Unexpectedly in London on Wednesday 16th April 2025.
He is predeceased by his parents Jim and Margaret, brother Connie, sister-in-law Eileen and sister Rita Keehan.
Loving husband of Mary (Cronin, Knockmanagh, Kilcummin) and adored father of Leanne, Emma and Liam.
Funeral for Sean [Seano] O’Sullivan will take place in London.
A memorial mass will take place at the Sacred Heart Church, Ballyhar at a later date.
Those who wish to offer their condolences to Seano’s family can do so using the "Condolences" option below.
Enquiries to Eamon O’Connor Funeral Director, Firies.
memorial mass or anniversary for a Loved One?You can now create a family notice on RIP.ie to remember your loved one
<a href="/articles/s41467-024-47985-z/metrics" data-track="click" data-track-action="view metrics" data-track-label="link" rel="nofollow">Metrics details</a>
Glioblastoma (GBM) is a highly lethal type of cancer
GBM recurrence following chemoradiation is typically attributed to the regrowth of invasive and resistant cells
there is a pressing need to gain a deeper understanding of the mechanisms underlying GBM resistance to chemoradiation and its ability to infiltrate
we demonstrate that chemoradiation and brain vasculature induce cell transition to a functional state named VC-Resist (vessel co-opting and resistant cell state)
This cell state is midway along the transcriptomic axis between proneural and mesenchymal GBM cells and is closer to the AC/MES1-like state
VC-Resist GBM cells are highly vessel co-opting
allowing significant infiltration into the surrounding brain tissue and homing to the perivascular niche
which in turn induces even more VC-Resist transition
The molecular and functional characteristics of this FGFR1-YAP1-dependent GBM cell state
and induction of senescence/stemness pathways
contribute to its enhanced resistance to chemoradiation
These findings demonstrate how vessel co-option
and GBM cell plasticity jointly drive resistance to therapy during GBM recurrence
The two most clinically relevant challenges faced by patients with GBM are chemoradiation resistance and extensive infiltration of the peritumor regions
chemoradiation is insufficient to prevent regrowth of infiltrative therapy-resistant cells that are not removed by resection
little is known about how therapeutic stress and microenvironment dynamically modulate the plasticity of these cellular states or others
whether and how infiltrative vessel co-option and perivascular niche are relevant during GBM therapy remains unclear
we demonstrate that chemoradiation therapy can cause GBM cells to undergo a reprogramming into a vessel co-opting and invasive cell state
which we have designated as VC-Resist (acronym for vessel co-opting resistant)
This cell state – basally present in naïve cell populations but also induced by therapy – is intermediate in the proneural-mesenchymal axis
resistant to therapy and characterized by FGFR1 upregulation
as well as YAP1 and DNA-damage repair (DDR) machinery activation
this vessel co-opting cell state is extrinsically induced by blood vessels
leading to a local increase in its resistance to treatment
G Feature plot for CL3 signature in the harmonized database with over 1 M GBM cells
I Enrichment of NesHI cell population upon IR (2 and 5 Gy) in NestinP-dTomato MGG4 cells analyzed by real-time microscopy
Data are means ± SEM (n = 3 independent experiments
technical duplicates per experiment; p &lt; 0.0001; one-way ANOVA
J Enrichment of NesHI cell population upon IR (2
12 Gy) analyzed at day5 by FACS in NestinP-dTomato MGG4 and MGG18 cells
Data are means ± SEM (MGG4 n = 4; MGG18 n = 3; ns
non-significant; *p &lt; 0.05; **p &lt; 0.01; ***p &lt; 0.001; ****p &lt; 0.0001; one-way ANOVA
K Spearman correlation analysis of basal Nestin expression and fold change (FC) of Nestin expression after irradiation (5 Gy) in 10 GBM cell lines
X-axis: 1/basal CT values for Nestin expression determined by RT-PCR; Y-axis: Nestin FC after IR determined by RT-PCR
Patient-derived (blue) mouse (green) cell lines (n = 3 per cell line
L Time-lapse micrographs of FACS-sorted MGG4 NesLO cells showing Nestin reporter activation (arrows)
N Enrichment of MGG4 NesHI cell population overtime upon IR (5 Gy) or not (Naive) in FACS-sorted MGG4 NesLO cells analyzed by real-time microscopy and FACS
Data are means ± SEM (n = 3 biologically independent experiments
O Enrichment of NesHI cell population under IR (5 Gy) in FACS-sorted MGG18 and GL261 NesLO cells analyzed at day3 by FACS
Data are means ± SEM (MGG18 n = 4; GL261 n = 3; ***p &lt; 0.001; ****p &lt; 0.0001; unpaired two-sided t test)
by suggesting a marked intertumoral heterogeneity in the number of CL3+ cells
our findings demonstrate a cell state transition induced by radiotherapy in GBM cells
</a>A (Left)Volcano plot of the differential expression analysis between MGG4 naïve and treated with TMZ (25 μM) for 3days
(Right) GSEA plot of the CL3 signature in TMZ-treated MGG4 cells vs naïve
Normalized enrichment score (NES) and q.value are indicated (p = 0,0003; Fisher’s test)
B CL3 signature distribution in the scRNA-seq dataset from Larsson
(Left) Visualization of conditions (naïve or TMZ-treated U3065MG cells) and feature plot of CL3 geneset expression in scRNA-seq UMAP
(Right) Proportions of CL3-HI or CL3-LO cells (p = 0.0003; z-test)
C NesHI cell population upon TMZ treatment (25
50 and 100 μM) in NestinP-dTomato MGG4 cells by real-time microscopy (n = 3 biologically independent experiments
D NesHI cell population upon TMZ treatment (25
50 and 100uM) at day3 by FACS in NestinP-dTomato MGG4
Data are means ± SEM (n = 4 independent experiments; ns
non-significant; **p &lt; 0.01; ***p &lt; 0.001; ****p &lt; 0.0001; one-way ANOVA
E Spearman correlation analysis of basal Nestin expression and Nestin fold change (FC) of upon TMZ (25 μM) in 7 GBM cell lines
X-axis: 1/basal CT values for Nestin expression by RT-PCR
Patient-derived (blue) mouse (green) cell lines (n = 3; R = 0,84; p = 0,001; Spearman test)
F (Left) Time-lapse micrographs of FACS-sorted MGG4 NesLO cells showing the reprogramming detected by dTomato fluorescence (arrow)
(Right) of NesHI cell population enrichment upon TMZ treatment in FACS-sorted NesLO MGG4 cells
(n = 4 biologically independent experiments
G NesHI cell population upon TMZ treatment (25 and 50 μM) in FACS-sorted MGG4 NesLO cells analyzed at day3 by FACS
Data are means ± SEM (n = 3 independent experiments; ****p &lt; 0.0001; one-way ANOVA
H NesHI cell population enrichment upon TMZ treatment in FACS-sorted MGG18 (left) and GL261 NesLO cells (right) analyzed at day3 by FACS
Data are means ± SEM (n = 3; *p &lt; 0.05; ***p &lt; 0.001
I NesHI cell population upon IR alone or combinatorial therapy (25 μM TMZ and indicated IR dose) in NestinP-dTomato MGG4 by FACS at day3
Data are means ± SEM (n = 3 independent experiments; ***p &lt; 0.001
****p &lt; 0.0001 vs the correspondent IR doses; two-way ANOVA
these results indicate that TMZ chemotherapy induces reprogramming towards the cell state we discovered
thus making it a GBM DNA-damaging therapy-induced cell state
already present in the naïve population but strongly induced by TMZ or IR treatment via phenotypic reprogramming
we found that monitoring Nestin expression may be instrumental in following this GBM cell state
K FACS analysis of CellTraceTM dye dilution during cell division
Data are means ± SEM (n = 3 independent experiments; ns
L Bar plots showing decrease in SubG1 and increase in G2M cell cycle phases in NesHI cells compared to NesLO in NestinP-dTomato MGG4 cells
Data are means ± SEM (n = 3; *p &lt; 0,05; **p &lt; 0.01; paired two-sided t test)
M Decrease of NesHI cell population overtime in FACS-sorted NesHI MGG4 and NesHI GL261 cells by FACS
N β-Gal senescence staining in FACS-sorted NesLO and NesHI MGG4 or GL261 cells
Data are means ± SEM (n = 3 independent experiments; ***p &lt; 0.001; unpaired two-sided t-test)
These results show that the CL3/NesHI cell state is intermediate in the PMT
partially reversible and with DDR machinery activation
These intriguing results prompted us to investigate the behavior of NesHI cells in an orthotopic environment. Intravital microscopy of NestinP-dTomato MGG4 tumors implanted in mouse brains showed that the VC-Resist cells were preferentially located in the proximity of Dextran-labeled blood vessels and extended protrusions towards them (Fig. <a data-track="click" data-track-label="link" data-track-action="figure anchor" href="/articles/s41467-024-47985-z#Fig6">6A</a>).
