Reintroduced legislation intends to clean up Ontario’s public spaces Doug Ford floats idea of electing judges in rant on bail reform Ontario proposes bail reforms to keep repeat offenders behind bars Thousands without power after Ontario thunderstorms Sportsline: Hamilton native and TSN host Mark Roe Jonathan Pedneault steps down as Green party co-leader Hamilton police have arrested two people after seizing loaded firearms and illegal drugs from a vacant property Police say they were called to a vacant home in Hamilton on April 27 after the homeowner reported seeing strangers in the backyard Officers arrived at the scene around 2:25 p.m and were met by a group of people who told police that they were allowed inside the empty home the homeowner confirmed no one had permission to be there several more people fled from the basement where officers found a loaded 9mm handgun in plain view on a table Both people were arrested and discovered to be in possession of half an ounce of methamphetamine officers discovered a sawed-off shotgun that was hidden under a sweater Police have arrested and charged Steven Pacheco The pair face a total of nine charges related to drugs and weapons possession Pacheo is known to police and was wanted in connection to multiple violent offences including three counts of assault with a weapon READ MORE: Two people arrested following Burlington car theft investigation Emily Vukovic was at Linea Intima in Oakville checking out the array If your after-work financial plan is tanking – please don’t try this We are cranking things up a notch with a Mamma Mania Dance Sunny skies with light winds and cooler high of 13°C today glamjulz is supporting a ‘Joyful Journey’ CHCH-TV started broadcasting in 1954 and is proud to be the news leader for Hamilton and the surrounding Halton and Niagara regions Copyright © 2025 CHCH. All Rights Reserved. ZWD and trusted home for helpEasyDonate quickly and easily Send help right to the people and causes you care about Your donation is protected by the GoFundMe Giving Guarantee Alzheimer's Disease and Related Dementias Volume 15 - 2023 | https://doi.org/10.3389/fnagi.2023.1105620 This article is part of the Research TopicWomen in Alzheimer's Disease and Related Dementias: 2022View all 13 articles The global population is expected to have about 131.5 million people living with Alzheimer’s disease (AD) and other dementias by 2050 Dementia is a progressive neurodegenerative condition that gradually impairs physical and cognitive functions and heterogeneity concerning the influence of sex on prevalence The proportion of male-to-female prevalence varies based on the type of dementia Despite some types of dementia being more common in men women have a greater lifetime risk of developing dementia AD is the most common form of dementia in which approximately two-thirds of the affected persons are women Profound sex and gender differences in physiology and pharmacokinetic and pharmacodynamic interactions have increasingly been identified In the heart of a rapidly aging worldwide population the Women’s Brain Project (WBP) was born from the necessity to address the sex and gender gap in AD WBP is now a well-established international non-profit organization with a global multidisciplinary team of experts studying sex and gender determinants in the brain and mental health WBP works with different stakeholders worldwide to help change perceptions and reduce sex biases in clinical and preclinical research and policy frameworks WBP is an example of the importance of female professionals’ work in the field of dementia research and various initiatives in the policy and advocacy space have profoundly impacted the community and driven global discussion WBP is now in the initial phases of establishing the world’s first Sex and Gender Precision Medicine Institute This review highlights the contributions of the WBP team to the field of AD This review aims to increase awareness of potentially important aspects of basic science policy framework and provide the research community with potential challenges and research suggestions to leverage sex and gender differences we briefly touch upon our progress and contribution toward sex and gender inclusion beyond Alzheimer’s disease In fact, AD has been shown to be more frequent in women than in men (Martin Prince et al., 2015). Since aging is one of the most critical risk factors in developing AD, the higher female frequency has often been associated with men’s shorter life span than women (Kim et al., 2015; Podcasy and Epperson, 2016); however increasing evidence indicates that this is not the only reason; biological as well as socio-cultural mechanisms are probably at play The biological traits that differ between men and women are referred to as sex These are genetically defined physical features that result from the expression of sex chromosomes and are generated throughout puberty by hormonal stimulation gender is a socio-cultural concept that includes behaviors attributed to being feminine and masculine that are specific to a given culture Each society has culturally imposed behavioral and temperamental features that are deemed proper for males and females disparities that impact aspects such as education Both sex and gender are determinants of health, according to the World Health Organization [WHO], 2021 the role of sex and gender was seldom acknowledged and their study was considered a niche topic the higher frequency among women living with AD was rarely acknowledged and most scientists considered it negligible in clinical research the sex and the gender of individuals involved in clinical development were often not described nor analyzed explicitly with regard to the disease’s characteristics the sex of the animals used in preclinical studies was often not reported or discussed the burden of caregivers (including emotional and financial) which mainly falls on the female population was not recognized or addressed by specific policy actions at the time WBP was founded in Switzerland in 2017 as a non-profit association to study sex and gender determinants of the brain and mental health as the gateway to precision medicine It is composed of professionals hailing from different disciplines with strong female leadership WBP has contributed to more than 50 papers and 20 policy-led documents and engaged in more than 50 collaborations with different stakeholders Its work has had a profound impact on the community and has inspired several other organizations resulting in the strengthen of ad hoc working groups such as the Coordinating Panel of Diversity Equity and Inclusion at the European Academy of Neurology (EAN) the Gender mainstreaming group at OECD and the Center for Gender Medicine (CfGM) at Karolinska Institutet WBP has been focused on pushing the boundaries of sex and gender in AD we have helped and worked with experts from other areas apart from AD the scientific work we have done in AD in terms of basic research and policy was cross-applied by our collaborators and us to other diseases with success in this article we first highlight our main contributions to the field of AD in terms of basic science we provide the research community with practical suggestions to leverage sex and gender differences in research studies and finally we briefly touch upon our contribution toward sex and gender inclusion beyond AD WBP has contributed to the identification of profound differences in brain and mental diseases at large The studies have revealed that such differences are complex and multifaceted involving both biological (sex) and socio-cultural (gender) aspects; they interest all levels of research and can also be found in novel technologies to properly address the complexity of the topic the activity of the WBP has developed around four main pillars of interest: basic science can profoundly affect disease mechanisms as well as drug development the sex of the animals used in preclinical studies is often not reported or discussed Such lack of consideration of the sex of animals in preclinical studies leads to a knowledge gap and has likely hindered therapeutic innovation The basic science study of sex differences in brain physiology and drug mechanism of action is the first pillar of WBP’s work Clinical differences between men and women are crucial areas of interest in the WBP’s work. These refer to physiology, pharmacokinetics and pharmacodynamics interactions as well as symptoms (e.g., Butlen-Ducuing et al., 2021); identifying such differences calls for tailored approaches in diagnosis, care and patient journeys in AD but also in other diseases (Liberale et al., 2018) Thanks to the advent of high-throughput advanced technologies statistical models and computational tools we now have novel potential digital biomarkers for early diagnosis of AD The role of sex and gender in novel digital health technologies particularly for AD the study of differences between men and women cannot neglect the role of gender meant as the socio-economic and socio-cultural construct of being a man or a woman in society As socio-economic determinants of health are modifiable a significant line of WBP activities has focused on policy-related projects to highlight existing gender differences and gender-based inequity in these determinants of health and how policymakers could address them The results gathered in the past 5 years based on these four pillars have been collected in a first textbook on the topic, “Sex and Gender Differences in Alzheimer’s Disease” (Ferretti et al., 2021) we highlight some of the major contributions and lessons learned by the team with useful recommendations When it comes to studies in animal models, it is mistakenly believed that data from preclinical studies using female animals are complicated to analyze due to the higher variance associated with the estrous cycle; as a result, there have been comparatively few preclinical investigations done using female mice, or both male and female, in many fields of neuroscience (Beery and Zucker, 2011; Karp et al., 2017; Karp and Reavey, 2019) it is now known that female mice are not more variable than male mice It is important to note that drug pharmacokinetics (PK) and pharmacodynamics (PD) can potentially differ among the sexes and it may be crucial in these circumstances to gather PK/PD data for both sexes already in preclinical studies and then assess whether or not to incorporate a design for potential sex differences in human dosage-finding trials to determine the ideal dose neuroscience is quickly embracing the use of new and complex in vitro models of disease mechanisms and drug response we currently examine how sex differences can be accounted for in vitro We argue that in vitro models of increasing complexity should account for a sex as an experimental variable we propose practical recommendations as to how to investigate sex differences (if not known) or address (if known) them (Castro-Aldrete This sex and gender difference is only one but a powerful example of patient heterogeneity a sex-sensitive clinical diagnosis of AD dementia based on biomarkers is still needed In addition to genetic risk factors, modifiable, life-style related risk factors are well known to affect risk (as much as 40%) of AD (Livingston et al., 2020). It is important to highlight that most of such modifiable risk factors are known to occur differently across sexes and genders since inequities are not only linked to biological sex but also to gender, as summarized by Ferretti et al. (2020) Regarding modifiable vascular and lifestyle-related risk factors, the Finnish Geriatric Intervention Study to Prevent Cognitive Impairment and Disability (FINGER) has demonstrated that a multidomain intervention could improve or maintain cognitive functioning in at-risk elderly people from the general population (Ngandu et al., 2015) The occurrence of sex and gender differences in risk factors calls for tailored preventative campaigns for men and women and might also be a key element to consider in patient stratification for clinical trials and overall study design additional barriers might exist and need to be identified across the patient journey novel technologies are emerging also in AD and will most likely become crucial tools to support the patient journey in AD technological innovations in digital technologies and data analytics provide an umbrella of opportunities to estimate health variables to improve personalized health outcomes Digital Health refers to the use of data and communication technologies to promote wellness and Digital health technologies use computing platforms Examples of Digital Health technologies are mobile medical apps intended to improve clinical decisions to diagnose and treat diseases These apps collect users’ data which are subsequently stored and analyzed to enhance health status Digital biomarkers and predictive algorithms promise to dramatically change the landscape of medicine greatly improving and streamlining health management from risk factors monitoring to diagnosis and treatment The field is developing today the technologies that will be used in the next decades and it is important to be aware of sex and gender aspects also in this field Bias is a hidden issue of most databases used to generate algorithms; as such the risk as highlighted in other fields using artificial intelligence (AI) is to generate biased tools that do not serve the whole population The AD community needs to investigate whether gender biases might affect the efficiency of AI tools for health sex-specific characteristics might be leveraged to improve the efficiency of such digital tools the WBP has a dedicated working group focusing on this topic and has contributed to our understanding of how even such technologies must consider sex and gender aspects On the