disregard recommendations from the state agency entrusted with overseeing procurement issues
I respectfully request that this matter go back to the Commission for reconsideration,” Macksey writes
“This procedural failure requires remedy.”
The mayor contends that the commission should have deliberated over the OIG “rather than ignoring it,” discussed the committee’s recommendations
Macksey also weighed in on the possibility of leasing a brand new hangar to the people accused of causing extensive damage
saying that responsibility for the unsanctioned and unsafe partial demolition of the hangar “has never been ascertained.”
along with other individuals involved with the original hangar lease
are currently in litigation over responsibility for the damage,” Macksey writes.
The letter advises against taking action favoring one side over another given the context
Macksey said that after watching a recording of the commission meeting
it looked as if Milazzo lobbied commission members to award him the lease before the meeting
“To the extent any deliberations occurred outside of the Airport Commission meeting
this is a potential violation of the Open Meeting Law," Macksey said.
Milazzo has not responded to repeated requests for comment from The Eagle
Milazzo previously admitted he brought the excavator to the hangar and later removed it
but denies responsibility for carrying out the damage
Destruction to the hangar — blowing out one wall and causing major damage to three others — disabled the electrical system
Former hangar co-owners Derek and Jackie Rougeau have alleged to North Adams police and airport officials that their former business partners and hangar co-owners Doyle and Milazzo were responsible for the damage to the hangar
But nothing ever came of the 2021 police report
Interim Police Chief Mark Bailey said that because Milazzo and Doyle were co-owners of the hangar at the time
the police couldn’t charge them with destruction of property because they were destroying their own property
Quality local journalism needs your support
Access this story and all of our stories with 24/7 unlimited access
Subscribe now for 99¢
Subscriber Sign In | Return Home
but it comes after he was the lone "no" vote regarding a lease application for the airport's Northeast Hangar
North Adams Mayor Jennifer Macksey is attempting to change Morandi's mind
Despite efforts by the mayor to get him to change his mind
former North Adams Airport Commission Chair Marc Morandi's resignation is now official
forcing the group to recalibrate ahead of a major decision
the man accused of vandalizing a now-refurbished hangar at Harriman-and-West Airport
will not get to lease the same hangar after all
following intervention from the mayor and the commission chair's resignation
Michael McCarron resigned late November 2024 "due to conflicts of interest outside of the commission
and the stress and anxiety from the pressure coming from city officials to influence my decisions while on the commission."
Damage to a hangar at Harriman-and-West Airport in North Adams
Milazzo and Doyle are facing off against Derek Rougeau
Dodd Rougeau and Jackie Rougeau in a civil trial
part of which concerns how the hangar was vandalized
Damage to the interior of a hangar at Harriman-and-West Airport in North Adams following vandalism in late 2020.
a civil trial concerning a vandalized hangar at North Adams Airport raged on all week
NORTH ADAMS — A yearslong feud between partners who once owned an airplane hangar together is culminating this week in Berkshire Superior Court
Jackie Rougeau and Dodd Rougeau on one side
and Michael Milazzo and Brian Doyle on the other
The Rougeaus bought the hangar at Harriman-and-West Airport in 2002
and they used it for their aircraft maintenance business
the partnership had deteriorated to the point that Milazzo and Doyle sued the Rougeaus
and the Rougeaus followed with a counterclaim
the airport hangar at Harriman-and-West Airport was damaged with an excavator owned by Milazzo
which resulted in a $750,000 rebuild funded through federal
Derek and Jackie Rougeau say Doyle and Milazzo damaged the hangar
testimony has examined who used an excavator to damage the hangar and why Harriman-and-West Airport management — be it the airport manager or members of the Airport Commission — never addressed the ongoing issues cropping up on its premises between the two sides
The civil trial before a jury got underway Feb
18 with lawyers for Doyle and Milazzo presenting their case first. Doyle
Lawyers for Doyle and Milazzo say the animosity between both parties started with an alleged affair between Doyle and Jackie Rougeau in 2017. The lawyers have painted the prospect that this is what started Derek Rougeau
and his brother Dodd Rougeau harassing their clients
Smith showed video of the Rougeaus removing materials from the hangar
but did not produce evidence supporting their contention that someone other than Milazzo or Doyle destroyed the hangar with an excavator
The lawyers then contended the Rougeaus removed floor grates
Derek Rougeau testified that he nailed the doors shut because he was responding to hangar doors inexplicably being left open at night
Milazzo testified at length about the Rougeaus’ activity at the hangar
before and after the hangar was damaged on Dec
But Milazzo acknowledged that he had no proof that someone else had taken his excavator and used it to damage the hangar
cast doubt on Milazzo’s narrative that Doyle arrived the morning of Dec
Milazzo testified that he brought his excavator to the hangar following an eviction notice from the city in October 2020
all parties had stopped making payments on the property
Milazzo said he began an effort to obtain a demolition permit and was attempting to buy the hangar himself
Milazzo contended it would take about six months to get the permit and demolish the hangar
He said he told the city’s building inspector in frustration that they likely won’t get the whole building because the Rougeaus were in the process of slowly dismantling it
Milazzo said he was surprised to find his excavator parked outside when he arrived on Dec
“Somebody had run the excavator and damaged the building,” Milazzo said
He said he had left his keys to the excavator in its cupholder
Milazzo said he did not call the police because of past incidents in which he said police said they were powerless to hold owners of a property responsible for damaging it
Asked directly by his attorney whether he demolished the hangar without a permit
Milazzo was asked how he planned to remove the excavator since it was parked inside the hangar behind a bifold door
The excavator was driven through a wall and parked outside
Milazzo had brought the excavator to the hangar expressly for demolition
but he didn’t use it for the demolition that occurred
he described how the 80-foot bifold door had been pulled and broken and heating tubes were hanging from the ceiling
Rougeau reported the damage to the city building inspector
left behind at the hangar in the days following the destruction that made lewd remarks about Jackie Rougeau
Derek Rougeau reported the damage to the city building inspector immediately
He had been working for weeks to secure a demolition permit and was one step away when the vandalism happened
The trial testimony is expected to conclude early this week
Then it will go to the jury to decide whether damages
Bruce Goff has resigned as manager of the Harriman-and-West Airport; neither he nor officials are saying why
the jury in a civil trial in Berkshire Superior Court chose not to award damages to any of the involved parties in the North Adams airport hangar dispute.
The tow truck struck his Subaru on the driver’s side door and both vehicles went off the road
Brooks-TLC officials expressed they were “saddened” to hear the news
“If there was ever a doctor who emulated ‘commitment to community,’ it was Dr
Milazzo was a well-respected physician in the Dunkirk-Fredonia community – treating patients for over 50 years
He had an amazing tenure at Brooks Hospital as a colleague and friend
Milazzo’s passing and will miss him more than words can express
chief medical officer at Brooks-TLC Hospital System called Milazzo a “truly great doctor and a very dear man
He made such a difference in the many lives that he touched
My thoughts and prayers are with his family.”
