"none"); */ } $("document").ready(function($) { let url = window.location.pathname; let nav_home = $('.only-home'); if (url != '/' && url != '/#') nav_home.removeClass("row"); }); $("document").ready(function($) { let url = window.location.pathname; let nav_home = $('.only-home'); let nav_home2 = $('.only-home2'); let nav = $('.without-home'); if (url != '') { $(window).bind('scroll load resize' "@id": "https://www.theworldfolio.com//interviews/maruhachi-muramatsu-expands-dashis-horizons/6721/" } "headline": "Maruhachi Muramatsu Expands Dashi’s Horizons" a traditional Japanese stock and adapting it for modern dishes Maruhachi Muramatsu is enhancing the taste and improving the healthiness of dishes in both Japan and abroad Can you please introduce yourself and tell us about your company the fifth-generation president of Maruhachi Muramatsu Our company was founded in 1868 and have specialized in dashi (Japanese soup stock) crafted from seafood-based ingredients like katsuobushi (dried bonito) we have been primarily engaged in B2B business growing alongside the development and expansion of the food industry we will continue to expand our business globally that delivers “deliciousness and peace of mind” to people around the world we’ve seen Japanese food-related exports increase This has been consolidated overseas by the growing popularity of Japanese restaurants which grew from 55,000 in 2013 to more than 200,000 today How do you account for this substantial rise in Japanese food exports Why is now the time for washoku to shine internationally But there’s more to it—three key factors truly set it apart perfectly balanced with delicate and harmonious flavors it’s celebrated for being low in calories while providing excellent nutritional balance tourists who experience Japanese food during their visit often seek it out once they return home Our dashi products have flourished in step with the global rise of Japanese dining culture The government is trying to push food-related exports even further with very ambitious targets of JPY 5 trillion worth of exports by 2030 being set are these targets achievable in that time frame what are some of the opportunities that these targets provide your firm health-promoting seafood and superfoods like matcha as well as functional and health-focused foods achieving the 5 trillion yen market goal feels entirely within reach this is an exciting opportunity to introduce the wonders of dashi to the world A key factor driving this potential is the global rise in diabetes often linked to obesity caused by excessive calorie consumption Diabetes contributes to numerous health issues emphasizing the need for dietary improvements By incorporating katsuobushi or kombu-based dashi into not only Japanese cuisine but also Western and international dishes sugar and salt usage can be reduced without sacrificing delicious flavor With its unique ability to enhance natural tastes dashi serves as a powerful ingredient for creating healthier Japan is expecting 27 million inbound tourists by the end of 2024 While other Asian nations are aware of Japanese food and really enjoy it Have you noticed any changes in this during this recent post-COVID tourism boom Will inbound tourism be the key to achieving the JPY 5 trillion target The appreciation of Japanese cuisine is growing globally with Japanese restaurants flourishing across the United States and Europe We sell dashi and plant-based ramen soups to these restaurants and our sales have been steadily increasing many professional chefs are already well-acquainted with dashi and we are eager to see its recognition expand further among the general public the Culinary Institute of America’s Napa Valley branch hosted the Worlds of Flavor International Conference and Festival Japan This event brought together 30 to 40 Japanese chefs and provided an exceptional platform for Japanese manufacturers to showcase products like soy sauce and dashi we believe in the equal importance of steady grassroots efforts to promote and sell our products Just like the major soy sauce manufacturers we remain dedicated to consistently advancing the reach of dashi through hard work and perseverance they spoke about the importance of getting French or American chefs to create recipes that match the local market but use Japanese ingredients Is this something that interests your company in terms of your dashi To encourage the use of traditional Japanese seasonings like miso overseas it’s crucial to adapt recipes to align with each country’s unique food culture as Marukome has demonstrated so effectively catering to dietary preferences and religious practices is vital Dashi made from kombu or shiitake mushrooms is incredibly versatile and can be embraced by people all around the world We are also actively exploring new ingredients to develop innovative dashi varieties While dashi is commonly used in savory dishes katsuobushi or kombu dashi can elevate the flavor of sweet red bean paste (anko) and kombu dashi adds incredible depth to risotto I