Although further cases of GBM are needed to confirm this finding in patients
these findings combined with the others above collectively suggest that the naïve and treated VC-Resist cell state co-opts brain vasculature and that brain vessels induce cell state transition of NesLO cells towards the VC-Resist phenotype in vitro and in vivo
</a>A Nestin expression in NestinP-dTomato MGG4 cells in presence of conditioned media from blood vessels (CM-BV) or conditioned media from brain endothelial cells (CM-bEnd) using time-lapse imaging
Data are means ± SEM (n = 4 independent experiments; p = 0.0003; Spearman correlation)
B Enrichment of GL261 NesHI cell population when cultured with bEnd-CM or control (CT) media by FACS
Data are means ± SEM (n = 3 independent experiments; p = 0.0016; paired two-side t test)
C Nestin mRNA per cell in NestinP-dTomato MGG4 cells in the presence of bEnd.3 conditioned media (CM) or control media (CT)
D (Left) Real-time micrographs of NestinP-dTomato MGG4 cells embedded in agarose gel showing the induced NesLO-to-NesHI transitions
(Right) Quantification of the reprogramming rate in NestinP-dTomato MGG4 cells pre-conditioned in CT or CM for 3 days (n = 76; ****p &lt; 0.0001; unpaired two-sided t test)
E Pearson correlation analysis of basal Nestin expression and fold change (FC) of Nestin expression in presence of conditioned media (bEnd-CM) in 4 GBM cell lines
Patient-derived (blue) mouse (green) cell lines (n = 3; R = 0,88; p = 0,001; Pearson test)
F Enrichment of MGG4 NesHI cell population in the presence of CM-bEnd (CM) both with (5 Gy) and without IR analyzed at day5 by FACS
Data are means (n = 2 independent experiments; *p &lt; 0.05; **p &lt; 0.01; two-way ANOVA
GSEA plots of the VC-Resist signature and senescence geneset (FRIDMAN_SENESCENCE_UP) in MGG4 co-cultured with blood vessels (Bottom)
or GSC2 co-cultured with endothelial cells
The normalized enrichment score (NES) and q.value are indicated
H β-Gal senescence in NestinP-dTomato MGG4 cells after treatments (5 Gy of IR
Data are means ± SEM (n = 3 independent experiments; *p &lt; 0.05; unpaired two-sided t test)
I FACS analysis of CellTraceTM dye dilution during cell division in CT or CM-bEnd cells
Time to undergo cell division was calculated based on the mean fluorescent intensity values
J Cell death (percentage of Sytox+ cells) in NestinP-dTomato MGG4 cells conditioned with bEnd.3 conditioned media (CM) or control (CT)
Data are means ± SEM (n = 3 independent experiments; ***p &lt; 0.001; unpaired two-sided t test)
D Kinase enrichment analysis (KEA) on phosphoproteome in the patient-derived PN-MGG4 and the mouse MES-GL261 GBM cells treated for 72 h with control (CT-CM) or blood vessel conditioned media (BV-CM) (n = 5 independent experiments; z-score is indicator of the kinase activity estimated; significant in black and not-significant in gray)
</a>A YAP1 Ingenuity Pathway Analysis (IPA) z-scores for all conditions and cell lines with corresponding p value
Quantification of immunoblot using YAP and p-YAP antibodies for YAP activation in VC-Resist state transitions
Quantification of YAP localization in FACS-sorted MGG4 (C)
GL261 (D) NesLO or NesHI cells or in MGG4 bEnd-conditioned (CM) or control (CT) media (E) (n = 326 cells for MGG4 NesLO
315 cells for MGG4 NesHI; 343 cells for GL261 NesLO; 316 cells for GL261 NesHI; 377 cells for CT; 361 cells for CM; 3 independent experiments; unpaired two-sided t test)
F(Left) FACS plots of YAP-activation (dsRed) in MGG4 cells treated with bEnd conditioned media (bEnd-CM) vs control (CTRL)
(Top right) YAP-responsive reporter lentiviral construct
(Bottom right) YAP activation in MGG4 cells treated with blood vessel conditioned media (bEnd-CM) vs control (CTRL)
Data are means ± SEM (n = 4 independent experiments; *p &lt; 0.05; unpaired two-sided t test)
G Inhibition of the BV-CM induced enrichment of NesHI when NestinP-dTomato MGG4 cells are silenced for YAP1 (siYAP1) in comparison with scramble (siCTRL) by FACS
Data are means ± SEM (n = 3 independent experiments; **p &lt; 0.01; paired two-sided t test)
H Nestin expression in NestinP-dTomato MGG4 cells silenced for YAP1 (siYAP1) or scramble (siCTRL) in presence of conditioned media from blood vessels using live-cell imaging
Data are means ± SEM (n = 3 independent experiments; p &lt; 0.001; Spearman correlation)
I GSEA plot of the VC-Resist signature in verteporfin-treated GBM cells vs control from Barrette et al.
J YAP activation is in silico predicted by using the Molecular Activity Predictor with the genes from VC-Resist signature
L The FGF-trap compound NSC12 inhibits the bEnd conditioned media (bEnd-CM) or the irradiation-induced reprogramming
while it does not modify the maintenance of NesHI state
Data are means ± SEM (n = 3 independent experiments; *p &lt; 0.05; **p &lt; 0.01 vs the CM/vehicle condition; paired two-sided t test)
M The FGF-trap inhibitor NSC12 blocks the bEnd-CM-induced YAP-responsive reporter activation
YAP activation in MGG4 cells treated with conditioned media (bEnd-CM) vs control (CT) (n = 3 independent experiments; *p &lt; 0.05; ***p &lt; 0.001 vs the respective CM/vehicle condition; paired two-sided t test)
Finally, we decided to in silico validate the potential activation and upstream regulator/s of YAP1 using the IPA molecule activity predictor (MAP) tool. Using transcriptomic measurements of the 32 common genes in NesHI VC-Resist cells and the curated Ingenuity Knowledge Base, IPA predicted strong activation of YAP1 in NesHI VC-Resist cells (Fig. <a data-track="click" data-track-label="link" data-track-action="figure anchor" href="/articles/s41467-024-47985-z#Fig9">9J</a>)
these findings revealed that the VC-Resist state transition is mechanistically driven by the FGFR1-YAP1 axis
</a>The VC-Resist cells are intermediate in the PMT and are highly resistant to therapy
we propose a model wherein chemoradiation leads to vessel co-option and resistance to therapy via reprogramming of GBM cells into the VC-Resist cell state
as increased resistance and vessel co-option contribute to the recurrence of GBM
the intermediate states in the PMT are unclear
and the data presented here are one of the first reports of pPMT and pMPT
and their link with therapy and the GBM microenvironment
while here we show that they are actively induced by therapy via cell plasticity
suggesting a non-exclusive senescence/stemness combination based on the cell plasticity observed under our experimental conditions
we surprisingly proved that angiocrine factors released from naïve blood vessels and endothelial cells strongly induce the cell state transition towards VC-Resist
regardless of the mutational landscape of GBM cells or their transcriptional subtype
This naïve TME-induced senescent-like status changes our way of seeing senescence as a phenomenon induced exclusively by stress and certainly opens stimulating questions on its role in GBM progression
thus evading gadolinium leakage that highlights tumor areas
This delineates a scenario where surgery does not remove the invasive vessel co-opting GBM cells that are intrinsically and extrinsically resistant to therapy due to reprogramming towards the VC-Resist cell state
here we discovered that vessel co-option in AC/MES-like cells is an intrinsic and acquired resistance mechanism to conventional therapy
Our findings suggest that cell plasticity during chemoradiotherapy directly induces resistance and aggressiveness in recurrent tumors
and localization of the VC-Resist cell state directly in patients with GBM
In conclusion, here we show a cell state called VC-Resist that, even if already present in naïve tumors at different levels, is strongly induced by chemoradiation and angiocrine factors from the brain blood vessels. The VC-Resist cells are intermediate in the PMT and are highly resistant to therapy, vessel co-opting, senescent-like and slow-cycling (Fig. <a data-track="click" data-track-label="link" data-track-action="figure anchor" href="/articles/s41467-024-47985-z#Fig10">10</a>)
All animal care and treatment protocols complied with European legislation (no
2010/63/UE) and national (French Ministry of Agriculture) guidelines for the use and ethical treatment of laboratory animals
Experimental procedures were specifically approved by the ethics committee of the Institut Curie CEEA-IC #118 (Authorization number APAFIS#24702-2020031815185853 v2 given by the National Authority) in compliance with the international guidelines
The mouse GL261 cell line was purchased from The Jackson Laboratory (Bar Harbor
USA) and the mGBM1 and mGBM2 were provided by Dr
The BT18 and BT27 were maintained in neurospheres using Dulbecco’s Modified Eagle’s Medium (DMEM) containing F12,GlutaMAXTM supplement (Gibco Thermo Fisher Scientific #10565018)
#78003) and 20 ng/ml EGF (STEMCELL Technologies
All other GBM cells were maintained in neurospheres using NeuroCult basal medium with NeuroCult proliferation supplement (STEMCELL technologies
#07980) and gentamycin (Sigma) (NC complete media) in low attachment flasks (Corning
All cell lines were repeatedly tested and were negative for mycoplasma using the Mycoplasma Detection Kit (MB Minerva Biolabs
Cells were authenticated and cultured for no more than 15 passages
Neurospheres were passaged when they reached a diameter of 100-150 μm or a high density using accutase (Thermo Fisher Scientific
while the GFP fluorescent protein expression is controlled by the CMV promoter
Cells were then selected using 0,25ug/ml puromycin 48 h post transduction for 2 weeks
MGG4 cells were infected with lentiviral particles and selected with 4ug/ml blasticidin 48 h post transduction for 2 weeks
The pLV-EGFP:T2A:Puro-Nestin&gt;dTomato and pLV-Bsd-EF1A &gt; (GLuc) were generated by VectorBuilder Inc
Infected cells were then selected using 1 mg/ml of G418
The bEnd.3 cells (ATCC CRL-2299) were cultured in complete DMEM/F12- with GlutaMAX supplemented with 10% fetal bovine serum (Eurobio
penicillin-streptomycin (100U/ml) (Invitrogen 15140122)
The conditioned media from bEnd.3 cells was collected as follows: once cells reached 90-95% of confluence (in their growth culture media)
they were washed using NeuroCult basal medium
the same volume of medium was placed in 10 cm2-plate with no cell to be used as a control
MGG4-Nestin cells were seeded into 24 well plate before transfection
Cells were transfected with 30pmol of siRNA-YAP1 (#4392420; Ambion by Life Technologies) or siRNA-Control (#4390843; Ambion by Life Technologies) using lipofectamine RNAiMAx Reagent (#13778; life technologies) for 48 h at 37 °C
RNA extraction and qPCR have been done to check the efficiency of YAP silencing using YAP1 TaqMan assay (4331182
either resuspended with accutase as single cells or kept as small neurospheres and irradiated using a Cs-137 source (GSR Cs137/C
Gamma Service Medical GmbH) at the indicated doses
and seeded at optimal density depending on the experiment
TMZ was diluted in DMSO and used at indicated concentrations
For combinatorial experiments (γ-irradiation and TMZ) cells were first irradiated as indicated above before seeded in the presence of TMZ at indicated concentrations
NSC12 (a FGF2/FGFR2 interaction inhibitor) was purchased from Selleck Chemicals (#S7940
USA) and used at indicated concentrations for 3 days before analysis
DNAse-digested to remove DNA contamination and purified using the QIAGEN RNeasy Mini Kit (QIAGEN
#74104) according to the manufacturer’s instructions
RNA quality and concentration were determined using a Nanodrop (Thermo Fisher)
1ug of RNA was then reverse-transcribed using superscript III (Thermo Fisher
qPCR was then performed using the Fast advanced master mix in the light cycler QuantStudio5 (Applied Biosystems)
Inventoried Taqman assays were first validated for maximal efficiency
4.000 MGG4 NestinP-dTomato cells were seeded on a low attachment 96-well-plate in conditioned media from blood vessels (0,5 brain/ml of CM-Bv vs CM-Control) or conditioned media from bEnd.3 cells (50% CM-bEnd vs CM-Control)