“At least once a week I’ll have a patient say
Metrics details
The conditions supporting the generation of microglia-like cells in the central nervous system (CNS) after transplantation of hematopoietic stem/progenitor cells (HSPC) have been studied to advance the treatment of neurodegenerative disorders
we explored the transplantation efficacy of different cell subsets and delivery routes with the goal of favoring the establishment of a stable and exclusive engraftment of HSPCs and their progeny in the CNS of female mice
we show that the CNS environment drives the expansion
distribution and myeloid differentiation of the locally transplanted cells towards a microglia-like phenotype
Intra-CNS transplantation of HSPCs engineered to overexpress TREM2 decreased neuroinflammation
Aβ aggregation and improved memory in 5xFAD female mice
Our proof of concept study demonstrates the therapeutic potential of HSPC gene therapy for Alzheimer’s disease
the benefit of the procedure is still limited by the slow pace and extent at which cell repopulation in different CNS regions occur
the mechanisms and the conditions favoring the engraftment and generation of microglia-like cells in the CNS have been extensively studied
we challenge further the standard hematopoietic transplantation paradigm by exploiting and combining different HSPC subsets differentially enriched in long-term hematopoietic reconstituting potential
and by exploring different cell-infusion routes to eventually favor the establishment of a robust and exclusive donor engraftment in the CNS of recipients
we unveil a key role exerted by the CNS environment in uniquely driving expansion
distribution and myeloid differentiation of the locally transplanted HSPCs towards a microglia-like phenotype
we then test the therapeutic potential of engineered HSPC transplantation in the CNS in an established murine model of Alzheimer’s disease (AD) obtaining a clear example of efficacy of HSPC gene therapy in an adult onset
and a proof of benefit associated with an innovative approach that determines a CNS-restricted engraftment of the genetically modified transplant progeny cells
BU-treated mice transplanted IV with ∆NGFR/Cherry Lin- cells were used as term of comparison
Source data (a–d) are provided as a Source Data file
f Representative laser scanning confocal microscope microphotographs of IF-stained brain sections from mice co-transplanted with Lin- both ICV and IV
at 90 days pTX [n = 5 slices from n = 3 mice]
ICV-derived cells (green signal) are stained with (e) anti-GFP antibody
IV-derived cells (red signal) with anti- ΔNGFR antibody
and (f) Iba1 for microglia cells (arrows indicate representative co-localizations of Iba1 and GFP/ΔNGFR signals)
Images were acquired at Leika SP2 confocal microscope
a Short-term HSPC biodistribution in the bone marrow (BM)
5 and 14 days post-transplant (pTX) in IV (black)
ICV (green) and ITL ( pink) transplanted mice as measured by flow cytometry [n = 3 mice/group across n = 2 experimental replicates]
2-way ANOVA followed by Tukey post-hoc test pTX (p* = 0.0351
Source data (a) are provided as a Source Data file
Distribution of GFP+ donor-derived cells analyzed at 14 days (b) and 30 days pTX (c) in the brain of representative IV
ICV or ITL transplanted mice (single transplantations) [n = 4 slices from n = 3 mice/group]
Images were acquired at 25x magnification using Leica SP5 confocal microscopy after tissues clearing
labeled with GFP (green signal) or with ΔNGFR/Cherry (blue signal)
in representative mice transplanted with Lin- HSPCs via ICV + IV or ITL + IV or IV only delivery (as indicated) and analyzed at 45 (d) [n = 4 slices from n = 3 mice/group] or 90 days pTX (e) [n = 3 slices from n = 4 mice/group]
Images were acquired at Delta Vision Olympus Ix70 for brain reconstruction
The corresponding masks (b–e) were generated accordingly using Fiji software
f Graphs showing the proportion of the total area covered by the progeny of IV injected cells
vs the progeny of cells injected ICV or ITL
and labeled with GFP of mice sacrified at 90 days pTX [n = 4 mice/group]
g High resolution confocal z-stacks of selected brain regions (with 5 µm step size) of IV
ICV or ITL transplanted mice at the indicated time points [n = 3 slices from n = 2 mice/group]
Images were acquired at 25x magnification and processed using Fiji open source software
these findings were confirmed independently from the timing of IV cell transplant and the combination of cell source adopted
indicating that the route of cell administration is the most relevant factor affecting the regional distribution of the transplant-derived cells
d Correlation between the number intersection radii and the sum intersections for microglia-like cells derived from HSPCs co-transplanted in the CNS (ICV or ITL) and IV
and retrieved in the indicated brain regions
The vertical and horizontal dashed lines divide the graphs in four quadrants
to highlight subpopulations with different complexity
for highly complex cells characterized by high sum of intersections and high number of intersecting radii; LL = lower left quadrant for cells with low complexity; UL (upper left) and LR (lower right) quadrants for cells displaying intermediate complexity between the LL and UR quadrant
e Histograms displaying the percentage of cells retrieved in each of the four quadrants highlighted in d
ITL and IV co-injected cells in the total and indicated regions
h Representative laser scanning confocal microscope microphotographs of brain sections showing the expression of selected microglia genes in the brain of intra-CNS co-transplanted mice [n = 5 slices from n = 2 mice/group] detected with RNAscope
Tissues were hybridized with probes for Tmem 119 (g) or TGFBR (h) gene (white dots) and their expression was analyzed within CNS (green) or IV co-injected cells (red)
Nuclei were counterstained with DAPI (blue)
Sall1 expression was lower in TAµ versus µ cells
further supporting the hypothesis of a differential state of maturation of the two subpopulations
we analyzed endogenous microglia retrieved from busulfan-treated mice injected ICV with PBS (sham control)
to exclude with the reported results that the procedure per se could significantly affect the gene expression profile of resident microglia
In this setting we observed some differences that might be associated with a response to the conditioning regimen
this being the only difference when comparing endogenous microglia from untreated vs transplanted animals
Notably, in situ RNA analysis of selected genes on cryostatic brain sections by RNAscope assay confirmed the expression of representative above-mentioned genes by the ICV/ITL derived cell progeny (Fig. 4g, h)
we generated microglia-like cells with a signature reminiscent of microglia
a Experimental scheme of TREM2_LV HSPCs transplantation in 5xFAD mice
mock/GFP transplanted 5xFAD mice and WT controls in the elevated plus maze (EPM) (b)
analyzed monthly from 4 to 12 months and in the Morris Water Maze (MWM) test
in the hidden platform (c) and reversal platform trial (d)
at 12 months (n° mice/group/time point b: N ≥ 7; c: N ≥ 12; d: N ≥ 9)
Data values (b–d) are shown as MEAN ± SEM [n = 4 experimental replicates]
e VCN calculated by ddPCR on DNA from the brain of 5xFAD treated animals [GFP: n = 9
Statistics: unpaired T test: not significant (P-value: 0.3881)
f Correlation between VCN and TREM2 expression measured by SYBR Green qPCR on brain from transplanted mice [n = 6] and on the liquid culture progeny of the infused HSPCs (reference)
on brain from treated 5xFAD mice (Mock/GFP and TREM2) and controls (WT) at >12months [n° slices/mouse: g
Data from mock and GFP mice are indicated by clear versus green dots
i IHC on brain slices showing the extent of neuroinflammation (Iba1 and GFAP staining) retrieved in mock vs TREM2 5xFAD transplanted mice at 12 months
j Quantification of Aβ deposits in the CTX and HPC of TREM2 transplanted animals (brain VCN > 0.5) compared to GFP/Mock animals [n > 3 slices/mouse
asterisks indicate significance at unpaired t-test (CTX p** = 0.0012; HPC p** = 0.0016)
k IHC on brain slices showing the extent of Aβ deposits in the HPC and CTX of TREM2 and mock/GFP Tx 5xFAD mice at 12 months
a Representative epifluorescence microscope image reconstruction of a LV_TREM2 transplanted 5xFAD mouse showing the enrichment of transduced cells (identified through RNAscope with WPRE-specific probe
Images were captured at a 20x magnification
N = 5 brain slices from n = 2 mice were analyzed
b Representative laser scanning confocal microphotographs of the cortex and hippocampal region from the brain of 5xFAD TREM2 transplanted mice (top and central figure) analyzed in a or in a WT mouse (bottom) used as negative control to demonstrate the specificity of Aβ amyloid and WPRE
Images were captured at a 40x magnification with a 1.5x digital zoom using a Leica SP5 scanning confocal microscope
c Representative laser scanning confocal microphotographs of the cortex and hippocampal region from the brain of a representative TREM2 transplanted mouse showing that reactive Iba1+ microglia/myeloid cells localized in close proximity to beta amyloid plaques are immunopositive for CD68
d Single channels of the ROI highlighted in the dashed square in c
e Representative laser scanning confocal microphotographs of the hippocampal region from the brain of 5xFAD TREM2 transplanted mice showing the presence of WPRE probe positive signal in CD68 positive cells in proximity of beta amyloid plaques
f Single channels of the ROI highlighted in the dashed squares in e
g Orthogonal view of the cell highlighted by the arrow in f
Images in c-g were analyzed in N = 4 brain slices from n = 3 mice
these data provide clear proof of the therapeutic potential of HSPC gene therapy in a pure neurodegenerative condition as well as evidence of therapeutic benefit associated to a CNS-restricted engraftment of engineered hematopoietic cells
by challenging further the hematopoietic cell transplantation paradigm we unveiled a key role exerted by the CNS environment in uniquely driving expansion
we also provided a clear example of the therapeutic potential of this approach that determines a CNS-restricted engraftment of the genetically modified transplant progeny cells
in a multifactorial neurodegenerative condition
for the administration of the conditioning protocol
which is essential to favor robust CNS-engraftment of the transplant progeny cells
or for HSPC manipulation and transplantation
if the transcriptome of mature microglia could be affected by CNS signaling
it is plausible to assume that intra-CNS injected HSPCs may differentiate toward microglia faster than upon IV administration
The olfactory bulb was characterized by high but equal presence of both IV and intra-CNS cell progenies in the combinatorial transplants with no morphological differences
supporting the hypothesis that this neurogenic area may play a crucial role in the recruitment of engrafted cells independently from the route of cell injection
as demonstrated by the short term biodistribution study
by which a downregulation of canonical genes associated with resident microglia
was observed at later time points (12–13 months post-transplant)
we here provided experimental proof of concept of the therapeutic potential of intra-CNS HSPC gene therapy for AD in a severe animal model of the disease
