my teammates and I stopped at the Ebina Service Area for a quick breakfast is famous for its plentiful food and shopping options Japanese rest stops and service areas are quite similar to Korean ones access free Wi-Fi and shop for travel essentials and local specialties and an indoor food court and shopping area exploring Japanese snacks was like discovering a collection of popular local treats a bakery displayed various kinds of melon bread and a baked sweet potato vending machine caught my eye Japan’s creative vending machine culture is always a fun part of traveling in Japan I enjoyed a breakfast I’d only seen in anime before Ebina is also perfect for finding souvenirs The Pokémon Tokyo Banana products especially stood out as adorable and delicious Whether you’re looking for a tasty bite or fun souvenirs Make sure to stop by if you’re heading to Mt Sign up for our weekly newsletter of articles from Japan About Us Company Overview Philosophy Corporate Policy Corporate Profile Officers Corporate Organization History Exhibition Facilities Event & Exhibition MHI Group’s Declaration to achieve Carbon Neutral by 2040 CEO Message Outline of MHI Group Business Area Global Network Region Products Business Alphabetical Order Locations Head Offices & Domestic Offices Research & Innovation Center Works & Plants Overseas Offices Nagasaki Shipyard & Machinery Works Shimonoseki Shipyard & Machinery Works Hiroshima Machinery Works Mihara Machinery Works Kobe Shipyard & Machinery Works Takasago Machinery Works Yokohama Dockyard & Machinery Works Sagamihara Machinery Works Hitachi Works Kure Works Procurement Procurement Policy MHI Group Supply Chain Sustainability Promotion Guidelines Procurement Network Registration REGIONS Mitsubishi Heavy Industries in AMER Mitsubishi Heavy Industries in EMEA Mitsubishi Heavy Industries in APAC Mitsubishi Heavy Industries in THAILAND Our Business Key Solutions CCUS Hydrogen and Ammonia Data Center Products Energy Aircraft Space Ship & Ocean Transportation Material handling Environment Automotive Industrial machinery Infrastructure Living & leisure Defense Engineering Technology 01 CARBON NEUTRAL WORLD 02 INNOVATION 03 MHI CORE TECHNOLOGIES 04 R&D CENTER, FACILITY 05 DIGITAL INNOVATION Intellectual Property Yokohama Hardtech Hub Technical Review Nuclear Energy Systems Quality Assurance Bidding information Engineering Business Decarbonization Occupational Health and Safety Profile Videos MHI Engineering, Ltd. Sustainability Topics Framework Material Issues マテリアリティ（重要課題） GRI Guidelines Comparison Tables Materiality Explanation Cartoon TCFD Disclosure Declaration on Biodiversity How MHI Group is Helping to Protect Biodiversity Certification(ISO45001) Library Investors Management Policy Corporate Governance Disclosure Policy Financial Data Financial Highlights Outline of Financial Results Main Financial Data Main Financial Index Business Segment Data Overseas Sales by Region Consolidated Statement of Financial Position Consolidated Statement of Profit or Loss Consolidated Statement of Cash Flows IR Library Financial Results Medium-Term Business Plan Briefings by Topic Business Presentation MHI REPORT (Integrated Report) and Other Reports Other Presentation Conference Movie Stock and Bond Information Stock Information Shareholder Return Stock Quotes Shareholders' Meeting Corporate Ratings and Bonds Analyst Coverage The Articles of Incorporation Sustainable Finance Insights STORIES CINEMA WHITEPAPERS announce that their automated picking solution that utilizes the "ΣSynX" (Sigma Synx) solution concept(Note1) to enable automation and intelligence for picking work in beverage warehouses has been put into operation at the Ebina Logistics Center in Ebina managed by Kirin Group Logistics (East Japan Regional Office ordered by Kirin Group companies Kirin Beverage Co. is the first of its kind to be utilized in Japan.(Note2) Shipment volume will be increased in stages from January 2025 The automated picking solution utilizing ΣSynX introduces automation and intelligence for the picking work that up to now has been performed manually by workers who have also been responsible for considering how to improve efficiency in their picking operations The system utilizes a proprietary optimization engine and integrated control system to efficiently coordinate multiple automated guided forklifts (AGFs) and palletizers(Note3) in order to reduce the number of picking and transfer operations and improve throughput (processing capacity) Companies face challenges for improving the working environment for logistics operations at beverage warehouses and other facilities such as measures to address the shortage of logistics operators With the aim of providing solutions to these issues MHI Group and Kirin Group began a joint demonstration project to introduce MHI Group's automated picking solution in a beverage warehouse.(Note4) The project verified the effectiveness of the system for logistics centers leading to the decision to implement an automated picking solution at the Ebina Logistics Center in November 2023 ultimately resulting in the start of operation MHI Group continues to collaborate with Kirin Group on joint demonstration projects for the automation of inbound and outbound processes at beverage warehouses using a new type of unmanned forklift equipped with ΣSynX,(Note5) and automation solutions for the loading and unloading of trucks.(Note6) Going forward MHI and Mitsubishi Logisnext will promote the development and application of optimal solutions for the challenges facing warehouse logistics facilities and further accelerate the response to regulatory changes in the logistics industry in 2024 aimed at alleviating the shortage of logistics operators and reducing the working time and waiting time for truck drivers Implementation at the Ebina Logistics Center This site (www.mhi.com) uses cookies in order to improve your experience and to provide content of your interest upon revisiting the site. For more information about the use of cookies on this site, please review our cookie policy in our Terms of Use. And please confirm that you agree to use of cookies by clicking Yes.Terms of Use Navy helicopter made an emergency landing in a rice field near Tokyo on Saturday The helicopter carrying 12 people landed at around 10:55 a.m after departing the Atsugi base about 7 kilometers away Naval Air Facility Atsugi said a precautionary landing was carried out after some irregularities were detected midair while declining to explain the purpose of the flight The helicopter was en route to a base in Iwakuni in Yamaguchi Prefecture No fuel spill was found following the incident To have the latest news and stories delivered to your inbox Simply enter your email address below and an email will be sent through which to complete your subscription Please check your inbox for a confirmation email Thank you for reaching out to us.We will get back to you as soon as possible Today's print edition Home Delivery Three children have died after being found injured at home in Ebina Emergency authorities said a father called an ambulance on Sunday night at around 10:55 p.m. saying he came home and found his three children with head injuries.googletag.cmd.push(function() { googletag.display('div-gpt-ad-1499653692894-0'); }); were found on the second floor of the house and were taken to hospital reportedly attempted to kill herself and was taken to hospital but was not in a life-threatening condition Believing that the mother was involved in the incident police plan to conduct interviews with her the mother and the children were living on the second floor of a two-family house If you or someone you know is in crisis and needs help please call 119 in Japan for immediate assistance The TELL Lifeline is available for those who need free and anonymous counseling at 03-5774-0992 visit www.suicide.org/international-suicide-hotlines.html for a detailed list of resources and assistance In a time of both misinformation and too much information quality journalism is more crucial than ever.By subscribing Your subscription plan doesn't allow commenting. To learn more see our FAQ Sponsored contents planned and edited by JT Media Enterprise Division Your browser does not support JavaScript, or it is disabled．Please check the site policy for more information National Report KANAGAWA—Three children were found dead with head wounds at their house in Ebina while their mother was hospitalized after an apparent suicide attempt Their father discovered the grisly scene upon his return home and made an emergency call at 10:50 p.m a third-year junior high school student; Mako a first-year junior high school student; and Rei The three were confirmed dead at a hospital and police plan to question her about what had happened in the home The incident occurred in a two-family detached house The five Hayashi family members--the three deceased and their parents--lived on the second floor There were no signs of vandalism or robbery at their home woman seriously injured in apartment attack in Osaka Driver arrested after 4 students run down at Miyagi school Nagoya school fails to take child with fractured face to hospital Kyoto man accused of killing female student with thallium 17-year-old held over stabbing incident near Todai exam site Information on the latest cherry blossom conditions Please right click to use your browser’s translation function.) A series based on diplomatic documents declassified by Japan’s Foreign Ministry Here is a collection of first-hand accounts by “hibakusha” atomic bomb survivors chefs and others involved in the field of food introduce their special recipes intertwined with their paths in life A series about Japanese-Americans and their memories of World War II In-house News and Messages No reproduction or republication without written permission Read now > Kanagawa — Police arrested a 49-year-old woman on Monday on suspicion of killing her 9-year-old son by such means as striking him at their home in Ebina after her three children had been confirmed dead please disable the ad blocking feature and reload the page This website uses cookies to collect information about your visit for purposes such as showing you personalized ads and content By clicking “Accept all,” you will allow the use of these cookies Users accessing this site from EEA countries and UK are unable to view this site without your consent The police will investigate the case also on suspicion of the murder of the other two children the father made an emergency call to the fire department after returning home late Sunday night saying that his three children were lying motionless in their house in the Kokubuminami district in the city The Ebina Police Station arrested Atsuko Hayashi a 15-year-old third year student in junior high school; and 13-year-old Mako Hayashi was discovered by emergency workers while attempting to commit suicide The police will attempt to clarify a motive Our weekly ePaper presents the most noteworthy recent topics in an exciting © 2025 The Japan News - by The Yomiuri Shimbun Plan a sweet getaway to the strawberry fields of Ebina city “There must be an easier way,” I thought discreetly wiping the red juice from between my fingers “You lift upwards to break the stem,” said Azusa Surrounding the city of Ebina in Kanagawa Prefecture is the locally known Strawberry Road a cluster of strawberry greenhouses and farm shops dotted around a residential area Signs for いちご (“ichigo” – the Japanese word for strawberry) appear on shopfronts at the side of the road and red cartoon-like images gaze at passing motorists is a red little figure with a shrimp-like head and a strawberry body Ebina is located on the Sagami Plain and is surrounded by wide-open rice paddy fields that stretch out towards the Tanzawa Mountains in the distance It is a place to enjoy the beauty of spring and there are several spots around the city to experience the strawberry culture With the arrival of spring, Strawberry House in Ebina is busy with young families who come to enjoy picking and eating strawberries on a Saturday morning Everyone is given a small tray of sweet condensed milk and has 30 minutes to pick and eat their way around the greenhouse The five varieties are clearly marked and it’s fun to do a comparison between them while learning something new The strawberries grow a meter from the ground so they are easy to pick and the wide flat aisles make it accessible for wheelchairs and strollers The farm sells a range of strawberry products such as strawberry-scented cosmetics as well as individual strawberry plants to grow at home visitors don’t need to make a reservation but should arrive when doors open at 7:30 am to book their slot Open Saturday and Sunday only between January and June Entry is ¥1,900 for adults and ¥1,100 for children While Strawberry House Ebina opens earliest in the strawberry season, there are two other popular farms nearby that offer strawberry picking during the peak months of April and May. Takei Strawberry Farm is situated about a 10-minute walk from the strawberry road It is necessary to make a reservation as it is a highly-regarded spot that has gained recognition from the Japanese Ministry of Agriculture Entry is ¥1,200 for adults and ¥1,000 for children in April and May Onoue Strawberry Farm is similar to Strawberry House and visitors don’t need to make a reservation in advance There is a small shop on the strawberry road where you can buy their delicious strawberry jam as well as other homegrown fruits and vegetables Strawberry picking in Ebina is about enjoying their fresh taste rather than taking the fruits home but there are a number of places to buy strawberry products around the city is a hidden gem and is known for its varieties of strawberry daifuku – soft sticky rice cakes with a plump fresh strawberry at their center The shop is located in a quiet residential area and sells attractively-packaged sweets to take away The products are made in their own kitchen and a small window allows customers to see the production area while they browse the shop If you are looking for a more modern way to enjoy strawberries then the Rembrandt Hotel has a newly-renovated restaurant on the ground floor which sells the hotel’s unique strawberry cake sophisticated environment to relax with a cup of coffee or hot tea The delicious red cakes have a moist topping and are made with rice flour so maintain a firm texture a visit to Ebina is the perfect family day trip in spring It’s not difficult to see why Japan consumes so many strawberries and once you have mastered your picking technique It takes 44 minutes on the Odakyu Line’s rapid express service from Shinjuku Station to Ebina Station follow signs for the West Exit bus stops and take bus 16 towards Chogo for 15 minutes You should alight at Kamigouchi intersection and it’s a 10-minute walk to the Strawberry Road Feature photo: barmalini / Shutterstock.com First, think about the traces of daily life left in the house, including the forms and the story that remains there, and to create new traces of daily life, the film director: Yui Kiyohara, and the dramatist / photo-artist: Arata Mino joined the design team. people living and visiting here will continue to touch the fragments of traces such as the shadows that casually fall into the room and the light that leaks out of the building and create new traces in daily life You'll now receive updates based on what you follow Personalize your stream and start following your favorite authors If you have done all of this and still can't find the email A 49-year-old woman in Kanagawa Prefecture has been arrested for allegedly killing her son who was found dead along with two other children of the suspect Upon returning to the family's home in Kanagawa's city of Ebina at around 10:55 p.m the children's father made an emergency call to firefighting and medical services reporting that the kids had sustained head injuries.googletag.cmd.push(function() { googletag.display('div-gpt-ad-1499653692894-0'); }); The three children were confirmed dead after being rushed to the hospital was arrested by the Kanagawa police Monday on suspicion of murdering the son partly by beating him at the home at around 3:30 p.m The other two children were the couple's 15-year-old daughter The suspect attempted to kill herself at the home She was sent to the hospital and is not in a life-threatening condition The prefectural police will investigate the deaths of the two girls The couple and the three children were living on the second floor of the house while their relatives are using the first floor If you or someone you know is in crisis and needs help, resources are available. In case of an emergency in Japan, please call 119 for immediate assistance. The TELL Lifeline is available for those who need free and anonymous counseling at 03-5774-0992. For those in other countries, visit International Suicide Hotlines for a detailed list of resources and assistance A U.S. military helicopter made an emergency landing in a rice paddy in Ebina, Kanagawa Prefecture, on Saturday morning, according to video footage shown by broadcaster NHK. military's Atsugi Air Base around 12:40 p.m Authorities were continuing to investigate the accident.googletag.cmd.push(function() { googletag.display('div-gpt-ad-1499653692894-0'); }); It was not immediately clear what was behind the emergency landing but local media reported that no smoke or fire had been seen from the aircraft Not because it’s the beginning of the work week or a fat cat told me to but because almost all the museums are closed So with nowhere to go indoors and rain making the outdoors unpleasant it seemed I would waste a vacation day in Kanagawa Prefecture Then I remembered a little museum in Ebina the Odawara Electric Railway’s Romancecar limited express has been a stylish way to get passengers from Odawara to Shinjuku fast the term “romancecar” likely originated with two-person “romance seats” at movie theaters.) Five of these proprietary people movers are on display allowing museum passengers to come aboard and see six decades of high-speed rail evolution up close they’re visually enticing with their (then) modern lines and shiny vermillion which held the world speed record for a narrow gauge railway when it debuted in 1957 and can be considered a forerunner to the Shinkansen Its round nose doesn’t hurt the comparison either The sixth train in the collection is also the only remaining MOHA 1 commuter train from 1927 It’s in a section about the history of both Odawara Electric Railway and the Romancecar I think the museum lets itself down a little as there aren’t many of the accompanying artifacts usually seen in railway museums to help visualize the story The upstairs holds child-friendly interactive areas including a model railway layout featuring real Odakyu line landmarks that takes up a room and a Romancecar driving simulator that lets you get behind the controls in a full-sized cockpit though the immediate area is flush with dining options it still has that new museum smell and room to grow into its facility My only complaint is that the 900 yen adult entry fee is steep for what amounts to six trains in a company public relations center That’s like putting positive exposure and advertising for a very attractive way to travel behind a pay wall The unique trains on display did sell it for me and I found it worth my time on a rainy Monday Ebina can be spun off into its own day trip with a nearby historical museum and temple ruins Like a Dragon: Infinite Wealth is an upcoming action-adventure RPG developed by Ryu Ga Gotoku Studio Check out the latest spotlight trailer for Masataka Ebina who envisions a new world order for the underworld Like a Dragon: Infinite Wealth is launching on January 26 A monkey appeared in a private house in Ebina it opened its mouth wide in a likely sign of showing aggression.   It hit the glass with its right hand.   It’s a monkey without a hand that was featured on TV.  It is believed to be the monkey without its left hand.  It appears to have stayed in Ebina since a day earlier.  the monkey pulled out a radish that was growing in the garden and then left.  About Nippon Television Metrics details A Publisher Correction to this article was published on 24 September 2024 This article has been updated Thymic stromal lymphopoietin (TSLP) is a pleiotropic cytokine that acts on multiple cell lineages It is best known for its role in promoting type 2 immune responses such as in allergic diseases and a monoclonal antibody targeting TSLP was approved for the treatment of severe asthma it is now clear that TSLP has many other important roles in a variety of settings several genetic variants for TSLP are linked to disease severity and chromosomal alterations in TSLP are common in certain cancers indicating important roles of TSLP in disease we discuss recent advances in TSLP biology highlighting how it regulates the tissue environment not only in allergic disease but also in infectious diseases therapies targeting the TSLP pathway are being actively pursued for several diseases Prices may be subject to local taxes which are calculated during checkout A Correction to this paper has been published: https://doi.org/10.1038/s41577-024-01094-6 A thymic stromal cell line supports in vitro development of surface IgM+ B cells and produces a novel growth factor affecting B and T lineage cells The original study showing the existence of TSLP as a stromal factor that acts on both B and T cells Epithelial cell-derived cytokines: more than just signaling the alarm A role for TSLP in the development of inflammation in an asthma model This study demonstrates a role for TSLP in allergic inflammation New insights into the regulation of T cells by gamma(c) family cytokines Molecular cloning and biological characterization of a novel murine lymphoid growth factor Human epithelial cells trigger dendritic cell mediated allergic inflammation by producing TSLP This study demonstrates that human epithelial cells produce TSLP and that it acts on DCs TSLP-activated dendritic cells induce an inflammatory T helper type 2 cell response through OX40 ligand Cutting edge: direct action of thymic stromal lymphopoietin on activated human CD4+ T cells The first demonstration of a direct effect of TSLP on human T cells with TSLPR expression increased on activated CD4+ T cells A direct and nonredundant role for thymic stromal lymphopoietin on antiviral CD8 T cell responses in the respiratory mucosa The role of thymic stromal lymphopoietin in CD8+ T cell homeostasis A role for thymic stromal lymphopoietin in CD4+ T cell development A TSLP-complement axis mediates neutrophil killing of methicillin-resistant Staphylococcus aureus This study demonstrates that TSLP can promote the killing of methicillin-resistant S Homeostatic control of sebaceous glands by innate lymphoid cells regulates commensal