other hand, until last year, it was not known whether sex differences would be also present also in digital biomarkers. To study this, the WBP has partnered with Altoida Inc., which has created the Neuro-Motor Index (NMI), a digital biomarker application dedicated to early AD diagnosis. The NMI measures cognition via augmented reality (AR) and motor skills in the fingers with an aim to replicate daily activities and tasks (Buegler et al., 2020) the successful differentiation in healthy individuals shows that males and females have distinct differences in their neurocognition as detected by the NMI These results prove that the sex of a patient can affect digital biomarkers; more studies will be needed to confirm and explain these findings we advocate for digital biomarker programs to factor in sex when gathering data Digital biomarkers are only one example of the power of AI-driven solutions in healthcare AI-powered data analysis can detect specific patterns that can be leveraged to improve therapeutic and preventative measures against diseases at large While this field it’s just at its inception in AD it is much more developed in other branches of medicine the value of AI in medicine has been highlighted during the Coronavirus Disease 2019 (COVID-19) pandemic which has revealed how unprepared healthcare systems are we believe that AI is the key to preparing the healthcare system for future pandemics and AI aims to incorporate patient data to make informed decisions concerning patient care and treatment plans Constant legislative and policy adaptation to current technological innovation in a rapidly evolving field such as AD is vital for trustworthy relationships and policy framework in clinical trials is only one of them At the core of WBP we are working toward bridging science and society educating policymakers and raising awareness on important societal and economic aspects linked to brain health The work of the WBP in policy and advocacy includes response to the global policy agenda by contributing to ongoing initiatives as well as driving WBP-led projects and deliverables with evidence generation tailored support measures for men and women as caregivers These results are important for driving ad hoc communication campaigns to educate and raise awareness of brain health in the population which is key for disease prevention in society The importance of brain health in the global agenda has been underscored recently by the, WHO position paper on brain health, to which WBP has contributed (World Health Organization [WHO], 2022c) is the intersection between brain health and aging Prevention of age-related disorders is increasingly becoming a key global goal and to support the discussion in this field WBP is working alongside other partners to understand longevity in the context of brain health Together with the OECD the WBP is demonstrating the importance of building and protecting our own brain health, which we call “late-life Brain Capital.” We have argued that investing in late-life Brain Capital can help older persons retain, engage, and empower themselves (Dawson et al., 2022) A combination of public health strategies targeting tobacco use cardiovascular disease management and prevention can reduce the likelihood of cognitive decline by making an investment in late-life brain capital these actions need to consider specific needs of segments of the population The study of sex and gender differences is highly relevant for policymakers as it can support the development of strategies for prevention early detection and better treatment of diseases that present a huge medical need and socio-economic cost we realize that sex and gender-sensitive medicine is still in its infancy in neurology and psychiatry The WBP has therefore convened a dedicated series of regulatory roundtables to discuss the best way to integrate sex and gender-sensitive medicine in developing solutions for neurological patients the WBP is currently in the process of establishing a foundation and a dedicated research institute to strive for innovation in sex and gender-sensitive precision medicine for brain and mental disorders Figure 1. The Women’s Brain Project toward a sex-sensitive Alzheimer’s disease (AD) approach. Figure shows key recommendations (blue boxes) from which Alzheimer’s and brain research milestones (white boxes) will benefit in constant feedback to accurately capture the impact of sex and gender and develop precision medicine agendas. Created with Biorender.com Useful resources for conducting sex and gender research particularly those from racial or ethnic minority backgrounds due to limited access and exclusion from app creation gender imbalance in digital health leadership We believe that societies can benefit from digital health and AI approaches by developing national dementia frameworks that prioritize actions to reduce the digital gap between digitally disadvantaged and advantaged individuals Guaranteed access to early and accurate diagnosis -including digital health- and equity in the actions needed to diminish caregiver psychological and financial burden must have high priority The WBP team has made important contributions to the study of sex and gender differences in AD as well as its awareness in society and its consideration at the policy level Sex and gender differences occur and are important in neurology and psychiatry well beyond AD and this is captured by the work of our group in other fields of medicine To give a few examples, WBP has contributed to the characterization of sex and gender aspects in traumatic brain injury (Rauen et al., 2021), neuropathic pain Parkinson’s disease and schizophrenia in a dedicated, WBP-led special issue in the journal Frontiers in Neuroendocrinology (Szoeke et al., 2020), stroke (Sandset and Ferretti, 2021) and in brain health (de Lange et al., 2021) As an example of WBP response to the ongoing policy actions, we have contributed, as members of the OneNeurology group, to the Global Action Plan on Epilepsy and other neurological disorders by the WHO, to make sure that sex and gender aspects in neurology are part of the research agenda (World Health Organization [WHO], 2022b) The specific needs of female migraine patients have been highlighted in several ad hoc policy and awareness projects such as #notallinherhead social media campaign Awareness campaigns and communication programs are run by the WBP team also for psychiatric disorders such as depression Interestingly, the COVID-19 pandemic has revealed the importance of sex and gender differences and the WBP has been particularly active in documenting such differences and advocating for their consideration in clinical trials (Grisold et al., 2021; Jensen et al., 2021, 2022) Finally, we have advocated for the proper consideration of sex and gender in the context of drug development (Ferretti and Galea, 2018), particularly for neurological and psychiatric disorders that present an unmet medical need (Butlen-Ducuing et al., 2021) The work done by the team at WBP showcases the power of female leadership a diverse and multidisciplinary team in the field of Alzheimer’s research and beyond Collaboratively the WBP have helped to change perceptions increase visibility and reduce sex biases in preclinical research Incorporating specific individual needs (including those driven by sex and gender aspects) will be key to reaching a precision medicine approach in AD as well as personalized patient management for a more sustainable healthcare and GP collected and cataloged the literature and ASD contributed substantially to the content discussion and reviewed/edited the manuscript before submission and ASD provided the resources and supervision All authors contributed to the article and approved the submitted version This manuscript has been written on behalf of the whole Women’s Brain Project For a list of team members please see: Women’s Brain Project The Women’s Brain Project would like to extend thanks to the contributors of the research manuscript and sponsors who generously gave their time and expertise to the Women’s Brain Project mission MTF is the co-founder and Chief Scientific Officer of the non-profit organization the WBP In the past 2 years she has received personal fees from Eli Lilly for projects not directly related to the present paper and also co-founder and pro bono CEO of the WBP ASD is also co-founder of the non-profit organization the WBP This position paper represents LC-A and ASC personal view only and not the position of any group or entity with which they are associated The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher in Sex and Gender Differences in Alzheimer’s Disease Sex modifies the APOE-related risk of developing Alzheimer disease Alzheimer’s Disease International, and McGill University (2022). Life after Diagnosis: Navigating Treatment, Care and Support. Available online at: https://www.alzint.org/resource/world-alzheimer-report-2022/ (accessed November 19 Google Scholar Summary of the evidence on modifiable risk factors for cognitive decline and dementia: a population-based perspective Sex bias in neuroscience and biomedical research New insights into the genetic etiology of Alzheimer’s disease and related dementias BlueJeans (2016). BlueJeans Network. Available online at: https://bluejeans.com/playback/s/0Ra60FQEledQlOf0P9Wq3fe1R8Qsj9iu8XleSivjLiTGhTYgYJ3pHOFFUTxotdyB (accessed February 18 Google Scholar Budin-Ljøsne Public perceptions of brain health: an international Digital biomarker-based individualized prognosis for people at risk of dementia Implications of sex-related differences in central nervous system disorders for drug research and development Canadian Institutes of Health Research (2022). Sex and Gender Research and Methods. Available online at: https://cihr-irsc.gc.ca/e/49629.html (accessed February 7 Google Scholar Dealing with gender bias issues in data-algorithmic processes: a social-statistical perspective Sex differences in functional and molecular neuroimaging biomarkers of Alzheimer’s disease in cognitively normal older adults with subjective memory complaints CIHR (2019). IGH Learning - CIHR. Available online at: https://cihr-irsc.gc.ca/e/49347.html (accessed January 29 Google Scholar Sex and Gender Bias in Technology and Artificial Intelligence: Biomedicine and Healthcare Applications Google Scholar Sex and gender differences and biases in artificial intelligence for biomedicine and healthcare Why the sexes don’t feel pain the same way PubMed Abstract | CrossRef Full Text | Google Scholar Sex-specific association of the X chromosome with cognitive change and tau pathology in aging and Alzheimer Disease The scientific body of knowledge: Whose body does it serve A spotlight on women’s brain health Drug Trials Snapshots (2022). Drug Approvals and Databases. Available online at: https://www.fda.gov/drugs/drug-approvals-and-databases/drug-trials-snapshots (accessed February 9 Google Scholar Google Scholar Economist Impact (2023). Sex, gender and the brain: towards an inclusive research agenda. Available online at: https://impact.economist.com/perspectives/sites/default/files/womensbrainproject_report_230306.pdf Google Scholar Erol, R., Brooker, D., and Peel, E. (2015). Women and Dementia A Global Research Review. Available online at: https://www.alzint.org/resource/women-and-dementia-a-global-research-review/ (accessed November 19 Google Scholar Sex-related differences in the prevalence of cognitive impairment among overweight and obese adults with type 2 diabetes European Union (2011). Gendered Innovations | Stanford University. Available online at: https://genderedinnovations.stanford.edu/ (accessed January 29 Google Scholar Longitudinal change in CSF biomarkers in autosomal-dominant Alzheimer’s disease Google Scholar Sex-dependent autosomal effects on clinical progression of Alzheimer’s disease and ethnicity on the association between apolipoprotein E genotype and Alzheimer Disease: a meta-analysis Sex and Gender Differences in Alzheimer’s Disease CrossRef Full Text | Google Scholar Improving pharmacological treatment in brain and mental health disorders: the need for gender and sex analyses Sex differences in Alzheimer disease — the gateway to precision medicine Sex and gender differences in Alzheimer’s disease: current challenges and implications for clinical practice The need for feminist intersectionality in digital health The promises and pitfalls of sex difference research Ge-academy (2019). Gender Equality Training Materials. Available online at: https://ge-academy.eu/ (accessed February 20 Google Scholar Gender Experts (2021). Gender ExpertsA Global Database. Available online at: https://genderexperts.org/ (accessed February 19 Google Scholar Gendered Innovations (2019). Sex and Gender Methods for Research. Available online at: https://genderedinnovations.stanford.edu/ (accessed February 3 Google Scholar Göttgens The impact of sex and gender on the multidisciplinary management of care for persons with Parkinson’s Disease Gove, D., Capstick, A., Ettenes, P., Georges, J., Gzil, F., Harper, P., et al. (2022). Sex, Gender and Sexuality in the Context of Dementia: a Discussion Paper. Available online at: https://www.alzheimer-europe.org/sites/default/files/2022-02/2022-02-25%20Alzheimer%20Europe%20ethics%20report%202021.pdf (accessed November 6 Google Scholar Gender issues during the times of COVID-19 pandemic Global estimates on the number of persons across the Alzheimer’s disease continuum Revolution of Alzheimer precision neurology passageway of systems biology and neurophysiology Precision medicine and drug development in Alzheimer’s disease: the importance of sexual dimorphism and patient stratification Digital biomarkers and sex impacts in Alzheimer’s disease management – potential utility for innovative 3P