The real-time visualization of NestinP Tomato reporter was performed using an IncuCyte live-cell imaging system (Sartorius)
Images were taken every 3 h at ×4 magnification using RFP channel and phase contrast for 4 days
The IncuCyte Basic Software was used to perform image analysis
Cell segmentation was performed by using the phase contrast images
An area filter was applied to exclude objects below 50 μm2 (debris)
Red channel background noise was subtracted with the Top-Hat method of background non-uniformity correction with a radius of 100 μm and a threshold of 0,6 red corrected units
Fluorescence signal was quantified as follows: the area of cells expressing tdTomato divided by the total area of cells
MGG4-NestinP-dTomato cells irradiated (2 or 5 Gy) or not were seeded on a collagen-I coated (50 μg/ml) 96 well plate (3000 cells per well) in Neurocult complete media or Neurocult complete media containing 0
The real-time visualization of NestinP-dTomato reporter was performed using an IncuCyte live-cell imaging system
Images were taken every 3 h at ×20 magnification using RFP channel and phase contrast for 5 days
and a custom ImageJ macro was designed to quantify the number of GFP+dTomato+ cells and GFP+dTomato- cells at each time point for all timepoints
The percentage of double positive cells was then calculated
and resuspended as single cell suspension with accutase
and resuspended in neurocult media before filtering in a FACS tube
Cells then loaded into the BD FACSAriaTMIII sorter (BD Biosciences)
Viable cells were first gated based on their size and granularity on FSC-A/SSC-A parameters
Doublets were excluded using both FSC-A/FSC-H and SSC-A/SSC-H parameters
cells were plotted for their FITC and dTomato parameters
GFP-neg cells were excluded and sorting was performed on GFP-pos/dTomato-neg cells for NesLO cells and GFP-pos/dTomato-pos cells for NesHI cells
gates were placed at each extremity of the dTomato intensity plot
MGG18 or GL261 cells were seeded at the optimal density
treated (IR or TMZ) or not and cultured for several days according to the experiment
neurospheres of each condition were collected
and resuspended with accutase as single cell suspension
centrifuged and resuspended in MACS buffer and divided in 2 FACS tubes: one for the dTomato analysis
cells were loaded into the BD LSRFortessaTM Cell Analyzer (BD Bioscience)
Live cells were first gated and doublets were then excluded as explained above
NestinP-dTomato cells were detected using the PE channel
MGG18 or GL261 naïve cells were used as control
#S34857) was added in the flow cytometry tube containing cells and incubated for few minutes
Cells were then loaded into the FACS analyzer
Debris were discarded based on FSC-A/SSC-A parameters and Sytox positive cells were then detected in the BV421 channel
Cells without Sytox of each and all conditions were used as control for proper identification of Sytox positive cells
Analysis of all the recorded FACS data were then performed using FlowJo v10.7.2 software (BD Biosciences)
MGG4 cells expressing the YAP/TAZ activity reporter were plated at the optimal density on collagen I (Thermo Fisher
#A1048301) coating in 50% bEndCM or 50% CTL media
Cells were loaded into the FACS analyzer (BD Fortessa)
and doublets were then excluded as explained above
DsRed positive cells were detected using the PE channel
incubated without the TMP were used as control for gating
Analysis of all the recorded FACS data were then performed using FlowJo
Click-iT EdU Alexa Fluor 647 kit was used (#C10424; Thermo Fisher Scientific)
MGG4 NestinP dTomato cells were seeded at an initial density of 1 × 105 cells/well in 6-well plates
Depending on time points and treatments employed (5 Gy irradiation or preconditioning with bEnd.3 CM)
washed with PBS and incubated with EdU at a concentration of 10 μM for 2 h at 37 °C
EdU incorporation was subsequently detected by Alexa Fluor 647 azide
followed by Sytox staining as per manufacturer’s protocol (Thermo Fisher Scientific)
S and G2/M phases were determined in each condition
The histogram plots for fraction of cells in each cell cycle phase was plotted using GraphPad 8 software
FACS gating strategies provided in Supplementary Fig. <a data-track="click" data-track-label="link" data-track-action="supplementary material anchor" href="/articles/s41467-024-47985-z#MOESM1">17,</a><a data-track="click" data-track-label="link" data-track-action="supplementary material anchor" href="/articles/s41467-024-47985-z#MOESM1">18</a>
All samples were run through the ImageStream X MKII (ISX MKII) imaging flow cytometer (LUMINEX Corporation
Texas) and data was acquired with ISX INSPIRE software
Images of cells were acquired for each sample at 60X magnification with the extended depth field (EDF) mode by using 4 lasers set as 405 nm 20 mW for DAPI
561 nm 170 mW for Nestin and 642 nm 150 mW for γ-H2AX; brightfield images were captured in channel Ch01 and Ch09
while the DAPI images were captured in channel Ch07; GFP on channel Ch02
Nestin (dTomato) on channel Ch03 and γ-H2AX on channel Ch11
Data were recorded by gating on Ch01 area feature and Ch01 Aspect Ratio feature
allowing to select cells by size and avoiding debris
MGG4 cells were single stained with DAPI or γ-H2AX
The data analysis was done by using the Image Data and Exploration Analysis Software (IDEAS) package (v6.2)
Compensation matrix and scatted profile for each channel were applied and following gating strategy applied: we selected cells in focus with Ch01 Gradient RMS feature (Focus)
and isolated single cells using Ch01 area and Aspect Ratio Intensity features (Singlets)
We then gated on DAPI positives nuclei (DAPI + )
followed by the isolation of gH2AX positives events γ-H2AX +  and finally the identification of NesHI and NesLO populations
For γ-H2AX analysis in both respective NesHI and NesLO population
we first quantified geometric mean fluorescence intensity of γ-H2AX in each population
to quantify the nuclear γ-H2AX foci formation in each population per cell
we created a specific mask allowing the identification of all γ-H2AX peaks of intensity and exclude background noise (Peak (M11
The plots and curves for spot quantification and geometric mean fluorescence intensity of γ-H2AX in each condition was plotted using GraphPad 8 software
For chemotaxis experiments u-slide chemotaxis slides (Cat number-80326 Ibidi GmbH
These are microscopy slides equipped with 3 chambers each consisting of one channel for cells and 2 reservoirs for media with and without chemotaxis factors
channels were coated with 50ug/ml of collagen 1 for 1 h at 37 °C
the cells at a concentration 107 cells/ml were seeded in the channels
Once the cells were well attached in the channels
bEnd.3 CM was added at a concentration of 50% (diluted with Neurocult complete media) in the first reservoir while in the second reservoir we added the control media
a positive and a negative control with bEnd.3 CM or control media in both reservoirs were loaded
This allowed us to analyse specifically chemotaxis and avoiding any potential chemokinesis effect induced by CM
Cells were seeded on collagen-I (MGG4) or fibronectin (GL261) in an Ibidi chamber slide (m-slide 8 well Ibidi GmbH
permeabilized using PBS Triton X-100 0.1% and then blocked in 10% FBS
Cells were then incubated overnight with primary antibody against YAP (D8H1X
XP® Rabbit mAb #14074 S) in blocking buffer at 4 °C
Cells were then washed in PBS and incubated with Alexa Fluor-conjugated secondary antibodies (1:500; Thermo Fisher Scientific) for 1 h at RT and finally stained with DAPI 1 μg/ml
Images were acquired using an inverted microscope (Leica DMI6000B)
Nuclear versus cytoplasmic YAP signal was analyzed using a custom ImageJ macro designed to quantify the signal in each compartment
All animal procedures were conducted in compliance with recommendations of the European Community (2010/63/UE)
7 to 8-week-old female Swiss nude mice (Crl:NU(Ico)-Foxn1nu; Charles River) were used in our studies
These mice were housed in temperature and light controlled facility with maximum five mice per cage
Mice were routinely observed and weighted to ensure that interventions were well tolerated
Animal experimental procedures were specifically approved by the ethics committee of Institut Curie (CEEA-IC #118; 2018-010)
For the orthotopic implantation of the patient-derived MGG4 cell line
mice were anesthetized with isoflurane and secured in stereotactic head holder
20.000 MGG4-Gluc cells in 5 μl of media were implanted at the following coordinates according to Bregma: x = 2; y = −0.5; z = −3/−2 mm
In vivo tumor growth was monitored using an established Gluc assay<a data-track="click" data-track-action="reference anchor" data-track-label="link" data-test="citation-ref" aria-label="Reference 83" title="Tannous, B. A. Gaussia luciferase reporter assay for monitoring biological processes in culture and in vivo. Nat. Protoc. 4, 582–591 (2009)." href="/articles/s41467-024-47985-z#ref-CR83" id="ref-link-section-d8952059e3771">83</a>
Gluc activity was routinely recorded in the blood
Blood Gluc activity was measured using Coelentrazine (100 μM; Nanolight Technologies) by a Tristar2 multi-modal microplate reader (Berthhold technologies) in the luminescence mode
the blood Gluc activity was required to reach a predefined threshold range of 2–5 × 106 RLU/s
MGG4-Gluc tumors reached the predefined Gluc threshold at median period of 90 days
For in vivo irradiation treatment the Small Animal Radiation Research Platform (SARRP
an image-guided micro X-ray irradiator was employed; wherein the treatment group (10–15 mice) was treated with a dose 10 Gy
10 mg/kg of TMZ (Sigma T2577) prepared in DMSO solution in treatment group was intraperitoneally injected while control group was injected with the same amount of DMSO
the tumor growth was monitored by measuring Gluc activity in blood over a period of 7 days
we ensured that we had time-matched Gluc values for control and 10 Gy mice
the determination of maximal tumor size/burden was based on a combined assessment involving GLuc measurement and clinical behavior evaluation
The experimental protocol established a maximum threshold for tumor burden when GLuc reached more than 15 million GLuc bioiluminiscence units
the endpoints in this study were determined by a loss of 15-20% of the mouse initial body weight and/or the degradation of the general condition of the animal such as prostration
the maximal tumor size/burden was carefully monitored and did not exceed the predetermined threshold
thus maintaining the ethical standards outlined by the research institution and its regulatory bodies
Mouse brains were heart-perfused with 4%PFA under controlled pressure
The harvested brains were immersed in 4%PFA for 24–48 h
After PBS washes and dehydration step with increasing gradient of ethanol percentage solutions
All paraffin-embedded blocks were sectioned to obtain coronal sections of 7 μm
To visualize general tumor histopathology features
tissue sections were routinely H&amp;E stained
sections were deparaffinized and then underwent heat induced antigen retrieval step in citrate buffer pH6 for 20 mins
The sections were then subjected to blocking and incubation overnight at 4 °C with the following primary Abs: anti-Nestin (10C2; 1:200; Ebiosciences or #PAS-82905
anti-hMito (113-1; 1:200 or 1:50; Millipore)
R&amp;D Systems) and anti-CD34 (EPS73Y; 1:500; Abcam)
the sections were incubated with HRP or AP secondary Ab polymer for 25 mins at RT
the revelation was done using for Vector Substrate Peroxydase DAB kit and Substrate ImmPACT Vector Red AP kit
In both cases the sections were counter stained with hematoxylin for nuclear staining and finally the sections were mounted using aqueous based mounting media
secondary antibodies (Alexa Fluor Donkey anti-Rabbit 488) (#A21206
Dylight Donkey anti-Mouse 650 (#DkxMu-003-D650NHSX
ThermoScientific) were applied for 30 min at room temperature