had the chance to enjoy miso soup made with shiitake mushroom dashi—it was remarkably delicious As global palates become more diverse and menus expand I am confident this will lead to further market growth and exciting opportunities | | | Previous Next Japan faces some serious issues with its aging and declining population efforts abroad are now being hindered by China’s blanket ban on the import of seafood China accounted for 22% of seafood exports in 2022 which are the key overseas markets for your products that you are looking to target China undeniably wields immense purchasing power It’s essential for us to prioritize markets with strong purchasing capacity we are preparing to expand into Southeast Asia and explore opportunities in Africa and South America we must carefully evaluate legal risks and determine whether we have the capabilities to succeed in these markets I’ve seen major seasoning manufacturers enter the African market by offering products in small affordable portions and educating local consumers on their use our limited overseas staff makes it challenging to implement at present we plan to partner with local companies or continue focusing on high-purchasing-power markets for now Many of our clients are global food processors who purchase our dashi and distribute them in markets like the United States and Southeast Asia Although we don’t yet have our own overseas sales bases this segment continues to show promising growth We saw that your company’s research not only covers the culinary industry but also the biopharmaceutical industry what are some of the specific products that you are developing for the biopharmaceutical industry Chinese hamster ovary cells are cultured to create specific substances and katsuo extracts are used as yield-improving additives in this process we are deeply involved in researching and producing functional materials for health foods and swallowing disorders demand innovative approaches and actively participating in academic conferences we will conduct clinical trials focused on the elderly striving to contribute to society with products that promote longer So much of the food we are consuming these days is flavored with artificial or processed flavors such as MSG is really focused on natural foods and natural ingredients that bring taste to the forefront What are the advantages of your natural flavors over these artificial or processed ones in terms of taste Our products are founded on natural resources like seafood which form the basis of seasonings rich in diverse flavor and aroma compounds These elements combine to create a complex and enjoyable sensory experience we have honed techniques to maximize the potential of these ingredients while continuously developing innovative applications to meet our customers’ needs are highly cost-effective and deliver impactful results By skillfully utilizing the strengths of both we ensure we fulfill the diverse demands of our customers major chain restaurants use a central kitchen to distribute all of their dishes Is your dashi something that can work overseas where they don’t work on a central kitchen model For restaurants and facilities that require authentic dashi Many in the industry face challenges such as labor shortages and the need to reduce working hours While preparing dashi traditionally was once standard it has become increasingly difficult to manage It is a high-pressure extracted dashi filled into Tetra Gemina® Aseptic Packages enabling any establishment to create authentic dashi in just 10 seconds eliminating waste and the need to discard unused dashi traditional dashi preparation often generates leftover residue which requires additional disposal effort—an issue entirely avoided with Handy Broth Handy Broth is widely used across washoku restaurants Its versatility also makes it a great addition to Western and ethnic cuisines enhancing the natural flavors of each dish's ingredients Your company recently engaged in M&A activities to acquire Higuchi kaisan（樋口海産） and AmakusaSeafoods（天草シーフーズ） Why did you choose these two food acquisitions is this an area you wish to continue expanding in The company we acquired specializes in producing roasted flying fish (yakia-go) and dried sardines (niboshi) with exceptional strength in raw material procurement Climate change is altering sea temperatures leading to shifts in the types of fish available and the decline of certain species Enhancing our raw material procurement capabilities is vital and we will continue to explore acquisitions of upstream companies with expertise in seafood sourcing We are also keenly interested in companies with advanced processing technologies We have received a proposal from a kombu processing company in Hokkaido to join our group We will further strengthen our efforts related to kombu a number of food-related companies are looking to plant-based foods as a way of achieving their SDGs while offering customers healthy alternatives We’ve seen that your business is no different With declining fish stocks