medicine approach Informal caregiving and Alzheimer’s Disease: the psychological effect Mapping of European activities on the integration of sex and gender factors in neurology and neuroscience Menopause hormone therapy significantly alters pathophysiological biomarkers of Alzheimer’s disease Higher rates of decline for women and apolipoprotein E epsilon4 carriers Sex differences in the association between midlife cardiovascular conditions or risk factors with midlife cognitive decline Illán-Gala Sex differences in the behavioral variant of frontotemporal dementia: a new window to executive and behavioral reserve Institute of Gender in Medicine (2023). Gender-Sensitive Prevention Research in Medicine. Available online at: https://gender.charite.de/en/research/ (accessed February 19 Google Scholar and beta-amyloid across the adult life span Janusinfo. (2022). Janusmed Sex and Gender. Available online at: https://www.janusinfo.se/genus/in-english?letter=X (accessed February 20 Google Scholar Sex and gender differences in the neurological and neuropsychiatric symptoms of long COVID: a narrative review Google Scholar Highly accurate protein structure prediction with AlphaFold Prevalence of sexual dimorphism in mammalian phenotypic traits Sex bias in preclinical research and an exploration of how to change the status quo Gender differences in risk factors for transition from mild cognitive impairment to Alzheimer’s disease: a CREDOS study Ischemic stroke across sexes: What is the status quo LIBRA (2021). Unifying Innovative Efforts of European Research Centres to Achieve Gender Equality in Academia. Available online at: https://www.eu-libra.eu/ (accessed February 10 Google Scholar Marked gender differences in progression of mild cognitive impairment over 8 years and care: 2020 report of the Lancet Commission Effect of gender and apolipoprotein E genotype on response to anticholinesterase therapy in Alzheimer’s disease Google Scholar Cognitive trajectories of older adults with prediabetes and diabetes: a population-based cohort study Martin Prince, A., Wimo, A., Guerchet, M., Gemma-Claire Ali, M., Wu, Y.-T., Prina, M., et al. (2015). World Alzheimer Report 2015: The Global Impact of Dementia: An Analysis of Prevalence, Incidence, Cost and Trends. Available online at: https://www.alzint.org/resource/world-alzheimer-report-2015/ (accessed November 19 Google Scholar Proportion of women and reporting of outcomes by sex in clinical trials for Alzheimer Disease: a systematic review and meta-analysis Sex and gender differences in Alzheimer’s Disease dementia Google Scholar Sex and gender in Alzheimer’s disease – Does it matter Multi-feature computational framework for combined signatures of dementia in underrepresented settings Sex and Gender Differences in Neurological Disease Google Scholar Increased Alzheimer’s risk during the menopause transition: a 3-year longitudinal brain imaging study National Institutes of Health (2023). Bench to Bedside: Integrating Sex and Gender to Improve Human Health Course. Available online at: https://orwh.od.nih.gov/career-development-education/e-learning/bench-bedside (accessed February 11 Google Scholar Apolipoprotein E genotype and sex risk factors for Alzheimer Disease and vascular risk monitoring versus control to prevent cognitive decline in at-risk elderly people (FINGER): a randomised controlled trial Nordström Traumatic brain injury and the risk of dementia diagnosis: a nationwide cohort study Oertelt-Prigione GenderMedDB: an interactive database of sex and gender-specific medical literature Chromosomal and environmental contributions to sex differences in the vulnerability to neurological and neuropsychiatric disorders: Implications for therapeutic interventions Earliest accumulation of β-amyloid occurs within the default-mode network and concurrently affects brain connectivity Considering sex and gender in Alzheimer disease and other dementias CrossRef Full Text | Google Scholar PORTIA (2020). #ACTonGender. Available online at: https://act-on-gender.eu/portia (accessed February 18 Google Scholar “Analysis of the Alzheimer’s patient journey through a sex and gender lens: initial results from an international survey,” in Proceedings of the international Conference on Alzheimer’s and Parkinson’s Diseases (ADPD) Sex and gender driven modifiers of Alzheimer’s: the role for estrogenic control across age Quality of life after traumatic brain injury: a cross-sectional analysis uncovers age- and sex-related differences over the adult life span Research on Women’s Health (2023). Putting Science to Work for the Health of Women. Available online at: https://orwh.od.nih.gov/ (accessed January 19 Google Scholar Baricitinib as potential treatment for 2019-nCoV acute respiratory disease Sex and gender differences research design for basic and population studies: essentials for investigators The role of sex and gender in the selection of Alzheimer patients for clinical trial pre-screening Sex and gender differences in stroke—The need for individualised follow-up Artificial intelligence-aided precision medicine for COVID-19: strategic areas of research and development Improved protein structure prediction using potentials from deep learning Shansky, R. M., and Anne, Z. (2021). Biomedical Research Falls Short at Factoring in Sex and Gender. Available online at: https://www.scientificamerican.com/article/biomedical-research-falls-short-at-factoring-in-sex-and-gender/ (accessed February 19 Google Scholar Effect of psychological first aid program on stress level and psychological well-being among caregivers of older adults with Alzheimer’s disease “Evaluating gender bias in machine translation,” in Proceedings of the Conference ACL 2019 - 57th Annual Meeting of the Association for Computational Linguistics Investigating for bias in healthcare algorithms: a sex-stratified analysis of supervised machine learning models in liver disease prediction Improving detection of amnestic mild cognitive impairment with sex-specific cognitive norms Better verbal memory in women than men in MCI despite similar levels of hippocampal atrophy Beyond sex differences: a spotlight on women’s brain health Taslem Mourosi The sex and gender dimensions of COVID-19: a narrative review of the potential underlying factors Tunyasuvunakool Highly accurate protein structure prediction for the human proteome Biomarker-based prognosis for people with mild cognitive impairment (ABIDE): a modelling study AlphaFold protein structure database: massively expanding the structural coverage of protein-sequence space with high-accuracy models Association of diabetes mellitus and mild cognitive impairment in middle-aged men and women World Health Organization [WHO] (2021). Social Determinants of Health. Available online at: https://www.who.int/publications/i/item/WHO-IER-CSDH-08.1 (accessed November 19 Google Scholar World Health Organization [WHO] (2022a). A Blueprint for Dementia Research. Available online at: https://apps.who.int/iris/handle/10665/363341 (accessed November 19 Google Scholar World Health Organization [WHO] (2022b). Intersectoral Global Action Plan on Epilepsy and Other Neurological Disorders. Available online at: https://apps.who.int/iris/handle/10665/325293 (accessed November 19 Google Scholar World Health Organization [WHO] (2022c). Optimizing Brain Health Across the Life Course. Available online at: https://www.who.int/publications/i/item/9789240054561 (accessed November 19 Google Scholar The Epidemiology of Alzheimer’s Disease Modifiable Risk Factors and Prevention Schumacher Dimech A and Santuccione Chadha A (2023) Sex and gender considerations in Alzheimer’s disease: The Women’s Brain Project contribution Copyright © 2023 Castro-Aldrete, Moser, Putignano, Ferretti, Schumacher Dimech and Santuccione Chadha. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) distribution or reproduction in other forums is permitted provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited in accordance with accepted academic practice distribution or reproduction is permitted which does not comply with these terms *Correspondence: Laura Castro-Aldrete, bGF1cmEuY2FzdHJvLndicEBnbWFpbC5jb20= Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher 94% of researchers rate our articles as excellent or goodLearn more about the work of our research integrity team to safeguard the quality of each article we publish '+n.escapeExpression("function"==typeof(o=null!=(o=r(e,"eyebrowText")||(null!=l?r(l,"eyebrowText"):l))?o:n.hooks.helperMissing)?o.call(null!=l?l:n.nullContext||{},{name:"eyebrowText",hash:{},data:t,loc:{start:{line:28,column:63},end:{line:28,column:78}}}):o)+" \n '+(null!=(o=c(e,"if").call(r,null!=l?c(l,"cta2PreText"):l,{name:"if",hash:{},fn:n.program(32,t,0),inverse:n.noop,data:t,loc:{start:{line:63,column:20},end:{line:63,column:61}}}))?o:"")+"\n"+(null!=(o=(c(e,"ifAll")||l&&c(l,"ifAll")||n.hooks.helperMissing).call(r,null!=l?c(l,"cta2Text"):l,null!=l?c(l,"cta2Link"):l,{name:"ifAll",hash:{},fn:n.program(34,t,0),inverse:n.noop,data:t,loc:{start:{line:64,column:20},end:{line:70,column:30}}}))?o:"")+" By continuing to use our site, you agree to our Private Policy and Terms of Use I recently told someone that my mom was a drug addict "Was it prescription pills?" he asked Perhaps because so many mothers in the 1970s took what the Rolling Stones made famous in "Mother's Little Helper" (i.e. there's a presumption that because I look white and middle-class my mother must be a nice old lady who used to dabble in stuff that wasn't illegal and wasn't really drugs.The truth is (usually male) criminals who live and die in roach-infested pay-by-the week motels or crowded urban homeless shelters.None of those descriptions fit her she is a gender-based abuse survivor with enduring mental health issues like Philip Seymour Hoffman and River Phoenix before him my mother is an addict with a brain disease that both causes drug-seeking behavior and That fried egg commercial with the "This is your brain on drugs" voiceover It was quite apt; that cautionary tale was about my mother.There's a distinction we make between drug addicts and us yet many LGBT people are addicts without even recognizing it in part because we have a culture built on imbibing Happy hour socials and circuit parties act as addiction tourism how many people at any given Pride festival this summer drugs were long a part of LGBT culture before our image -- if not the reality of our lives -- was cleaned up for mainstream appeal "Many people view an addict as someone who doesn't have strong will power or discipline and lacks moral character but nothing could be farther from the truth," says Joe Putignano a gay athlete and author of the addiction memoir Acrobaddict chronic disease that if left untreated could be fatal." In his memoir Putignano vividly describes his decline from healthy competitive gymnast to homeless heroin addict and back to active performer and taking acid and ecstasy while I was competing in gymnastics," he recalls "I was 17 years old and it was only recreational use at that time the quicker I found a solution to the many challenges I experienced in my life."One of those challenges was being gay."I'm not an addict because I'm gay," Putignano is quick to point out being gay may have exacerbated my need to blot out negative emotions and many people find different ways to cope with life Using alcohol and other drugs can instantly and significantly alter moods from sadness to euphoria Once I discovered how easy and powerful this was I made a decision to never live without it."That's one of the drivers of the crystal meth epidemic among gay men not just in the bedroom (we've all heard about marathon sex-on-meth sessions) but those that come from residual guilt from internalized homophobia left over from childhood A study from the University of Pittsburgh in the academic journal Addiction put the risk of substance use among LGB youth (trans kids were not included in study) at 190% higher than for heterosexual youth overall -- for bisexual kids and lesbian youth than non-queer youth.But you don't need to be queer to use According to the National Survey on Drug Use and Health an estimated 23 million Americans age 12 or older use illegal drugs each month For every party monster there is a Hoffman middle-aged professional with a lifelong addiction who died not in front of a bustling nightclub but alone in the silence of his own home.The day before I sat down to write this two gay men were found dead of alleged overdoses in New York a much-beloved 37-year-old trainer from West Hollywood This came on the heels of new funding allocated by the West Hollywood City Council to raise awareness of the danger of crystal and GHB among the city's gay residents "Meth will make you lose your teeth and your mind Above: Joe PutignanoBy the time Putignano got to college he had already developed an obsession with cocaine which led to a horrendous prescription drug problem and even wore out his welcome crashing on his dealers' sofa That's what finally landed him in a homeless shelter "The strange thing was that I hadn't even started using heroin yet I believed I was a 'professional' drug addict and knew how to use without it turning into a problem This is one of the popular lies we like to tell ourselves: 'I can do this I don't have a problem because I don't do it every day' -- and then there's my all-time favorite: 'Just one more time.'"Hoffman's death dovetailed with a rash of heroin-related deaths in the Northeast 22 people died after a batch of heroin that was mixed with fentanyl a narcotic that can be up to 100 times more potent than morphine learning of the deaths propelled them to seek sobriety; for many more it led to the oft-repeated mantra "That must have been some really great stuff."What pushed him to sobriety "What really