the slices were mounted using Fluoroshield with DAPI Histology Mounting Medium (#F6057
MACs clearing was performed according to the manufacturer’s instruction (#130-126-719; Miltenyi Biotech)
washed with PBS and embedded in 4% agarose for cutting into 500um slices with vibratome
Brain slices were permeabilized overnight at RT and incubated with primary antibodies (chicken GFP antibody from AvèsLabs #GFP-1020; rabbit mCherry antibody from Curie Facility #APR-13; Lycopersicon Esculentum Lectin dylight-649 #DL-1178 Vector Laboratories) for3 days at 37 °C
After washes with staining solution 5 times
the secondary antibodies were added (AlexaFluor555 goat anti-rabbit #A21429 Invitrogen or goat anti-chicken-555 #ab150170 Abcam) overnight at 37 °C
After washes with staining solution 3 times
labeled slices were embedded in 1,5% agarose and dehydrated with a series of ethanol dilutions (50% ethanol / 70% ethanol / 100% ethanol containing 2%Tween 20)
the embedded slices were transferred on tubes containing clearing solution for 6 h
12 bits images were acquired with a Leica SP8X inverted confocal laser scanning microscope (CLSM)
equipped with a 16x FLUOTAR immersion objective (NA = 0.6)
The objective ring was adjusted for oil immersion (RI 1.51)
Sequential excitation mode (647 nm and 555 nm obtained with a white light laser (WLL)) was used to collect images on GaAsP Hybrid photon detectors
Emission was detected at 660-710 nm upon excitation at 647 nm and at 575‐625 nm upon excitation at 555 nm
The whole system was driven by LAS X software (Leica)
Whole slide scan images of sections at 20X magnification were obtained using ZEISS AXIO Imager Z2 microscope
Automated quantification of staining was performed using Visiopharm (VIS; Visiopharm A/S
Blinding during analysis was used for all the in vivo experiments
An algorithm-based analysis protocol package (APP) was developed to detect the tumor area in each tissue section
A deep-learning-based APP was created to distinguish tumor vs normal tissue based on the differences in cell density
For Nestin positive nuclei detection in the defined tumor ROI
In this APP the differences in Nestin intensity and feature like Fast Red were used to detect and classify nuclei as NesHI or NesLO (or negative)
additional steps in the APP allowed us to separate and detect highly dense nuclear regions (NesHI nuclei
To calculate the percentage Nestin positive nuclei in tumor region:
The tumor area was also calculated for sections in treatment and control group to ensure that there were no significant differences between the two groups
which differentiated between tissue and background based on a classification method
a similar APP (like one used for Nestin+ nuclei quantification) was created to distinguish tumor vs normal tissue based on the differences in cell density
in addition tumor border was defined based on decreasing cell density from tumor core
Based on CD34 (in brown) for blood vessels and hMito (in red) for tumor cells staining
an APP was designed to detect blood vessels and tumor cells
we specifically detected tumor cells in the border of tumor in contact with blood vessels (vessel co-opting cells) and also quantified tumor cells present in total
Mice were sacrificed using the standard method of cervical dislocation
following which the brain was immediately harvested
Dissect pieces of tumor were immediately immersed in RNAlater solution (Invitrogen)
the tumor pieces in RNAlater were stored at 4 °C for 1 week before initiating RNA extraction
Tumor tissues were homogenized using Precellys CK28 Hard tissue homogenizing columns with ceramic beads and evolution homogenizer (Bertin Corp)
the RNA was extracted using RNeasy Mini kit (Qiagen)
only the probes aligned to human genes were taken in account
EGFP-NestinP-dTomato MGG4 tumor cells were stereotactically implanted into the right brain cortex of 8- to 10-week-old female immunocompromised Swiss nude mice (Crl:NU(Ico)-Foxn1nu; Charles River)
Injections were stereotactically performed at 0.5 mm right from sagittal sinus
1 mm caudal to the bregma and at a depth of 0.5 mm from the brain surface
7-mm-diameter cranial windows were surgically implanted to dynamically follow tumor cells intravitally
High speed driller with 0.6 mm burr-tip diameter was used to perform the craniotomy
Transparent cover glass was gently placed and glued to the skull with cyanocrylate and acrylic powder
Sequential imaging was performed with the use of 920 nm (for EGFP) and 990 nm (for NestinP-dTomato) excitation laser lights
The used emission filters were: 400-492 nm (for CascadeBlue)
500-550 nm for EGFP and 563-588 nm for dTomato
Resulted 2D images and 3D z-stacks were processed with Imaris Image Analysis software
Brains from C57 BL/6 mice (Charles River Laboratories) were washed in PBS and transferred into 1X HBSS (Sigma
All following steps of brain vessel isolation were carried out at 4 °C
Brain tissues were cut into pieces of approximately 1 mm using scalpel and homogenized using a 5-cm3 Potter-Elvehjem tissue grinder (Wheaton
mortar size 10 ml) with 20 strokes of the pestle
The resulting homogenate was centrifuged at 2000g for 10 min
the pellet containing the whole cortex homogenate was resuspended in 18% Dextran (Sigma
31390) solution in HBSS buffer with 10 mM Hepes by vigorously shaking
Centrifugation at 3220 g for 30 min resulted in a pellet containing the brain vessels and a white myelin-rich layer of floating glial and neuronal cells at the top
which was removed together with the supernatant
The blood vessel pellet was resuspended in HBSS buffer with 10 mM Hepes and 1% BSA (Sigma
#A2153) and passed through a 20 m cell strainer to remove single cells and debris
The brain vessels on top of the filter were washed and then collected by inverting and rinsing the cell strainer with HBSS with 10 mM Hepes and 1%BSA
the blood vessels were pelleted by centrifugation at 2000 × g for 5 min and resuspended in Neurocult complete medium to keep a ratio of 0.25 brain for 1 ml of media (24-well plate)
The conditioned medium from blood vessels was collected 24 h after the seeding of blood vessels according to the ratio of 0.25 brain per 1 ml of media
the same volume of medium was placed in 24-well plate without blood vessels to be used as a control
Immunofluorescence staining of blood vessels was performed after fixation with 4%PFA in PBS for 20 min at RT
permeabilized and blocked overnight with 0,25%Triton-X 100
Primary antibodies were diluted in the permeabilization/blocking solution and incubated at 4 °C
The blood vessels were washed 3X with 1%BSA
Alexa Fluor-conjugated secondary antibodies (1:500
Thermo Fisher Scientific) were incubated for 4 h at RT
then resuspended in approximately 30ul 1%BSA and subsequently mounted using mounting medium with DAPI
Blood vessels were seeded (0.25 brain/ml; in 24-well plate) on collagen-I coating (50 μg/ml; Corning #354236) to allow their attachment (24h-37 °C
The MGG4 NestinP-dTomato cells were added on top of the brain vessels (20.000 cells for 0,25 brain/ml of culture)
The vascular association was analyzed using an inverted microscope (Leica DMI6000B) at 37 °C with 5%CO2 for 24 h
Images were taken with GFP and dTomato and bright-field filters (10X magnification
every 10 min for 24 h for multiple positions)
Further analyses were performed using ImageJ software
Quantification of vascular association was calculated according to the following formula: (number of Nestin positive cells attached to vessel)/ (total number of Nestin positive cells in the field) compared to (number of Nestin negative cells attached to vessel)/(total number of Nestin negative cells in the field)
the quantification of the reprogramming was performed by calculating the number of Nestin positive cells normalized by the total number of cells in presence or not of vessels
The organotypic brain slice culture was based on previously published protocol<a data-track="click" data-track-action="reference anchor" data-track-label="link" data-test="citation-ref" aria-label="Reference 90" title="Humpel, C. Organotypic brain slice cultures: A review. Neuroscience 305, 86–98 (2015)." href="/articles/s41467-024-47985-z#ref-CR90" id="ref-link-section-d8952059e4130">90</a>
brain slices were cut using a vibratome (thickness at 250um in dissection buffer containing G-Glucose 1 M; NaHCO3 1 M; MgCl2 6H2O 100 mM; CaCl2 2 H2O 100 mM; Hepes 0.25 M pH7,4; amphotericin B 1X; penicillin-streptomycin in HBSS 1X) after embedding brain in 4% of low-melting agarose
Then brain slices were transferred on the top of a free-floating nucleopore membrane (13-mm-diameter
WHA110409-Sigma Aldrich) previously placed in a 24 well-plate containing NeuroCult NS-A Medium with the proliferation supplement (StemCell Technologies); 10mM G-Glucose; amphotericin B 1X; penicillin-streptomycin 1X; Glutamax 1X (Invitrogen) and kept at 37 °C for maximum one week
Immunostaining of brain slices was performed to attest the survival of all cell components of the brain microenvironment
brain slices were maintained overnight at 37 °C in the media
brain slices were labeled with lectin-647 (1 h at RT; 4 ug/ml; Vector #DL1178)
and then maintained in the bottom of a u-slide 8 well glass bottom (IBIDI chamber) with 2% agarose covered with Neurocult basal medium
a standard Gilson pipet was used to deposit 20.000 cells in the smallest volume possible
An inverted Nikon Spinning-disk microscope with 10X magnification was used for image acquisition at 37 °C and 5%CO2
Multistage positions and z-series corresponding to a range of 450 um were acquired every 20 min using 491
Imaris (Bitplane) was used to quantify the distance of MGG4-Nestin cells to vessels after creating segmentation for vessels and defining cells as spots at different time points
The correlation coefficient in spatially resolved data needs to be addressed differently compared to data where every datapoint can be assumed to be independent
In the context of spatial weighted correlation measurements
the model needs to be corrected for effects of local neighbor dependencies
we only made use of samples that were clearly distinguishable by histological features (n = 3)
Each sample was segmented into tumor core and the infiltrative area
which were then used to generated spatially weighted correlation arrays (c,c,n) (c = signatures and n = number of samples)
which was reduced by mean to a c x c correlation matrix
#74104) from all conditions and cell lines described
RNA quality was assessed using Agilent 2100 Bioanalyzer (RNA 6000 Nano kit -Agilent Technologies)
and filtered to focus on the cancer cells only for RNA extraction
for which the quality was assessed using an RNA 6000 Pico kit on Agilent 2100 Bioanalyzer
RNA-seq libraries were constructed using Illumina library structure (Illumina)
according to the manufacturer’s instructions
and were sequenced as 100 bp paired-end runs on the Novaseq 6000 (Illumina)
resulting in an average of 30 million reads per sample
RNA-seq data have been deposited in NCBI’s Gene Expression Omnibus (GEO; <a href="https://www.ncbi.nlm.nih.gov/geo/">https://www.ncbi.nlm.nih.gov/geo/</a>) and are accessible through GEO Series accession number <a href="https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE218860">GSE218860</a>
MGG4 naïve cells cultivated as small neurospheres were collected
and irradiated (5 Gy) or not (control cells)
neurospheres of both conditions (control and 5 Gy) were collected
centrifuged and resuspended with accutase as single cell suspension
centrifuged and dead cells were removed using the dead cell removal kit (Miltenyl Biotec
#130-090-101) according to the manufacturer instructions
cells were incubated with Dead cell removal microbeads for 15 min at room temperature to remove dead cells
After the incubation the cell suspension was diluted with 1X binding buffer and loaded onto the column
Live cells were collected into the effluent
Live cell fraction was then centrifuged and resuspended in 1X PBS BSA 0.04%
Cells were counted and resuspended at 106 cells/ml