bacteria equilibrium This study demonstrates a role for TSLP in the persistence of ILCs within skin and its control of sebaceous gland function to maintain the microbiota A mechanism for the initiation of allergen-induced T helper type 2 responses Thymic stromal lymphopoietin is produced by dendritic cells DC-derived TSLP promotes Th2 polarization in LPS-primed allergic airway inflammation Expression and cellular provenance of thymic stromal lymphopoietin and chemokines in patients with severe asthma and chronic obstructive pulmonary disease TLR3- and Th2 cytokine-dependent production of thymic stromal lymphopoietin in human airway epithelial cells Thymic stromal lymphopoietin is released by human epithelial cells in response to microbes or inflammation and potently activates mast cells Airway epithelial TSLP production of TLR2 drives type 2 immunity in allergic airway inflammation Thymic stromal lymphopoietin is induced by respiratory syncytial virus-infected airway epithelial cells and promotes a type 2 response to infection Responsiveness to respiratory syncytial virus in neonates is mediated through thymic stromal lymphopoietin and OX40 ligand Respiratory syncytial virus infection activates IL-13-producing group 2 innate lymphoid cells through thymic stromal lymphopoietin Thymic stromal lymphopoietin limits primary and recall CD8+ T-cell anti-viral responses This study shows that TSLP can limit primary and recall T cell-mediated antiviral responses Thymic stromal lymphopoietin gene promoter polymorphisms are associated with susceptibility to bronchial asthma Macrophage-derived progranulin promotes allergen-induced airway inflammation Insights into the role of progranulin in immunity The multiple facets of thymic stromal lymphopoietin (TSLP) during allergic inflammation and beyond Functional analysis of the thymic stromal lymphopoietin variants in human bronchial epithelial cells This study describes the properties of short and long forms of TSLP Long TSLP transcript expression and release of TSLP induced by TLR ligands and cytokines in human keratinocytes Evidence for a functional thymic stromal lymphopoietin signaling axis in fibrotic lung disease The expression of the short isoform of thymic stromal lymphopoietin in the colon is regulated by the nuclear receptor peroxisome proliferator activated receptor-gamma and is impaired during ulcerative colitis The short form of TSLP is constitutively translated in human keratinocytes and has characteristics of an antimicrobial peptide Dichotomy of short and long thymic stromal lymphopoietin isoforms in inflammatory disorders of the bowel and skin Distinct roles of short and long thymic stromal lymphopoietin isoforms in house dust mite-induced asthmatic airway epithelial barrier disruption Thymic stromal lymphopoietin expression from benign lymphoproliferation to malignant B-cell lymphoma in primary Sjogren’s syndrome Short-form thymic stromal lymphopoietin (sfTSLP) is the predominant isoform expressed by gynaecologic cancers and promotes tumour growth Cloning of a receptor subunit required for signaling by thymic stromal lymphopoietin Cloning of the murine thymic stromal lymphopoietin (TSLP) receptor: formation of a functional heteromeric complex requires interleukin 7 receptor Structure and antagonism of the receptor complex mediated by human TSLP in allergy and asthma This study shows the structure and mechanism of antagonism of the IL-7Rα–TSLPR complex and further revealed the mechanism for tezepelumab for neutralizing TSLP function mediated via the cytokines IL-1alpha and TSLP This study extended work of Olkhanud et al (2011) by showing that TSLP cooperates with IL-1α to promote the progression of breast cancer Thymic stromal lymphopoietin-mediated STAT5 phosphorylation via kinases JAK1 and JAK2 reveals a key difference from IL-7-induced signaling TSLP and IL-7 use two different mechanisms to regulate human CD4+ T cell homeostasis Barrier epithelial cells and the control of type 2 immunity TSLP-activated dendritic cells induce human T follicular helper cell differentiation through OX40-ligand TSLP enhances the function of helper type 2 cells Local increase in thymic stromal lymphopoietin induces systemic alterations in B cell development TSLP elicits IL-33-independent innate lymphoid cell responses to promote skin inflammation Thymic stromal lymphopoietin-elicited basophil responses promote eosinophilic esophagitis TSLP promotes interleukin-3-independent basophil haematopoiesis and type 2 inflammation Thymic stromal lymphopoietin does not activate human basophils Skin thymic stromal lymphopoietin initiates Th2 responses through an orchestrated immune cascade TSLP signaling in CD4+ T cells programs a pathogenic T helper 2 cell state A tissue checkpoint regulates type 2 immunity Thymic stromal lymphopoietin drives the development of IL-13+ Th2 cells Thymic stromal lymphopoietin signaling in CD4+ T cells is required for TH2 memory Targeted deletion of the TSLP receptor reveals cellular mechanisms that promote type 2 airway inflammation Association of filaggrin loss of function and thymic stromal lymphopoietin variation with treatment use in pediatric atopic dermatitis Genetic variants in thymic stromal lymphopoietin are associated with atopic dermatitis and eczema herpeticum and the risk of atopic disorders in children Cytokine concentration across the stratum corneum in atopic dermatitis and healthy controls Spontaneous atopic dermatitis in mice expressing an inducible thymic stromal lymphopoietin transgene specifically in the skin Promoter demethylation contributes to TSLP overexpression in skin lesions of patients with atopic dermatitis TSLP is a direct trigger for T cell migration in filaggrin-deficient skin equivalents Stimulation of the histamine 4 receptor upregulates thymic stromal lymphopoietin (TSLP) in human and murine keratinocytes The role of the histamine H4 receptor in atopic dermatitis and psoriasis Histamine H4 receptor regulates Th2-cytokine profile through thymic stromal lymphopoietin in allergic rhinitis National surveillance of asthma: United States Genetics of asthma and hay fever in Australian twins A population-based study of bronchial asthma in adult twin pairs Meta-analysis of genome-wide association studies of asthma in ethnically diverse North American populations Genome-wide association study identifies three new susceptibility loci for adult asthma in the Japanese population Increased expression of immunoreactive thymic stromal lymphopoietin in patients with severe asthma TSLP disease-associated genetic variants combined with airway TSLP expression influence asthma risk Blood tryptase and thymic stromal lymphopoietin levels predict the risk of exacerbation in severe asthma Bronchial allergen challenge of patients with atopic asthma triggers an alarmin (IL-33 and IL-25) response in the airways epithelium and submucosa The pathogenesis of eosinophilic asthma: a positive feedback mechanism that promotes Th2 immune response via filaggrin deficiency Thymic stromal lymphopoietin (TSLP)-mediated dermal inflammation aggravates experimental asthma Skin-derived TSLP triggers progression from epidermal-barrier defects to asthma Thymic stromal lymphopoietin overproduced by keratinocytes in mouse skin aggravates experimental asthma Respiratory syncytial virus infection provokes airway remodelling in allergen-exposed mice in absence of prior allergen sensitization Determinants of asthma after severe respiratory syncytial virus bronchiolitis Sex-associated TSLP-induced immune alterations following early-life RSV infection leads to enhanced allergic disease TSLP-driven chromatin remodeling and trained systemic immunity after neonatal respiratory viral infection Effect of tezepelumab on airway inflammatory cells and hyperresponsiveness in patients with moderate-to-severe uncontrolled asthma (CASCADE): a double-blind Tezepelumab improves patient-reported outcomes in patients with severe Tezepelumab in adults with uncontrolled asthma Tezepelumab in adults and adolescents with severe This study shows that tezepelumab lowered exacerbation and led to better lung function Anti-IL-7 receptor alpha monoclonal antibody (GSK2618960) in healthy subjects-a randomized TSLP regulates intestinal immunity and inflammation in mouse models of helminth infection and colitis Helminth products bypass the need for TSLP in Th2 immune responses by directly modulating dendritic cell function Neuronal regulation of type 2 innate lymphoid cells via neuromedin U The neuropeptide neuromedin U stimulates innate lymphoid cells and type 2 inflammation The neuropeptide NMU amplifies ILC2-driven allergic lung inflammation Calcitonin gene-related peptide negatively regulates alarmin-driven type 2 innate lymphoid cell responses Neuronal regulation of group 2 innate lymphoid cells and type 2 inflammation Neuropeptide CGRP limits group 2 innate lymphoid cell responses and constrains type 2 inflammation Transcriptional atlas of intestinal immune cells reveals that neuropeptide alpha-CGRP modulates group 2 innate lymphoid cell responses The ChAT-acetylcholine pathway promotes group 2 innate lymphoid cell responses and anti-helminth immunity dsRNA-induced expression of thymic stromal lymphopoietin (TSLP) in asthmatic epithelial cells is inhibited by a small airway relaxant Viral infection induces thymic stromal lymphopoietin (TSLP) in human keratinocytes Human dendritic cells activated by TSLP and CD40L induce proallergic cytotoxic T cells Thymic stromal lymphopoietin plays an adjuvant role in BCG-mediated CD8+ cytotoxic T cell responses through dendritic cell activation plays a key role in the T cell response to influenza A virus TSLP promotes influenza-specific CD8+ T-cell responses by augmenting local inflammatory dendritic cell function Interferon-lambda enhances adaptive mucosal immunity by boosting release of thymic stromal lymphopoietin This study shows that IFNλ induced by virus triggers the synthesis of TSLP by microfold cells leading to enhanced adaptive mucosal immunity Clinical and immunological factors that distinguish COVID-19 from pandemic influenza A(H1N1) Dysregulation of lipid metabolism and pathological inflammation in patients with COVID-19 Hepatitis C virus promotes T-helper (Th)17 responses through thymic stromal lymphopoietin production by infected hepatocytes Thymic stromal lymphopoietin transgenic mice develop cryoglobulinemia and hepatitis with similarities to human hepatitis C liver disease TSLP production by epithelial cells exposed to immunodeficiency virus triggers DC-mediated mucosal infection of CD4+ T cells Th2 type inflammation promotes the gradual progression of HPV-infected cervical cells to cervical carcinoma Serum immunoglobulins in patients with carcinoma of the oral cavity HPV16 E7 expression in skin induces TSLP secretion type 2 ILC infiltration and atopic dermatitis-like lesions Targetable kinase-activating lesions in Ph-like acute lymphoblastic leukemia CRLF2 over-expression is a poor prognostic marker in children with high risk T-cell acute lymphoblastic leukemia Degradation of Janus kinases in CRLF2-rearranged acute lymphoblastic leukemia This study shows that targeting of JAKs is effective treatment for CRLF2-rearranged ALL RAS-protein activation but not mutation status is an outcome predictor and unifying therapeutic target for high-risk acute lymphoblastic leukemia Understanding the tumor immune microenvironment (TIME) for effective therapy TSLP: an epithelial cell cytokine that regulates T cell differentiation by conditioning dendritic cell maturation Intratumor T helper type 2 cell infiltrate correlates with cancer-associated fibroblast thymic stromal lymphopoietin production and reduced survival in pancreatic cancer Thymic stromal lymphopoietin is a key mediator of breast cancer progression Thymic stromal lymphopoietin fosters human breast tumor growth by promoting type 2 inflammation The IL-1/IL-1 receptor axis and tumor cell released inflammasome adaptor ASC are key regulators of TSLP secretion by cancer associated fibroblasts in pancreatic cancer Basophil recruitment into tumor-draining lymph nodes correlates with Th2 inflammation and reduced survival in pancreatic cancer patients IL1 receptor antagonist controls transcriptional signature of inflammation in patients with metastatic breast cancer NKT cell-mediated repression of tumor immunosurveillance by IL-13 and the IL-4R-STAT6 pathway Tumor-driven evolution of immunosuppressive networks during malignant progression Thymic stromal lymphopoietin blocks early stages of breast carcinogenesis No evidence for TSLP pathway activity in human breast cancer Identification of a novel immune-related prognostic signature associated with tumor microenvironment for breast cancer Elevated epidermal thymic stromal lymphopoietin levels establish an antitumor environment in the skin This study shows that elevated levels of epidermal TSLP establish an antitumour environment in skin Loss of cutaneous TSLP-dependent immune responses skews the balance of inflammation from tumor protective to tumor promoting Thymic stromal chemokine TSLP acts through Th2 cytokine production to induce cutaneous T-cell lymphoma TSLP expression and high serum TSLP level indicate a poor prognosis in gastric cancer patients The expression and prognostic impact of proinflammatory cytokines and their associations with carcinogens in oropharyngeal squamous cell carcinoma Tumor-derived thymic stromal lymphopoietin enhances lung metastasis through an alveolar macrophage-dependent mechanism Tumor-derived thymic stromal lymphopoietin expands bone marrow b-cell precursors in circulation to support metastasis Increased prevalence of regulatory T cells in the lung cancer microenvironment: a role of thymic stromal lymphopoietin Human lung-resident macrophages express and are targets of thymic stromal lymphopoietin in the tumor microenvironment The infiltration and functional regulation of eosinophils induced by TSLP promote the proliferation of cervical cancer cell TSLP promotes angiogenesis of human umbilical vein endothelial cells by strengthening the crosstalk between cervical cancer cells and eosinophils Human thymic stromal lymphopoietin promotes the proliferation and invasion of cervical cancer cells by downregulating microRNA-132 expression Evaluation of thymic stromal lymphopoietin (TSLP) and its correlation with lymphatic metastasis in human gastric cancer Overexpression of thymic stromal lymphopoietin is correlated with poor prognosis in epithelial ovarian carcinoma Expression and polymorphism of TSLP/TSLP receptors as potential diagnostic markers of colorectal cancer progression Thymic stromal lymphopoietin (TSLP) inhibits human colon tumor growth by promoting apoptosis of tumor cells Chronic adipose tissue inflammation: all immune cells on the stage Activated type 2 innate lymphoid cells regulate beige fat biogenesis Eosinophils and type 2 cytokine signaling in macrophages orchestrate development of functional beige fat Group 2 innate lymphoid cells promote beiging of white adipose tissue and limit obesity Innate lymphoid type 2 cells sustain visceral adipose tissue eosinophils and alternatively activated macrophages Eosinophils sustain adipose alternatively activated macrophages associated with glucose homeostasis Antigen- and cytokine-driven accumulation of regulatory T cells in visceral adipose tissue of lean mice fat is enriched for a unique population of regulatory T cells that affect metabolic parameters Thymic stromal lymphopoietin induces adipose loss through sebum hypersecretion This study shows that TSLP induces the loss of white adipose tissue and protects against obesity by promoting sebum hypersecretion Regulators of thymic stromal lymphopoietin production by human adipocytes Epithelial-cell-derived cytokines in patients with obesity before and after bariatric surgery Obesity increases the prevalence and the incidence of asthma and worsens asthma severity Viral stimuli trigger exaggerated thymic stromal lymphopoietin expression by chronic obstructive pulmonary disease epithelium: role of endosomal TLR3 and cytosolic RIG-I-like helicases Cigarette smoke extract induces thymic stromal lymphopoietin expression leading to T(H)2-type immune responses and airway inflammation Thymic stromal lymphopoietin in cigarette smoke-exposed human airway smooth muscle Inducible expression of the proallergic cytokine thymic stromal lymphopoietin in airway epithelial cells is controlled by NFkappaB Upregulation of interleukin-33 and thymic stromal lymphopoietin levels in the lungs of idiopathic pulmonary fibrosis Epithelial alarmins in serum and exhaled breath in patients with idiopathic pulmonary fibrosis: a prospective one-year follow-up cohort study The level of thymic stromal lymphopoietin and its gene polymorphism are associated with rheumatoid arthritis A possible role for TSLP in inflammatory arthritis a novel proinflammatory mediator in rheumatoid arthritis that potently activates CD1c+ myeloid dendritic cells to attract and stimulate T cells Critical proinflammatory role of thymic stromal lymphopoietin and its receptor in experimental autoimmune arthritis FcepsilonRI-mediated thymic stromal lymphopoietin production by interleukin-4-primed human mast cells Interleukin-32-induced thymic stromal lymphopoietin plays a critical role in macrophage differentiation through the activation of caspase-1 in vitro Mast cells in early rheumatoid arthritis associate with disease severity and support B cell autoantibody production Intestinal epithelial cells: regulators of barrier function and immune homeostasis Interactions between the host innate immune system and microbes in inflammatory bowel disease Pediatric ulcerative colitis associated with autoimmune diseases: a distinct form of inflammatory bowel disease The biology of thymic stromal lymphopoietin (TSLP) Protective effect of TSLP and IL-33 cytokines in ulcerative colitis Functionality and performance of an accessorized pre-filled syringe and an autoinjector for at-home administration of tezepelumab in patients with severe parallel group trial to evaluate the efficacy and safety of tezepelumab in reducing oral corticosteroid use in adults with oral corticosteroid dependent asthma parallel-group trial to evaluate the effect of tezepelumab on airway inflammation in patients with uncontrolled asthma Tezepelumab normalizes serum interleukin-5 and -13 levels in patients with severe Download references Lin for critical comments on the manuscript We acknowledge funding by Division of Intramural Research National Heart Tohoku University Graduate School of Medicine The authors contributed equally to all aspects of the article is an inventor on NIH patents related to thymic stromal lymphopoietin (TSLP) reviewer(s) for their contribution to the peer review of this work Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations A disease characterized by chronic type 2 inflammation hyper-responsiveness and clinical symptoms of wheezing The most prevalent inflammatory skin disease usually developing in childhood; also known as eczema Innate lymphoid cells characterized by high expression of GATA3 and production of IL-5 and IL-13 that have pathological and protective roles in multiple human diseases such as asthma Molecules that are released by injured tissue as well as dead or dying cells and activate the host response through the inflammasome A chronic eosinophil-mediated inflammatory disease of the oesophagus; affected individuals have oesophageal dysfunction with vomiting A filament-associated protein that binds to keratin fibres in epithelial cells and is essential for normal regulation of epidermal homeostasis; also known as filament aggregating protein The progression of allergic manifestations generally beginning with atopic dermatitis leads to JAK1 and TYK2 activation and phosphorylation of STAT1 and STAT2 which combine with IRF9 to form the heterotrimeric transcription factor ISGF3 A process by which white adipose tissue acquires features of beige or brown adipocytes that use extra energy for heat production A chronic lung disease characterized by progressive airflow obstruction in peripheral airways dynamic hyperinflammation and shortness of breath Download citation DOI: https://doi.org/10.1038/s41577-022-00735-y Anyone you share the following link with will be able to read this content: a shareable link is not currently available for this article Cellular & Molecular Immunology (2025) Sign up for the Nature Briefing: Cancer newsletter — what matters in cancer research Copyright © document.write(new Date().getFullYear()) The Recap Group TALENTRECAP.COM Talent America's Got Talent Kenichi Ebina made history on America’s Got Talent season eight and was one of the most watched acts of all time he returned to the stage as the founder of Unicircle Flow Here’s what this winner is up to in 2022 America’s Got Talent season eight winner returned to the stage as the founder of unicycle group he now works as an artistic director and producer of shows and events booking agent and has is the CEO of the production company LinQuest Inc In 2021, he founded the AGT season 16 group, UniCircle Flow he brought together champion unicyclists with the goal of spreading recognition of unicycling as an artistic performance Fans of the series loved this act because it was something completely new to America This dance style has been popular in dance for more than 40 years because of its unique and fascinating style UniCircle Flow stunned in their audition and was picked to advance into the Top 36 of the season they continued to perform beautiful dances in both the quarter finals and semi finals Even though their unique act was outstanding the group received criticism in the quarter finals Following that performance, they did not receive enough votes during normal voting, but was the judges choice during the Instant Save. They were eliminated in the semi finals While UniCircle Flow didn’t show up in the finals He was featured in Josh Blue’s finale package Within the package Blue got advice from other stars on how to succeed in the finals Ebina shows up while Williamson is talking about his results show night with Blue He recently returned to Japan after performing in a Dubai expo Ebina spent five days there then returned to Japan for a show in Nagaragawa Convention Center in Gufu The dancer shared that his event was cancelled due to COVID-19 he shared that six members of UniCircle Flow returned from the France “GAIA” show tour by Cirque Phenix They had been on this tour for four months and were working hard and avoiding COVID The founder of the group shared that he’s proud of the group and he heard their performances were the highlight of the show It seems like Ebina still lives an extremely busy lifestyle in 2022 he auditioned for America’s Got Talent and quickly became a household name His audition consisted of Matrix-inspired