scared me wasn't dying of addiction but living with addiction." He felt a constant struggle between being high and attempting to get clean: "I had been trying to get clean from the time I was 19 to 29 years old I was just throwing punches at a tornado."When he was 27 "A therapist in my last rehab gently pushed the idea on me that maybe I could go back to something I had loved as a child but do it without the restraints of perfectionism and overachieving This idea burned inside me and while I was in the rehab but I can say I worked hard and didn't give up on my dreams."After his recovery he joined the cast of Cirque du Soleil's Totem began studying for a degree in health studies appearing on television shows such as Anderson Cooper 360 and CNN's Sanjay Gupta as a gay former addict.Putignano is especially interested in reaching gay and trans users We're a set of communities that have historically relied on nightlife as the only discrete way to congregate with other LGBT people and many who have felt what Putignano calls the "soul-crushing feelings of worthlessness and many other negative emotions" are self-medicating with alcohol and other drugs even in today's more tolerant America.But experts like Joseph Sharp agree that drug use is not a moral issue -- and by not recognizing this are five times more likely to become HIV-positive than those who don't use drugs and as much as 70% of users inject the drug rather than smoking or snorting it and many other conditions.And most won't face their addiction and the risky behaviors it causes I could not comprehend people who didn't drink alcohol or use other drugs and attractive -- is frequently approached by people who want to talk "The people who approach me are usually friends of addicts or addicts themselves and all romantic endeavors take a back seat to this So while it might be nice to meet my future husband at one of my book signings it hasn't happened yet." But the point is that with his addiction under control it might.My mom has been (mostly) off drugs and alcohol for over two decades and the stigma only adds stress to an already fragile psyche fighting a lifelong battle that many people lose But what surprises most people is that she has always looked like any other nice a year after a stroke and a brief hospitalization for psychosis she's just another senior in her senior village One has to wonder if the conversation after Hoffman's death and the new gay tell-alls are part of America finally coming out about addiction Maybe by holding up the mirror and looking honestly at what we see some of us will recognize something of ourselves in these stories and be sufficiently inspired to get the help we need -- or get our loved ones the help they need -- before it's too late Douglas Blyde interviews the bar manager of Ginger Lily a luxurious bar inside Europe’s first Pan Pacific hotel in the City of London the ginger lily is a symbol of strength and commitment – attributes which reflect the ethos of Pan Pacific my twist on the Singapore Sling using ratafia liqueur instead of cherry brandy yielding more body with the theme – currently birds of paradise at the beginning of the curvaceous Italian marble counter – changing each Friday Somebody once called the bar Tiger Lily by mistake which we weren’t that happy about… Is there another drink which reflects the bar Vermouth Classico del Professore infused with basil How long have you led the Ginger Lily team I’ve been with the company for seven months I’m so pleased Ginger Lily has finally opened It is my second opening after Seabird atop The Hoxton in Southwark Italy and Spain brings lots of influences which helps to create a memorable experience for our guests where we can connect with people and share feelings and emotions simply through flavours I need only five minutes to see if you have fire in your eyes – if you move me And we never have ‘issues’ – we have ‘concerns’ and ‘solutions’ we all make and serve and explain the menu; I polish glasses as much as anyone else which means attention to detail is everything which is why we arrange the chairs to face the entrance at the beginning of service to emphasise the welcome Creativity applies as much to making a drink as it does to dealing with one of our 15 suppliers: if you miss the cut off for olives you won’t be able to serve olives and will need to tell the guest why you don’t have olives which is not a feeling you would want to experience you could end up with your team working 55 hours a week – and then they’ll think it’s not worth it Which is why I’m working on a rota which reduces the amount of hours they need to work outside the hours of service And creativity applies to the search for ingredients such as sourcing dragon fruit for our ‘Caitaya’ cocktail or Cici López cream of coconut for ‘Wilson’ order a drink and receive a beautiful product and leave happy – they don’t know how long we worked behind that to make the drinks appear so smoothly and quickly I remember clearly getting off the National Express A9 bus beside Liverpool Street One of my best friends offered me a back bar position at Soho House where I worked a couple of tough years supporting the bartenders before moving to D&D’s The Den at 98 Wardour Street It was a beautiful experience to learn about pairing rums with cigars between our four hands we produced 600 drinks in a shift I have a fine collection of rums including out of production bottles Rum informs cocktails such as the ‘Guacapa’ which is a take on the Dark ‘n’ Stormy featuring aged rum How has the pandemic altered drinking habits in bars People are drinking less wine and beer and more cocktails having had time at home to develop an interest in what’s in their favourite drink We want to become known as one of the best cocktail bars I want to make a lot of noise in the industry and lead my team to help Ginger Lily become amongst the best bars in London they often ask if I also have tattoos and seem quite surprised when I say that I actually don’t… We are using cookies to give you the best experience on our website You can find out more about which cookies we are using or switch them off in settings This website uses cookies so that we can provide you with the best user experience possible Cookie information is stored in your browser and performs functions such as recognising you when you return to our website and helping our team to understand which sections of the website you find most interesting and useful Strictly Necessary Cookie should be enabled at all times so that we can save your preferences for cookie settings we will not be able to save your preferences This means that every time you visit this website you will need to enable or disable cookies again Nancy Putignano stands at the premiere for "That 90s Show" in Los Angeles invited to the red carpet event by Netflix because of her status as a nostalgia influencer showcasing fashion from the decade Nancy Putignano stands near a poster for the show at the red carpet premiere.  A selfie of Nancy Putignano in her outfit for the red carpet She was given a moodboard by representatives from Netflix to compile the attire ahead of time Pittsfield TikTok star @fancypantz707 started her page to pass the time during the pandemic it punched her ticket for a red carpet premiere in Los Angeles.  These were among the hottest fashion items in 1995 But Nancy Putignano made her red carpet debut wearing exactly that last week It’s all part of her niche on TikTok: nostalgia for the '90s and Y2K years. Her videos on the social media platform showcase a backlog of fashion items and accessories from the era, coupled with a chart-topping song from the year. Putignano has nearly 1.6 million likes on her most popular post Most of the wardrobe comes from clothes that Putignano kept through the years — and in those threads “It’s hard for me to part with them,” Putignano said “I think that’s just the nostalgic part of me." Putignano takes great care to recreate outfits authentic to the years she chooses to model She uses eBay to fill in gaps if she doesn’t have something She’ll go to extra lengths to look up release dates on perfumes and accessories she includes to make sure it's accurate — but much of it just comes from having been there a lot of it is just from my memory,” she said Putignano’s nearly 348,000 followers on TikTok were enough to draw the attention of the team at Netflix who extended an invitation to attend the premiere of “That '90s Show,” a sequel series to the sitcom “That '70s Show” that aired in the early 2000s The original series chronicled a group of teenage friends growing up in Point Place (a fictional suburb of Green Bay) navigating small-town living and the groovy times that accompanied the Ford administration The sequel jumps ahead two decades and focuses on the daughter of Eric Forman The show sees a few of its cast members reprising roles from the original series, including Debra Jo Rupp and Kurtwood Smith as Kitty and Red Forman. Rupp has performed previously at the Barrington Stage Company in productions of “Boca,” “The Cake,” “Dr along with a group of fellow '90s influencers was invited for an all-expense paid trip to the show’s premiere where she got to rub shoulders with cast members such as Wilmer Valderrama She attended a screening for the first two episodes of the show after a photo shoot along with other influencers on the red carpet Her hotel room had a clear view of the Hollywood sign It was Putignano’s first time in California. She was born in New York City and her family moved to Lenox when she was a baby. Since then, she bounced around the Berkshires along with her family’s restaurant, now called Flo’s Diner She works as a cook there alongside her mother and sisters She lives in Pittsfield with her two children Growing up in the area in the '90s and early aughts meant she spent most of her time at an institution that has since closed its doors: The Berkshire Mall The mall rat days are a central part of that '90s nostalgia Saturday it was the hangout spot,” Putignano said “You would get dressed up and hope you ran into your crush … it was just so fun because you’d see everyone you knew.” kids and teens were doing the same at their shopping centers Putignano believes her TikToks are popular because they have a deep connection for those who came of age in that era 'We've all lived the same lives,'” Putignano said I had that perfume.’ … I feel like we're just like one big family unit.” Putignano started the TikTok page in 2020 to keep busy during the pandemic not imagining it would lead to a red carpet appearance and an audience that keeps growing She’s excited to see where it leads her next she finds it’s a way to keep in touch with that time in her life — and a feeling of wanting that old thing back I just had the greatest memories,” Putignano said “That includes holding on to the items I have Just using it in the videos makes me feel so nostalgic It takes you back to a good place — like a safe place I think that resonates the same with everybody else.” Matt Martinez can be reached at mmartinez@berkshireeagle.com Not many people can say they've gone from a ski chalet in Japan to a culinary school in the mountains of Mexico to the Berkshires in search of the ultimate "foodie getaway," but that's just what the hosts of "The World's Most Amazing Vacation Rentals" do in an episode devoted to "Gourmet Stays." The Berkshires — more specifically its farm-to-table food scene and a unique vacation rental in Lee — are front and center in the last third of episode six of the new travel show Pittsfield's Imari Semaj is going viral on TikTok for imitating her mother but also offer a valuable lesson for parents: Don't be afraid to laugh at yourself As the federal Low Income Home Energy Assistance Program faces uncertainty Berkshire residents share their stories of how the program has kept their heat on and their families afloat during difficult times the Berkshire Carousel will open to the public In the library room of Reid Middle School Friday night Lake Onota Village residents moved another step towards purchasing their community An anonymous Dalton resident has underwritten the cost of a “No Kings” billboard that will be going up on Monday at Berkshire Crossing in Pittsfield and a Cumberland Farms truck carrying 12,000 gallons of gasoline had crashed into a guardrail on the hairpin turn outside the Golden Eagle gift shop and restaurant on the Mohawk Trail Their contracts were canceled before the end date It's resulting in the firing of a combined 14 AmeriCorps members doing service work in the Berkshires Your browser is out of date and potentially vulnerable to security risks.We recommend switching to one of the following browsers: Get up-to-the-minute news sent straight to your device An actor poses for photos during the Carnival of Putignano in southern Italy on Feb The Carnival of Putignano is known as one of the oldest carnivals in Italy A float parade is held during the Carnival of Putignano in southern Italy on Feb Search for shows online and experience them offline Il Tacco di Bacco is a tool designed to enhance the quality of our lives A fulfilling existence is built on authentic connections which we believe can only arise in the real world This is why we’ve created a guide to help you navigate We provide the means; you discover the purpose The winner for last week’s SouthCoast Girls Athlete of the Week poll was GNB Voc-Tech’s Elle McCormack McCormack received more than 4,000 votes (61%) to earn the honor Previous winners were GNB Voc-Tech's Morgan Teves and Kendra Santiago and Old Colony’s Lorelai Ashley and Ronni Putignano Here's your chance to vote for the top high school performance among SouthCoast female athletes from Oct. 7-13 Here’s a look at last week’s top performers (listed in alphabetical order by school):  