For single-cell library preparation on the 10x Genomics platform
we used: the Chromium Single Cell 3′ v3.1 Library and Gel Bead Kit v3.1 (PN-1000121)
Chromium Next GEM Chip G Single Cell Kit (PN-1000127)
according to the manufacturer’s instructions in the Chromium Single Cell 3′ Reagents Kits V3.1 User Guide
Approximatively 3000 cells were loaded on the chip
The 10X capture and library preparation protocol was used without modification
Samples were sequenced on the Illumina Novaseq 6000
Raw transcript counts of gene-cell matrices were filtered to remove cells with total UMI counts lower than 4000 and higher than 11000; and cells with more than 20% mitochondrial genes
The UMI counts matrices were then normalized with Satija’s lab SCTransform method
Cell cycle scores were calculated with Seurat and used to regress out the cell cycle signal during normalization
the different datasets were integrated with Seurat’s anchors method using 3000 features
Linear dimension reduction (principal component analysis) was applied on the 3000 genes with the highest variance identified by SCTransform and the number of principal components used in downstream analyses
30 was chosen considering Seurat’s PCHeatmap and Elbowplot
Seurat’s implementation of Uniform manifold approximation and projection (UMAP) was applied on the reduced data for visualization in two-dimensional space
IKAP uses Seurat graph-based unsupervised clustering
It generates various candidate clustering by tuning Seurat’s algorithm parameters
then computes a gap statistics for each clustering
The clustering with the highest gap increase is then selected
which internally calls Seurat’s FindAllMarkers
was used to identify cluster-specific markers
To select widely and significantly overexpressed genes
the minimal logFC was set to 0,5 and the minimum percentage of cells to 0.75
FindMarkers function was used to calculate DE genes between treated and untreated cells
Cells were classified according to Suva’s lab method and the gene signatures they generated<a data-track="click" data-track-action="reference anchor" data-track-label="link" data-test="citation-ref" aria-label="Reference 11" title="Neftel, C. et al. An integrative model of cellular states, plasticity, and genetics for glioblastoma. Cell 178, 835–849.e821 (2019)." href="/articles/s41467-024-47985-z#ref-CR11" id="ref-link-section-d8952059e4300">11</a>
This score was calculated as the difference between the average relative expression of the genes in (Gj) and the average relative expression in a control gene set
Score(G,) = av(Er(G(j,i)) – av(Er(Gj control
The control gene set was defined as first binning all analyzed genes into 30 bins of aggregate expression levels and then
randomly selecting 100 genes from the same expression bin
The cell was then attributed the state with the highest score between APC-like
the y coordinate was calculated by the formula y = max(SCopc,SCnpc) – max(SCac,Scmes)
The sign of the y coordinate allowed to separate cells into OPC/NPC (y &gt; 0) versus AC/MES (y &lt; 0)
The x coordinate was defined for OPC/NC cells as x = log2( | SCopc – SCnpc | +1) and for AC/MES cells as x = log2( | SCac – SCmes | +1)
Count matrices of pre-mature (unspliced) and mature (spliced) RNAs were obtained with velocyto
Scvelo functions were used with defaults parameters to filter and normalize the data
Future cell state was computed using a likelihood-based dynamical model (funtion velocity
Seurat’s Umap representations were imported and scvelo functions were used to project velocities into Umap’s low dimension space
plots were generated either with Seurat’s visualization functions or with R package ggplot2 or CerebroApp visualization and export functions
plots were generated with scvelo’s visualization functions
Cells were lysed in a buffer containing 8 M urea
Lysates were sonicated to decrease viscosity and centrifuged at 20,000 x g for 10 min
The protein concentration was measured using the BCA assay (Sigma)
Equal amounts of proteins were then prepared (400ug of each condition) and reduced by adding 5 mM dithiothreitol (Sigma #D0632) and incubated for 30 min at 55 °C
Samples were subsequently alkylated by incubation with iodoacetamide (Sigma #I1149) at a final concentration of 10 mM for 30 min in the dark
Samples were then diluted 10-fold with 50 mM ABC to obtain a final concentration of urea &gt; 1 M before overnight digestion with Trypsin/LysC (Promega #V5072) at 37 °C
Digested samples were incubated with 1% trifluoroacetic acid (Sigma #299537) for 15 min on ice and then centrifuged at 3,000 x g for 10 min to remove precipitate
Peptides were desalted using a SEP-PAK C18 cartridge (Waters #WAT054955) and eluted with 0,1% trifluoroacetic acid
40% acetonitrile buffer and 90% of the starting material was enriched using Titansphere Phos-TiO kit centrifuge columns (GL Sciences #5010-21312) as described by the manufacturer
the phospho-peptides and the remaining 10% eluted peptides were vacuum concentrated to dryness and reconstituted in 0.1% formic acid prior to LC-MS/MS of phosphoproteome and proteome analyses
Peptides for MGG4 proteome analyses were separated by LC using an RSLCnano system (Ultimate 3000
Thermo Fisher Scientific) coupled online to an Orbitrap Exploris 480 mass spectrometer (Thermo Fisher Scientific)
Peptides were trapped on a C18 column (2 cm × 75 μm inner diameter; nanoViper AcclaimTM PepMapTM 100
Thermo Fisher Scientific) with buffer A (2/98 MeCN/H2O (vol/vol)
0.1% formic acid) at a flow rate of 3 µl / min over 4 min
Separation was performed using a 50 cm × 75 μm C18 column (Thermo Fisher Scientific #164540)
regulated to a temperature of 50 °C with a linear gradient of 3% to 32% buffer B (100% MeCN
0.1% formic acid) at a flow rate of 300 nl / min over 211 min
MS full scans were performed in the ultrahigh-field Orbitrap mass analyzer in the m/z range of 375–1500 with a resolution of 120,000 (at m/z 200)
an automatic gain control (AGC) set at 300% and with a maximum injection time (IT) set on custom mode
The 30 most intense ions were isolated (isolation width of 1.6 m/z) and further fragmented via high-energy collision dissociation (HCD) activation and a resolution of 15,000
an AGC target value set to 100% and with a maximum IT on auto
We selected ions with charge state from 2+ to 6+ for screening
Normalized collision energy (NCE) was set at 30 and dynamic exclusion of 40 seconds
For MGG4 phosphoproteome analyses LC-MS/MS was performed as previously (same LC and MS system
Peptides were trapped on a C18 column with buffer A at a flow rate of 3 µl/min over 4 min and separation was performed using a C18 column
regulated to a temperature of 40 °C with a linear gradient of 3% to 29% buffer B at a flow rate of 300 nl/min over 91 min
MS full scans were performed in the ultrahigh-field Orbitrap mass analyzer in the m/z range of 375–1500 (120,000 resolution; AGC 300%; IT 25 ms)
The 20 most intense ions were isolated and further fragmented via HCD (15,000 resolution; AGC 100%; IT 60 ms; selected ions 2+ to 6 + ; NCE 30) and with dynamic exclusion of 40 seconds
LC was performed as previously with an RSLCnano system (same trap column
column and buffers) coupled online to an Orbitrap Eclipse Tribrid mass spectrometer (Thermo Fischer Scientific)
Peptides were trapped on a C18 column at a flow rate of 3.0 µl / min in buffer A for 4 min and separation was performed using a C18 column regulated to a temperature of 50 °C with a linear gradient from 2% to 30% buffer B at a flow rate of 300 nl / min over 211 min
MS1 data were collected in the Orbitrap (120,000 resolution; IT 60 ms; AGC 4 × 105)
Charges states between 2 and 5 were required for MS2 analysis
and a 45 s dynamic exclusion window was used
MS2 scan were performed in the ion trap in rapid mode with HCD fragmentation (isolation window 1.2 Da; NCE 30%; IT 60 ms; AGC 104)
For GL261 and PN-MGG4 phosphoproteome analyses
column and buffers) coupled online to an Orbitrap Exploris 480 mass spectrometer
Peptides were trapped on a C18 column with buffer A at a flow rate of 2.5 µl/min over 4 min and separation was performed using a C18 column regulated to a temperature of 50 °C with a linear gradient of 2% to 30% buffer B at a flow rate of 300 nl/min over 91 min
MS full scans were performed in the ultrahigh-field Orbitrap mass analyzer (range 375–1500; resolution 120,000; AGC 300%; IT 60 ms)
The 20 most intense ions were isolated and further fragmented via HCD (resolution 15,000; AGC 100%; IT 60 ms; selected ions 2+ to 6 + ; NCE 30) and a dynamic exclusion of 40 seconds
XICs from proteotypic peptides shared between compared conditions (TopN matching for proteome setting and simple ratios for phosphoproteome) with missed cleavages were used
Median and scale normalization at peptide level was applied on the total signal to correct the XICs for each biological replicate (N = 5)
The phosphosite localization accuracy was estimated by using the PtmRS node in PD
Phosphosites with a localization site probability greater than 75% were quantified at the peptide level
To estimate the significance of the change in protein abundance
a linear model (adjusted on peptides and biological replicates) was performed
and p-values were adjusted using the Benjamini–Hochberg FDR procedure
KEA was performed with a p value threshold at 0.01 and a minimum of 5 substrates per kinase
For the proteomic enrichment analysis shown in Fig. <a data-track="click" data-track-label="link" data-track-action="figure anchor" href="/articles/s41467-024-47985-z#Fig7">7L</a> the cell state markers’ score was performed by using the mean of the log2(ratio) of all cell state markers’ genes present in the proteomics dataset
This was carried out with the intention of evaluating the difference in protein expression levels between the two conditions in the time
Each probe was designed with 21 nucleotides to hybridize the target RNA with Tm of 60 °C
and a Cy5 fluorescence sequence for detection
ACATTATTCCTCATCTGCAAACCCATACCAAGGTAGTTTAGTAGCCTGAAAGATA
ACATTATCTCCTTTTCCAGAGCTGTCAACCAAGGTAGTTTAGTAGCCTGAAAGATA
ACATTATTCTCTTGTCCCGCAGACTTACCAAGGTAGTTTAGTAGCCTGAAAGATA
ACATTACATTTTCCACTCCAGCCATCACCAAGGTAGTTTAGTAGCCTGAAAGATA
MGG4-NestinP Tomato cells were fixed with 1.6% PFA in PBS for 10 min then transferred to pre-chilled (−20 °C) methanol and kept at −80 °C for at least 15 min (and up to 1 wk)
SNAIL probes were dissolved at 100 μM in ultrapure RNase-free water and pooled at a final concentration of 100 nM per oligo (1 gene detected by 4 probe pairs)
The probe mixture was heated at 90 °C for 2 to 5 min and then cooled-down at RT
The samples were taken from −80 °C and equilibrated to RT for 5 min
40 U/mL RNAsin·In in PBS) for 2–5 min and incubated in 1× hybridization buffer (2X SSC
0.1 mg/ml salmon sperm DNA and pooled SNAIL probes at 100 nM per oligo) in 40 °C humidified oven with gentle shaking overnight
followed by one 20 min wash in 4X SSC dissolved in PBSTR at 40 °C
the sample was briefly rinsed with PBSTR once at RT
The samples were then incubated for two hours with T4 DNA ligation mixture (1:50 dilution of T4 DNA ligase supplemented with 1X BSA and 0.2 U/μl of RNAsin) at room temperature with gentle agitation
incubated with RCA mixture (200U/ml of Phi29 DNA polymerase
1X BSA and 0.2 U/μl of RNAsin) at 30 °C for two hours under agitation
The samples were next washed twice in PBSTR and 2,5 μM of detection oligo for human Nestin and CD31 were added and incubated at 37 °C for 30 min with shaking
a staining with DAPI was performed 7 min at RT
then samples are washes with PBS and imaged
and results were considered statistically significant at p &lt; 0.05
All results shown in the manuscript are the outcomes of at least three biological replicates (different batches of cells) and independent experiments
Statistical analyses for all other experiments were performed using paired or unpaired two-sided t-tests or
by ANOVA followed by Dunnett’s multiple comparisons test
Statistical analyses were performed using Prism (GraphPad Software Inc.)