we selected TREM2 as a relevant therapeutic transcript specifically intended at enhancing a disease-specific function of transplant-derived microglia-like cells for this study
upon ICV transplantation of HSPCs from 5xFAD mutant mice transduced with a LV encoding the human TREM2 cDNA under the control of a moderate-strenght promoter
a CNS-restricted engraftment of the TREM2-expressing cells was observed up to 12 months post-transplant in busulfan myeloablated 5xFAD recipients
This resulted in substantial disease-modifying effects: a significant amelioration of the behavioral and histopathological disease manifestations was observed
with improved performance of the treated versus control mice at the Elevated plus maze and Morris Water Maze tests
as well as reduction of neuroinflammation (astrogliosis and microgliosis)
The phenotypic effects observed were accompained by a LV-dose dependent decrease of Aβ-deposits in treated mice as compared to mock treated controls
using a WPRE ISH probe as strategy to specifically identify the LV-transduced cells in brain sections
we documented a preferential distribution of the TREM2 expressing cells in brain regions associated to β amyloid deposits such as the cortex and hippocampal area and in particular a localization of CD68+TREM2+ cells in an activated state in the close proximity of amyloid plaques
despite the proof-of-concept nature of our findings will require proper adaptation of protocols in a clinical development plan
in the presence of anticonvulsant prophylaxis during conditioning administration
no short- or long-term neurotoxic effects of busulfan were noticed
at least phenotypically as per regular daily observation and at behavioral studies
nor obvious and severe signs of neural damage were observed at histopathological observation of the treated and control mice
Although specific neurotoxic effects of busulfan across epileptogenic and/or other neural circuits in this Alzheimer’s disease models remain undefined at the microscopic evaluation
such effects have not compromised treatment outcomes nor treated and control mice overall performances
this work unveiled a key role exerted by the CNS environment in uniquely driving expansion
distribution and myeloid differentiation of locally transplanted HSPCs towards a microglia-like phenotype and showed the robust potential of intra-CNS HSPC gene therapy for exerting specific therapeutic effects in the CNS
paving the way for the design of ad hoc gene therapy strategies to treat severe neurodegenerative disorders
The specific protocols covering the studies described in this paper were performed in compliance with all relevant ethical regulations and were explicitly approved by the Italian Ministry of Health
an internal ethical committee at San Raffaele Hospital (IACUC 573) and the Dana Farber Animal Facility Institutional Animal Care and Use Committee (IACUC 15-031)
Experiments performed on wild type C57BL/6 mice or C57BL6/Ly5.1 mice (hereafter called CD45.2 or CD45.1 respectively) were obtained from Jackson Lab or Charles River and maintained at San Raffaele Hospital and at the Dana Farber Animal Facility
Experiments performed on 5xFAD mice (#034840-JAX) were obtained from Jackson Lab and maintained at the ARCH animal Facility at Boston Children’s hospital (approved by the Institutional Animal Care and Use Committee (IACUC 17-06-3455) and at Fondazione Istituto di Ricerca Pediatrica Città della Speranza (IRPCDS) animal facility (IACUC 46/2023-PR)
Animals used in the study were housed within temperature and humidity ranges appropriate for the species
to which they can adapt with minimal stress and physiologic alteration
Light in animal holding rooms provided for both adequate vision and neuroendocrine regulation of diurnal and circadian cycles
The following LVs were used: pCCLsin.cPPT.humanPGK.GreenFluorescentProtein.Wpre for CNS injected cells (GFP-LV) pCCLsin.cPPT.humanPGK.DeletedNerveGrowthFactorReceptor.Wpre (ΔNGFR-LV) or pCCLsin.cPPT.humanPGK.mCherryProtein.Wpre (mCherry-LV) for IV injected cells
A fraction of the transduced cells was cultured for 10 days in vitro in order to assess transgene expression by cytofluorimetric analysis
Transduced cells were injected via the tail vein or directly in the CNS by means of ICV or ITL injection into seven/eight-week-old conditioned C57BL6/J female mice
24 h after the fourth busulfan dose (25 mg/kg x four days
at different concentration according to the different experimental settings
CNS injected cells (Lin- 0.3 × 106/mouse); IV injected cells (Lin-1 × 106; BM 3 × 106; KSL 0.5 × 106)
8 weeks old 5xFAD mice were transplanted ICV with 0.3 × 106 Lin- cells obtained from 5xFAD donors (6–8 weeks old) and transduced at MOI 100 with a TREM2 expressing LV (pCCLsin.cPPT.humanPGK.Trem2.Wpre) as described above
2.0 × 106 BM cells from 5xFAD donors were provided IV for hematopoietic rescue
Mice were conditioned with 25 mg/kg of busulfan for 4 days prior to transplant and provided with Diazepam to avoid seizures
Diazepam solution (available at 5 mg/mL) was provided daily in the drinking water starting for a total of 10 days with progressive decreases in drug dose (0.25 mg/kg used for the first 8 days
then dose decreased in the two following days to 0.125 mg/kg −0.063 mg/kg and removed)
5xFAD mice transplanted with 0.3 × 106 GFP-transduced Lin-cells ICV were used as control
ICV transplantation was performed by surgery
upon anesthesia (ketamine (100 mg/kg) and xylazine (10 mg/kg)
was fixed with ear bars in a stereotactic frame and the skin was disclosed longitudinally
Bregma was visualized and coordinates were recorded
−0.5 mm anterior) were adjusted before the cranial bone was enclosed under visual control with a drill head of 0.7 mm diameter
Five µl of the cell suspension (0.3 × 106 cells) were injected through a 10 µl Hamilton syringe upon insertion into the brain 2.5 mm distal from the cranial bone
animals received a single dose of atipamezole (1 µl/g) and were maintained in sterile conditions
ITL transplantation was performed under anaesthesia with isoflurane (4% induction
A 10 µl Hamilton syringe connected to a 30-gauge needle containing 5 µl of cell suspension was introduced into the intervertebral foramen between L5 and L6 through the intact skin
Slow administration of 0.3 × 106 cells/mouse was performed once the proper position of the needle was confirmed by tail flick reflex
injection of atipamezole (1 μl/g) as analgesic and returned to the cage
Prophylactic Antibiotic (Gentamycin Sulfate
80 mg/250 mL) was administered via the drinking water for 2 weeks following conditioning and transplantation
Mice were euthanized under deep anesthesia by extensive intra-cardiac perfusion with cold PBS for at least 10–15 min/mouse after clumping the femur
The procedure was stopped only when complete liver blanching was observed to avoid contamination with circulating blood cells
Organs were then collected and differentially processed
BM cells were collected from the clumped femur as described
Brain was removed and the two hemispheres were differently processed
one hemisphere was fixed for 24 h in 4% PFA
embedded in OCT compound and stored at −80 °C
after equilibration in sucrose gradients (from 10 to 30%)
cells from the other hemisphere were mechanically disaggregated to obtain a single cell suspension in 20 ml of GKN/BSA buffer (8 g/L NaCl
The same protocol was used to process the spinal cord
Cells from BM and CNS tissues (brain and spinal cord) were analyzed by FC upon re-suspension in blocking solution (PBS 5%FBS
1%BSA) and labeling at 4 °C for 15 min with the following specific antibodies: rat PE anti-mouse CD45 (BD Pharmingen) 1:100; rat APC anti-mouse CD45 (BD Biosciences) 1:150; rat Brilliant Violet 510 anti-mouse CD45
(BioLegend) 1:150; rat Pacific Blue antimouse CD45.2 (Bio Legend) 1:100; mouse PE anti-Mouse CD45.1 (BD bioscience) 1:100; rat APC anti-mouse CD11b (eBioscience) 1:100; mouse Alexa Fluor 647 anti-Human CD271 (NGF receptor) (BD Pharmingen) 1:30; rat APC 780 anti-mouse CD11b (eBioscience) 1:100; rat APC 780 anti-mouse CD117(c-kit) (eBioscience) 1:100; rat PE-Cy7 anti- mouse Ly-6A/E Sca-1 (Sca-1) (BD Bioscence) 1:150
7-AAD (1 mg/ml) (Sigma-Aldrich) or DAPI was added to the cells prior to analysis for dead cell exclusion
Samples were analyzed by LSR Fortessa (Beckton Dickinson)
Brains were serially cut in the sagittal planes on a cryostat in 15 µm sections
Then sections were incubated over night with primary antibodies diluted in PBS
10% NGS at 4 °C as follows; rabbit anti Iba1 (Wako) 1:100; chicken anti-GFP (Abcam) 1:250; rabbit anti GFP (Invitrogen) 1:100; mouse PE anti-human CD271 (NGF Receptor) (BD Pharmingen) 1:50; rabbit anti-cherry (Abcam) 1:100
The secondary antibodies goat IgG anti-Chicken Alexa Fluor 488
goat IgG anti-Mouse Alexa Fluor 546 (Molecular Probes
Invitrogen) were diluted 1:500 in the same blocking solution used for primary antibodies staining and incubated with sections for 2 h at room temperature
Nuclei were stained with Topro III (Molecular Probes
Invitrogen) 1:1000 in PBS or by DAPI (Roche) 1:30 in PBS
air dried and mounted with Fluorsafe Reagent (Calbiochem)
Not transplanted mice were used as negative controls for the reporter transgene staining
Incubation with secondary antibody alone was performed in order to exclude the background signal
Samples were analyzed with a confocal microscope (Zeiss and Leica TCS SP2; Leica Microsystems Radiance 2100; Bio-Rad) (λexcitation = 488
Fluorescent signal was processed by Lasersharp 2000 software
Images were imported into Adobe Photoshop CS 8.0 software and processed by using automated level correction
a fluorescence microscope Delta Vision Olympus Ix70 was used for the acquisition of the images
which were then processed by the Soft Work 3.5.0 software
Images were then imported into the Adobe Photoshop CS 8.0 software and reconstructed
The branching analysis was performed with ImageJ software using an automatic Macro
developed in the lab for standardizing the procedure
on multiple individual cells (comprised between 20 and 80) from different brain region of transplanted mice
Cells were identified according to the expression of different fluorescent markers (GFP/Cherry/∆NGFR) and validated reproducing the same analysis on Iba-1+ stained cells
Automated Sholl analysis was performed by applying the same strategy
to study the radial distribution of microglia branches around the cell body
The sum intersections and number of intersection radii were selected as parameters to characterize donor derived cells
in terms of complexity and spatial extension of the cell arborizations
a mask was created from splitted channel images by using Fiji program
The positive signal was then converted in colored spotted signal to differentially mark CNS vs IV transplanted cells
a deeper analysis was conducted on splitted channel images upon removal of background noise and identification of region
In particular tissues were a) soaked in Starting Solution overnight at 4 °C; b) transferred to Solution A at 37 °C for 24 h
followed by three 20-minute washes in distilled water at 4 °C; c) immersed in Solution B at 37 °C for 24 h
followed by four 30-minute washes in distilled water at 4 °C; d) stained with Nuclei staining solution (DAPI 10 µg/ml in distilled water) for 2 h at 4 °C