and the global rise in vegetarianism we are focused on developing dashi using non-seafood ingredients kombu remains an essential dashi ingredient but rising sea temperatures have led to a yearly decline in kombu harvests Strengthening our kombu sourcing and product development is a priority and we dream of introducing both kombu and katsuobushi dashi to gourmets around the globe non-seafood dashi like kombu and shiitake mushrooms have long been a staple We are advancing research into these resources while also exploring agricultural ingredients With our expertise in producing seasonings from agricultural products we also handle several contract manufacturing projects in this area These plant-based seasonings cater to diverse religious dietary needs and we are committed to furthering their development we collaborate with a partner company in Indonesia that holds halal certification and we are exploring joint product development initiatives to strengthen our offerings A majority of your business is currently B2B Do you plan to develop any direct B2C products in the future we have also established a modest presence in B2C markets selling through department stores and select shops The feedback and requests we receive directly from consumers are invaluable offering insights that we actively incorporate into the development of our B2B products Imagine that we come back on the very last day of your presidency and have this interview all over again What goals or dreams do you hope to achieve by the time we come back for that new interview The transition to the next generation of leadership is not far off my primary objective is to reorganize our group’s manufacturing facilities I aim to complete the restructuring of our equipment to produce health-functional materials and seasonings using new technologies we can build a production system capable of serving diverse prospective customers worldwide delivering even greater flavor and health benefits across the globe Fish and agricultural products often generate significant waste including unused scraps or produce undervalued due to imperfections we strive to transform these materials into high-value products I hope to focus on contributing to the local community My vision includes renovating our old warehouses and offices to create spaces for chefs and artists aiming to foster a vibrant and lively community To read more about Maruhachi Muramatsu, check out this article about them For more information, please visit their website at: https://www.08m.co.jp/ To read more about Maruhachi Muramatsu, check out this article about them For more information, please visit their website at: https://www.08m.co.jp/ The Worldfolio provides business, industrial and financial news about global economies, with a focus on understanding them from within. Dior’s creative and image director of makeup gives Vogue an exclusive look into the models’ makeup for the historic show Photo: Kyoko MuramatsuWe aimed for a very pure natural finish and used different nuances of pink in the makeup to match the skin tones of the various models we used a soft pastel pink blush as eyeshadow—to give a watercolour-like effect a deep Bordeaux color imitated the deep color of a flower in bloom as if the color had been blended with water Photo: Kyoko MuramatsuThe pink eye is inspired by Japanese cherry blossoms the blush color is placed under the eye and blended out to create a natural I made it look more free and bold—as if it were at one with the skin Photo: Kyoko MuramatsuI used a brown waterproof liner—not to outline the eyes, but to deepen the shadows. To do this, I placed the ink a little further away from the corner of the eye, as if I were extending the shadow created by the eyelid. Brown mascara is lightly applied to the outer corner lashes only and I chose the color because it blends naturally with the eye Photo: Kyoko MuramatsuWe actually only had light communication, actually: “Here’s what’s going to happen next.” Normally, the show is held first, followed by the look, and then campaign shoots, but this time we did the opposite. The look and campaign shoots were already completed before the show. Because I knew the show would be held in Japan in the spring I naturally thought of cherry blossoms and pink This content can also be viewed on the site it originates from The Naked Manicure Trend Will Be Everywhere This Spring Victoria Beckham Takes Beauty Inspo From the Olsens 2025’s Trending Eyeliner Flatters Those in Their 20s and 70s Alike Sign up for Vogue’s beauty newsletter to receive the insider’s guide to all things beauty and wellness Never miss a Vogue moment and get unlimited digital access for just $2 $1 per month Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease characterized by the white matter degeneration. Although changes in blood lipids are involved in the pathogenesis of neurological diseases, the pathological role of blood lipids in ALS remains unclear. These results suggested that the reduction of FFAs in the plasma is a pathogenic biomarker