Further information on research design is available in the <a data-track="click" data-track-label="link" data-track-action="supplementary material anchor" href="/articles/s41467-024-47985-z#MOESM2">Nature Portfolio Reporting Summary</a> linked to this article
Software versions and full pipelines are available at <a href="https://github.com/bioinfo-pf-curie/RNA-seq/">https://github.com/bioinfo-pf-curie/RNA-seq/</a> for RNA-seq, <a href="https://github.com/bioinfo-pf-curie/myproms">https://github.com/bioinfo-pf-curie/myproms</a> for proteomics and <a href="https://github.com/casecpb/KSEAapp/">https://github.com/casecpb/KSEAapp/</a> for KSEA
CBTRUS statistical report: Primary brain and other central nervous system tumors diagnosed in the United States in 2014–2018
The 2021 WHO classification of tumors of the central nervous system: A summary
Stepanenko, A. A. &amp; Chekhonin, V. P. Recent advances in oncolytic virotherapy and immunotherapy for glioblastoma: A glimmer of hope in the search for an effective therapy? Cancers (Basel) 10 <a href="https://doi.org/10.3390/cancers10120492" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="10.3390/cancers10120492">https://doi.org/10.3390/cancers10120492</a> (2018)
Challenges in glioblastoma research: focus on the tumor microenvironment
Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma
Cancer cell heterogeneity and plasticity: A paradigm shift in glioblastoma
Integrated genomic analysis identifies clinically relevant subtypes of glioblastoma characterized by abnormalities in PDGFRA
Tumor evolution of glioma-intrinsic gene expression subtypes associates with immunological changes in the microenvironment
Spatiotemporal genomic architecture informs precision oncology in glioblastoma
Intratumor heterogeneity in human glioblastoma reflects cancer evolutionary dynamics
Guilhamon, P. et al. Single-cell chromatin accessibility profiling of glioblastoma identifies an invasive cancer stem cell population associated with lower survival. Elife 10 <a href="https://doi.org/10.7554/eLife.64090" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="10.7554/eLife.64090">https://doi.org/10.7554/eLife.64090</a> (2021)
heritability and plasticity of glioma transcriptional cell states
The glioma stem cell model in the era of single-cell genomics
Uribe, D. et al. Adapt to persist: Glioblastoma microenvironment and epigenetic regulation on cell plasticity. Biology (Basel) 11 <a href="https://doi.org/10.3390/biology11020313" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="10.3390/biology11020313">https://doi.org/10.3390/biology11020313</a> (2022)
Stem cell-associated heterogeneity in Glioblastoma results from intrinsic tumor plasticity shaped by the microenvironment
Single-cell multimodal glioma analyses identify epigenetic regulators of cellular plasticity and environmental stress response
Quiescent human glioblastoma cancer stem cells drive tumor initiation
Modeling glioblastoma heterogeneity as a dynamic network of cell states
A Glial Signature and Wnt7 Signaling Regulate Glioma-Vascular Interactions and Tumor Microenvironment
Targeting the perivascular niche in brain tumors
Vessel co-option in glioblastoma: emerging insights and opportunities
Peritumoral brain zone in glioblastoma: Biological
A perivascular niche for brain tumor stem cells
Secreted factors from brain endothelial cells maintain glioblastoma stem-like cell expansion through the mTOR pathway
Maintenance of primary tumor phenotype and genotype in glioblastoma stem cells
Chen, Y. C. et al. IKAP-Identifying K mAjor cell Population groups in single-cell RNA-sequencing analysis. Gigascience 8 <a href="https://doi.org/10.1093/gigascience/giz121" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="10.1093/gigascience/giz121">https://doi.org/10.1093/gigascience/giz121</a> (2019)
Ruiz-Moreno, C. et al. Harmonized single-cell landscape, intercellular crosstalk and tumor architecture of glioblastoma. BioRxiv <a href="https://doi.org/10.1101/2022.08.27.505439" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="10.1101/2022.08.27.505439">https://doi.org/10.1101/2022.08.27.505439</a> (2022)
Cell surface Nestin is a biomarker for glioma stem cells
An evolutionarily conserved region in the second intron of the human nestin gene directs gene expression to CNS progenitor cells and to early neural crest cells
Ferri, A., Stagni, V. &amp; Barilà, D. Targeting the DNA Damage Response to Overcome Cancer Drug Resistance in Glioblastoma. Int. J. Mol. Sci. 21 <a href="https://doi.org/10.3390/ijms21144910" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="10.3390/ijms21144910">https://doi.org/10.3390/ijms21144910</a> (2020)
A restricted cell population propagates glioblastoma growth after chemotherapy
Glioma progression is shaped by genetic evolution and microenvironment interactions
A single-cell atlas of glioblastoma evolution under therapy reveals cell-intrinsic and cell-extrinsic therapeutic targets
Glioblastomas acquire myeloid-affiliated transcriptional programs via epigenetic immunoediting to elicit immune evasion
Senescence and cancer - role and therapeutic opportunities
A guide to assessing cellular senescence in vitro and in vivo
An anatomic transcriptional atlas of human glioblastoma
A human brain vascular atlas reveals diverse mediators of Alzheimer’s risk
Spatially resolved multi-omics deciphers bidirectional tumor-host interdependence in glioblastoma
Angiocrine functions of organ-specific endothelial cells
Beyond Angiogenesis: Exploiting angiocrine factors to restrict tumor progression and metastasis
Degorre, C. et al. Mechanistic insights of radiation-induced endothelial senescence impelling glioblastoma genomic instability at relapse. bioRxiv, <a href="https://doi.org/10.1101/2021.12.13.472364" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="10.1101/2021.12.13.472364">https://doi.org/10.1101/2021.12.13.472364</a> (2021)
YAP-TEAD1 control of cytoskeleton dynamics and intracellular tension guides human pluripotent stem cell mesoderm specification
A proteomic atlas of senescence-associated secretomes for aging biomarker development
A coordinated phosphorylation by Lats and CK1 regulates YAP stability through SCF(beta-TRCP)
Role of the Hippo pathway and mechanisms for controlling cellular localization of YAP/TAZ
A bidirectional crosstalk between glioblastoma and brain endothelial cells potentiates the angiogenic and proliferative signaling of sphingosine-1-phosphate in the glioblastoma microenvironment
Anti-invasive efficacy and survival benefit of the YAP-TEAD inhibitor verteporfin in preclinical glioblastoma models
P300 promotes tumor recurrence by regulating radiation-induced conversion of glioma stem cells to vascular-like cells
Interplay between tumor microenvironment and partial EMT as the driver of tumor progression
Distinct contributions of partial and full EMT to breast cancer malignancy
Phenotypic mapping of pathologic cross-talk between glioblastoma and innate immune cells by synthetic genetic tracing
Replication stress drives constitutive activation of the DNA damage response and radioresistance in glioblastoma stem-like cells
Senescence-associated reprogramming promotes cancer stemness
Senescence elicits stemness: A surprising mechanism for cancer relapse
Cellular senescence in malignant cells promotes tumor progression in mouse and patient Glioblastoma
The Cancer SENESCopedia: A delineation of cancer cell senescence
Mongiardi, M. P., Pellegrini, M., Pallini, R., Levi, A. &amp; Falchetti, M. L. Cancer Response to Therapy-Induced Senescence: A Matter of Dose and Timing. Cancers (Basel) 13 <a href="https://doi.org/10.3390/cancers13030484" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="10.3390/cancers13030484">https://doi.org/10.3390/cancers13030484</a> (2021)
Putavet, D. A. &amp; de Keizer, P. L. J. Residual Disease in Glioma Recurrence: A Dangerous Liaison with Senescence. Cancers (Basel) 13 <a href="https://doi.org/10.3390/cancers13071560" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="10.3390/cancers13071560">https://doi.org/10.3390/cancers13071560</a> (2021)
Irradiation induces glioblastoma cell senescence and senescence-associated secretory phenotype
Temozolomide induces senescence and repression of DNA repair pathways in glioblastoma cells via activation of ATR-CHK1
Integrative multi-omics networks identify PKCdelta and DNA-PK as master kinases of glioblastoma subtypes and guide targeted cancer therapy
Senescent tumor cells lead the collective invasion in thyroid cancer
Senescent cells in cancer therapy: Friends or foes
In vivo switching of human melanoma cells between proliferative and invasive states
Identification of a transient state during the acquisition of temozolomide resistance in glioblastoma
Adaptive chromatin remodeling drives glioblastoma stem cell plasticity and drug tolerance
Targeting radiation-tolerant persister cells as a strategy for inhibiting radioresistance and recurrence in glioblastoma
Synthesis and deposition of basement membrane proteins by primary brain capillary endothelial cells in a murine model of the blood-brain barrier
FGFR1 induces glioblastoma radioresistance through the PLCγ/Hif1α Pathway
Senolysis induced by 25-hydroxycholesterol targets CRYAB in multiple cell types
Huang, C., Santofimia-Castaño, P. &amp; Iovanna, J. NUPR1: A Critical Regulator of the Antioxidant System. Cancers (Basel) 13 <a href="https://doi.org/10.3390/cancers13153670" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="10.3390/cancers13153670">https://doi.org/10.3390/cancers13153670</a> (2021)
The role of basic fibroblast growth factor in glioblastoma multiforme and glioblastoma stem cells and in their in vitro culture
FGFR1 induces glioblastoma radioresistance through the PLCgamma/Hif1alpha pathway
The radioprotective effect of the 24 kDa FGF-2 isoform in HeLa cells is related to an increased expression and activity of the DNA dependent protein kinase (DNA-PK) catalytic subunit
Expression of markers of neural stem and progenitor cells in glioblastoma multiforme in relation to tumor recurrence and overall survival
STAT3 is essential for the maintenance of neurosphere-initiating tumor cells in patients with glioblastomas: a potential for targeted therapy
Gaussia luciferase reporter assay for monitoring biological processes in culture and in vivo
Evidence for label-retaining tumour-initiating cells in human glioblastoma
Stanzani, E. et al. Dual role of integrin alpha-6 in glioblastoma: Supporting stemness in proneural stem-like cells while inducing radioresistance in mesenchymal stem-like cells. Cancers (Basel) 13 <a href="https://doi.org/10.3390/cancers13123055" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="10.3390/cancers13123055">https://doi.org/10.3390/cancers13123055</a> (2021)
μ-Slide Chemotaxis: A new chamber for long-term chemotaxis studies
Solid stress in brain tumours causes neuronal loss and neurological dysfunction and can be reversed by lithium
A cerebellar window for intravital imaging of normal and disease states in mice
Boulay, A. C., Saubaméa, B., Declèves, X. &amp; Cohen-Salmon, M. Purification of Mouse Brain Vessels. J. Vis. Exp. e53208 <a href="https://doi.org/10.3791/53208" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="10.3791/53208">https://doi.org/10.3791/53208</a> (2015)
Organotypic brain slice cultures: A review
DecoPath: a web application for decoding pathway enrichment analysis
ShinyGO: a graphical gene-set enrichment tool for animals and plants
Thanati, F. et al. FLAME: A Web Tool for Functional and Literature Enrichment Analysis of Multiple Gene Lists. Biology (Basel) 10 <a href="https://doi.org/10.3390/biology10070665" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="10.3390/biology10070665">https://doi.org/10.3390/biology10070665</a> (2021)
Near-optimal probabilistic RNA-seq quantification
EmptyDrops: Distinguishing cells from empty droplets in droplet-based single-cell RNA sequencing data
Integrated analysis of multimodal single-cell data
Generalizing RNA velocity to transient cell states through dynamical modeling
a web server for management and validation of mass spectrometry-based proteomic data
Fast and accurate protein false discovery rates on large-scale proteomics data sets with percolator 3.0
MassChroQ: a versatile tool for mass spectrometry quantification
KEA3: improved kinase enrichment analysis via data integration
The KSEA App: a web-based tool for kinase activity inference from quantitative phosphoproteomics
The PRIDE database resources in 2022: a hub for mass spectrometry-based proteomics evidences
Wang, X. et al. Three-dimensional intact-tissue sequencing of single-cell transcriptional states. Science 361 <a href="https://doi.org/10.1126/science.aat5691" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="10.1126/science.aat5691">https://doi.org/10.1126/science.aat5691</a> (2018)
<a data-track="click" data-track-action="download citation references" data-track-label="link" rel="nofollow" href="https://citation-needed.springer.com/v2/references/10.1038/s41467-024-47985-z?format=refman&amp;flavour=references">Download references</a>
Lasgi for her precious assistance with cytofluorimetry and FACS sorting; P
Le Joncour (Univ Helsinki) for critical discussion and insightful suggestions
This work was supported by the European Research Council (ERC) under the European Union’s Horizon 2020 (Grant Agreement No
Institut National du Cancer (INCa; INCa-2020-1-PLBIO-01-ICR-1 and INCa-2021-1-PAIR-CEREB-01-1 for G.S.)