Morrison finished sixth out of 48 runners in a tri-meet with Cardinal Spellman and Bishop Feehan Moura took second in a meet against New Bedford Milhench ran a first-place time of 20:46 to lead the undefeated Bulldogs against Dighton-Rehoboth Morales scored Apponequet’s lone goal in a 1-0 win over Old Rochester Azzara had 18 saves in a loss to Dartmouth Halstead scored the lone goal for Bishop Stang in a 1-1 tie with Old Rochester Smith had one goal and one assist in a win over Bishop Stang FairhavenLewis had a pair of goals against Wareham Souza had three goals and five assists in a win over Wareham Brogioli had the lone goal for Wareham in a 2-1 loss to Brockton VOTE: Football Player of the Week for Week 6 Seaberg had a combined two goals and three assists Andrade scored Dartmouth’s lone goal in a 2-1 loss to Apponequet Santiago had a pair of goals in Voc-Tech’s win over Bourne VOTE: Boys Athlete of the Week for Oct. 7-13 seven service points and three aces in a win over Seekonk Mendes had a combined 14 service aces and seven kills in a pair of games for Stang Barber had a combined 55 assists and 27 digs in a pair of matches Martin had 14 kills and seven aces against New Bedford and six kills and 24 digs against Old Rochester McKinnon had 15 kills and 17 digs against Old Rochester in addition to slamming down 14 kills against New Bedford Sweeney had 18 assists in a loss to Somerset Berkley Teves had a combined 34 kills in a pair of games She also had three aces and seven digs against Apponequet She also had 25 digs in a win over Durfee to wrap up a share of the Big Franco had 10 kills and 12 digs against Dartmouth Letourneau had a combined 53 assists and seven aces Although there's been a whole lot of pessimism recently even if it is less quickly than many hoped That's true in the commercial vehicle space as well—according to Cox Automotive 87 percent of vehicle fleet operators expect to add EVs in the next five years and more than half thought they were likely to buy EVs this year And where and when to plug those EVs in to charge is a potential headache for fleet operators to more than 144,000 level 2 plugs and closing in on 49,000 DC fast charger plugs There are ways to throw off a planned timeline when building out a station with multiple chargers Obviously you need the funds to pay for it all—if these are to come from grants like the National Electric Vehicle Infrastructure program that had to wait for the states to each develop their own funding plans and then there's the need to run sufficient power to a site "The challenge is getting the power to the points that it needs to be used The good thing is that the rollout for EV is not happening overnight So that does give some opportunity," said Amber Putignano market development leader at ABB Electrification For example, ABB has been working with Greenlane, a $650 million joint venture between Daimler Truck North America as it builds out a series of charging corridors along freight routes starting with a 280-mile (450 km) stretch of I-15 between Los Angeles and Las Vegas "They have funding to build out 100 massive charging sites for trucks but the utility couldn't give them all of the power that they needed immediately Just by nameplate power rating for the chargers they would need something like 12 MW of power," Putignano said probably you know that you don't really need to consider full power for the name plate because vehicles only charge at that power for a very limited time," she said they think that they could survive with 8 to 10 MW they still need to use this funding and get as much of it installed." That means digging all the trenching and building out all the electrical distribution equipment on site with a microgrid that's capable of working as well in the future with 12 MW of power as it does with just 4 MW "I think this is the same challenge that all of these large sites are facing—it takes an extremely long time to get the power from the utility So how do you create this sort of staged future-proof solution where you're not having to open the roads multiple times You want one construction phase and you want that site to support the future demand," Putignano said exposing patches of skin made red and angry by three new tattoos: a skull was meant to cover up what he called his “heroin tattoos,” a set of tribal symbols that recalled a descent through drugs and depression that nearly ended with his death is more than six years from his last hit of heroin and even refused painkillers during two recent surgeries fearing they would pull him back into addiction And more than a decade after he traded his first love – gymnastics – for his love of an opiate high Putignano is now an aerial acrobat with Cirque du Soleil Putignano is also touring the East Coast to promote his new autobiography “Acrobaddict,” and talk about the link between athleticism and addiction opens with his discovery of gymnastics and descends quickly into the sordid details of his addiction many of them pulled from the journals he kept though it all “I had to look at my own behavior,” Putignano said standing at the Hull shoreline where once practiced his gymnastics and “The most difficult aspects for me was reading the way I treated other people knowing I was trying to be a good person but kept doing bad things because of my addiction.” Putignano says he felt his first “high” in the basement of his family’s Raynham home when he taught himself to do a back flip on a pile of cushions he’d pulled off the couch after watching gymnasts at the 1984 Olympics on TV “To me it was like people with superhuman powers,” he said “They were launching themselves into the air and doing stuff and I couldn’t believe that was possible.” Stunned by their son’s self-taught back flips Putignano’s parents took him to a gymnastics class in Brockton where he was immediately picked up by a team as did a trip to an Olympic training center but Putignano was dogged by worsening asthma that landed him in the hospital His training was also derailed by the departure of a coach who served as a father figure in the absence of his parents who Putignano said were consumed with running their restaurant in Avon and a worsening marriage and began collecting piercings on his face Putignano was also struggling with his own sexuality and found a place of belonging in the emerging rave culture of the 1990s That was where he discovered the club drug Ecstasy Through his high school years and into college Putignano continued to pursue both gymnastics and drugs he found that the high he felt when mastering a routine could be replicated more easily with cocaine and Klonopin “I couldn’t do gymnastics and party the way I wanted to so I had to choose one love over another,” he said Putignano told his coach he was done and his drug use soon got him kicked out of college He become homeless and bounced from shelter to shelter eventually winding up in New York City and falling deep into a heroin addiction He managed to hold down jobs – including a gig as a clerk at The New York Times which led to him shoot up in the paper’s offices – but he never managed to stay away from drugs for long a place where he could get away from the lure of heroin and try to stay clean “It was the most serene environment,” he recalled desperate searches for drugs and failed attempts to get clean he checked himself into a two-week rehab program he went to Central Park and began practicing flips again just as he did in his family’s basement as a child and Putignano found he was able to overcome the lingering sense of failure he had felt from abandoning gymnastics a decade earlier He began focusing on getting back into shape and becoming an acrobat But he says he’s no longer compelled by the need to be the best He says he finds comfort and happiness in gymnastics “Everybody has something they really love to do and they’re afraid to go back to,” he said “It’s about doing what you love to do and not worrying about being the best at it.” Contact Neal Simpson at nesimpson@ledger.com or follow him on Twitter @NSimpson_Ledger READ MORE about heroin addiction. Volume 16 - 2023 | https://doi.org/10.3389/fnmol.2023.1118707 This article is part of the Research TopicAdvances in Brain Disorders: from Mechanisms to Therapeutic TargetsView all 21 articles a leading cause of intellectual disability is a result of the mutation in the gene encoding the creatine transporter SLC6A8 which prevents creatine uptake into the brain Preclinical in vitro and in vivo data indicate that dodecyl creatine ester (DCE) which increases the creatine brain content might be a therapeutic option for CTD patients To gain a better understanding of the pathophysiology and DCE treatment efficacy in CTD this study focuses on the identification of biomarkers related to cognitive improvement in a Slc6a8 knockout mouse model (Slc6a8−/y) engineered to mimic the clinical features of CTD patients which have low brain creatine content Shotgun proteomics analysis of 4,035 proteins in four different brain regions; the cerebellum hippocampus (associated with cognitive functions) and brain stem Comparison of the protein abundance in the four brain regions between DCE-treated intranasally Slc6a8−/y mice and wild type and DCE-treated Slc6a8−/y and vehicle group identified 14 biomarkers shedding light on the mechanism of action of DCE Integrative bioinformatics and statistical modeling identified key proteins in CTD The abundance of these proteins in the four brain regions was significantly correlated with both the object recognition and the Y-maze tests Our findings suggest a major role for PLCB1 and associated molecules in the pathogenesis of CTD with female carriers presenting with a milder phenotype Some of the main difficulties in elucidating the pathogenesis of and treating ID are that there are wide variety of causes of ID with no single cause being associated with a significant majority of ID cases To gain a better understanding of the pathophysiology of CTD and DCE treatment efficacy, we focused in this study on the identification of biomarkers related to cognitive improvement in a Slc6a8−/y mice which have low Cr content in the brain and hippocampus (Baroncelli et al., 2016) This mouse model exhibits a precocious cognitive and autistic-like defects mimicking the early key features of human congenital creatine deficiency syndromes mutant mice displayed a progressive impairment of short and long-term declarative memory denoting an early brain aging the study employed a combination of cognitive tests and molecular methods to decipher some of the molecular mechanisms involved in CTD pathophysiology The cognitive tests included the use of object recognition test (ORT) Y-maze and Morris water maze (MWM) tests to show the decline of cognitive function in Slc6a8−/y mice and whether the treatment with DCE improves the cognitive function The molecular methods involved the application of shotgun proteomics to four different brain regions; the cerebellum DCE was intranasally administered as previously reported (Ullio-Gamboa et al., 2019) to CrT KO mice for 30 days while wild-type (WT) and vehicle-treated mice were used as controls (N = 8 per group) A volume of 6 μL of DCE or vehicle was placed in the nostril DCE (4 mg/g) or vehicle was given twice bilaterally (12 μL total volume) CrT KO mice showed object recognition deficits when compared with WT mice Mice were assigned to treatment groups by sorting animals based on discrimination index (DI) and alternating assignments between vehicle and treatment to avoid performance confounds Figure 1A shows DI data. Vehicle-treated CrT KO mice showed reductions in DI compared with both WT mice (p = 0.023) and DCE-treated CrT KO mice (p < 0.05). DCE-treated CrT KO mice spent more time exploring the novel object than vehicle-treated CrT KO mice (one-way ANOVA, p < 0.01; Tukey’s post hoc test, p < 0.05; Figure 1B) but there was no difference between DCE-treated CrT KO mice and WT mice (p = 0.406) the median exploration time for the DCE-treated CrT KO mice was 96% of the median exploration time for the WT mice Analysis of cognition among the different experimental groups (A,B) Object recognition in the ORT was impaired in CrT KO mice Analysis of the object discrimination index and (B) percentage of time spent exploring the novel object revealed that WT and DCE-treated CrT KO mice but not vehicle-treated CrT KO mice showed a preference for the novel object (C) Early deficiency of working and spatial memory in CrT KO mice measured by the Y-maze test CrT KO mice showed a change in the spontaneous alternation percentage in the Y-maze test which was significantly improved by DCE treatment (D) CrT deletion progressively deteriorates spatial learning and memory in KO mice learning plot for the three group of animals (WT A significant difference was detected between WT and CrT KO mice as well as between WT and DCE-treatd CrT KO mice (p < 0.0001) Right histograms showing the mean swimming path covered to locate the submerged platform on the last day of training Four starting positions arbitrarily designated North (N) thus dividing into 4 quadarants were the mice were allowed to search for the escape platform A significant difference was detected between WT and DCE-treated CrT KO mice in the SO position (p < 0.001) a significant difference was detected between WT and DCE-treated KO-DCE mice as well as between WT and CrT KO mice (p < 0.0001) The data are the mean ± s.e.m Statistical analysis was performed by one-way or two way ANOVA followed by Tukey’s post-hoc test or 2 way ANVOA followed by *p < 0.05; **p < 0.001;***p < 0.0001; ns = not significant Memory was assessed using the MWM test. The results show that DCE did not have a beneficial effect on the performance of CrT KO mice in the MWM test (Figure 1D) suggesting that DCE treatment