for ALS in the early stages, and supplying a deficiency in FFAs is a potential therapeutic approach for ALS by preventing oligodendrocyte cell death. Volume 17 - 2023 | https://doi.org/10.3389/fncel.2023.1081190 This article is part of the Research TopicOligodendrocytes: From Their Development to Function and DysfunctionView all 10 articles Introduction: Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease characterized by the white matter degeneration Although changes in blood lipids are involved in the pathogenesis of neurological diseases the pathological role of blood lipids in ALS remains unclear Methods and results: We performed lipidome analysis on the plasma of ALS model mice mutant superoxide dismutase 1 (SOD1G93A) mice and found that the concentration of free fatty acids (FFAs) including oleic acid (OA) and linoleic acid (LA) An in vitro study revealed that OA and LA directly inhibited glutamate-induced oligodendrocytes cell death via free fatty acid receptor 1 (FFAR1) A cocktail containing OA/LA suppressed oligodendrocyte cell death in the spinal cord of SOD1G93A mice Discussion: These results suggested that the reduction of FFAs in the plasma is a pathogenic biomarker for ALS in the early stages and supplying a deficiency in FFAs is a potential therapeutic approach for ALS by preventing oligodendrocyte cell death global changes in systemic lipid metabolites at the early stages of ALS progression and their links to CNS pathogenesis remain unclear we hypothesized that alterations in circulating lipids in ALS may affect oligodendrocyte function thereby mediating the early pathogenesis of ALS we conducted a non-targeted lipidomic analysis of circulating lipids in the plasma of SOD1G93A mice and found a robust decrease in subsets of FFAs In primary cultured murine oligodendrocytes OA/LA inhibited excitotoxic oligodendrocyte death through FFAR1 Systemic LA/OA administration before disease onset ameliorated OL and MN deaths in SOD1G93A mice All experimental procedures were approved by the Committee on the Ethics of Animal Experiments of the National Institutes of Neuroscience National Center of Neurology and Psychiatry (2021013R2) Postnatal day 1 (P1) C57BL/6J mice were obtained from Tokyo Laboratory Animals Science that is express a G93A mutant form of human SOD1 were obtained from Jackson Laboratory (#002726) and heterozygous (SOD1G93A) males were bred with wild-type (WT) female C57BL/6J mice (Japan SLC) Offspring were ear punched and genotyped using PCR with following primers: Human/Mouse Sod1 forward CAGCAGTCACATTGCCCARGTCTCCAACATG; Human Sod1 reverse CCAAGATGCTTAACTCTTGTAATCAATGGC; Mouse Sod1 reverse Mice not expressing the transgene were used as WT littermate controls Mice were housed in an air-conditioned room at 22°C with a 12-h light–dark cycle The mice were fed standard chow diets (CE-2 CLEA Japan) and water under ad libitum conditions Female SOD1G93A mice were intraperitoneally administered with linoleic acid-oleic acid-albumin (10.6 mg/kg Sigma-Aldrich) or bovine serum albumin (BSA; 1.25 g/kg Sigma-Aldrich) twice a week between P60 and P100 Cardiac blood was collected via cardiac puncture from P60 mixed with one-hundredth of 1.3% ethylenediaminetetraacetic acid-2K/0.9% saline and centrifuged at 1,200 rpm for 15 min at 4°C The supernatant was collected as plasma and stored at -80°C until using Untargeted and unbiased lipidomic analysis were conducted at Human Metabolome Technologies Inc Primary cultures of oligodendrocytes were obtained from mice at P1 as previously described (Hamaguchi et al., 2019) The forebrains were dissected and minced with fine scissors in ice-cold phosphate-buffered saline (PBS) The minced tissues were dissociated with 0.25% trypsin (15090–046 After neutralization with Dulbecco’s modified Eagle’s medium (DMEM; 12800082 Thermo Fisher Scientific) containing 10% fetal bovine serum (FBS; F7524 cells were centrifuged at 1,500 rpm for 10 min and filtered through a 70 μm nylon cell strainer Cells were then plated on poly-L-lysine (PLL; P2636 Sigma-Aldrich)-coated 10-cm dishes at a density of 5 × 105 cells/dish and maintained at 37°C with 5% CO2 in 10% FBS-DMEM cells were washed with PBS and the remaining cells were treated with 0.05% Trypsin-PBS at 37°C for 3 min The detached cells were filtered through a 40 μm nylon cell strainer and plated into non-coated dishes and incubated at 37°C for 30 min the non-adherent cells were collected and plated into PLL-coated 96 well glass-bottom plate (5866-960 IWAKI) at a density of 5 × 104 cells/well in culture medium consisting of DMEM/Nutrient Mixture F-12 Ham medium (DMEM/F12; D0547 USA) supplemented with 1 mM sodium pyruvate (S8636 10 ng/ml platelet-derived growth factor-AA (315-17 and 10 ng/ml basic fibroblast growth factor (450-33 For the purification of oligodendrocytes progenitor cells (OPCs) detached cells were treated with CD140a (PDGFRα) Microbead kit (130-101-547 Germany) and the OPCs were plated onto PLL-coated 96-well glass plate at a density of 5.0 × 104/well in culture medium We