dance that featured martial art and miming Ebina was one of 30 acts to advance straight to the quarter finals without performing in Las Vegas The dancer once again impressed the audience with his quarter final performance This performance features Ebina dancing and miming to create the impression of him fighting monsters This was all portrayed using pre-recorded footage on the screen behind him Fans loved the way that Ebina’s dancing told a story on the stage He continued to tell stories using his art in the remaining weeks of the competition he made history as the first dance act to win the show Ebina returned to the America’s Got Talent competition in 2019 on America’s’ Got Talent: The Champions he didn’t receive enough votes to advance on in the series He competed later in the same year in China’s World’s Got Talent competition A talent competition where participants possessing some form of talent from the US and abroad We are using cookies to give you the best experience on our website You can find out more about which cookies we are using or switch them off in settings This website uses cookies so that we can provide you with the best user experience possible. Cookie information is stored in your browser and performs functions such as recognizing you when you return to our website and helping our team to understand which sections of the website you find most interesting and useful. You can view more details on Privacy and Policy Strictly Necessary Cookie should be enabled at all times so that we can save your preferences for cookie settings we will not be able to save your preferences This means that every time you visit this website you will need to enable or disable cookies again Metrics details Even though highly active anti-retroviral therapy is able to keep HIV-1 replication under control the virus can lie in a dormant state within the host genome known as a latent reservoir and poses a threat to re-emerge at any time novel technologies aimed at disrupting HIV-1 provirus may be capable of eradicating viral genomes from infected individuals we showed the potential of the CRISPR/Cas9 system to edit the HIV-1 genome and block its expression When LTR-targeting CRISPR/Cas9 components were transfected into HIV-1 LTR expression-dormant and -inducible T cells a significant loss of LTR-driven expression was observed after stimulation Sequence analysis confirmed that this CRISPR/Cas9 system efficiently cleaved and mutated LTR target sites this system was also able to remove internal viral genes from the host cell chromosome Our results suggest that the CRISPR/Cas9 system may be a useful tool for curing HIV-1 infection This CRISPR/Cas9 system is composed of guide RNA (gRNA) and a human codon-optimized Cas9 nuclease that forms an RNA-protein complex to digest unique target sequences matching those of gRNA The CRISPR/Cas9 system can be utilized by simple transfection of designed gRNA and a humanized Cas9 (hCas9) expression plasmid into target mammalian cells making it a promising tool for various applications we tested the ability of the CRISPR/Cas9 system to suppress HIV-1 expression by editing HIV-1 integrated proviral DNA were transfected and significantly inhibited LTR-driven expression under the control of Tat This LTR-targeted CRISPR/Cas9 system can also excise provirus from the cellular genome Suppression of HIV-1 gene expression by the CRISPR/Cas9 system targeting HIV-1 LTR (A) Schematic of provirus derived from LTIG vector and the LTR Two target sites of CRISPR/Cas9 were indicated at the bottom of the LTR (B and C) GFP expression after CRISPR/Cas9 treatment 293 T and HeLa cells were infected with LTIG vector pseudotyped with VSV-G protein the cells were co-transfected with gRNA expression vector and hCas9 expression vector The level of GFP expression was analyzed by flow cytometry at 5 days after TF (D) Percentage of GFP positive 293 T cells after multiple TF with the CRISPR/Cas9 system Flowchart of the experiment is depicted on the left side The percentage of GFP positive cells resulting from single double and triple TF is shown on the right side The error bars in C and D show standard deviations (n = 3) Sequencing analysis of the CRISPR/Cas9-target site DNA sequence of the TAR region of LTR is indicated Twenty-two sequences were obtained from LTIG-infected 293 T cells which were transfected three times with T5 gRNA The WT reference sequence is shown on the top The target sequence of T5 is indicated in orange The putative cleavage site is indicated with an arrowhead Eighteen out of 22 clones were deletion mutants (B) TAR sequence with both deletions and insertions Two out of 22 clones were mutants consisting of insertion and deletion Red and blue colors indicate insertion and unanticipated mutation Suppression of proviral re-activation in T cells by the CRISPR/Cas9 system Jurkat cell lines latently-transduced with LTIG vector were used These cell lines were co-transfected with gRNA expression vector and hCas9 expression vector The cells were treated with TNF-α or the combination of 5-Aza-dC and TSA 4 days after TF (A and B) The level of GFP expression after 48 hours of TNF-α stimulation and 24 hours 5-Aza-dC and TSA stimulation The positive percentage of GFP is shown in B (n = 3) (C) Multiple TF of T5 or gRNA empty vector and hCas9 expression plasmid Solid lines with squares and circles indicate c19 and c5 co-transfected with gRNA empty and hCas9 expression vector Dotted lines with x and triangles indicate c19 and c5 co-transfected with T5 and hCas9 expression vector The error bars in B and C show standard deviations (n = 3) These results clearly demonstrated that the T5 CRISPR/Cas9 system was able to prevent the re-activation of latently integrated provirus in T cells Excision of HIV-1 provirus from host cell genome with CRISPR/Cas9 A primer set was designed for the host cell genome sequence flanking the proviral integration site in c19 The schematic of PCR products indicating genomic sequences full-length provirus and one LTR footprint resulting from proviral excision are shown on the right side (D) DNA sequence of one LTR footprint resulted from proviral excision TAR sequence of WT LTR is shown on the top in bold Target sequence of T5 gRNA is indicated in orange LTR sequences from five clones are shown in the middle The host cell genome sequence is indicated on the bottom These results clearly demonstrate that the CRISPR/Cas9 system targeting HIV-1 LTR has the potential to excise latent form of HIV-1 proviral DNA from the host cell chromosome it could still be an appropriate target for the elimination of latently infected provirus The final hurdle concerns possible off-target effects which are pertinent concerns for all genome-editing strategies that may lead to nonspecific gene modification events then removal of the off-target activity may be the best approach before utilizing CRISPR/Cas system for anti-HIV treatment gRNA expression plasmids were constructed according to manufacturer's protocol to make a 100 bp dsDNA insert fragment containing the target sequence (20 bp) and PAM sequence a set of oligonucleotides was used and the fragment was generated by using Phusion polymerase (NEB) The dsDNA fragment was purified and inserted into the AflII site of a gRNA_cloning vector (addgene) with the Gibson assembly system (NEB) Two sets of oligonucleotides targeting 5 and 6 are listed as follows: HE388 (TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGttagaccagatctgagcct) and HE389 (GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACaggctcagatctggtctaaC); and HE384 (TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGctacaagggactttccgct) and HE385 (GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACagcggaaagtcccttgtagC) Lower case letters indicate the target sequence These 60 nt oligonucleotide sets annealed to each other over a 20 nt complementary sequence at the 3′ ends 293 T and HeLa cells were maintained in Dulbecco's Modified Eagle Medium (DMEM) containing 10% fetal calf serum (FCS) 100 U/ml penicillin and 100 g/ml streptomycin Jurkat cells were maintained in RPMI 1640 medium containing 10% FCS 293 T cells were transfected by the calcium phosphate method24 HeLa cells were transfected by Lipofectamine2000 (invitrogen) according to the manufacturer's protocol Jurkat clone cells were transfected by NEON transfection system (life technology) 1 μg of hCas9 expression vector and 1 μg of gRNA expression vector was used The level of GFP expression was analyzed 5 days after TF Cells were suspended in phosphate-buffered saline (PBS) containing 1% formamide Flow cytometry was performed with a FACScCalibur (BD Biosciences) and data were analyzed using CellQuest software (BD Biosciences) Jurkat cells were infected with LTIG pseudotyped vector at MOI 0.5 and cultured for one weak After treatment with 10 ng/ml TNF-α for 24 hours GFP positive cells were sorted by FACSAria (BD) and cultured for another one month to relax the GFP expression GFP negative cells were sorted four times and the cells were cloned by limiting-dilution clone cells were treated with 10 ng/ml of TNF-α (R&D systems) or a combination of 1 μg/ml 5-Aza-dC (SIGMA-ALDRICH) and 1 μM TSA (SIGMA-ALDRICH) and screened for the potential to be reactivated after stimulation Genomic DNA extracted from Jurkat cell clones were digested with a combination of BamHI and BclI or NcoI and BspHI and re-ligated by T4 ligase The ligation products were EtOH precipitated and used as the template for inverse PCR LA taq (TAKARA) were used according to the manufacturer's protocol Primer sets used for the inverse PCR were HE410 (CTCCTCGCCCTTGCTCACCA) and M667 (GGCTAACTAGGGAACCCACTGC) The PCR products were cloned into pGEM-T (Promega) vector and sequenced using M13 primers HE433 (AGCACATCACACTCCTCTG) and HE435 (AGACATGAGCCACTATGTCT) were used for PCR amplification of integrated provirus in c19 All data were expressed as mean ± standard deviations (S.D.) The student's t test was used to indicate the differences between groups Cold Spring Harbor perspectives in medicine 2 Transcriptional and posttranscriptional regulation of HIV-1 gene expression Cold Spring Harbor perspectives in medicine 1 The site of HIV-1 integration in the human genome determines basal transcriptional activity and response to Tat transactivation Redefining the viral reservoirs that prevent HIV-1 eradication Highly efficient endogenous human gene correction using designed zinc-finger nucleases De novo-engineered transcription activator-like effector (TALE) hybrid nuclease with novel DNA binding specificity creates double-strand breaks Efficient and specific modifications of the Drosophila genome by means of an easy TALEN strategy Heritable gene targeting in zebrafish using customized TALENs The discovery of zinc fingers and their applications in gene regulation and genome manipulation RNA-guided genetic silencing systems in bacteria and archaea RNA-guided human genome engineering via Cas9 Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease A putative RNA-interference-based immune system in prokaryotes: computational analysis of the predicted enzymatic machinery functional analogies with eukaryotic RNAi and hypothetical mechanisms of action Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria Structures of the RNA-guided surveillance complex from a bacterial immune system Plasma membrane-targeted Raf kinase activates NF-kappaB and human immunodeficiency virus type 1 replication in T