the NanoTheRad grant from Paris-Saclay University
Fondation ARC pour la recherche sur le cancer
Campus France and Canceropole Ile-de-France (2022-1-EMERG-06-ICR-1 for C.P.)
High-throughput sequencing was performed by the ICGex NGS platform of the Institut Curie supported by the grants ANR-10-EQPX-03 (Equipex) and ANR-10-INBS-09-08 for N.S
(France Génomique Consortium) from the Agence Nationale de la Recherche (Investissements d’Avenir program)
by the ITMO-Cancer Aviesan (Plan Cancer III) and by the SiRIC-Curie program (SiRIC Grant INCa-DGOS-465 and INCa-DGOSInserm_12554)
Part of this work was carried out by the ICM Data Analysis Core platform; we gratefully acknowledge them for the use of Ingenuity Pathway Analysis
We acknowledge the Cell and Tissue Imaging Platform
PICT-IBiSA (member of France-Bioimaging – ANR-10-INBS-04) of the UMS2016-US43-MIC at Institut Curie for help with light microscopy
The MassSpec platform (LSMP) was supported by “Région Ile-de-France” and Fondation pour la Recherche Médicale grants
These authors contributed equally: Cathy Pichol-Thievend
Laura Marcos-Kovandzic &amp; Giorgio Seano
Konstantin Masliantsev &amp; Lucie Karayan-Tapon
CurieCoreTech Spectrométrie de Masse Protéomique
Department of Computational and Quantitative Medicine
Hematologic Malignancies Research Institute and Beckman Research Institute
All authors reviewed and edited the manuscript
The authors declare no competing interests
Nature Communications thanks the anonymous reviewers for their contribution to the peer review of this work
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations
<a data-test="citation-link" data-track="click" data-track-action="download article citation" data-track-label="link" data-track-external="" rel="nofollow" href="https://citation-needed.springer.com/v2/references/10.1038/s41467-024-47985-z?format=refman&amp;flavour=citation">Download citation</a>
DOI: https://doi.org/10.1038/s41467-024-47985-z
Anyone you share the following link with will be able to read this content:
a shareable link is not currently available for this article
Sign up for the Nature Briefing: Cancer newsletter — what matters in cancer research
When one admires a sculpture by Quinto Martini
one might be overwhelmed by the temptation to consider his art as a sort of coda of nineteenth-century verism
an art strongly anchored to the naturalistic datum
at most retooled according to the modes of the dominant taste
one will realize that Quinto Martini&rsquo;s is a rather complex figure: meanwhile
he is an artist capable of transfiguring reality into a poetry with delicate
we should not forget that Martini is a Tuscan very attached to his land
and that by his own admission he had no other masters outside of nature and Ardengo Soffici
when Vallecchi published Periplo dell&rsquo;arte di Soffici in 1928: he had met the older painter a couple of years earlier
and evidently that lesson would mark much of his future production.One of the chapters in Periplo dell&rsquo;arte is devoted to the pairing of Clarity and Realism: &ldquo;let us understand by realism,&rdquo; Soffici wrote
according to which matter and spirit are inseparable in every living entity
[...] From the earliest birth of the arts up to a few years ago
from the unknown ones of the caves up to Degas
have done nothing but take inspiration from nature in creating their works
with the characteristic accent of his own soul.&rdquo; These are words that Quinto Martini clearly decided to make his own
since they are perfectly suited to his art
everyday clarity that spans centuries of art history
rooted in the Etruscan statuary so masterfully interpreted
to arrive at a present where the monumental presence is reserved for a weekday humanity and with which the artist celebrates the life of the humblest
It was in 1988 when the &ldquo;Quinto Martini&rdquo; Park-Museum was inaugurated in Seano
arising from an initiative of the then mayor of Carmignano
and from an idea of the artist: the first citizen had asked Martini for a work to be placed in the town square
So why not extend the initial purpose and open a park where he could display a large array of bronze sculptures
This was Quinto Martini&rsquo;s counterproposal
accepted willingly and enthusiastically by the municipality: in the end
cast from sculptures made between 1931 and 1988
were donated by Martini to the municipality and ended up being installed in the thirty-two thousand square meters of the large park that now bears the name of the sculptor and painter
one of the largest in Europe dedicated to the work of a single artist
The donation was tied to three conditions: the inclusion of the works in a &ldquo;circumstantial space,&rdquo; a location &ldquo;connatural to the place,&rdquo; and the possibility that the presence of the works could be made &ldquo;for the benefit of all.&rdquo; In order to make concrete the idea of the large garden
which would rise in place of some uncultivated fields that no one used anymore
one of the best Tuscan architects of the time
and together with Quinto Martini they imagined the form to be given to the park: three tree-lined pathways
cypresses and other typical local essences abound
where one always arrives accompanied by the gentle and delicate presence of the works
which never abandon the visitor who wanders through the foliage
The integration of sculpture and space is the soul that breathes life into this magical
a poetry of simplicity: the park is itself an emblem of the common good
a temple of recreation but also a site where one can pause and reflect
It is the score on which the narrative of the land of Tuscany will take shape
The hills that surround it are &ldquo;places of work and culture,&rdquo; according to the formula used by the artist himself
The sculptures are the verses of this long poem dedicated to the simple life of the inhabitants of the rural areas of Tuscany
&ldquo;My sculptures,&rdquo; Martini had said in an interview with La Nazione in 1988
and reproduced in the catalog of the Park-Museum edited by Marco Fagioli and Lucia Minunno
&ldquo;want first of all to express the simple vitality of this land
but an appropriate insertion into that nature from which they were taken and where everyone can have their hours of freedom
Each of these statues responds within me with a different sound: different because of the memory of a particular situation
When I come here each one speaks to me in its own voice
which is then my own voice from the time of that time
Each of them is a child of a different time of mine
which so at a distance I could no longer even bring precisely into focus
perhaps because I never gave importance to the recording of time or what was happening around me.&rdquo;
the artist stated that works should always remain in the place where they are born
And it is with this idea in mind that Martini marked the difference between a park and a museum: sculpture
activates a direct exchange with the landscape that surrounds it and interacts with it (just think of the light conditions in the park
which can present us with the same sculpture in hundreds of different guises)
The sculpture becomes a presence on the territory evoking its history
a sign of identification and sense of belonging
a lens through which to read the peculiarities of the land that hosts it
a ribbon that simultaneously binds the community
its culture and its space establishing a deeply dialectical relationship
an object that responds to a social function
The ensemble of works in the park composes a symbolic path that unravels in evocative stages
capable of leading visitors through a journey into a vanished dimension
into the memories of a peasant reality that today&rsquo;s productive society has almost completely erased
There is no trace of melancholy: Martini almost seems to want to remind us that
however much the epochs may change and the realities modify
the human being always has an unavoidable responsibility towards his history and the environment that allows him to live
There are four possible entrances to the park
where a double row of holm oaks leads us to the first square
along which are some examples of the animalistic sculpture that Quinto Martini often practiced from the 1960s until the end of his career
&ldquo;in a naturalistic manner,&rdquo; writes Marco Fagoli
&ldquo;but with a margin of stylization always aimed in an appealing sense
in this revealing the artist&rsquo;s lively sympathy for the animal world.&rdquo; escorting the visitor along the beginning of the itinerary are thus a Martinaccio
or large snail (&ldquo;martinaccio&rdquo; is the name by which the inhabitants of Seano call the animal in their vernacular)
a Caccia al cinghiale (Boar Hunt ) with a dog pouncing on the frightened swine to bite it (in a formidable essay in moving sculpture)
one will also encounter a Rooster and two elegant Snakes in love) are a subject particularly felt by the artist
in the colorful and multifaceted world of nature
they are the beings closest and most similar to humans
and at the same time express those values of simplicity and spontaneity that Quinto Martini held dear
Then among the animal sculptures is a maternal tribute(To My Mother)
translated into the everyday image of a mother going shopping with her baby in her arms
the larger of the two that make up the park
is tantamount to immersing oneself in a piece of village life: there is a Torso of a bowler that is among the most obvious results of the antiquarian culture of a Quinto Martini fascinated by Etruscan antiquities (something similar can be said for the sleeping Seanese Girl
an amused portrait of a slumbering commoner); a Hunter stands before us
displaying his inert prey; there is a Girl taking a goose
although the title does not do justice to the stubbornness of the bird that escapes from the young woman who barefoot chases after it; there is a Spring holding a bouquet of roses; there is a Poor Beggar Girl forced to strut with a cardboard box on her head
caught in the act of extending her hand to beg for charity from passersby
in the most touching piece in the entire park
It is among these sculptures that Quinto Martini&rsquo;s poetry is fully grasped: the square comes alive with the figures of its inhabitants
and one never feels the sense of loneliness that one sometimes feels in a museum
because the sculptures become living presences
Living presences that perhaps evoke faces that Quinto Martini really knew and in which today&rsquo;s visitors perhaps mirror themselves: for the artist
the identification between statue and relative had to be total
&ldquo;The public,&rdquo; he had written in 1953 in a letter to Nuovo Corriere
&ldquo;has always approached those forms of art where it recognizes itself
those expressions of life in which it participates.&rdquo; Impossible not to find
a reason in which not to recognize oneself
two naked girls embracing and caressing each other with an innocent gesture of graceful
and nudity becomes a condition that enhances the purity of their feeling
with the father looking into the eyes of the child he holds
perhaps evoked by one of the many female figures that abound in Quinto Martini&rsquo;s production and that fill the park with classical and harmonious venusty: see the immediacy of theAlcea
one of the few dated sculptures (it is dated 1945)
although we do not know for what reasons the sculptor wanted to give it that name
Or the disheveled and procupacious pose of the Bather
an admirable example of the virtuosity to which Quinto Martini&rsquo;s modeling could go
and where one has no trouble discerning echoes of an Aristide Maillol
Or the music that seems to come out of the Guitar Player
heavily indebted to Picasso&rsquo;s painting
there is a group of sculptures with an almost mystical