confirmed that 90.26 ± 0.93% of cells in the culture were labeled by Olig2 using immunocytochemical analysis (data not shown) and dead cells were stained with 1 μg/mL Propidium Iodide (PI; 169-26281 Cells were fixed with 4% paraformaldehyde (PFA Germany) in PBS at room temperature for 30 min followed by permeabilization and blocking with blocking solution (0.1% Triton X-100 and 3% BSA in PBS) for 1 h at room temperature the cells were incubated with the primary antibody rat anti-myelin basic protein (MBP) antibody (AB7349 and rabbit anti-Cleaved caspase-3 (CC3; #9661 USA) at 1:1000 dilution in the blocking solution overnight at 4°C Primary antibody was detected by the Alexa Fluor 488-conjugated donkey antibody against rat IgG (Thermo Fisher Scientific) diluted with blocking solution at 1:500 Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI Images were acquired using a confocal laser-scanning microscopy (FV3000 Japan) with a 20×/0.75 objective lens the percentage of PI+ MBP+ cells in MBP+ cells were calculated from more than 50 MBP+ cells using ImageJ software (National institute of health) total RNA was isolated from cultured oligodendrocytes using the TRIzol reagent (10296010 cDNA was synthesized using the High-Capacity cDNA Reverse Transcriptase Kit (4368814 Real-time qRT-PCR was performed using KAPA SYBR Fast Master Mix (7959397001 USA) with the following primer pairs: Ffar1 forward PCR conditions included one cycle at 95°C for 30 s followed by 39 cycles of 95°C for 5 s and 60°C for 45 s A melting analysis was carried out following PCR to monitor amplification specificity Relative mRNA expression was normalized against Gapdh mRNA levels in the same samples and calculated by the Δ/Δ-Ct method Mice were transcardially perfused with 4% PFA in PBS Lumbar spinal cords were post-fixed with 4% PFA in PBS overnight at 4°C and then immersed in 30% sucrose in PBS at 4°C Tissues were embedded in optimal cutting temperature compound (Tissue-Tek sliced into 30 μm sections and mounted on Adhesive Glass Slides (Matsunami Glass) Sections were permeabilized with 0.1% Triton X-100 in PBS and blocked with 3% normal donkey serum in PBS for 1 h at room temperature The sections were incubated with primary antibodies overnight at 4°C and then incubated with fluorescently labeled secondary antibodies for 1 h at room temperature The following primary antibodies were used: rabbit anti-CC3 (#9661 mouse anti-glial fibrillary acidic protein (GFAP; G3893 goat anti-choline acetyltransferase (ChAT; AB144P Alexa Fluor 488-conjugated donkey antibodies against rabbit Alexa Fluor 568-conjugated donkey antibodies against mouse or goat IgG and Alexa Fluor 647-conjugated donkey antibody against rabbit IgG (Thermo Fisher Scientific Oligodendroglial cell death were evaluated with percentage of CC3+ CC1+ Olig2+ cells in CC1+ Olig2+cells and neuronal cell death were evaluated with the number of ChAT+ cells in the anterior horn using ImageJ fluorescence intensity of GFAP and Iba1 in the anterior horn was normalized to its area using ImageJ The grip strength test for OA/LA or BSA-treated SOD1G93A mice were performed twice a week between P60 and P100 The mice were placed on a grid attached to grip strength meter (Bio-GS3; Bioseb) The tail was pulled until the mouse released the grid and the maximum value (given by gram) from 10 trials was recorded All statistical values are presented as mean values ± standard error of mean (SEM). The number of samples analyzed is given for each experiment. Significant differences were determined with Student’s t-test, one-way analysis of variance (ANOVA) followed by Tukey–Kramer test, or two-way ANOVA followed by Sidak’s multiple comparison tests. All data were analyzed using Excel 2019 (Microsoft) or EZR (Kanda, 2013) These facts prompted us to investigate whether OA and LA are involved in ALS pathogenesis Free fatty acid (FFA) concentration is reduced in the plasma of SOD1G93A mice The plasma was obtained from WT or SOD1G93A mice at P60 and P100 and subjected to mass spectrometry for lipid analysis (A) Kaplan–Meier curve showing the probability of SOD1G93A mice without tremor symptoms (n = 9) (B–D) A heat map showing the z-score of each fatty acid (B) and lysophosphatidic acid (D) in the plasma The rows and columns represent lipids and samples Graph indicating the relative concentration of oleic acid (OA) (E) The error bars represent mean ± SEM (n = 4 for each group) assessed by one-way ANOVA followed by Tukey–Kramer test for panel (E) These results suggested that OA/LA prevent excitotoxicity-induced OL death FFAR1 is a candidate molecule that regulates oligodendrocyte cell death (A) Representative images show the fluorescence of PI (red) and immunocytochemistry for MBP (green) of primary oligodendrocytes treated with vehicle (B) Graph indicating the percentage of PI+ MBP+ cells in MBP+ cells (vehicle: n = 6 (C) Graph showing the percentage of PI+ MBP+ cells in MBP+ cells of primary oligodendrocyte culture transfected with siRNA library followed by treatment with glutamate + OA + LA (n = 3 for each) (D) Plot indicating the –log10 (p-value) and log2 (fold change) of PI+ MBP+ cell percentage compared with control siRNA in each siRNA treatment (n = 3 for each group) (E) Relative expression of Ffar1 mRNA in primary oligodendrocytes after control or Ffar1 siRNA treatment (n = 3 for each group) (F) The percentage of PI+ MBP+ cells in MBP+ cells after Control or Ffar1 siRNA treatment (n = 3 for each group) assessed by one-way ANOVA followed by Tukey–Kramer test for panels (B–D) and by two-sided Student’s t-test for panels (E,F) These results suggest that OA/LA prevents excitotoxic cell death in oligodendrocytes via FFAR1 indicating that OA/LA directly supported oligodendrocyte survival via FFAR1 OA and LA inhibit glutamate-induced oligodendrocyte apoptosis via FFAR1 (A) Representative images show the fluorescence of PI (red) and immunocytochemistry for MBP (green) of purified primary oligodendrocytes treated with vehicle (B) Graph showing the percentage of PI+ MBP+ cells in MBP+ cells assessed from panel (A) (Vehicle: n = 4 (C) Representative images showing the fluorescence of PI (red) and immunocytochemistry for MBP (green) in purified primary oligodendrocytes treated with control siRNA or Ffar1 siRNA in the presence of glutamate with or without OA/LA (D) Graph showing the percentage of PI+ MBP+ cells in MBP+ cells (Control siRNA in glutamate: n = 4 and Ffar1 siRNA in glutamate + OA/LA: n = 4) (E) Representative images showing fluorescence of immunocytochemistry for CC3 (cyan) and MBP (green) of purified primary oligodendrocytes treated with vehicle (F) Graph showing the percentage of CC3+ MBP+ cells in MBP+ cells assessed from panel (E) (vehicle: n = 4 (G) Representative images showing the fluorescence of immunocytochemistry for MBP (green) and CC3 (cyan) of purified primary oligodendrocytes treated with control siRNA or Ffar1 siRNA in the presence of glutamate with or without OA/LA (H) Graph showing the percentage of CC3+ MBP+ cells in MBP+ cells assessed from panel (G) (Control siRNA in glutamate: n = 4 assessed by one-way ANOVA followed by Tukey–Kramer test for panels (B,F) and two-way ANOVA followed by Sidak’s multiple comparison tests for panels (D,H) suggesting that the protective effect of OA/LA on oligodendrocyte also contributed to mitigating the ALS pathology OA and LA prevent the OL loss in SOD1G93A mice (A) Representative images show the immunohistochemistry for CC1 (green) and Ffar1 (cyan) in the spinal cord section of SOD1G93A at P100 (B) Representative images indicate immunohistochemistry for CC1 (green) and CC3 (cyan) in the spinal cord of Vehicle or OA + LA injected SOD1G93A mice at P100 White arrows indicate CC1+ Olig2+ CC3+ cells (C) Graph shows the number of CC1+ Olig2+ CC3+ cells per mm2 (n = 4 for each group) (D) Graph shows the number of CC1+ Olig2+ cells per mm2 (n = 4 for each group) (E) Graph showing the gram of grip strength (vehicle: n = 3 *P < 0.05 assessed by two-sided Student’s t-test for panel (C) and two-way ANOVA followed by Sidak’s multiple comparison test for panel (E) confirming the successful treatment of OA/LA in vivo these results suggest that OA/LA also have a protective effect on MNs OA and LA prevent the degeneration of MNs in SOD1G93A mice (A) Representative images show the immunohistochemistry for ChAT in the spinal cord section (B) The graph shows the number of ChAT+ cells per section (vehicle: n = 5 (C–F) Representative images show the immunohistochemistry for Iba1 (green Graphs show the relative fluorescence intensity of Iba1 (D) and GFAP (F) *P < 0.05 assessed by two-sided Student’s t-test we applied global lipidomic analyses to identify circulating lipids that mediate ALS pathogenesis We identified a robust decrease in circulating FFAs OA/LA inhibited excitotoxic oligodendrocyte cell death via the cell surface receptor FFAR1 We also observed that the systemic administration of OA/LA ameliorated the loss of OLs and MNs in SOD1G93A mice Although we could not detect SCFAs in our analysis changes in the gut microbiome in ALS may also affect the systemic lipidome Further investigations in peripheral organs are needed to elucidate the mechanism by which circulating FFAs levels decrease transfection of Ffar4 siRNA did not influence the anti-apoptotic effect of OA/LA on OLs the anti-apoptotic role of FFAR4 might be differently regulated in cell types depending on the downstream signaling molecules they express Further investigation is needed to elucidate the mechanism regulating the protection of OLs by OA/LA Further investigation is needed to elucidate the prospect of astrocyte-mediated oligodendrocyte cell death suppression by OA/LA Recent advantages of lipidomic analysis have revealed global changes in lipids in neurological diseases, such as Parkinson’s disease (Galper et al., 2022), Alzheimer’s disease (Proitsi et al., 2017), and multiple sclerosis (Gonzalo et al., 2012) in addition to ALS Further evaluation of the multiple roles of FFA in the pathogenesis of CNS diseases may contribute to