lymphocytes Specific HIV-1 TAR RNA loop sequence and functional groups are required for human cyclin T1-Tat-TAR ternary complex formation Multiplex genome engineering using CRISPR/Cas systems Genetic and functional characterization of the LTR of HIV-1 subtypes A and C circulating in India TALEN and CRISPR/Cas-based methods for genome engineering Differential integrity of TALE nuclease genes following adenoviral and lentiviral vector gene transfer into human cells Integrase-independent HIV-1 infection is augmented under conditions of DNA damage and produces a viral reservoir HIV reproducibly establishes a latent infection after acute infection of T cells in vitro Development of a self-inactivating lentivirus vector The importance of and a method for including transfection efficiency into real-time PCR data analyses Quantitative analysis of human immunodeficiency virus type 1 DNA dynamics by real-time PCR: integration efficiency in stimulated and unstimulated peripheral blood mononuclear cells Download references This work was supported in-part by grants from the following: Grant-in-Aid for Young Scientists (B24790438) and Grant-in-Aid for Grant-in-Aid for Scientific Research (B24390112) from Japan Society for the Promotion of Science Scientific Research on Innovative Areas (24115008) from the Ministry of Education Science and Technology and Research on HIV/AIDS from the Ministry of Health and Y.Koyanagi wrote the main manuscript text The authors declare no competing financial interests This work is licensed under a Creative Commons Attribution 3.0 Unported License. To view a copy of this license, visit http://creativecommons.org/licenses/by/3.0/ Download citation Sign up for the Nature Briefing newsletter — what matters in science amazed audiences all season long with his unusual dance moves on America's Got Talent The Season 8 champ also amazed in a post-win phone call today when we asked him about Miley Cyrus "I'm really bad at famous shows or people." When told that her now-famous twerking involves wiggling one's rear around trying to be sexy The charming Ebina grew up in Tokyo and did not aspire to be a dancer "When I was kid I wanted to be a professional baseball player or soccer player I'm not sure of the word -- you go up in space." But he moved to Connecticut when he was 20 and started dancing as a hobby It became a passion and a way to express himself In 2001 he founded a dance group that won the Amateur Night grand championship at the Apollo Theater he has performed and taught at many events around the world who teaches Zumba and physical movement classes to the elderly and their seven-year-old daughter are based in New York come "from all over the place -- other shows he's $1 million richer and will headline the AGT tour He's also 'trying to figure out how it's going to work" with the $1 million I don't know how it works in the United States the final decision-maker will be my wife." Meanwhile he can hardly remember how he felt the moment the confetti fell and he won the AGT crown 'Oh my god.' And then a couple of seconds later He says he really didn't think he would win He thought droll comedian Taylor Williamson or opera trio Forte would snag the crown I was hoping to be third or fourth." He adds it is fair to say that TV talent contests are not exactly everyone’s cup of tea We all know they are often staged and manipulated to promote the act with the most mawkish back story but these programs still have the power to transfix us Despite all their faults we continue to watch hoping to see that performance that takes our breath away like Paul Potts did when he belted out Pavarotti’s classic “Nessun Dorma” on the first season of Britain’s Got Talent At last year’s America’s Got Talent it was a Japanese performer named Kenichi Ebina who stole the show who were gushing in their praise for the pint-sized star he became the first foreign dance act to win it picking up a million dollars in the process—a remarkable achievement for a man who first arrived in the US without any real goals Weekender recently caught up with the 40-year-old at a coffee shop in Omotesando “I wasn’t interested in dancing as a youngster,” he says “I wanted to be an astronaut or sports player: something like that I learned some moves from a friend in high school but it wasn’t something I thought about pursuing until I moved to the States.” I was invited to a party where they had this kind of dance-off Everyone got in a circle; then each person had to come up with a dance I did just the one step—the MC Hammer style running man and people seemed to love it I thought they were cheering because it looked cool: I only later realized that it looked cheesy and they were just laughing at me.” “I’d misunderstood the situation but it had encouraged me to dance taking inspiration from what was around me as well as watching videos to learn new moves Teaching other students and performing at events around the campus it felt like a natural progression to continue with it after my studies.” Ebina earned a living as a dance instructor while supplementing his income by performing at bar mitzvahs He also formed the group BiTriP who went on to become Grand Champions of the Amateur Night at the Apollo which has helped launch the careers of singers like Stevie Wonder and Ella Fitzgerald proved to be an extremely rewarding venue for the Tokyo-born performer who returned there a few years later as a solo artist to once again claim the Grand Champion title at the Showtime at the Apollo contest he started performing at major events such as the Cirque du Soleil the Monaco Grand Prix and the TED Conference He also appeared on numerous TV programs such as Maury Jimmy Fallon and the cartoon Angelina Ballerina as well becoming a regular fixture at the BOX NYC a risqué Moulin-Rouge style burlesque club in Manhattan His routine proved extremely popular among the rich and famous that regularly frequented the club with Simon Cowell and Madonna both booking him for private parties “People were always talking about the big names that would drop by but apart from the megastars like Janet Jackson and Snoop Dogg “One night I was doing my robot routine and as part of the act I pick a member of the audience to revive my battery by pretending to blow on my crotch After the show someone told me it was Kate Moss that I grabbed: I didn’t have a clue who she was!” “I’m really not good at identifying celebrities Meg Ryan and Cameron Diaz both came up and complimented me on my dancing but until they said their names I just assumed they were ordinary members of the public.” Ebina has gone on to become a star in his own right and is now one of the most well-known dancers in America He had actually been invited on the show a few years earlier but couldn’t take part as he didn’t have a green card Once that issue had been sorted he decided to give it another try and quickly emerged as a leading contender following his standout audition his choreographed set became more elaborate: in the Top 60 he used a video backdrop to create multiple versions of himself on a screen to create what looked like a video game who described him as the “best act in the world”—all seemed to fancy his chances of winning was not sure whether that was what he wanted “I went on the show to get myself out there I started thinking it would be great to finish as a runner-up as you get all the praise and recognition without the problems.” “I knew that if I finished first there would be negative feedback and racist comments The million dollars was of course nice and it has certainly helped boost my profile I can now say I’m delighted to have won it even if my performance in the final wasn’t great I actually agreed with [program judge] Mel B’s criticism!” Aside from a few dissenters on social networking sites (including such gems as “How could a man from Japan win it Has everyone forgotten Pearl Harbor?”) Ebina has received mostly supportive messages since his victory he is definitely worth checking out on YouTube And plenty of people have: the video of his original audition currently has more than 31 million views Kenichi Ebina is best known for winning the eighth season of “America’s Got Talent” on September 18 He is a self-taught dancer who began dancing freestyle hip hop and expanded his style to poppin’ Ebina’s unique performance combines illusion with sound On Thursday, March 27, he will illustrate the growing interplay between Asian and American pop cultures for the Wang Center audience at 7 pm in the Theatre Tickets are $35 VIP, $30 general, $20 faculty/staff, $15 seniors and $10 students. Click here to reserve tickets now This even is co-sponsored by Stony Brook University’s Japan Center and website in this browser for the next time I comment Δdocument.getElementById( "ak_js_1" ).setAttribute( "value" This site uses Akismet to reduce spam. Learn how your comment data is processed. and members of the local community took to the field at Stony Brook University's LaValle Stadium for Stony Brook Movie Night on July 16 Stony Brook University’s choral concert this winter provided songs of beauty Asian American and Pacific Islander Heritage Month is celebrated in April at Stony Brook University to recognize the diverse culture of Asian Americans © 2024 Stony Brook University On the 76th anniversary of the Great Tokyo Air Raid essayist Kayoko Ebina received a surprising letter that touched a chord in her The letter came from a senior official at the U.S thanking her for arranging an annual gathering to remember victims of the firebombing attack sent the letter to Ebina as a personal message “Thank you for the opportunity to join you in solemn remembrance of all the victims who were lost over the course of the Second World War,” the letter read “This letter is written to many people who were orphaned from the air raid Ebina lost six family members in the massive air raid of March 10 which left the capital in flames and ashes An estimated 100,000 people died in the attack She had evacuated to her aunt’s home in Shizuoka Prefecture at the time of the bombing she climbed a nearby mountain while an air raid siren blared brought his sister the bad news: the rest of their family--their grandmother parents and three brothers--all perished in the attack Ebina said she stayed at her relatives and acquaintances after the air raid She couldn’t attend much of her classes in junior high school and sometimes was forced to eat weeds to ease her hunger pains she didn’t know where she could obtain certificates verifying that she was a survivor of the bombing and a bereaved family member of those who died in the air raid She said she has never received an invitation to an annual memorial service for victims of the bombing held by the Tokyo metropolitan government because she has yet to be officially recognized as a bereaved family member Ebina married the rakugo storyteller Hayashiya Sanpei I (1925-1980) and their children included Hayashiya Shozo IX and Hayashiya Sanpei II She has been sharing her experience of the Tokyo air raid in such books as “Ushiro no Shomen Dare” (Who’s Left Behind?) and at lectures Ebina began holding a gathering to remember the victims of the air raid and pray for peace in front of a memorial monument and a statue of a mother and children she erected in Tokyo’s Ueno district The number of participants of the annual gathering has risen each year Embassy in Tokyo visited Ebina’s home on March 8 when she was preparing