It happens in an almost dechirichianWaiting
where a woman can be glimpsed between the doorsills of a door: it is &ldquo;one of the most beautiful examples of Italian sculpture of those years,&rdquo; wrote Marco Fagioli
And it happens in sculptures that interpret the elements of the atmosphere
so much so that he centered one of his exhibitions at Palazzo Strozzi on this theme
a mother holding the hand of a child who is hard to see because of the mist that envelops them both
are among the most informal outcomes of his art
but this concession does not lose sight of the compass that directs Quinto Martini&rsquo;s art
a means of experimenting with further possibilities
a bas-relief striped at an angle (an intuition that came to the artist in 1964: the work is three years later) where
among the dense downpours that cross the surface of the bronze
one glimpses the silhouette of a figure trying to take shelter
It is a Quinto Martini who does not neglect the search for optical effect
who elaborates new solutions to involve the observer even more
and who tries here to suggest not only an event
referring to the tradition of the late nineteenth century
&ldquo;I&rsquo;ve always liked rain,&rdquo; he had said in a 1988 interview
&ldquo;I like to hear it tapping on the glass because I was born
art also meant civic commitment (&ldquo;an artist who has a commitment to himself,&rdquo; he wrote
&ldquo;has a commitment to society&rdquo;): perhaps this is also why he took care
of branding it as the worst of the errors that hinder an artist&rsquo;s path
And it is relevant that for Quinto Martini the civil commitment of art did not resolve itself into an art of history
or into an art of philosophical subtleties
moreover in the years when the political role of art was at the center of cultural debate
Quinto Martini&rsquo;s art is completely insensitive to contingency
and it is behind this element that the artist&rsquo;s commitment lies
not even the impression of a man detached from his time
who has decided to isolate himself in his countryside and entrench himself behind that appearance of shy modesty that his works convey
On the contrary: he is an artist perfectly inserted in his environment
he is a man aware of the problems of his time
he is an intellectual who knows the scope of the avant-garde
But in his art the present takes on the absolute dimensions of poetry
And so we like perhaps to imagine Quinto Martini behind a window on a rainy day
reflecting on the verbovisual poetry he must surely have known and trying to decline it in his own way
on his sheets alternating verses and drawings
to compose lyrics inspired by the days of his land
is a whole lot of fun and always on the go
Sean took a break from coaching swimming and enrolled for voice training with Edge Studio in New York
Sean joined MFM 926 in Stellenbosch as a volunteer presenter and just 2 years later
Sean has hosted Breakfast to Drive shows and everything in between.Seano
hosted the Good Hope FM afternoon drive show from 2011 – 2018 and during this time
the talented radio host won the MTN Radio Award for Best Commercial Afternoon Drive show (2014)
Seano continues to make magic whenever he is on air
fast-talking on-air antics have won him many accolades over the years
optimistic nature continues to win over listeners where ever he goes
Sean spends his spare time honing his photography skills and dreaming about his next adventure
Sean has an innate ability to connect with people and hopes to inspire youngsters through his work
Magic 828 AM is a South African commercial radio station playing the best of hits from the 80s
Download the Magic828 App now on your mobile phone by clicking here
© 2025 <a href="https://magic828.co.za/">Magic828.</a> All Rights Reserved
Seano Loots excites audiences with a South African leadership Magic Originals podcast series called About 10,000 Hours
foodies and industry leaders about how they&#8217;ve gotten to where they are today
John Sanei is a globally recognized key-note speaker and 5x bestselling author
entrepreneur and he is an advocate for dogs
With a focus on building a successful future
Sean asked John about how we can make the most of now
what he foresees as the next big disruption and what gives him hope for SA’s future
In this first episode of About 10,000 Hours John Sanei explains what he does for a living
how he helps individuals and organisations prepare for what lies ahead
and he shares the decisions we should be making now &#8211; in 2022 &#8211; that will set us up well for the future
John also sheds light on his latest book &#8216;Who Do We Become?&#8217;
Written by:  <a href="https://magic828.co.za/author/amitcorporateservice/" class="qt-authorname qt-capfont">Producer</a>
<a href="https://magic828.co.za/tag/podcasts/" rel="tag">#Podcasts</a> <a href="https://magic828.co.za/tag/about-10000-hours/" rel="tag">About 10000 Hours</a> <a href="https://magic828.co.za/tag/john-sanei/" rel="tag">John Sanei</a> <a href="https://magic828.co.za/tag/seano-loots/" rel="tag">Seano Loots</a>
Rapper K.Keed sets the mood for her upcoming album “Bite the Bullet” set to be released on February 28
She took to Instagram to reveal the captivating artwork for “Bite the Bullet”
sending fans into a frenzy.K.Keed has been making waves in the local music scene
who captured the hearts of South Africa when he won Idols SA Season 11
He’s putting the final touches on his third studio album
and while many are eager to hear his latest work
Karabo has also been busy growing in [&hellip;]
</a><a href="https://twitter.com/intent/tweet?url=https://www.essentiallysports.com/boxing-news-mike-tysons-therapist-exposes-boxing-legend-in-one-line&amp;text=Mike Tyson’s Therapist Exposes Boxing Legend in One Line&amp;via=es_sportsnews" target="_blank" rel="noreferrer noopener"></a>Link Copied!via Getty
If one were to describe Mike Tyson’s personality
the first things that come to mind would be ruthless
as the boxing legend was notorious for his ferocious and aggressive boxing style
Tyson seems to be a person who is much more human
as his therapist revealed the true nature of Iron Mike in the latest episode of his podcast
was sharing experiences of his traumatic childhood and revealed how he had to change in order to overcome them
“Nobody can do that unless I give them permission and I realized that the rule doesn’t need to change
The only person I suffer from is Seano McFarland and once I got hit to that
things changed a little bit and I always bring a guy like you into conciseness.” He said
pointing out that he saw Tyson as an inspiration when he went through hard times
Tyson then responded by asking Seano to tell everyone who he really was underneath all the fame and glory
“Tell them who a guy like me is who I really am behind all this stuff.” He said to Seano
who then made sure that it was what Tyson wanted.”Beyond all this stuff?” said Seano
Tyson then stated he was sure and told Seano to let his colleagues know what kind of person they work for.” Yeah
let them know who they work for seriously.” said Tyson
Read More: <a class="es-hyperlink-new" href="https://www.essentiallysports.com/boxing-news-beyonces-bigger-than-you-mike-tyson-once-revealed-why-his-kids-think-he-is-a-d//?utm_medium=website&amp;utm_source=website_internal&amp;utm_campaign=web_link_1" target="_self">“Beyonce’s Bigger Than You”: Mike Tyson Once Revealed Why His Kids Think He Is a “D***!”</a>
Iron Mike was not ready for what his therapist had to say as Seano went on and exposed Tyson
“Yeah I’ll get down man you’re a sacred little boy sometimes.” He told Tyson who was not expecting this response from his therapist
it seems ridiculous that Seano would call ‘The Baddest Man On The Planet’ scared
Tyson grew up in a poverty-stricken and violent environment
which made him repress his fear and emotions
CALIFORNIA – JANUARY 22: Mike Tyson is seen in attendance during the UFC 270
he used violence and aggression to cope with the emotional trauma he was suffering
but his fears were still present in his unconscious mind
Tyson’s therapist saw just that and can now help Tyson in overcoming his innate fears
Watch This Story: <a class="es-hyperlink-new" href="https://www.essentiallysports.com/stories/boxing-news-five-infamous-altercations-of-mike-tyson-outside-the-ring//?utm_medium=website&amp;utm_source=website_internal&amp;utm_campaign=web_link_1" target="_self">Five Infamous Altercations of Mike Tyson outside the Ring</a>
What did you think about Seano’s assessment? Let us know in the comments.
EssentiallySports is a digital-first sports media house that surfaces the best stories on America&#x27;s favorite sports celebrities with a fan&#x27;s perspective to 30+ M average monthly readers.
Full Spectrum Services LLP © 2025 | All Rights Reserved
</a>Link Copied!The nineties was a golden period for boxing as some of the greatest boxers of all time were in their prime
Mike Tyson was one of the figures that carried boxing on his shoulders in the latter part of the 1990s
He was regarded as the most brutal boxer to ever have lived
but sometimes your own anger can lead you down unspoken paths
The recent episode of <a class="es-hyperlink-new" href="https://www.youtube.com/c/HotboxinwithMikeTyson/?utm_medium=website&amp;utm_source=website_internal&amp;utm_campaign=web_link_1" target="_blank">Hotboxin’ with Mike Tyson</a> was a rather special one
as Tyson’s therapist was invited as a guest
they talked about Tyson’s life and how he prevailed over everything in life despite the circumstances
Moreover, as the podcast progressed, <a class="es-hyperlink-new" href="https://www.essentiallysports.com/tag/mike-tyson//?utm_medium=website&amp;utm_source=website_internal&amp;utm_campaign=web_link_1" target="_self">Mike Tyson</a> stated
and I was just very grateful and very lucky to have the opportunity to meet brother Seano
DIVE DEEPER: <a class="es-hyperlink-new" href="https://www.essentiallysports.com/boxing-news-why-am-i-not-in-prison-mike-tyson-56-makes-brutally-honest-confession//?utm_medium=website&amp;utm_source=website_internal&amp;utm_campaign=web_link_1" target="_self">“Why Am I Not in Prison?”: Mike Tyson, 56, Makes Brutally Honest Confession</a>
‘Iron Mike’ delved into how he was stuck and was unable to control himself
he feels that he is grateful that Sean MacFarland (Seano) entered his life and helped him transform himself
The Baddest Man on the Planet is considered the most ruthless and tough fighter in the history of boxing
there is a little boy from Brooklyn who had a disturbed childhood and has now become one of the most revered athletes in the world
Even though Tyson has moved on from his past
the boxer still feels its lingering effects
<a style="color:#c9c8cd;font-family:Arial,sans-serif;font-size:14px;font-style:normal;font-weight:normal;line-height:17px;text-decoration:none" href="https://www.instagram.com/reel/Cf9vCxjoUsx/?utm_source=ig_embed&amp;utm_campaign=loading" target="_blank" rel="noopener">A post shared by Hotboxin’ with Mike Tyson (@hotboxinpodcast)</a>
It’s too painful sometimes to feel that intimacy
and what he just did that we’ve had many versions of that
and he had to learn how not to run away and face that
The greatest fight he’s ever had is his mind.”
WATCH THIS STORY: <a class="es-hyperlink-new" href="http://www.essentiallysports.com/stories/boxing-news-five-infamous-altercations-of-mike-tyson-outside-the-ring/?utm_medium=website&amp;utm_source=website_internal&amp;utm_campaign=web_link_1" target="_self">Five Infamous Altercations of Mike Tyson outside the Ring</a>
Apparently, Tyson is not just a fighter inside the ring, he has even gone to war with himself, and he has prevailed over his dark side. What do you think of Tyson and Seano’s discussion? Share it in the comments below.