ameliorates some cognitive deficits seen in these mice In order to identify proteins across the different brain regions involved in the pathogenesis of CTD proteomics based differential abundance analysis was performed in the different brain regions of 24 mice the animals from all three groups were sacrificed Label-free shotgun proteomics analysis of cortical and brainstem tissues and muscle tissue as a control was carried out for each mouse in WT vehicle-treated CrT KO mice and DCE-treated CrT KO mice The muscle was considered a control for protein analysis due to the fact that Cr levels are decreased in muscle as well Even if the mice do have a muscle phenotype we have shown that the learning deficits are independent of any somatic problems the mice may have hence in this study we wanted to compare various regions of the brain to tissue that is not related to the brain we did a global coefficient of variation (CV) calculation of all the proteins abundance between DCE and WT for each of the 4 brain regions as well as muscle The results show that the least variation is in the muscle tissue with CV less than 4,000 all the 4 brain regions had CV of more than 5,000 [cortex (5692.59) brain stem (5519.19)] with cerebellum being the highest at 5948 This shows that there are some alteration in muscle but not as much as we see in the 4 different brain regions Comparison of proteomic signatures in different brain regions among the different experimental groups (A–D) Venn diagram showing overlapping proteins among the three experimental groups The proteins that showed a significant change in abundance in CrT KO mice compared with the WT and in DCE-treated mice compared with vehicle-treated mice were selected for pathway analysis The proteins that showed a change in abundance in the vehicle-treated mice and the DCE-treated mice compared with the WT mice were also selected for pathway analysis The abundances of these proteins in the cortex hippocampus and muscle were analyzed using a multivariate statistical model based on one-way ANOVA followed by Bonferroni’s post hoc test (E) Heatmap showing the proteins that showed a significant change in abundance in vehicle-treated CrT KO mice compared WT mice (F) Heatmap showing the proteins that showed a significant change in abundance in DCE-treated CrT KO mice compared with vehicle-treated CrT KO mice The overlapping proteins whose abundances were significantly altered in all CrT KO mice compared to that in WT mice and in DCE-treated mice CrT KO mice compared to that in vehicle-treated CrT KO mice were then selected for pathway analysis using gene set enrichment analysis carried out using ENRICHR The proteins found to be involved in different diseases and pathways were selected for subsequent analysis [Cortex (41 proteins) These findings suggest that lack of Cr into the brain of CrT KO mice leads to a significant alteration of protein abundance involved in the pathogenesis of CTD Correlation of the levels of 14 proteins with performance in different cognitive tests using a stepwise regression statistical model (A) Heatmap showing the abundance levels of the 14 proteins that showed significant changes in abundance in both vehicle-treated CrT KO mice and DCE-treated CrT KO mice (B) Map showing the correlation between the level of each of the 14 proteins with performance in the ORT to evaluate cognition (C) Maps showing the correlation between the level of each of the 14 proteins and performance in the Y-maze test The correlation maps were derived using a stepwise regression model to assess the correlation between the abundance each of the 14 differentially expressed proteins and performance in each of the cognitive tests Group comparisons were carried out using a statistical model based on one-way ANOVA followed by Bonferroni’s post hoc test for multiple comparisons A stepwise regression model was used to assess the effect of each of the proteins of interest on cognitive outcomes to identify those that may influence cognitive function. The levels of several proteins were significantly correlated with the discrimination index (DI); the correlation between KIF1A, Fabp7 and L1CAM levels and DI was found in the hippocampus, cortex, cerebellum and brain stem (n = 11, Supplementary Table 5a) PLCB1 is significantly more abundant in the cortex compared to other brain regions and its abundance in the cortex and hippocampus is correlated with DI and Y-maze (p = 0.01) Amongst the 14 key proteins with individual animal performance in different cognitive tests KIF1A was shown to be the protein with the most uniformly abundance across the 4 brain regions and correlated with the DI in the novel object recognition test and spontaneous alternation in the Y-maze test which are linked to cognitive function improvement These results indicate that KIF1A is a potential key player in CTD pathogenesis KIF1A and PLCB1 interplay is associated with DCE treatment efficacy in CrT Ko mice (A–C) Western blot results showing that the KIF1A level was significantly increased in the cortex (A) hippocampus (B) and cerebellum (C) in vehicle-treated CrT KO mice compared to WT mice while DCE treatment rescued this overabundance in the three brain regions in CrT KO mice E) Western blot results showing that the pro-BDNF/BDNF ratio (D) was significantly altered in DCE-treated CrT KO mice compared to that of both WT mice and vehicle-treated CrT KO mice the PSD95 level (E) was significantly altered in the cortices of vehicle-treated CrT KO mice compared to that of DCE-treated CrT KO mice Western blotting showed that PLCB1 protein (150 kDa) abundance was increased in the cortex (F) hippocampus (G) and cerebellum (H) in CrT KO mice at 0 days after DCE treatment (I,J) Western blot results for Ibα (I) and IκBβ (J) showing that DCE promotes IκBα transcription factor abundance but not IκBβ transcription factor abundance Statistical analysis was performed by one-way ANOVA followed by Tukey’s post-hoc test *p ≤ 0.05; **p ≤ 0.001; ***p ≤ 0.0001; ns = not significant p = 0.012; cortex: r2 = 0.469 further downstream functional analysis focused on KIF1A and PLCB1 proteins Additional analysis confirmed the abundance of PLCB1 by Western blotting (Figures 4F–H). The results showed that PLCB1 level decreased in the cortex (Figure 4F) and hippocampus (Figure 4G) in vehicle-treated CrT KO mice, while DCE-treated CrT KO mice showed a significant increase in PLCB1 levels in the cortex (p = 0.0004) compared to the hippocampus and cerebellum (Figure 4H) while DCE treatment rescued IκBα protein levels in CrT KO mice (p = 0.008) suggesting that PLCB1 is involved in NF-κβ regulation in these mice we were interested by the identification of subset of proteins correlated with the cognitive trajectory of CrT KO mice Correlation analysis was performed using a stepwise regression model between the 14 selected proteins affected both by the mutation and DCE treatment Schematic presentation showing the key players in the different brain regions and potential links between several proteins that are regulated in neurons in the context of CTD and by DCE treatment (A) Proteins regulated by DCE in CrT KO mice DCE-mediated upregulation of PLCB1 levels in the brain might lead to the production of inositol-1,4,5-triphosphate (IP3) and IP3 modulates the NF-κβ pathway via dysregulation of a PKCα inhibitor thereby altering the expression of NF-κβ-inducible genes which regulates the NF-κβ pathway by rescuing IκBα protein levels in CrT KO mice NF-κβ is bound by IκBα and then translocates to the nucleus to activate target genes including KIF1A and BDNF We noticed the abundance of KIF1A across the hippocampus and cortex in CrT KO mice correlating with the cognitive performance in Y-maze test These findings indicate that KIF1A is one of a potential key player in CTD pathogenesis The regulation of neuroinflammation is also supported by the identification of NCAM1 in CrT KO mice whose abundance was altered and restored by DCE treatment; NCAM1 could participates in the structural deficits in CrT Ko mice including changes in neuronal migration and synaptogenesis the results of the study indicated that the crosstalk between KIF1A and PLCB1 mediates cognitive function in the CTD the results identified a panel of additional 12 proteins which suggests that Slc6a8−/y mice could have structural deficits including changes in neuronal migration or synaptogenesis this is the first study that describes some of the molecular mechanisms of CTD-related cognitive dysfunction and the therapeutic effect of DCE the results of the study provide further evidence regarding the efficacy of DCE in treating the cognitive symptoms of CTD and restoring the abundance of key molecular players to normal levels in several brain regions Little is known about the underlying mechanisms of the Cr-mediated behavioral deficits Correlating proteomic changes to behavioral deficits provide mechanistic insights into Cr-mediated changes Future studies can be designed to investigate this relationship This study provides a shift in research paradigms and an advancement in intervention for CTD While CTD carrier females are reported to have a milder phenotype it will be of interest in the future to assess the potential alteration of the molecular landscape of the brain area of for females that have a milder phenotype All in vivo experiments were conducted in compliance with the European Communities Council Directive of 22 September 2010 and were approved by the Italian Ministry of Health (authorization number 259/2016-PR) Male CrT−/y and CrT+/y mice were generated on the C57BL/6 J background as previously described (Baroncelli et al., 2014) The mice were housed at 22°C on a 12–12 h light–dark cycle and provided food and water ad libitum The presence of the Slc6a8 mutation was confirmed by PCR as previously described (Baroncelli et al., 2016) genomic DNA was isolated from tail tissue collected from P25 mice using the DNeasy® Blood & Tissue kit from Qiagen according to the manufacturer’s protocol The following primers were used for PCR amplification: F: AGGTTTCCTCAGGTTATAGAGA; R: CCCTAGGT GTATCTAACATCT; R1: TCGTGGTATCGTTATGCGCC The amplicon sizes were as follows: CrT+/y allele = 462 bp; mutant allele = 371 bp DCE was prepared as previously described (Trotier-Faurion et al., 2013) Ten milligrams of DCE was added to 0.375 g of Maisine®CC (Gattefossé) at room temperature and then 125 mg of DHA (Sigma–Aldrich) was added The mixture was vortexed for 5 min and shaken at 1,000 × g in a thermomixer at 30°C for 48 h the sample was centrifuged at 20,000 × g for 10 min at room temperature and the resulting supernatant was filtered through a 0.22 μm filter placed in another tube and stored at +4°C prior to use DCE was intranasally administered to CrT KO mice for 30 days as previously reported (Ullio-Gamboa et al., 2019) while wild-type (WT) and vehicle-treated mice were used as controls (N = 8/group) 6 μL of DCE or vehicle (Maisine®CC with DHA) was placed in the nostril The DCE (4 mg/g) or vehicle was given twice bilaterally (12 μL total volume) Behavioral testing started 14 days after the start of the treatment as was done previously (Baroncelli et al., 2016) Treatment continued during behavioral testing for a total of 30 days of treatment Each mouse was subjected to all of the behavioral assessments in following order: the 24-h ORT (3 days) and hidden platform MWM test (7 days) The spontaneous alternation rate was measured using a Y-shaped maze with three symmetrical gray solid plastic arms at a 120-degree angle (26 cm long, 10 cm wide, and 15 cm high) as previously described (Begenisic et al., 2014; Baroncelli et al., 2016) The mice were placed in the center of the maze one at a time and their movements were recorded for 8 min The number of arm entries (all four limbs within an arm) and the number of triads (successive entries into all three arms) were recorded to calculate the spontaneous alternation percentage (defined as the number of triads divided by the number of possible alternations (total arm entries minus 2) multiplied by 100) The mice were subjected to 4 training trials per day for a total of 7 days The apparatus consisted of a circular water tank (diameter 40 cm) filled with water (23°C) to a depth of 25 cm The water was made opaque by the addition of nontoxic white paint Four starting positions arbitrarily designated the north (N) A square escape platform (11 × 11 cm) was submerged 0.5 cm below the water surface in the middle of one of the 4 quadrants The mice were allowed to search for the escape platform for up to 60 s and their swimming paths were automatically recorded by the Noldus Ethovision system The last trial on the last training day was a probe trial during which the escape platform was removed from the tank and the swimming paths of the mice were recorded for 60 s while they searched for the missing platform The peptides were loaded on a reverse-phase PepMap 100 C18 μ-precolumn (5 μm Thermo Fisher) and then resolved on a nanoscale PepMap 100 C18 nanoLC column (3 μm Thermo Fisher) at a flow rate of 0.2 μL.min−1 using a 90-min gradient (4% B from 0 to 3 min 4–25% B from 3 to 78 min and 25–40% B from 78 to 93 min) with 0.1% HCOOH/100% H2O as mobile phase A and 0.1% HCOOH/80% CH3CN/20% H2O as mobile phase B The mass spectrometer was operated in Top20 mode with a scan range of 350 to 1800 m/z and selection and fragmentation were performed using a 10 s dynamic exclusion time for the 20 most abundant precursor ions Only ion precursors with a 2+ or 3+ charge were selected for HCD fragmentation which was performed at a normalized collision energy of 27 eV MS/MS spectra were assigned using Mascot Daemon software version 2.6.1 (Matrix Science) and the Mus musculus SwissProt database comprising 17,096 protein sequences and the maximum number of missed