followed by three 10-minute washes in distilled water at 4 °C; e) placed in Mounting Solution at 37 °C for 24 h and then stored at room temperature for imaging
A z-stack of 400–500 μm thickness (with 20 μm intervals) was obtained in both the UV and FITC channels to visualize the DAPI-stained nuclei and GFP+ cells
A composite image was generated through stitching
Four partially overlapping acquisitions were performed
focused on four different brain subregions (forebrain
Full brain was reconstructed by manually merging the four acquisitions (with GIMP v.2.10.8 open-source software
Selected brain regions of interest were acquired at high-resolution on the z-axis by capturing a z-stack image of 400–500 μm thickness (with 5 μm intervals) at 25x magnification with a Leica SP5 scanning confocal microscope
For the analysis of microglia enriched genes
cryostatic brain sections were processed and stained using the RNAscope 2.0 kit (cat#310095
following the Fixed-frozen tissue sample preparation and pre-treatment protocol according to manufacturer instructions
Perfusion and post-fixation in paraformaldehyde were performed as described above
After equilibration in 30% phosphate buffered sucrose solution
14 µm thick brain sections were mounted onto Superfrost Plus glass slides using a cryostat
Detection of Tmem119 and Tgfbr1‐mRNA was performed using the RNAscope® Fluorescent Multiplex Assay with a probe set targeting base pairs 2–1106 of mouse Tmem119‐mRNA (Cat No
CA) or base pairs 2257–3252 of mouse Tgfbr1-mRNA (Cat No 406201
washed in PBS and subsequently immersed in boiling 1x Target Retrieval solution for 5 min
After washing in distilled water and 100% ethanol for 2 min each
the sections were incubated with Protease IV solution for 30 min at 40 °C in a humidified tray
After washing in distilled water for 2 min
the sections were then hybridized with target probes for 2 hr at 40 °C followed by amplification solutions 1 (30 min)
the sections were rinsed in 1x Wash Buffer for 2 min at room temperature
the sections were counterstained with 4’,6‐Diamidine‐2’‐phenylindole dihydrochloride (DAPI) for 30 s and coverslipped in PVA‐DABCO
Images were acquired at Delta Vision Olympus 10x
Brain samples from 5xFAD mice were processed for immunohistochemistry by Neuroscience Associates
After equilibration in sucrose gradients (from 10 to 30%) and 24 h treatment with 4% PFA
samples were embedded in a gelatin matrix using MultiBrain®Technology
after curing by immersion in 2-Methylbutane chilled with crushed dry ice and mounted on a freezing stage of an AO 860 sliding microtome
The MultiBrain® blocks were sectioned coronally with desired micrometer (μ) setting on the microtome
All sections were cut through the entire length of the specimen segment and collected sequentially
free floating sections were processedd for IF as per internal protocols
All incubation solutions from the blocking serum onward use Tris buffered saline (TBS) with Triton X-100 as the vehicle; all rinses are with TBS
After a hydrogen peroxide treatment and blocking serum
the sections were immunostained with the primary antibodies (i.e anti-Iba1
and incubated overnight at room temperature
Vehicle solutions contained Triton X-100 for permeabilization
a biotinylated secondary antibody was applied
After further rinses Vector Lab’s ABC solution (avidin-biotin-HRP complex) was applied
then treated with diaminobenzidine tetrahydrochloride (DAB) and hydrogen peroxide to create a visible reaction product
the sections were mounted on gelatin coated glass slides
The identification of LV-transduced cells in the tissues of transplanted 5xFAD mice was performed through in-situ hybridization for WPRE on 20 μm brain slices
The protocol was optimized to allow the co-detection of WPRE as well as amyloid beta
CD68 and Iba1 (stained with immunohistochemistry) on the same tissue slice
a standard immunohistochemistry protocol was performed
brain sections were blocked for 1 h at RT in blocking buffer (NGS 10% or BSA 3%
The primary antibodies used were Mouse anti-B-Amyloid (1:500
the sections were incubated with Biotinylated Goat anti-Mouse IgG (H + L) (1:200
Biotinylated Goat anti-Rat IgG (H + L) (1:200
Vector Labs) or Biotinylated Donkey anti-Rabbit IgG (H + L) (1:200
followed by 30’ incubation at RT with HRP-streptavidin conjugate (1:100
Before starting the in-situ hybridization protocol
AB64212) was used following manufacturer’s instructions to saturate any available biotin-binding surface in the tissue
Slices were fixed with PFA 4% and left to dry O/N at RT
In-situ hybridization was performed using the RNAscope Probe WPRE-04 (Biotechne
initially blocking peroxidases through the RNAscope H2O2 followed by protease treatment according to the manufacturer instructions (ACD
322381) and subsequently amplifying the target signal with the RNAscope Multiplex Fluorescent Detection Kit V2 (ACD
323110) and associating it with the Cy5 tyramide fluorophore (1:1000
Images were captured at a 40x magnification with a 1.5x digital zoom using a Leica SP5 laser scanning confocal microscope
Total RNA was extracted with the RNeasy Plus Micro kit (Qiagen) from sorted myeloid brain populations
RNA quantity was determined using QuantiFluor® RNA system and QuantusTM Fluorometer (Promega)
cDNA was generated starting from 1 ng up to 100 ng of purified mRNA by using SuperScript VILO Master mix (Thermo Fisher Scientific)
cDNA was then pre-amplified using Custom Taqman® PreAmp Pools (Thermo Fisher Scientific)
Thermal cycling for cDNA generation and preamplification was performed on T100 Thermal cycler (BIO-RAD) following manufacturer’s instructions
Gene expression analysis was performed using a custom design TaqMan-based microfluidic card gene expression assay (Applied Biosystems)
Real time PCR was run in standard mode on Applied Biosystems® ViiATM 7 Real-Time PCR System
using the following thermal cycling conditions: one cycle at 50 °C for 2 min
40 cycles at 95 °C for 15 s and 60 °C for 1 min (Applied Biosystems)
The ViiATM 7 Software v1.2.2 was used to extract raw data
The difference (dCT) between the threshold cycle (CT) of each gene and that of the reference gene (mean of HPRT and r18S CTs) was used to determine gene expression
Fold change expression of selected microglia genes was calculated by 2−ddCT method
The RNA-seq gene expression analysis was performed on additional samples
corresponding to different combinations of route of administration (IV
The complete design matrix reporting the characteristics of each sample is available as Source data in a Source data file
Raw sequencing files were investigated for QC and aligned to the reference mouse genome mm39 (Genome assembly GRCm39) using STAR workflow83
Poorly-detected genes with a cumulative reads count smaller than 10 or measured (reads count>0) in less than two samples were filtered out
Gene counts have been modeled using a negative binomial model
Normalized data are used for the heatmap representations and are available as Source Data in a Source data file
hTREM2 expression was detected on brain tissue extracts by qPCR using a SYBR Green Kit with primers and probe from Thermofisher (Catalog number: 4448892
Primers for hTREM2 were preliminary validated on human THP1 cells
a monocytic cell line that constitutively expresses hTREM2
and on BV2 murine cells transduced with the LV_hTREM2
both used as positive controls for hTREM2 expression
All values were normalized to the housekeeping gene GAPDH
hTREM2 expression was then measured on the brain of animals transplanted ICV with LV-hTREM2 HSCs at sacrifice at 10 months after the transplant
ddPCR was performed on genomic DNA extracted respectively from the liquid culture grown in vitro for 14 days post transduction and from the brain tissues by using the DNeasy Blood & Tissue kit (Qiagen)
ddPCR was ran in duplicate using 20 ng of gDNA as template
ddPCR Supermix for Probes (Bio-Rad Laboratories Inc) and primers specific for HIV Psi region LENTI (FAM fluorochrome
forward primer: 5’-TGAAAGCGAAAGGGAAACCA-3’; Reverse primer 5’-CCGTGCGCGCTTCAG-3’; probe: AGCTCTCTCGACGCAGGACTCGGC) and for the murine RPP30-(HEX fluorochrome
forward primer: 5’-CCAGCTCCGTTTGTGATAGT-3’
Reverse primer 5’-CAAGGCAGAGATGCCCATAA-3’)
Poisson statistical analysis of the numbers of positive and negative droplets yields absolute quantification of the target sequence
the elevated-plus maze (EPM) test was performed on the transplanted 5xFAD animals every month from age 4 months until the age of 12 months and the Morris Water Maze (MWM) test at study termination (12 months of mice age)
All four arms are elevated 1 meter from the floor
with the drop-off detectable only in the open arms
The EPM contained two open arms (35.5 cm×6 cm) and two closed arms (35.5 cm × 6 cm) radiating from a central area (6 cm × 6 cm)
A 0.5 cm high lip surrounded the edges of the open arms
whereas the closed arms were surrounded by 20 cm high walls
The EPM was cleaned with Peroxigard before the beginning of the first test session and after each subject mouse was tested
with sufficient time for the ethanol odor to dissipate before the start of the next test session
the mouse was placed in the central area facing the open arm
The mouse was allowed to freely explore for 5 min
Trials were videotaped and scored with EthoVision XT video tracking software (version 12.0
circular tub (60 cm depth x 83 cm diameter) was filled to 29 cm deep with water that was approximately 25 °C
distinct shapes were places in each of the four quadrants inner walls of the tub to form distinct quadrants
Acquisition training (day 1) consisted of 8 trials per mouse with a white platform (10 cm diameter) 0.5 cm above the surface of the water and marked with the red reflector
Each training trial began by lowering the mouse into the water close to the pool edge
The start location for each trial was alternated in a semirandom order for each mouse
Each mouse started in each of the quadrants twice
Hidden training (day 2–3) consisted of 20 trials per mouse
Each mouse started in each of the quadrants five times
For probe testing (day 4) the platform was removed and mice started opposite the position of where the hidden platform had been located
Reversal training (day 5 consisted of 1 trials per mouse
Mice were allowed a maximum of 90 s to reach the platform
a mouse that failed to reach the platform in 60 s was guided to the platform by the experimenter
Mice were left on the platform for 5 s before being removed
the subject was placed in a cage lined with absorbent paper towels and allowed to rest
Time spent in each quadrant and number of crossings over the trained platform location was used to analyze probe trial performance
we used Unpaired T-test with Welch’s correction
one-way ANOVA followed by Tukey post-hoc test was used; for multiple variable comparisons
two-way ANOVA followed by Sidak post-hoc test was applied
Details on the exact statistical test used as well as the number of subjects and samples are included in the respective figure legends
P-values are reported in the respective figure legends whenever possible or are available as Supplementary information
No statistical method was used to predetermine sample size
A biological triplicate (independent experiment) was guaranteed in both in vitro and in vivo experiments
Blinding analysis was adopted for behavioral testing in AD mice
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article