unveiling novel molecules that can serve as both biomarkers and therapeutic targets for CNS pathologies with abnormal lipid metabolism The raw data supporting the conclusions of this article will be made available by the authors The animal study was reviewed and approved by the Committee on the Ethics of Animal Experiments of the National Institutes of Neuroscience RM wrote the manuscript and supervised the project All authors contributed to the article and approved the submitted version This work was supported by a Grant-in-Aid of Scientific Research (B) from the Japan Society for the Promotion of Sciences to RM (22H02962) and AMED under Grant Number 23wm0525016 to RM We thank the Human Metabolome Technologies Inc. The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fncel.2023.1081190/full#supplementary-material Comprehensive profiling of plasma fatty acid concentrations in young healthy Canadian adults Protective effects of oleic acid against palmitic acid-induced apoptosis in pancreatic AR42J cells and its mechanisms Non-canonical targets of HIF1a impair oligodendrocyte progenitor cell function Treatment of rat spinal cord injury with the neurotrophic factor albumin-oleic acid: Translational application for paralysis Oxidative stress in ALS: A mechanism of neurodegeneration and a therapeutic target Modulatory effect of linoleic and oleic acid on cell proliferation and lipid metabolism gene expressions in primary bovine satellite cells Potential roles of gut microbiome and metabolites in modulating ALS in mice ALS: A disease of motor neurons and their nonneuronal neighbors PubMed Abstract | CrossRef Full Text | Google Scholar Factors affecting the diagnostic delay in amyotrophic lateral sclerosis Lipids in the nervous system: From biochemistry and molecular biology to patho-physiology Alterations in lipid metabolism of spinal cord linked to amyotrophic lateral sclerosis The role of short-chain fatty acids in microbiota-gut-brain communication Evidence for defective energy homeostasis in amyotrophic lateral sclerosis: Benefit of a high-energy diet in a transgenic mouse model Falomir-Lockhart Fatty acid signaling mechanisms in neural cells: Fatty acid receptors Increased peripheral lipid clearance in an animal model of amyotrophic lateral sclerosis Astrocyte-specific deletion of peroxisome-proliferator activated receptor-γ impairs glucose metabolism and estrous cycling in female mice Oligodendrocytes contribute to motor neuron death in ALS via SOD1-dependent mechanism Dietary ω-3 polyunsaturated fatty acid intake and risk for amyotrophic lateral sclerosis Glutamate transporters and the excitotoxic path to motor neuron degeneration in amyotrophic lateral sclerosis Lipid pathway dysfunction is prevalent in patients with Parkinson’s disease Godoy-Corchuelo Lipid metabolic alterations in the ALS-FTD spectrum of disorders Gonçalves-de-Albuquerque Lipidome analysis in multiple sclerosis reveals protein lipoxidative damage as a potential pathogenic mechanism Circulating transforming growth factor-β1 facilitates remyelination in the adult central nervous system Fatty acid binding protein 7 is involved in the proliferation of reactive astrocytes Blood cell palmitoleate-palmitate ratio is an independent prognostic factor for amyotrophic lateral sclerosis Age-dependent decline in remyelination capacity is mediated by apelin–APJ signaling Hypermetabolism is a deleterious prognostic factor in patients with amyotrophic lateral sclerosis Progressive loss of a glial potassium channel (KCNJ10) in the spinal cord of the SOD1 (G93A) transgenic mouse model of amyotrophic lateral sclerosis Investigation of the freely available easy-to-use software “EZR” for medical statistics Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Apelin deficiency accelerates the progression of amyotrophic lateral sclerosis Free fatty acids inhibit serum deprivation-induced apoptosis through GPR120 in a murine enteroendocrine cell line STC-1 Free fatty acid receptors in health and disease Peripherally derived FGF21 promotes remyelination in the central nervous system Linoleic acid reduces apoptosis via NF-κB during the in vitro development of induced parthenogenic porcine embryos Oligodendroglia metabolically support axons and contribute to neurodegeneration Expression of free fatty acid receptor GPR40 in the central nervous system of adult monkeys Energy intake and amyotrophic lateral sclerosis Glutamate-mediated glial injury: Mechanisms and clinical importance Differential free fatty acid receptor-1 (FFAR1/GPR40) signalling is associated with gene expression or gelatinase granule release in bovine neutrophils Relationship between body fat mass and free fatty acid kinetics in men and women Lipids in regulating oligodendrocyte structure and function PubMed Abstract | CrossRef Full Text | Google Scholar Oligodendrocytes provide antioxidant defense function for neurons by secreting ferritin heavy chain Effects of exogenous linoleic acid on fatty acid composition and transport functions in rat astrocytes in primary