for this year’s gathering An envelope the staff handed her contained two sheets of a letter from Young one written in Japanese and the other in English In addition to thanking Ebina for her activities Young touched on the “enduring friendship” between the people of Japan and the United States Ebina said she used to hate the United States but the bitterness left her following her visit to Pearl Harbor where Japan staged a sneak attack on the U.S She saw books of the 1945 atomic bombing of Hiroshima on sale there making her realize that both victims and attackers were suffering She also said she wants to continue telling people of the cruelty of war by sharing her experience of the Tokyo air raid Unlike members of the former Imperial Japanese Army civilian victims of the bombing are not eligible for compensation from the Japanese government Support for orphans of the air raid is also insufficient “We can feel much relief if the government expresses appreciation for the pain we had to endure,” Ebina said in disappointment Osaka museum to list Korean air raid victims by ethnic names Researcher fights for Nagasaki to create archives of A-bomb attack Wartime airfield in Hyogo hands down area’s tragic history War victims still pushing for compensation 75 years after WWII Woman captured as a girl in iconic A-bomb photo dies at age 90 air raid shows scale of attack on Shuri-jo castle Copyright © The Asahi Shimbun Company. All rights reserved. No reproduction or republication without written permission. But the win was a surprise to one person — Ebina himself. The brand new millionaire (and soon-to-be headliner on the Vegas Strip) stopped by TODAY Thursday and explained his shock. "Nooooooo!" That was Ebina's reaction when asked if he really thought he'd nab top honors on the show. "Honestly, I thought I would end up with third or fourth. So when I got into the top two, I was like, 'Oh! What am I going to do?'" Win, as it turned out — which now seems like an even more impressive feat considering the fact that Ebina had very little chance to sleep in the days before his final performances. "I'm always thinking, 'What (will) I do?' Thinking about the routine — how I put the show together?" the dancer said of how he spent the last couple of weeks. Now that pressure is behind him, the only moves he has to worry about are the ones he'll take to Vegas. Please enable JS and disable any ad blocker The end is nigh on "America's Got Talent." On Tuesday night the six remaining acts had one last chance to show viewers why they deserve the $1 million prize and a gig on the Las Vegas Strip — and they did it by going back to the beginning Forte and Kenichi Ebina revisited and retweaked their earlier performances for their final faceoff The winner? Well, that's yet to be determined, but it's safe to say Ebina — once again — stole the show complete with the usual seemingly impossible contortions and the new addition of lasers earned him a following in the audition rounds and it had the audience cheering again Tuesday Tenor troupe Forte delivered an encore of "The Prayer," the first song they performed together in their current line up — on "Talent" or anywhere else — that had the crowd out of their seats So will it be Forte or Ebina? Or one of the others? Judge Mel B stopped by TODAY on Tuesday and threw her support behind Forte. But when Howie Mandel paid a visit on Wednesday, he was split between Ebina and another. But Mandel spread the praise around. No, not to the other acts — to himself and his fellow judges. "I think we are one of the most brilliant panels in all of television," he said with a laugh. "I'm telling you that people should aspire to be us." See that panel in action and find out whose talent is enough to take top honors when the second part of the "America's Got Talent" season finale airs Wednesday night at 9 p.m. on NBC. Apple logo® and App Store® are registered trademarks of Apple Inc 19 (UPI) -- Dancer Kenechi Ebina was crowned the Season 8 winner on "America's Got Talent" in New York He won $1 million and the opportunity to headline a show in Las Vegas Examination of Japanese cases of gynecological cancer offers a better understanding of the profile of a rare ovarian tumor and could change treatment guidelines Ovarian granulosa cell tumors are a rare type of ovarian cancer that affect the ovaries and fallopian tubes and can extend further into the pelvis and lymph nodes Treatment typically follows the same guidelines as other ovarian cancers and often sees the lymph nodes removed via surgery Researchers at Hokkaido University and colleagues have analyzed the disease and treatment of hundreds of women with ovarian granulosa cell tumors and say more invasive surgery could be avoided in some cases published in the journal Gynecologic Oncology improve understanding of how the disease progresses and responds to therapy “Our main objective with this study was to improve understanding of the clinical pathological and prognostic features of ovarian granulosa cell tumors,” says Hokkaido University gynecological oncologist Yasuhiko Ebina Ebina and a team of scientists from several Japanese universities accessed the Gynecological Tumor Registry of the Japan Society of Obstetrics and Gynecology They examined the data of 1,426 patients in the registry who were diagnosed with ovarian granulosa cell tumors between 2002 and 2015 This study represents analysis of the second largest sample size of ovarian granulosa cell tumors in the scientific literature and is the largest such cohort study in Asia They found that just under 2% of the women in the registry were diagnosed with this specific cancer microscopic examination of surgically removed lymph node tissue showed that early-stage tumors only rarely spread beyond the ovaries and fallopian tubes The team found a worse prognosis for patients with cancers that had spread beyond the ovaries and tubes Those whose tumors were incompletely removed during surgery also had worse five-year survival rates They also found that surgery in patients under 50 designed to protect fertility typically by removing only an early-stage tumor or the affected ovary and tube This suggests that fertility-sparing surgery could be considered for more women in the early stages of the disease “Our findings have led us to conclude that lymph node dissection can be omitted if the surgeon finds the tumor limited to the ovarian and fallopian tube tissue following a thorough exploration of the abdominal cavity,” says Ebina as much of the tumor should be removed as possible to ensure that residual tissue is not left behind at the end of the initial surgery.” 10.1016/j.ygyno.2021.08.012 Clinicopathological characteristics and prognostic factors of ovarian granulosa cell tumors: A JSGO-JSOG joint study are not responsible for the accuracy of news releases posted to EurekAlert by contributing institutions or for the use of any information through the EurekAlert system Copyright © 2025 by the American Association for the Advancement of Science (AAAS) Dancer and illusionist Kenichi Ebina walked away with the big prize after Wednesday night's finale of the eight season of "America's Got Talent." "This is why 'America's Got Talent' is great: We discovered a superstar," said judge Howard Stern who taught himself to play guitar while deployed in Iraq 17-year-old magician Collins Key and singer Cami Bradley The mayor of a town in northeastern Japan said Wednesday he has called on the U.S military to suspend operations by F-16 fighter jets stationed at Misawa Air Base after one of them dumped fuel tanks in a lake in the town following an engine fire Tohoku town Mayor Koji Ebina made the request during a meeting with Col after the F-16 jettisoned its two external fuel tanks into Lake Ogawara in Aomori Prefecture One wrong step could result in a catastrophe," Ebina told reporters on Wednesday Local fishermen said the tanks dropped between 200 and 400 meters away from clam boats The F-16 fighter developed the engine fire on Tuesday morning and jettisoned the fuel tanks before returning safely to base But the dumped fuel tanks created oil slicks in the lake and sparked safety concerns among locals the local fishery association decided to totally halt fishing in the lake until the fuel oil is cleaned up The town also decided Wednesday to demand the central government pay compensation for the losses incurred by the suspension of fishing and examine measures to protect their lives "We will do our best to acquire compensation as soon as the amount of the damages and fishing suspension days are determined," the mayor said secretary general of Prime Minister Shinzo Abe's Liberal Democratic Party Nikai's counterpart in the ruling coalition partner Komeito agreed to urge the government to take measures Chief Cabinet Secretary Yoshihide Suga expressed the government's readiness to comply with the request we will investigate the actual conditions and deal with the matter appropriately." The latest case "has caused great fear to the people of the local fishery association and should not have taken place We will provide relevant municipalities with any new information we get," the top government spokesman said The fuel tank incident followed a series of mishaps and accidents involving U.S mostly in the southern prefecture of Okinawa U.S. fighter jet dumps fuel tanks into lake after engine fire Part from U.S. military Osprey falls off, found in Okinawa A transoceanic collaboration recorded at the height of lockdown bears subtle Our relationship with nature is complicated We’ve spent thousands of years bending it to our will while consigning it to the periphery yet there when we need it to power our phones and computers and lifestyles the new EP by ambient artists Kin Leonn and Hiroshi Ebina This theme of urban alienation is nothing new But what is foreign for most of us is the extra pressure we’ve had to face in the form of a pandemic and the isolation and detachment – from one another and from nature – that has characterised our experience of it The duo – Leonn is from Singapore and Ebina from Japan – recorded ‘Faraway Vicinity’ at the height of the pandemic The EP was written on the inside looking out as observers of the natural world from an enforced distance It offers 16 minutes of subtle ambience that’s defined by a central paradox: a yearning to return to nature while acknowledging the impossibility of that notion acoustic instruments and found objects are processed through Leonn’s software effects and Ebina’s Eurorack modules their synthesisers attempt to emulate sounds of the natural world: synthetic foliage rustles in the wind and pads swell like waves lapping on the beach But what the EP lacks in originality the artists make up for in execution: the pair have a delicate touch and their processed recordings and synthetic re-creations never jump the shark into new-age kitsch Understated charm is the order of the day here Be it the rainforest field recordings and ominous synth of opener ‘Forest Future’ or the sun-drenched fields birdsong and melancholia of closer ‘Leaving Home For The Fields’ Leonn and Ebina deftly manipulate and create sounds and the duo place each element precisely where it needs to be They get their point across in delicate but effective ways building sonic worlds without ever calling attention to the process itself Third track ‘A Secluded Channel’ is the best of the four on the EP Chimes and percussion flitter in the upper midrange and the sound of the ocean floats in from across some unknown distance You can almost feel the wind in your hair and the salt in your nostrils – it’s a soothing like the sonic equivalent of sci-fi manga Yokohama Kaidashi Kikou’s verdant post-apocalypse emotional synth lead that’s perhaps slightly too much in the context of such reserved music ‘Faraway Vicinity’ is an intentionally self-effacing EP happy for the listener to put it on as background music for moments of contemplation and these short sketches open up to reveal entire miniature worlds of their own constructed by two musicians with a fine ear for detail and a keen reverence for the subject matter While it may not be quite substantial or memorable enough to be hailed as a classic ‘Faraway Vicinity’ has a lot to offer for both fans of ambient music and anyone that simply needs a bit of a break – which The world’s defining voice in music and pop culture: breaking what’s new and what’s next since 1952 Dazzling dancer Kenichi Ebina was hardly making a living last year but that's all changed after capturing the grand prize of 1 million dollars on season 8 of "America's Got Talent" on NBC who mesmerized America with his unbelievable body twists and robotic choreography beat out five impressive finalists: sultry singer Cami Bradley country singer Jimmy Rose and comedian Taylor Williamson Dazzling dancer Kenichi Ebina was hardly making a living last year, performing in a Japanese troupe, but that's all changed after capturing the grand prize of 1 million dollars on season 8 of \"America's Got Talent\" on NBC, Wednesday night.