Development and homeostasis of “resident” myeloid cells: the case of the microglia
Fate mapping analysis reveals that adult microglia derive from primitive macrophages
Microglia: Dynamic Mediators of Synapse Development and Plasticity
Synaptic pruning by microglia is necessary for normal brain development
Intracerebroventricular delivery of hematopoietic progenitors results in rapid and robust engraftment of microglia-like cells
Brain conditioning is instrumental for successful microglia reconstitution following hematopoietic stem cell transplantation
Wild-type bone marrow cells ameliorate the phenotype of SOD1-G93A ALS mice and contribute to CNS
Outcomes of unrelated umbilical cord blood transplantation for X-linked adrenoleukodystrophy
Microglia in the adult brain arise from Ly-6ChiCCR2+ monocytes only under defined host conditions
AAV-Mediated Gene Delivery to the Spinal Cord by Intrathecal Injection
Hematopoietic Stem-Cell Gene Therapy for Cerebral Adrenoleukodystrophy
Lentiviral haemopoietic stem-cell gene therapy in early-onset metachromatic leukodystrophy: an ad-hoc analysis of a non-randomised
Design of a regulated lentiviral vector for hematopoietic stem cell gene therapy of globoid cell leukodystrophy
Lentiviral hematopoietic stem cell gene therapy benefits metachromatic leukodystrophy
Identification of hematopoietic stem cell-specific miRNAs enables gene therapy of globoid cell leukodystrophy
Safety of arylsulfatase A overexpression for gene therapy of metachromatic leukodystrophy
Hematopoietic stem cell gene therapy with a lentiviral vector in X-linked adrenoleukodystrophy
Gene therapy of metachromatic leukodystrophy reverses neurological damage and deficits in mice
CRISPR-Cas9 Gene Editing of Hematopoietic Stem Cells from Patients with Friedreich’s Ataxia
Gene therapy using haematopoietic stem and progenitor cells
Hematopoietic Stem Cell Gene Therapy: Progress and Lessons Learned
Lentiviral haemopoietic stem/progenitor cell gene therapy for treatment of Wiskott-Aldrich syndrome: interim results of a non-randomised
Hematopoietic Stem Cell Transplantation for Mucopolysaccharidoses: Past
Lentiviral Hematopoietic Stem Cell Gene Therapy Corrects Murine Pompe Disease
Non-toxic HSC Transplantation-Based Macrophage/Microglia-Mediated GDNF Delivery for Parkinson’s Disease
Neuroinflammatory paradigms in lysosomal storage diseases
Metallothioneins are neuroprotective agents in lysosomal storage disorders
Macrophage enzyme and reduced inflammation drive brain correction of mucopolysaccharidosis IIIB by stem cell gene therapy
Hematopoietic stem cell transplantation chemotherapy causes microglia senescence and peripheral macrophage engraftment in the brain
Busulfan conditioning enhances engraftment of hematopoietic donor-derived cells in the brain compared with irradiation
Plasschaert, R. N. et al. High-throughput analysis of hematopoietic stem cell engraftment after intravenous and intracerebroventricular dosing. Mol. Ther. https://doi.org/10.1016/j.ymthe.2022.05.022 (2022)
Phenotypic clustering: a novel method for microglial morphology analysis
Automated Sholl analysis of digitized neuronal morphology at multiple scales: Whole cell Sholl analysis versus Sholl analysis of arbor subregions
New tools for studying microglia in the mouse and human CNS
Identification of a unique TGF-beta-dependent molecular and functional signature in microglia
A neurodegeneration-specific gene-expression signature of acutely isolated microglia from an amyotrophic lateral sclerosis mouse model
Regulation of microglial phagocytosis and inflammatory gene expression by Gas6 acting on the Axl/Mer family of tyrosine kinases
The microglial sensome revealed by direct RNA sequencing
Microglia development follows a stepwise program to regulate brain homeostasis
Competitive repopulation of an empty microglial niche yields functionally distinct subsets of microglia-like cells
Peripherally derived macrophages can engraft the brain independent of irradiation and maintain an identity distinct from microglia
A Combination of Ontogeny and CNS Environment Establishes Microglial Identity
Genetic Cell Ablation Reveals Clusters of Local Self-Renewing Microglia in the Mammalian Central Nervous System
TREM2 - a key player in microglial biology and Alzheimer disease
Elevated TREM2 Gene Dosage Reprograms Microglia Responsivity and Ameliorates Pathological Phenotypes in Alzheimer’s Disease Models
Missense variant in TREML2 protects against Alzheimer’s disease
and neuron loss in transgenic mice with five familial Alzheimer’s disease mutations: potential factors in amyloid plaque formation
and reduced anxiety coinciding with axonal degeneration and intraneuronal Abeta aggregation in the 5XFAD mouse model of Alzheimer’s disease
A review of the validity and variability of the elevated plus-maze as an animal model of anxiety
Woodchuck hepatitis virus post-transcriptional regulatory element deleted from X protein and promoter sequences enhances retroviral vector titer and expression
Viral mediated neuropeptide Y expression in the rat paraventricular nucleus results in obesity
Sagoo, P. & Gaspar, H. B. The transformative potential of HSC gene therapy as a genetic medicine. Gene Ther. https://doi.org/10.1038/s41434-021-00261-x (2021)
The role of microglia in human disease: therapeutic tool or target
Efficient Strategies for Microglia Replacement in the Central Nervous System
Diverse Requirements for Microglial Survival
and Function Revealed by Defined-Medium Cultures
Human iPSC-derived mature microglia retain their identity and functionally integrate in the chimeric mouse brain
Transnasal transplantation of human induced pluripotent stem cell-derived microglia to the brain of immunocompetent mice
Intracerebroventricular Delivery as a Safe
Best practices for the use of intracerebroventricular drug delivery devices
Human intracerebroventricular (ICV) injection of autologous
adipose-derived stromal vascular fraction (ADSVF) for neurodegenerative disorders: results of a 3-year phase 1 study of 113 injections in 31 patients
The Evolving Concept of the Blood Brain Barrier (BBB): From a Single Static Barrier to a Heterogeneous and Dynamic Relay Center
Isolation and culture of microvascular endothelial cells from murine spinal cord
Neurogenic Radial Glia-like Cells in Meninges Migrate and Differentiate into Functionally Integrated Neurons in the Neonatal Cortex
The meningeal and choroidal infiltration routes for leukocytes in stroke
Effector T-cell trafficking between the leptomeninges and the cerebrospinal fluid
Meninges: A Widespread Niche of Neural Progenitors for the Brain
Highly regionalized neuronal expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) in rat brain: evidence for its colocalization with neurotransmitters and neuropeptides
Restricted proliferation and migration of postnatally generated neurons derived from the forebrain subventricular zone
Functional integration of adult-born neurons
Cell trafficking through the choroid plexus
IFN-gamma-dependent activation of the brain’s choroid plexus for CNS immune surveillance and repair
Gosselin, D. et al. An environment-dependent transcriptional network specifies human microglia identity. Science 356, https://doi.org/10.1126/science.aal3222 (2017)
Engrafted parenchymal brain macrophages differ from microglia in transcriptome
chromatin landscape and response to challenge
Effects of long-term and brain-wide colonization of peripheral bone marrow-derived myeloid cells in the CNS
Microglia and Microglia-Like Cells: Similar but Different
Neuroprotective Properties and Therapeutic Potential of Bone Marrow-Derived Microglia in Alzheimer’s Disease
Rescue of Alzheimer’s disease phenotype in a mouse model by transplantation of wild-type hematopoietic stem and progenitor cells
Bone marrow-derived microglia play a critical role in restricting senile plaque formation in Alzheimer’s disease
Neuroprotective properties of the innate immune system and bone marrow stem cells in Alzheimer’s disease
Gene therapy augments the efficacy of hematopoietic cell transplantation and fully corrects mucopolysaccharidosis type I phenotype in the mouse model
Lipophilic dye-compatible brain clearing technique allowing correlative magnetic resonance/high-resolution fluorescence imaging in rat models of glioblastoma
Team, R. C. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria, https://www.R-project.org/ (2013)
Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2
In Methods of Behavior Analysis in Neuroscience Frontiers in Neuroscience (eds nd & J
Sociability and motor functions in Shank1 mutant mice
Download references
Valentina Cipolla and Valeria Bortolotto for experimental support on the Alzheimer’s disease project and for supporting the optimization of RNAscope protocol and related analysis
We wish to thank Mauro Giuseppe Spatafora (University of Pavia) for the help with confocal microscope acquisitions and Claudia Balducci (“Mario Negri” Institute for Pharmacological Research) for kindly providing the anti-Amyloid beta antibody
This work was funded by ERC Consolidator Grant #617162
ERC Proof of Concept 2022 Grant TREM2MICROENGINES and sponsored research agreement funds to AB
San Raffaele Telethon Institute for Gene Therapy
Dana-Farber/Boston Children’s Cancer and Blood Disorders Center
Department of Biology and Biotechnology “L
Cellular and Molecular Neuropharmacology lab
methodology and writing of the original draft
are authors on a patent application related to this work (intracerebral transplantation of engineered HSCs) filed by Boston Children’s Hospital
the San Raffaele Hospital and Politecnico of Milano (application no
are authors of a provisional patent application related to this work (TREM2 HSC gene therapy for AD) filed by Boston Children’s Hospital and Dana Farber Cancer Institute application no
All other authors declare that they have no competing interests
Nature Communications thanks the anonymous reviewers for their contribution to the peer review of this work
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations
Download citation
DOI: https://doi.org/10.1038/s41467-024-52301-w
Anyone you share the following link with will be able to read this content:
a shareable link is not currently available for this article
Sign up for the Nature Briefing newsletter — what matters in science
Milazzo has been approved to lease the same hangar
A 2022 photo of the then-partially-deconstructed airport hangar at the Harriman-and-West Airport
The North Adams Airport Commission approved Michael Milazzo's application to lease the damaged
Milazzo and associate Brian Doyle allegedly destroyed the hangar according to a 2021 police report
NORTH ADAMS — A familiar face will soon fly out of a refurbished hangar at Harriman-and-West Airport in North Adams
He's also accused of previously vandalizing it
The North Adams Airport Commission accepted Michael Milazzo’s proposal for the refurbished Northeast Hangar
It was rebuilt after it was partially demolished in a manner a police report says was unsafe
The Federal Aviation Administration funded $566,644 of the rebuild
The commission accepted Milazzo's application against the recommendation of a committee
consisting of two commission members and two city officials
According to commission Chair Marc Morandi
"A discussion took place regarding [the] expectation held by all that we had hoped for more than one response."