cleavages were set to 5 ppm Carbamidomethylation of cysteine was considered a fixed modification and oxidation of methionine was considered a variable modification Peptides with p value ≤0.05 for homology threshold mode and proteins with at least two distinct peptides were selected (false discovery rate < 1%) The data were sorted according to the adjusted p value based on a false discovery rate < 0.05 Reproducibility plots and principal component analysis (PCA) were used to assess the quality of the separation of the data between the various groups that were being compared The identified differentially expressed proteins were visualized using volcano plots and heatmaps The heatmaps were generated using unsupervised hierarchical clustering carried out on the basis of Ward linkage and Euclidean distance to assess the degree of proteomic profile separation across the four brain regions among the three groups Relevant pathways were selected based on a cutoff of p < 0.05 The set of proteins found to be significantly involved in the different pathways and diseases were selected for further analysis In order to identify the patterns of differentially expressed proteins across the different regions the data identified by ENRICHR analysis was used to construct a multivariate statistical model using one-way ANOVA followed by Bonferroni’s post hoc test for comparisonsacross the cortex The muscle was used as control for tissue other than the brain The stepwise regression statistical modelling was used to further reduce the marker set and identify the proteins whose abundances were significantly altered by the mutation and restored by the DCE treatment To identify the proteins involved in cognition a stepwise regression model was constructed to assess the correlation between the levels of the differentially expressed proteins and performance in the ORT (DI) and the Y-maze test The results were further validated using Pearson correlation analysis of the differentially abundant proteins among the different groups Since PLCB1 and KIF1A abundance as well as their partners are associated to several brain disorders Western blotting was used to determine their abundance as well as two inhibitors of NF-κB brain tissues were homogenized in freshly prepared lysis buffer containing 20 mM Trizma-Base 150 mM NaCl (pH 7.4) (Sigma–Aldrich 4% complete protease inhibitor cocktail and 20% mix of anti-phosphatase inhibitors using a Precellys Evolution tissue homogenizer The samples were then centrifuged at 2500 × g for 15 min followed by 10,000 x g for 20 min to obtain lysates for electrophoresis The proteins (10 to 20 μg) and protein standards were mixed with Laemmli buffer and loaded on 4–15% Criterion TGX Stain-Free protein gels in 1 × TGS running buffer (all from Bio-Rad France) and transferred to a 0.2 μm PVDF membrane with the Trans-Blot Turbo RTA Midi Transfer Kit (Bio-Rad The membranes were blocked for 30 min in 5% low-fat milk in TBS-0.1% Tween 20 at room temperature The blots were probed with specific primary antibodies overnight at 4°C followed by horseradish peroxidase (HRP) secondary antibodies diluted 1:5000 or 1:50000 in 5% low-fat milk in TBS-0.1% Tween 20 at room temperature the membranes were treated with ECL Prime Western Blotting reagent (Amersham UK) or Clarity Western ECL Substrate and exposed with a ChemiDoc Touch Imaging System (Bio-Rad The band density was quantified with Image Lab software (Bio-Rad The following antibodies were used at the indicated dilutions: anti-PLCB1 (1:1000 Protein extract samples (200 μg) from cortex and hippocampus were adjusted to a final volume of 600 μL with binding buffer (20 mM Tris–HCl (pH 7.5) and 1X protease inhibitor) before the addition of 17.6 μL anti-KIF1A antibody and 100 U of Benzonase nuclease (Novagen 70,746–3) The mixture was incubated overnight at 4°C on a rotating wheel Forty-three microliters of Dynabeads protein G (Invitrogen 10003D) were washed 3 times with PBS + 0.05% Tween and once with binding buffer The beads were then added to the immunoprecipitate and incubated for 1 h at room temperature with rotation the immunoprecipitate was washed twice with Benzonase buffer (20 mM Tris–HCl (pH 8.0) and 1X protease inhibitor (Roche)) and incubated in Benzonase buffer supplemented with 100 U of Benzonase nuclease for 30 min at 37°C before being washed three times with washing buffer (20 mM Tris–HCl (pH 7.5) The immunoprecipitated proteins were eluted directly in 25 μL 1.5× Laemmli buffer supplemented with 200 mM DTT and 1 mM beta-mercaptoethanol at 95°C for 10 min before magnetic separation of the beads and MS MS was carried out under similar conditions as those for the brain protein extracts except that the nano-UPLC gradient was reduced to 60 min The MS and proteomics dataset is available through the ProteomeXchange Consortium via the PRIDE partner repository (https://www.ebi.ac.uk/pride/) under dataset identifiers PXD024968 and 10.6019/PXD024968 The animal study was reviewed and approved by All in vivo experiments were conducted in compliance with the European Communities Council Directive of 22 September 2010 and were approved by the Italian Ministry of Health (authorization number 259/2016-PR) AM was responsible for project administration funding acquisition and writing of the manuscript EP administered drugs to the mice and performed genotyping and the behavioral studies J-CG and JA designed and conducted the proteomic experiments RaH and RiH conducted mathematical and statistical modeling of the proteomics data as well as bioinformatics analysis and TJ participated in the writing and review of the manuscript This work was supported by Jerome Fondation Lejeune grant and by X-traordinaire which is a patient group dedicated to rare intellectual disabilities AM is funded by Foundation Lejeune grant; RiH is funded by the University of Sharjah - Skotech collaborative Artificial Intelligence for Life (AIfoL) award (grant no: AIfoL-2201) The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest The Supplementary material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fnmol.2023.1118707/full#supplementary-material Transcription factors in long-term memory and synaptic plasticity PubMed Abstract | CrossRef Full Text | Google Scholar Synapse type-specific proteomic dissection identifies IgSF8 as a hippocampal CA3 microcircuit organizer Association of neural cell adhesion molecule 1 gene polymorphisms with bipolar affective disorder in Japanese individuals NCAM1 association study of bipolar disorder and schizophrenia: polymorphisms and alternatively spliced isoforms lead to similarities and differences Efferent cortical connections of multimodal cortex of the superior temporal sulcus in the rhesus monkey A novel mouse model of creatine transporter deficiency A mouse model for creatine transporter deficiency reveals early onset cognitive impairment and neuropathology associated with brain aging Fluoxetine in adulthood normalizes GABA release and rescues hippocampal synaptic plasticity and spatial memory in a mouse model of down syndrome Creatine deficiency syndromes and the importance of creatine synthesis in the brain Treatment outcome of creatine transporter deficiency: international retrospective cohort study Screening for primary creatine deficiencies in French patients with unexplained neurological symptoms Enrichr: interactive and collaborative HTML5 gene list enrichment analysis tool Creatine transporter deficiency impairs stress adaptation and brain energetics homeostasis Cholewa-Waclaw The role of epigenetic mechanisms in the regulation of gene expression in the nervous system Dynamic changes in presynaptic and axonal transport proteins combined with striatal neuroinflammation precede dopaminergic neuronal loss in a rat model of AAV alpha-synucleinopathy X-linked creatine transporter (SLC6A8) mutations in about 1% of males with mental retardation of unknown etiology An LMNB1 duplication caused adult-onset autosomal dominant Leukodystrophy in Chinese family: clinical manifestations Alzheimer's disease: early alterations in brain DNA methylation at ANK1 Estimated carrier frequency of creatine transporter deficiency in females in the general population using functional characterization of novel missense variants in the SLC6A8 gene Esmaeeli Nieh De novo mutations in KIF1A cause progressive encephalopathy and brain atrophy Region and diagnosis-specific changes in synaptic proteins in schizophrenia and bipolar I disorder M1 polarization markers are Upregulated in basal-like breast cancer molecular subtype and associated with favorable patient outcome The phenotypic consequences of MECP2 mutations extend beyond Rett syndrome Differential expression of NF-kappa B target genes in MALT lymphoma with and without chromosome translocation: insights into molecular mechanism mediates activity-dependent differentiation in cerebral cortex PubMed Abstract | CrossRef Full Text | Google Scholar Bi-directional regulation of postsynaptic cortactin distribution by BDNF and NMDA receptor activity Kaltschmidt NF-kappa B regulates spatial memory formation and synaptic plasticity through protein kinase a/CREB signaling FABP7 upregulation induces a neurotoxic phenotype in astrocytes Motor protein KIF1A is essential for hippocampal synaptogenesis and learning enhancement in an enriched environment Enrichr: a comprehensive gene set enrichment analysis web server 2016 update De novo mutations in the motor domain of KIF1A cause cognitive impairment Ikappa Balpha deficiency in brain leads to elevated basal neuroinflammation and attenuated response following traumatic brain injury: implications for functional recovery Phosphoinositide-specific phospholipase C β1 gene deletion in bipolar disorder affected patient CrossRef Full Text | Google Scholar Increased adult hippocampal neurogenesis and abnormal migration of adult-born granule neurons is associated with hippocampal-specific cognitive deficits in phospholipase C-beta 1 knockout mice CrossRef Full Text | Google Scholar Novel translational phenotypes and biomarkers for creatine transporter deficiency CrossRef Full Text | Google Scholar Variance stabilization and normalization for one-color microarray data using a data-driven multiscale approach De novo KIF1A mutations cause intellectual deficit lower limb spasticity and visual disturbance Lamin B1 mediated demyelination: linking Lamins PubMed Abstract | CrossRef Full Text | Google Scholar Germline recessive mutations in PI4KA are associated with perisylvian polymicrogyria IgSF8: a developmentally and functionally regulated cell adhesion molecule in olfactory sensory neuron axons and synapses Location-dependent role of phospholipase C signaling in the brain: physiology and pathology X-linked creatine-transporter gene (SLC6A8) defect: a new creatine-deficiency syndrome CrossRef Full Text | Google Scholar MECP2 structural and 3'-UTR variants in schizophrenia autism and other psychiatric diseases: a possible association with autism Cerebral creatine deficiency syndromes: clinical aspects ROTS: an R package for reproducibility-optimized statistical testing A de novo dominant mutation in KIF1A associated with axonal neuropathy Trotier-Faurion Synthesis and biological evaluation of new Creatine fatty esters revealed dodecyl Creatine Ester as a promising drug candidate for the treatment of the Creatine transporter deficiency Trotier-Faurion Dodecyl creatine ester and lipid nanocapsule: a double strategy for the treatment of creatine transporter deficiency Ullio-Gamboa Dodecyl creatine ester-loaded nanoemulsion as a promising therapy for creatine transporter deficiency Valayannopoulos Functional and electrophysiological characterization of four non-truncating mutations responsible for creatine transporter (SLC6A8) deficiency syndrome van de Kamp X-linked creatine transporter deficiency: clinical aspects and pathophysiology Expression of PSA-NCAM and synaptic proteins in the amygdala of psychiatric disorder patients CrossRef Full Text | Google Scholar Genetic and clinical aspects of X-linked hydrocephalus (L1 disease): mutations in the L1CAM gene Identification of autism-related MECP2 mutations by whole-exome sequencing and functional validation Primary phospholipase C and brain disorders Armengaud J and Hamoudi R (2023) Dodecyl creatine ester improves cognitive function and identifies key protein drivers including KIF1A and PLCB1 in a mouse model of creatine transporter deficiency Received: 07 December 2022; Accepted: 20 February 2023; Published: 24 March 2023 Copyright © 2023 Mabondzo, Harati, Broca-Brisson, Guyot, Costa, Cacciante, Putignano, Baroncelli, Skelton, Saab, Martini, Benech, Joudinaud, Gaillard, Armengaud and Hamoudi. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) *Correspondence: Aloïse Mabondzo, YWxvaXNlLm1hYm9uZHpvQGNlYS5mcg== †These authors have contributed equally to this work ‡These authors have contributed equally to this work and share senior authorship and their deeds are recorded with the county clerk Boonton: 138 Barnett St from Indira Diguiseppi to Erik Nilsson and Donna Nilsson 68 Split Rock Rd from Ben Koehler to James Few and Tracie Few 109 Holly Ln from Dolores McCormick to Benjamin Kuipers and Kathleen Ryan 117 Decker Rd from Anthony Pilosi to David Dorer and Janna Dorer Budd Lake: 29 Louis Dr from Michael Iacobino to Vincent Tran and Dana Le 5 Knowles Ln from Muhammad Akhtar to Mahasen Muheisen Butler: 105 Kiel Ave from Harold Jones to Ryan Franey and Marielle Franey Chatham: 34 Weston Ave from Stephen Georges to Joseph Bruno and Catherine Bruno 58 Pembrooke Rd from Frank Gentile to Rahul Bansal and Khusboo Mittal Chester: 6 Barkman Way from Jeanne Harrington to Alan Trent and Jeanette Trent 13 Beacon Hill Dr from Isis Haywoode to Glenn Lawse and Michelle Lawse 14 Hardin Ct from Michael Paccione to Nathan Ayres Denville: 14 Overlook Dr from Fannie Mae to Michael Fasano 216 Riverside Dr from Francisca Beardsmore to Kimberly Bolognese 107 W Shore Rd from Mark London to Peter Pizza and Erica Pizza 13 Alpine Dr from Roman Enterprises Llc to James Scheidemann and Alexsandra Scheidemann Dover: 47 W Fairview Ave from Euro Romero to Jose Angeles and Vanessa Adames 236 -238 S Morris St from Gustavo Lara to Zhou Yeung 532 Mount Hope Ave from Walter Ardin Jr to Anthony Carpentiere Jr and Celina Carpentiere Flanders:21 Downstream Dr from US Bank to Angela Burns 132 US Highway 206 from Wells Fargo Bank to Jane Ho Florham Park: 142 Crescent Rd from Carole Dasti to Henock Asmerom and Tezzita Melaku Kenvil: 33 N Dell Ave from Deutsche Bank to Waseen Malek and Cynthia Cullen 12 Ferro Monte Ave from James Magnus to Angela Garces Kinnelon: 67 Voorhis Rd from Bryan Ottens to Joseph Dec and Agnieszka Dec 15 Stevens Ave from Fatmeh Abbasi to Joseph Donahue III and Lori Donahue 25 Powderhorn Dr from Karen Bernhardt to Craig Haines and Janine Haines 45 Forestdale Rd from Mary Neely to Michael Putignano and Meredith Putignano Lake Hopatcong: 23 Espanong Rd from Bank of NY Mellon to Kevin Goldstein Landing: 9 Bell Ct from Timothy Green to Daniel Ramos 48 Salmon Rd from Two Brothers Remolding LLC to Giancarlo Bruzzese and Nicole Bruzzese Lincoln Park: 8 Cambridge Ct from Diana Woesthoff to Christine Wong 10 Maple St from Harriet Howard to Avdula Ademi and Dhurata Ademi Long Valley: 23 Hemlock Dr from 1st Tennessee Bk to Jennifer Colletta and Shawn Colletta 297 Naughright Rd from Donna Keating to Steven Langdo and Barbara Langdo 35 Chancellor Way from Douglas Masteller to Benjamin Li and Qing Wei Madison: 17 Chapel St from Wilmington Savings to Alexius Wronka and Anna Wronka Mendham: 20 Coventry Rd from Janet Brozynski to Timothy Mahoney and Margaret Mahoney 7 Jared Ct from Gerald Grosslicht to David Maytidu and Sanatha Maytudu 46 Mendham Rd from Monty Edwards to Luis Muniz and Luba Soskin Montville: 136 Changebridge Rd from Helen Cavanaugh to Frank Brunda and Susan Brunda 19 Cable Ct from Roberta Wolfe to Rashed Gill and Farkhanda Gill Morris Plains: 104 Fairchild Ave from Altutude Management to Paul Magnani and Loren Magnani 8 Condict St from Mariette Scorsume to Teresa Day 158 Mountain Way from Daniel Pisello to Micahel Marsan Morristown: 18 Shadowbrook Ln from David Tator to Cynthia Beck 21 Colonel Evans Dr from Bruce Abrams to Robert Hoover and Jennifer Cromie 408 South St from HSBC Bank to Kevin Jang and Bi-Hwa Huang 38 Taft Ln from Karen Day to Corbin Dimeglio Mount Arlington: 497 Windemere Ave from Deutsche Bank to Mark Charnet and Teresa Charnet 48 Richard Dr from Kathleen Destefano to Stephen Parsons and Melissa Parsons 33 Woodland Way from NVR Inc to Manoj Aluri and Sruthi Nadimpalli 29 Woodland Way from NVR Inc To Vincent Saponar III 29 Woodland Way from NVR Inc to Vincent Saponar III 4 Brookside Ln from Robert Klein to Ryan Murphy 36 Brookside Ln from Stephen Parsons to Daniel Edwards and Judith Edwards New Vernon: 37 Village Rd from William Burke to Brett Tiede and Jason Tiede Oak Ridge: 79 School House Rd from Allan Lorimer Iii to William Sheenan and Cara Camiscioli 12 Little Doe Run from Brian Boyce to John Skurka 1 Partridge Run from Fannie Mae to Anthony Ventre Parsippany: 12 DiEdwardo Ct from Forge Pond Deve to Bhumi Patel and Snehal Patel 16 DiEdwardo Ct from Forge Pond Developers to Lavanya Rajagapolan and Gautam Parthasarathy 16 DeCroce Ct from Forge Pond Developers to Snehal Patel and Puja Patel 41 Allentown Rd from PR Solutions LLC to Nikul Desai and Kinjal Amin Randolph: 1399 Sussex Tpke from Fannie Mae to Mark Fusari 30 Ash Ln from Fannie Mae to Ramon Oropeza 103 High St from Janak Patel to Craig Myron and Kirsten Myron 35 Peace Rd from Timothy Allen to Mario Hernandez and Jeanette Hernandez Riverdale: 317 Cannella Way from Ann Capria to Robert Wells and Lois Wells 8204 Sanctuary Blvd from Luis Felix to William Legates Sr Rockaway: 22 W New St from Karen Profit to Ronald Meyers Jr and Cathrin Meyers 36 Willow Ave from Veronica Sefchick to Ralph Denisco and Valentina Denisco 16 Hilltop Dr from Devyani Amin to Steven Vargas and Cristina Vargas 13 Iowa Ave from Gregory Yarnall to Nneka Clarke 207 W Lake Shore Dr from Jeff Oneill to Inna Gordin 1208 Hamilton Dr from Joan Guinter to Robert Digiovanna 75 Meriden Rd from Thomas Dedio to Susan Bai and Keith Smoak Stirling: 385 Passaic Ave from Anthony Opalka to David Pagliaro and Melissa Pagliaro Succasunna: 16 Woods Edge Dr from Michael Hersh to David Dipasquale and Sara Dipasquale 60 Parkview Dr from Paul Choquette to Henry Piper and Rose Piper 48 Carol Dr from Ronald Webb to Luis Maldonado and Shannon Maldonado Towaco: 4 Bellows Ln from Weiss Construction Co to Ronak Patel and Brinda Patel Whippany: 34 Washington Ave from Nancy Hosler to Wojciech Matula and Emilia Matula This website is using a security service to protect itself from online attacks The action you just performed triggered the security solution There are several actions that could trigger this block including submitting a certain word or phrase You can email the site owner to let them know you were blocked Please include what you were doing when this page came up and the Cloudflare Ray ID found at the bottom of this page Sue Putignano worked for a larger salon for many years and how hard it was to make it a personal experience for her customers inside of the big salon along the Randall Road corridor in Algonquin Her salon is part of the InStyle Salon and Spa Suites in the Esplanade along the west side of Randall in Algonquin Inside of InStyle Salon and Spa Suites there are about 25 different individual salon owners who have tailored their businesses so they can focus on what they specialize in or what they feel is important to their customers while others strictly stick to the cut and color “It's all about you and the customer being comfortable in a relaxing environment,” Putignano said “The focus with this for me is on the person sitting in my chair and not on everything else going on like in a big salon where you can't really relax I just wanted to make a nice warm environment and a comfortable place.” Each of the individual salons is decorated differently But being a part of a business like In Style Salon and Spa Suites the owners are not putting out as much money to begin with to run their own stand-alone store they are leasing space at In Style Salon and Spa Suites said she felt this was where the future of salons was headed She also offers personal touches such as warm neck wraps and scalp massages “I've been watching and this seems to be the new up-and-coming trend,” she said “A lot of people are tired of being at the big salons I was and I wanted to personalize it and make it more my own business “It seems to be the way a lot of people are going right now InStyle Salon and Spa Suites has a chain of locations, including one in St. Charles at 457 Dunham Road. For details, visit www.instylesuites.com Trick-or-Treat: Geneva Commons mall along Randall Road in Geneva is hosting a trick-or-treat event from 3 to 4:40 p.m and trick-or-treat at stores throughout the mall They'll know which ones are offering candy when they see a trick-or-treat sign in the window They can also probably tell by the line of kids with open bags who will be standing in the doorway Ÿ Amy Williams' column covers all the news of business along the Randall Road corridor from Batavia to Crystal Lake Contact her at randallbiz@comcast.net or (847) 894-5036 Benny’s Bodega and Jennifer Shotwell each received $25,000 on Thursday March 21 in a 50/50 raffle sponsored by Bill DeBoer co-owner and vice president at DeBoer’s Auto in Hamburg The winner was announced at a party at the Irish Cottage Inn in Franklin is set up like a store for people who are struggling to “shop” for food hygiene and cleaning supplies free of charge employed) population: people who work hard but don’t earn enough to get by although they make too much to receive government assistance The nonprofit is located at 166 Spring St. On Monday, 16 September the first electric train shall debut on the completely restored tracks of the Bari-Putignano line (via Casamassima) of Ferrovie del Sud Est The new ETR train (with 3 modules and at 59 metres long) has been designed according to modern standards of safety of which two are for passengers with reduced mobility 1 toilet and a luggage rack for large suitcases Amongst the services aboard are internal LED information displays mobile platforms to facilitate access for people with reduced mobility All 5 trains purchased by Ferrovie del Sud Est will be operational by the end of October and will guarantee 70% of connections quality of the environment and comfort in travel Present this morning for the inaugural journey from Mungivacca to Adelfia were Giovanni Giannini—the Regional Councillor for Transport Luigi Lenci—Chairman of Ferrovie del Sud Est and Giorgio Botti—Chief Executive Officer of Ferrovie del Sud Est The radical renewal of 48 kilometres of line (tracks ballast and beams) and the restoration of electrification mean electric trains can circulate on the Bari-Putignano (via Casamassima) line the Bari-Putignano (via Casamassima) stretch will be also equipped with the Sistema di Controllo Marcia Treno (SCMT - the Train Speed Control System) and 17 level crossings that are currently managed manually shall be entirely automated The total investment for the renewal of the infrastructure and the modernisation of the train fleet is equal to 80 million euro and will permit—by the end of 2020—an increase in the commercial speed of trains from the current limit of 50 kilometres/hour reducing the travel time between Bari and Putignano to less than an hour The Adelfia station is confirmed as the hub of integrated train/bus transport for the Bari-Putignano line (via Casamassima) It is from here that the connections by bus to and from Cellamare Amongst the developments of the new timetable trains shall return to the Putignano-Martina Franca-Taranto line which will be reopened following the track restoration works There are thirty trains circulating daily between Putignano and Martina Franca (with a travel time of 55 minutes) 16 trains between Taranto and Martina Franca (with a travel time of 50 minutes) Finally comes Ferrovie del Sud Est’s 2019 scholastic offering thanks to the fruitful collaboration with the Puglia Region Municipal Institutions and Educational Institutes bus connections are more widespread and increasingly frequent based on the entry and exit times for the schools A dense network of connections connects the districts and smaller towns with the main school basins throughout the provinces of Bari We design and build infrastructure to move people and goods sustainably We’re shortening the distance for the development and growth of our country attended the Shen Yun Performing Arts performance at the Teatro Ópera in Buenos Aires a legislator in the Buenos Aires City Legislature and executive director of the anti-corruption Fundación Apolo a liberal political party now part of the Republicanos Unidos coalition Santoro said: “The performance was deeply moving and I learned more about traditional Chinese culture.” He was shocked by the portrayal of contemporary China’s persecution of faith: “I was outraged to see how a communist regime persecutes faith and suppresses spiritual cultural heritage.” Santoro admired the artists’ courage and thanked them for bringing the truth to light: “I want to congratulate them for delivering such an outstanding performance “I feel so proud to witness this performance The pure and beautiful performance left Ms Putignano in awe: “The performance was absolutely stunning I strongly recommend everyone see it—it far exceeded my expectations.” Putignano viewed the performance as more than an artistic feast; it stirred the soul: “The artists’ mission and the values they convey touch the audience’s hearts Beyond the exquisite dance and masterful technique they spread values that strive for a better society.” She elaborated that these values—truthfulness and forbearance—guide the artists’ actions: “Additionally as their dances displayed an impressive level of synchronisation.” Putignano described herself as a devoted Shen Yun fan noting that each performance offers a new experience: “I just returned from Cologne five days ago but the insights I gained there [watching Shen Yun] were completely different from today.” Traditional Chinese culture is a divine culture Putignano felt the performance conveyed many divine messages creating a connection: “I felt this connection because I’m very sensitive.” Regarding Shen Yun’s inability to perform in China and communication must be open to the world.” From The Epoch Times NTD is a media sponsor of Shen Yun Performing Arts Author Joe Putignano and his gorgeous fiancee just elevated the term "couples goals" to a whole new level based on the absolutely beautiful photo Joe posted on Saturday night one of which is a best-selling author & Broadway performer (Joe) and the other is a top personal trainer in New York City (Josh) have shared several adorable photos of the two of them on both of their respective social medias however this one truly takes the cake (and you see the cakes too!) With the simple caption "The love of my life" Joe posts a gorgeous pic of him and Josh passionately kissing sans any sort of clothing.  Not that we are looking but kudos for the great wall accessories as well Gives us something to live up to this year!  Best of luck to Joe and Josh on their journey The love of my life @ptjoshb #joeputignano #acrobaddict A post shared by Joe Putignano (@joeputignano) on Feb 3 Creepy with the skulls everywhere and stuff animals..but to each their own Δdocument.getElementById( "ak_js_1" ).setAttribute( "value"