\nRead More * Information contained in this news release is current as of its date of announcement Be aware that information contained herein is subject to change without notice a leading global real estate company headquartered in Tokyo announced that it began construction on Mitsui Fudosan Logistics Park Ebina I (“MFLP Ebina I”) in Ebina City Construction is scheduled to be completed in September 2022 As the industry’s first green energy logistics center*2 MFLP Ebina I is expected to acquire ZEB certification*3 The roof will have a photovoltaic power system with capacity of approximately 2,000 kilowatts and annual output of around 2.2 million kilowatts to provide on-site power generation and supply A green energy supply service*4 will also be offered to make it possible to use renewable energy for 100% of the electricity used at the facility which will help tenant companies address the RE100 and ESG issues they face energy efficiency measures will be employed including desiccant air conditioning systems and geothermal heat pumps which will reduce carbon dioxide emissions from primary energy consumption by 50% or more*5 A rainwater reservoir and greenbelt will be established as green infrastructure*6 in the buffer zone between the adjacent Ebina Sports Park in order to harmonize as much as possible with the surrounding environment Rendering of the green infrastructure of MFLP Ebina I MFLP Ebina I is next to the Ebina IC on the Ken-O Expressway boasting outstanding access to major areas in the Tokyo metropolitan area an excellent location for a logistics center it is an 11-minute walk from Atsugi Station on the JR Sagami Line and Odakyu Odawara Line a location excellent for commuting convenience and advantageous for recruiting human resources an exit on the automobiles-only prefectural road will be created to increase the safety of area transportation and alleviate traffic congestion the plan is to accommodate autonomous driving trucks and vehicle platooning The exterior design of the facility has a façade abstracted from an organic pattern out of respect for nature based on the concept of “organic flow.” It uses wooden louvers that cause the appearance to change moment by moment with the sunlight and the changing seasons The offices on the eastern side of the building are layered with high ceilings and greened balconies to provide highly pleasant workplaces the Mitsui Fudosan Group owns and manages approximately 5,000 hectares of forestland in 31 cities and towns primarily in the northern part of Hokkaido and wood products made from trees harvested at appropriate times and thinnings from forest maintenance are actively used in the finishings and furniture in the property’s entrance and lounge and employs an environmentally friendly design COVID-19 measures include body temperature cameras and disinfectant at entrances as well as non-contact security gates and elevators On the top floor of the facility there is a lounge with panoramic views of the Tanzawa Mountains and Mt Fuji across the Sagami River where people working at the facility can comfortably spend time and a high foundation for potential flooding which allow tenant companies to securely use the facility even in emergencies Rendering of lounge interiors using forest thinnings .st1{fill-rule:evenodd;clip-rule:evenodd;fill:#2a2a2a}By Len Melisurgo | NJ Advance Media for NJ.comA few months ago Kenichi Ebina was an amateur dancer performing with a Japanese dance troupe Tonight he is a rising star and $1 million richer after capturing the crown on season 8 of "America's Got Talent." Kenichi — who dazzled America with his robotic moves and creative choreography — earned the most votes in this popular nationwide talent competition Dazzling dancer Kenichi Ebina was named the winner of season 8 of "America's Got Talent." announced on NBC tonight at the conclusion of a two-hour season finale at Radio City Music Hall spelled defeat for five impressive finalists: Sultry singer Cami Bradley country singer Jimmy Rose and awkward comedian Taylor Williamson Kenichi graced the AGT stage with his crisp and unique free-style dances some in which he would move in sync or interact with background dancers shown on a large screen behind him Those background dancers were actually Kenichi in pre-recorded segments and somehow he found a way to blend the video clips together and almost flawlessly move in unison with the guys on the screen Kenichi also wowed the nation with some incredible body twists and scary head maneuvers The show's judges - and America - clearly loved this guy (Check out two of Kenichi's best performances of the season in these YouTube videos.) One of these six finalists will be crowned the winner of season 8 of 'America's Got Talent' Wednesday night on NBC we gave all you AGT fans out there a chance to weigh in on predictions for the finale Our readers overwhelmingly went for Kenichi Our question: Who will win 'America's Got Talent' tonight 43% (3,092 votes)Forte ......................... 16% (1,152 votes)Cami Bradley ........... 11% (806 votes)Collins Key ................ In case anyone is wondering the exact order of the finishers here's how it was announced on the season finale: Use of and/or registration on any portion of this site constitutes acceptance of our User Agreement, (updated 8/1/2024) and acknowledgement of our Privacy Policy, and Your Privacy Choices and Rights (updated 1/1/2025) © 2025 Advance Local Media LLC. All rights reserved (About Us) The material on this site may not be reproduced except with the prior written permission of Advance Local Community Rules apply to all content you upload or otherwise submit to this site YouTube's privacy policy is available here and YouTube's terms of service is available here Ad Choices \n m_gallery = \"americas_got_talent_2013_finals\";\n m_gallery_id = \"13430668\";\n m_gallery_title = \"America\\'s Got Talent 2013 Finals\";\n m_gallery_blog_id = \"4504\";\n m_gallery_creation_date = \"Wednesday 10:01 AM\";\n m_gallery_permalink = \"http://photos.nj.com/4504/gallery/americas_got_talent_2013_finals/index.html\";\n m_gallery_json = \"https://blog.nj.com/photogallery/4504/13430668.json\";\n m_gallery_pagetype = \"embed\";\n m_gallery_type = \"photo\";\n <\/script>\n Spoiler Alert: Do not continue reading if you don't want to know who won America's Got Talent No complaining about spoilers in the comments Collins Key and Jimmy Rose were the final six acts left standing in the NBC reality hit's Sept filled with performances by country star Luke Bryan Kenichi was crowned the winner of season eight "It's amazing," Kenichi said after his win "I want to thank my wife and my daughter [for] being supportive all the way through and all the fans that support us." VIDEO: The AGT cast reacts to Simon Cowell's baby news! Coming in second place was Taylor Williamson and 32-year-old singer and marine vet Jimmy Rose came in third while teen magician Collins Key and singer Cami Bradley came in fifth and six places Judge Howard Stern was happy to see the dancer win telling SiriuxSM's "AGT All Access" show that Kenichi should win hours before the finale "I really do think Kenichi really deserves to win and for two reasons he deserves to win," he said he creates [his own material]...with singers who sing other people's songs As for whether or not he'll return for season nine "They've asked me to come back already and I really have to think it through and just think about what impact that has," he explained "It's a lot of traveling and a lot of hours pulling [it all] together so I don't know But I do love the show; I really think I would miss it if I didn't do it." and NBC are both part of the NBCUniversal family.) PHOTOS: Check out these AGT OMG moments! will open Mitsui Shopping Park LaLaport EBINA on Thursday it will be a regional shopping center featuring direct train station access Back to index of News Releases in 2015 Print (2.1MB) Top of Page News Releases Global Initiatives ESG / Sustainability Investors Ebina ranked first in a character popularity poll on Nico Nico Seiga. The results of the poll went up on Monday to accompany the announcement of the spinoff manga. Rounding out the top ten are, in order: Kirie The sibling gag comedy manga centers around Umaru Taihei's little sister who boasts beautiful looks as well as prowess in both school and sports "Himōto" is a pun on "imōto" (little sister) and "himono," which means "dried fish," but in slang can refer to a woman who is proper in public but lazy at home Sankaku Head launched the manga in Weekly Young Jump in 2013 (after running an earlier two-chapter Himōto! Umaru-chan! version in Miracle Jump in 2012), and Shueisha published the seventh compiled book volume on Monday The anime adaptation premiered on July 8 and Crunchyroll streamed the series as it aired. Sentai Filmworks licensed the series Whoever said it's better to travel than to arrive must have been traveling in Japan Just ask the folks who hit the road earlier this month for the o-Bon summer holidays the nightly newscasts were filled with horror stories of bumper-to-bumper traffic but motorists and their families knew that relief lay as close as the next rest area refresh — and finally let the kids out of the car expressway pit stops have become destinations in their own right as operators have transformed the plazas — known as SA (service areas) or PA (parking areas) — into mall-like venues the nationwide infatuation with local cooking known as B-kyū gourmet (B-grade cuisine) has led motorists to stop by for a taste of authentic regional dishes Here are some notable rest areas within easy reach of Tokyo where travelers can fill up both their gas tanks and their stomachs.googletag.cmd.push(function() { googletag.display('div-gpt-ad-1499653692894-0'); }); Sponsored contents planned and edited by JT Media Enterprise Division.