The committee even reached out to the Office of the Inspector General about the proposal
which advised that a proposal cannot set lease terms as Milazzo's did
only the request for proposals can do that
The result was a formal recommendation to reject all bids and rework the RFP to rebid at a later date
Milazzo repeatedly interrupted deliberations during the commission's discussion of the vote
at one point noting that the city "on multiple occasions has taken single proposals and moved forward on projects with one proposal."
saying that there wasn't enough information in Milazzo's application
City Administrative Officer Kathy Eade said that Milazzo was “innocent until proven guilty.” During Tuesday's commission meeting
commissioners did not at all discuss the allegations against Milazzo
Former hangar co-owners Derek and Jackie Rougeau have alleged to North Adams Police and airport officials that their former business partners and hangar co-owners Brian Doyle and Milazzo were responsible for the damage to the hangar
A 2021 police report seems to validate the Rougeaus’ claims
Milazzo and Doyle did not face any internal action from airport management or the commission
North Adams Police Officer Kelly Wisniowski did not depict such gray areas in her 2021 report about the vandalism
which was carried out with an excavator owned by Milazzo
as he has admitted during litigation in court proceedings pitting the Rougeaus and Milazzo and Doyle against each other
“This partial demolition carried out by Doyle and Milazzo was done in a hazardous manner
and without consulting the other owner,” Wisniowski’s report states
“Valuable property was unnecessarily and maliciously damaged
were put at extreme risk as a result of unsafe work being done near a live gas line which had not yet been disconnected.”
Milazzo admitted he brought the excavator to the hangar and later removed it
but denies responsibility for carrying out the excavation
and it was never concluded how it happened.”
Despite the police report and repeated protestations from some who use the airport
Milazzo is once again in control of the hangar
Milazzo Air LLC offered to pay $24,000 annually to lease the hangar
The commission will meet with Milazzo in executive session on Oct
Milazzo Air would at first make available space for aircraft storage
would become “a full-service piston aircraft maintenance facility
including avionics service (not currently available at the North Adams Airport).”
Some level of aircraft storage would be available throughout
and the venture could create between five and seven jobs
The principals in the aircraft maintenance business would be Milazzo and Doyle
Both have not responded to requests for comment from The Eagle
when asked whether he had a hand in destroying the hangar
which is not part of the hangar dispute between the former co-owners
separately have accused Doyle and Milazzo of relentlessly harassing them verbally
as well as interfering with their gliding and airport operations
Milazzo and Doyle have accused Mohawk of being the real harassers
North Adams has named September "General Aviation Appreciation Month" as part of an effort to highlight the importance of small airports
The city-owned hanger is being renovated and is now unenclosed
Scott Balawender said bits of insulation blew into his yard
Students Build Professional Skills in the Field
New Book Brings Hip-Hop Pedagogy to Classrooms Nationwide
newly opened by Amanda Milazzo in Easthampton
Amanda Milazzo talks about opening a new dessert bar and cafe called Darlings in Easthampton
A Manhattan and a slice of Peanut Layer Cake at Darlings Bar and Cafe
EASTHAMPTON — A new member of the Small Oven Bakery family has opened its doors in Easthampton
Darlings Bar and Cafe offers an array of rich new desserts and savory snacks from the Small Oven staff alongside a selection of handcrafted cocktails
Small Oven and Darlings owner Amanda Milazzo said that the new bar and cafe not only serves as a space for community members to gather in the evenings
but has been an outlet for herself and her Small Oven staff
who get to explore new creative avenues when making the complex desserts available at Darlings
“Before I had opened the bakery and I was just working in service places
I always thought it was a really sweet idea to open a dessert bar,” said Milazzo
When she found out that the space at the corner of Holyoke Street and Fairfield Avenue in Easthampton was available
she knew it was time to realize that dream
Milazzo transformed the space into the moody
relaxed dessert bar that has already been drawing crowds each night
Milazzo said she has been working on making Darlings a reality for about a year now
and that renovating the bar to fit her vision was an “intense” process that began in July and only recently wrapped up
not really like a building person,” Milazzo said
Darlings prioritizes local ingredients in its offerings
From its decadent cakes to its bread and butter
everything on the menu is made from scratch in the Small Oven kitchen
While the desserts at Darlings aren’t offered at the bakery
Milazzo said that the flavor profiles at the dessert bar will be familiar to patrons of Small Oven
customers from Easthampton and beyond will have access to the tasty creations of Milazzo and her staff both morning and night
“The stuff during the day is very much bread and pastries… Here
it’s all about the plating and the composition on the plate,” Milazzo explained
“The desserts are tailored toward what we love to eat.”
Milazzo said that the Darlings House Tiramisu will always be on the menu
which is her “favorite dessert of all time.”
Patrons of Darlings can choose to sit and chat at the bar or take advantage of a full-service dining area
Milazzo said she plans to open the space as a “quick pickup coffee spot” as well
Milazzo said she envisions Darlings being used as a gathering place for future community events
Milazzo has felt support and excitement from the community
which has backed her throughout her business endeavors
Throughout the process of opening Darlings
responsible” staff at Small Oven has been incredibly helpful
especially as the bakery approaches the holiday season
Darlings is currently open Tuesday through Sunday from 5 to 10 p.m
you agree with our use of cookies to personalize your experience
measure ads and monitor how our site works to improve it for our users
Broadway
Off-Broadway
Off-Off Broadway
Cabaret
Dance
Opera
Classical Music
Nashville
Minneapolis / St. Paul
Connecticut
Atlanta
Chicago
Los Angeles
WEST END
UK Regional
Canada
Australia / New Zealand
Europe
Asia
Latin America
Africa / Middle East
TV/Movies
Music
The BroadwayWorld reviewer picks his favourite immersive shows of 2024
the immersive genre in London and beyond grew and grew and grew
with the independent sector overshadowing the biggest names
It seems that Punchdrunk has been the king of this jungle since forever but they are in something of a state of artistic limbo since the financial failure of 2022’s The Burnt City
was well-received by critics but artistically unambitious by their previous standards
Their latest accounts paint a picture of a company cutting back on creative staff
looking both at home and abroad for their next ventures and
after failing to make scheduled payments on a multi-million pound loan
the ingenious Key Of Dreams from Lemon Difficult pulled us into a 24 hour-long adventure of pulsating Lovecraftian horror
Two cabaret-style shows (Rhythm & Ruse and The Magicians Table) blended close-up magic
Foodies got stuck into the Batman-themed Monarch Theatre while global travel was the theme for Gingerline’s The Grand Expedition
Those with a taste for the luxurious boarded Neil Kelso’s Dead On Time to solve a cunning murder-mystery
moseying through the Kent countryside as the clues piled up
classical or jazz; even the Royal Ballet joined in for their Dark With Excessive Bright
Below are thirty of the year’s top immersive shows as described by writers of BroadwayWorld
the UK’s leading mainstream source of reviews for this exciting genre
“What is the difference between a house and a home? And who gets to write history? Interactive experience 1884 provokes challenging answers to these questions in the context of an almost-forgotten historical event that had significant consequences for two continents.” Full review
“Charles Mingus originally intended for his iconic 1963 jazz album Black Saint and The Sinner Lady to be accompanied by dancers and
thanks to performance company Clod Ensemble and the Nu Civilisation Orchestra
it becomes the inspiration for a vibrant and inclusive show.”
Full review
talking to the dead is not solely the preserve of spiritualists and mediums
Her immersive meditation on grief manifests in the form of nine storylines where the living pour their hearts to those who have passed.”
Full review
“Ever wanted to captain a spaceship on a mission to explore strange new worlds
seek out new life and new civilisations and perhaps shoot up some enemy ships along the way
Parabolic Theatre’s Bridge Command realises every sci-fi geek’s dream.”
Full review
“Stepping out from behind the ones and twos
Lemon Jelly DJ and club promoter Fred Deakin takes us on an odyssey through his own life and times
Club Life was one of the Edinburgh Fringe’s word-of-mouth hits last year
an immersive theatre piece that takes his career as a starting point and allows the audience the chance to jump on the dance floor.”
Full review
“Based on the 2017 hit film about PT Barnum
The Greatest Showman Circus Spectacular is a mishmash of circus
story and song that somehow manages to do a disservice to all three.”
Full review
“Appearing as part of their Festival of New Choreography
the Royal Ballet partners with the National Ballet of Canada for this extraordinarily intimate experiment which allows audience to experience the art form in a radical way.”
Full review
“If there was an award for the most art forms smooshed into one show
comedy and drag wrapped around the classic Die Hard plot is a satisfying mess that somehow (just) works.”
Full review
as the nation prepares itself for the Festival of Britain
a killer hiding in plain sight and around two hundred passengers-cum-amateur detectives find themselves all aboard the same train
It’s fair to say that Dead On Time knows how to set a scene even before we step aboard.”
Full review
Full review
“Feeling like the wildest circus party in town
Fuerza Bruta (Spanish for “brute force”) returned to the Roundhouse with their new show Aven.”
Full review
immersive dining specialists Gingerline’s revival of The Grand Expedition leads us on a merry virtual journey around the world all while sat in a hot air balloon gondola.”
Full review
Sherlock Holmes and Dr Watson are on the hunt for a mysterious killer in this theatrical dining experience
Link
“Watching this reboot of Immersive 1984, a thought comes to mind: if, as we’re constantly being informed, we’re all living in the post-privacy, post-truth and post-politics world foretold in 1984, aren’t we already inside an immersive version of George Orwell’s seminal book?”
Full review
15. Jeff Wayne’s Musical Version Of The War Of The Worlds: The Immersive Experience
music and mayhem: who could ask for more from an immersive show?”
Full review
a group of people is summoned to discuss the crimes of a man who swears his innocence
Full review
“Thanks to some nifty “mixed reality” technology from Tin Drum, the late Japanese composer Ryuichi Sakamoto is brought back to some semblance of life in Kagami.”
Full review
“With tickets costing £400 each and a Lovecraftian storyline stretching over 24 hours
is Lemon Difficult’s The Key Of Dreams the ultimate in immersive theatre?”
Full review
its clear that The Magicians Table is too cool for school
It’s certainly too cool for a helpful apostrophe but it becomes obvious very soon that we’re talking about multiple illusionists including the recently departed Dieter Rotenburg
are gathered here to pay tribute to his final trick and enjoy the company of his fellow professionals.”
Full review
“Deadweight Theatre’s The Manikins: A Work In Progress is many things
this is a polished work of hidden depths.”
Full review
“May Contain Food May Contain You takes audiences on a journey through dance
Full review
“Almost as secretive and hidden away as the Batcave
Soho’s Park Row is a restaurant dedicated to the Caped Crusader
an immersive dining experience which combines projections
Full review
it's just the opposite.’ Attributed to Nobel Prize-winning economist and Ali G interviewee JK Galbraith
this is the phrase that rolls around my head as I take on the Crystal Maze-like Monopoly Lifesized
a highly entertaining take on arguably art's single greatest monument to the pursuit of personal wealth.”
Full review
“Featuring works as diverse as Michael Nyman’s ‘Strong on Oaks, Strong on the Causes of Oaks’ and Felix Mendelssohn’s ‘Overture’ from A Midsummer Night’s Dream
Sinfonia Smith Square’s environmentally-minded concert The Orchestral Forest is an enchanting sonic experiment.”
Full review
“It is not the only impressive immersive show in town but its near-peerless execution and boundless imagination puts it up there with the more well known Punchdrunk.”
Full review
“On top of an exciting live band and plenty of close-up magic
there’s a hefty Punchdrunk pedigree in the creative team behind this Jazz Age theme party.”
Full review
“As well as the traditional risk of getting picked for a dose of benign audience interaction
high-speed flying skates and even some full-frontal near-nudity to contend with.”
Full review
“Selecting a Ghost is a fantastic example of a site-specific performance with some brilliant actors that struggles to combine the genres of horror and hip hop to make for a fully cohesive show.”
Full review
“Tucked away in a secret location in the heart of Clerkenwell
with the address given only upon booking and its exact plot begged to be kept hush-hush in the press.”
Full review
“In a sudden lurch away from their epic 2022 creation The Burnt City
immersive specialists Punchdrunk’s next effort is a far more cosy affair.”
Full review
Theatres Trust, the national advisory and advocacy body for theatres, has announced the latest theatres to receive grants through its Small Grants Programme with The Linbury Trust.
Acclaimed award-winning actor Rosalie Craig will return to the West End stage this summer to star as June Levant in the London premiere of Good Night, Oscar.
In this version of the familiar story, we are whisked away to the 1800s American West. The sparring young men are now gun-touting cowboys, the ball is a barn dance, and the soundtrack is all banjos and whistles. It’s a bold transposition of the star-crossed Verona lovers, but one that works surprisingly well.
function closestickysocial(){document.getElementById("foxsocial").style.display="none";}@media(max-width:1024px){.most-popular,.video-row{display:block;margin-top:25px}}Videos
and exclusive discounts on tickets to your favorite shows
© 2025 - Copyright Wisdom Digital Media, all rights reserved. Privacy Policy
A photo of a vandalized airplane hangar at North Adams Airport shortly after its unsanctioned demolition in December of 2020
a jury awarded no damages in a civil trial that concerned this hangar and a legal
personal and commercial dispute between the hangar's former co-owners
On Thursday, Judge John Agostini dismissed the legal claim of voluntary waste in a civil trial between to parties over the destruction of the hangar.
PITTSFIELD — A jury has decided the North Adams Airport dispute is a draw
On Thursday, the jury in a civil trial in Berkshire Superior Court — featuring counterclaims between Derek Rougeau
Jackie Rougeau and Dodd Rougeau on one side and Michael Milazzo and Brian Doyle on the other — chose not to award damages to any of the involved parties
At issue was a vandalized hangar
which Milazzo and Doyle allegedly demolished without a permit in 2020
Judge John Agostini also dismissed the Rougeaus' legal claim of voluntary waste — that someone has intentionally damaged or destroyed property
reducing its value — regarding the hangar because he felt he couldn't rule on it in the context of the suit
and the Rougeaus followed with a counterclaim.
Testimony during the trial examined who used the excavator to damage the hangar
thanked the jury for their work on the weekslong trial
which was the culmination of years of personal and professional drama between the two parties
“we don’t agree with everything in the verdict.”
“We also respectfully disagree with the trial judge inasmuch as he dismissed several claims that we believe had relatively strong legal and factual merit without putting them to the jury to decide,” Hamdan told The Eagle on Thursday
“This included the claim for damage to the hangar.”
told The Eagle on Thursday that he feels the judge’s dismissal of the hangar claim means the Rougeaus “don’t have a claim period” as to Doyle and Milazzo being the culprits of the vandalized hangar
“The evidence shows a campaign of intimidation and harassment by the Rougeau brothers against Mr
Doyle to drive them both out of the hangar and destroy their business,” Smith said
Milazzo and Doyle are glad to be able to move on from this and get back to work
to move on from this whole chapter," Smith said.
While the jury portion of the trial is concluded
Agostini will adjudicate the rest of the case
Remaining claims concern financial contribution
breach of contract and unfair and deceptive acts
Hamdan said the Rougeaus are considering appealing
but can’t until Agostini rules on the rest of the case
One of the men who was implicated in an investigation into how the hangar was destroyed in late 2020 is the lone applicant to lease the renovated hangar
Rebuilding the hangar took hundreds of thousands of federal
The post “Monster gobbler taken during youth season” first appeared on MS-Sportsman.com
This page is available to subscribers. Click here to sign in or get access.
Louisiana’s 2025 turkey season begins March 29 for youth/physically challenged
Walker High School Fishing Team member Hunter Holland
wants to complete his four-year run as a high school bass angler on a high note.[…]
aromatic spices from across the globe.[…]
Louisiana sportsmen get a bonus opportunity to hunt squirrels during the spring season that runs May 3-25 with a daily limit of three.[…]
©2025 Louisiana Sportsman, Inc., All Rights Reserved. Employee Information
"The fanship in each community definitely thinks that their community has the most intense fans," says Conshohocken's Liselle Milazzo
"But fans of teams like the Eagles and the Bills tend to take things to more of an extreme."
Fandom expert Liselle Milazzo from Penn State’s Abington campus shares her insights into Eagles fans ahead of the Super Bowl
(photos via Penn State Abington and Getty Images)
I first have to ask how on earth someone chooses fandom as their area of expertise
I grew up surrounded by the Buffalo Bills fan community
because my dad is a proud Buffalo Bills fan
And then I developed a fanship for Harry Potter in my teens
participating heavily in that fan community
visiting sites I saw in pictures in the books
And I realized there is a whole world out there of people who are fans of all sorts of things
I originally studied the fan communities surrounding Harry Potter
And I started studying the fan community surround the Eagles when I moved here in 2023
The Eagles have such a vibrant fan community
and once Penn State formally approves my study
I look forward to actively recruiting research participants
What are commonalities among all these different fan communities
People make small to major changes in lifestyle
this might mean restructuring your Sundays come football season so that you have time to watch the games
Maybe you are suddenly inviting friends over who you wouldn’t normally invite to your home
but you will during the season because they are Eagles fans
maybe changing your financials so you can afford tickets to games
This is actually quite common in fan communities
Fans will have objects of interest on display
These objects can remind them that they are part of that community
A lot of people get a lot of pleasure sharing the same fan interest
You might have these social interactions around the water cooler or in a Facebook group or a group chat
One other interesting thing about all of these fan communities is that people don’t always have the same level of interest throughout their lives
Then you might have fans who watched a few games this season but are now really enthusiastic and excited because of how well the team has done
Maybe they are suddenly listening to sports talk on 94.1 when they never would have done that before
I think you’re actually pointing to yet another commonality between fan communities when you bring up the diehard versus casual fan
some criticism coming from diehard fans of anything when there are all of a sudden newbies joining the pack
There are people who feel like they’ve borne all the losses
So they can see themselves as the “true fans,” but there is also pushback to that narrative
And I think particularly when you have a big celebratory event like the Super Bowl
we see more welcoming narratives celebrating our shared identity
We like to think that Eagles fans are somehow special
or do people in most cities with NFL football teams think the same of their team’s fans
The fanship in each community definitely thinks that their community has the most intense fans
But fans of teams like the Eagles and the Bills tend to take things to more of an extreme
fans like to jump up and down on tables at the local bars until they break
Rooting for a team creates a connection between the fan and the team
Some academics would use the word “parasocial” to describe this fan-team relationship
But there is this relationship between the individual and the thing they are rooting for
It feels like an extension of identity when they win
a validation of our emotional and financial investment
you could go to any park and watch kids playing football and come away with the same feeling
I get invited to Eagles games a fair amount
I’d just rather watch with diehard fans at a neighborhood bar and all scream at the TV together
What’s with these people who are refinancing their houses so they can go to the Super Bowl
Some people have a different desire of intensity for that external involvement we spoke about earlier
Some people see being at the Super Bowl itself as an act of communitas
spontaneous feeling of closeness among other people going through the same experience
The sense of closeness is replicable at homes and bars
but when you’re at an event as big as the Super Bowl
you will all have this intangible memory of this shared cultural experience
“I was at the Super Bowl!” And that can come with some social cache within the fan community
It can also serve as a badge of honor that you were such a devoted fan that you were willing to go to whatever lengths to get to the Super Bowl
And those of us who don’t make it to the Super Bowl, we just run out into the streets in this crazed, spontaneous celebration
We need to have that special feeling of closeness
there comes this theory of places of memory
that’s applied to monuments and museums and historical sites
I’m starting to see that there are also newly created places of memory tied to fanship
Having a spontaneous celebration on Broad Street creates a new place of memory
you will be able to immediately pull up that night
And you’ve only been in Philly for a couple of years
I can’t wait to go down to Broad Street Sunday night
19 Things You Didn’t Know You Could Do at the Library
30 Must-Visit Pennsylvania State Historical Markers
The Grammy Awards: A Philadelphia Timeline of Winners and Memorable Moments
Inspired by the life story of entrepreneur and inventor Joy Mangano
the musical features music and lyrics by AnnMarie Milazzo
AnnMarie Milazzo is releasing a concept album of her musical Joy
inspired by the life of entrepreneur and inventor Joy Mangano. The Shape of Things: Songs From Joy the Musical will release January 17 via Joy Machine Records
Get a first listen to the album's title track
Pre-order and pre-save the album here
“Making this record was an opportunity for me to get back to my roots in the recording studio
working with my band and doing the thing I love most—writing and singing songs,” says Milazzo in a statement
The album was recorded and mixed at Renaissance Studio in NYC
The music video features videography by Harry McFann
The project sees Davenport and Milazzo stepping into new career areas
Davenport is a Tony-winning Broadway producer
noted for his work on the 2017 revival of Once On This Island
He previously co-wrote (with The Grundleshotz) the book to 2018's short-lived Gettin' the Band Back Together
Milazzo is best known as a vocal arranger and orchestrator
including on Davenport-produced projects Spring Awakening
Take a look at the full track listing below:
1. "Welcome to My World"2. "The Shape of Things"3. "I Got People"4. "Out of Here"5. "The Only Mop You'll Ever Need"6. "We Sell Stories" (with The Doo Wop Project)7. "Walk With Me" (with Drew Gehling)8
Visit JoyTheMusical.com.
Brought to you by Playbill Partner Hotels.
Gail Kriegel's new play follows a family affected by mental illness.
The Tony-winning Best Musical continues at the Walter Kerr Theatre.
Noah Himmelstein will direct Matthew Puckett's original musical.
Neumann is the Tony nominated choreographer behind Hadestown and Swept Away.
Finalists included Cole Escola's Oh, Mary! and Itamar Moses's The Ally.
The world premiere opera, based on a play by Gerber, is the second opera by Nottage and Gordon.
In the Sondheim revue, one Tony winner is playing the trumpet while the other is channeling Mama Rose.
The George Abbott, Douglas Wallop, Jerry Ross, and Richard Adler musical opened May 5, 1955.
Thank You!You have now been added to the list.
Blocking belongson the stage,not on websites.
Our website is made possible bydisplaying online advertisements to our visitors.
Please consider supporting us bywhitelisting playbill.com with your ad blocker.Thank you!
Follow MLS Multiplex on X (Twitter).
Her time with the Chicago Red Stars showed her ability to stand out in one of the most demanding positions in the game
She played a total of 1,133 minutes last season alone
emphasized the significance of her arrival: “Tatumn is an excellent defender who earned several individual accolades for her achievements with Chicago
We’re excited to welcome her to the club and look forward to seeing her impact on and off the field.”
Milazzo has peculiarities that distinguish her: combative
and with the rare ability to lift the level of the defensive unit performance
Milazzo's stats rank her as one of the most reliable players in the NWSL
having gathered 70 league appearances between playoff and NWSL Challenge Cup important games
She had managed to amass 171 tackles and 115 interceptions in that period
with four goals to show she could be effective in front of goal if called upon
Her first professional goal arrived in 2021 with a real screamer against OL Reign
she made three playoff appearances to advance the Chicago Red Stars to the final
in which they lost 2-1 to the Washington Spirit
What makes Milazzo's career even more impressive is her resilience
she played for the University of South Carolina
where she won three Southeastern Conference titles and helped her team reach the 2017 College Cup semifinals
But a torn ACL cut her senior season short
After surgery and months of rehabilitation
she joined the Chicago Red Stars' preseason roster and
she made her professional debut in an NWSL Challenge Cup match
coming on in the 87th minute of a 0-0 draw
© 2025 Minute Media - All Rights Reserved
The content on this site is for entertainment and educational purposes only
Betting and gambling content is intended for individuals 21+ and is based on individual commentators' opinions and not that of Minute Media or its affiliates and related brands
All picks and predictions are suggestions only and not a guarantee of success or profit
If you or someone you know has a gambling problem
crisis counseling and referral services can be accessed by calling 1-800-GAMBLER
Follow MLS Multiplex on X (Twitter).
The experienced defender joins after four standout seasons with Chicago Red Stars
Please select what you would like included for printing:
Copy the text below and then paste that into your favorite email application
Louisiana to the late Charles Vincent Baglio
and Alex Milazzo (Rachel); great-grandchildren
and Jack Milazzo; his brother Freddie Baglio and his wife
Cynthia; sister Ann Powell and her husband
Lisa Baglio Cullop (Shannon) and Rebecca; and sister-in-law Phyllis Guzzardo and her husband
Margaret Ann Micele Baglio; and daughter Marcie Carona; and nephew
affectionately known as "Coach Bags," left an indelible mark on the world of sports and education
beginning with an impressive 34 years at Independence High School
where he served as head coach for 22 years
Coach Bags led his team to nine district titles and two state championship appearances
but his greatest pride was in mentoring and shaping the young athletes who looked up to him
Baglio joined the LSU Tigers as Director of External Relations
where he played a key role through three head coaches
Known for his sharp mind and competitive spirit
Coach Bags also enjoyed an active retirement
leaving behind a legacy of inspiration and excellence
and great-grandchildren were his pride and joy
but his impact will be felt for generations to come
Relatives and friends are invited to attend the visitation at Harry McKneely & Son Funeral Home in Hammond
The visitation will continue the following day
beginning at 9:00 AM until the funeral mass begins at 11:00 AM.
Interment will follow in Colonial Cemetery
Harry McKneely & Son Funeral Home and Crematory-Hammond
Enter your phone number above to have directions sent via text
This site is protected by reCAPTCHA and the Google Privacy Policy and Terms of Service apply
Service map data © OpenStreetMap contributors
Planes sit on the airfield and runway in October at the Harriman-and-West Airport in North Adams
the city's Airport Commission rescinded its decision to award a hangar lease to Michael Milazzo
The North Adams Airport Commission rescinded its decision to award Michael Milazzo a lease for a refurbished Northeast Hangar at Harriman-and-West Airport
The hangar is the building with the red trim behind the one with the blue roof
The interior of a hangar at Harriman-and-West Airport in North Adams was damaged by vandals in late 2020
A 2021 police report named Michael Milazzo
as one of the suspects in the incident — but no charges were filed
the city Airport Commission rescinded its decision to lease the refurbished hangar to Milazzo
A sign marks the entrance of Harriman-and-West Airport in North Adams.
NORTH ADAMS — In October, members of the city's Airport Commission agreed in principle to award a hangar lease to Michael Milazzo
During a contentious special meeting Thursday evening
the commission appointed a new chair — Jim Haskins — and rescinded its vote to lease the newly refurbished Northeast Hangar to Milazzo
and agreed to reissue a request for proposals for the hangar in the future
Robert Grandchamp was the lone commissioner not to change his vote
The commission ultimately fell in line with Mayor Jennifer Macksey’s recommendation to rescind the lease award to Milazzo
who had to be told not to speak out of turn after repeatedly interrupting the meeting to make his displeasure known
He had been poised to open a business in the newly renovated hangar at the city-owned Harriman-and-West Airport
but the need for those renovations are at the heart of concerns about the commission's decision to grant him the lease
Milazzo was the subject of a 2021 police report alleging he and associate Brian Doyle vandalized the hangar with Milazzo’s excavator
What resulted was a yearslong rebuild of the hangar using city
and the city’s official stance is that it’s still unclear how the hangar was destroyed
The hangar's former co-owners remain in litigation with Milazzo and Doyle regarding the damage
“I believe each of you have an obligation to try to do the best thing for each taxpayer of the city of North Adams
and not the biased thought process of Mayor Macksey,” Milazzo said to commissioners before they voted Thursday
“Airport commissions must be free to manage the airport as they see fit
without interference from any city administrator.”
Former commission Chair Marc Morandi resigned from his position soon after the October meeting at which he was the lone vote against awarding the lease to Milazzo
In a letter sent to the commission in October
Macksey cited as a "procedural defect" the commission's decision to award the lease despite recommendations to the contrary by a committee it established to review the matter — and it did not provide justification for that decision.
Special Assistant to the Mayor Katherine Eade read a memo to the commission Thursday night from city Procurement Officer Stacy Abuisi
“The single proposal identified conditions that would require modifications to the leases but hadn’t specified what they were,” Abuisi wrote
and the RFP should be reworked and put out again at a future date.”
the airport will begin renting out space in the hangar to people on a wait list to store their aircrafts
Airport Manager Bruce Goff said he doesn’t want to kick out any tenants until they have elsewhere to go
meaning the RFP and getting more activity in the space may have to wait longer than the city/commission hopes for
The city is in the process of rebuilding/refurbishing the hangar
A police report shines light on the story behind the damage
the feud between four former hangar co-owners and why the city is footing part of the bill.
EDITORIAL: While the letter of the charter says Mayor Macksey does not need councilors' consent on appointments
the spirit of good governance suggests she should still avail herself of their advice
Get up-to-the-minute news sent straight to your device.