culture Increased oxidative stress in patients with amyotrophic lateral sclerosis and the effect of edaravone administration Oleic acid is a potent inducer for lipid droplet accumulation through its esterification to glycerol by diacylglycerol acyltransferase in primary cortical astrocytes Myelination of the nervous system: Mechanisms and functions doi: 10.1146/annurev-cellbio-100913-013101 Vulnerability of oligodendroglia to glutamate: Pharmacology No benefit of dietary restriction on disease onset or progression in amyotrophic lateral sclerosis Cu/Zn-superoxide dismutase mutant mice Oligodendrocyte dysfunction in the pathogenesis of amyotrophic lateral sclerosis Glial cells in amyotrophic lateral sclerosis PubMed Abstract | CrossRef Full Text | Google Scholar Natural fish oil improves the differentiation and maturation of oligodendrocyte precursor cells to oligodendrocytes in vitro after interaction with the blood-brain barrier Association of blood lipids with Alzheimer’s disease: A comprehensive lipidomics analysis Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis Distinct roles for motor neuron autophagy early and late in the SOD1(G93A) mouse model of ALS Circulating factors that influence the central nervous system remyelination CRL4AMBRA1 is a master regulator of D-type cyclins Lipidomic traits of plasma and cerebrospinal fluid in amyotrophic lateral sclerosis correlate with disease progression Altered skeletal muscle glucose-fatty acid flux in amyotrophic lateral sclerosis ERK and cell death: ERK1/2 in neuronal death PubMed Abstract | CrossRef Full Text | Google Scholar The role of lipids in the central nervous system and their pathological implications in amyotrophic lateral sclerosis Dimethylarginine dimethylaminohydrolase 1 as a novel regulator of oligodendrocyte differentiation in the central nervous system remyelination Mechanisms involved in the regulation of free fatty acid release from isolated human fat cells by acylation-stimulating protein and insulin PPARs are a unique set of fatty acid regulated transcription factors controlling both lipid metabolism and inflammation Vesga-Jiménez Fatty acids: An insight into the pathogenesis of neurodegenerative diseases and therapeutic potential Assessing disease onset and progression in the SOD1 mouse model of ALS Astrocytes as determinants of disease progression in inherited amyotrophic lateral sclerosis Suzuki T and Muramatsu R (2023) Free fatty acids support oligodendrocyte survival in a mouse model of amyotrophic lateral sclerosis Copyright © 2023 Maruyama, Tanabe, Uyeda, Suzuki and Muramatsu. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) distribution or reproduction in other forums is permitted provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited in accordance with accepted academic practice distribution or reproduction is permitted which does not comply with these terms *Correspondence: Rieko Muramatsu, bXVyYW1hdHN1QG5jbnAuZ28uanA= Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher 94% of researchers rate our articles as excellent or goodLearn more about the work of our research integrity team to safeguard the quality of each article we publish Karen is a consultant in the Macroeconomics Trade and Investment Global Practice at the World Bank joined the World Bank in 2018 as a summer intern in Brazil where she has led and contributed to global and country-specific studies spanning all world regions She is particularly interested in the role that policy can play in shaping the trade-development nexus Karen holds a MA in International Economics and International Affairs with specializations in Development Economics and Latin American Studies from Johns Hopkins University School of Advanced International Studies sailor accused of slamming into and injuring five people near a popular beach two years ago was suffering from delirium and not in control of his actions Petty Officer 2nd Class Daniel Krieger was suffering from acute alcohol intoxication higher brain dysfunction and delirium when he collided with the group July 9 director of Rokubancho Mental Clinic in Tokyo and a part-time lecturer on neuropsychiatry at Keio University According to the World Health Organization “acute alcohol intoxication” requires dysfunctional behavior and at least one of seven additional symptoms The definition is “just a guideline” and does not encapsulate the “essence of the symptoms,” he testified Krieger’s condition resulted from his excess consumption of alcohol and a prior brain injury a defense witness at Krieger’s trial in the Yokosuka Branch of Yokohama District Court Krieger testified May 13 that he drank 10-20 alcoholic drinks the day of the incident Muramatsu concluded it was impossible for Krieger to control his behavior “because he was under a significantly altered state of consciousness,” he testified Prosecutors pored over Muramatsu’s 44-page report questioning whether Krieger could have lied during Muramatsu’s interviews and whether Muramatsu would reach a different conclusion had he reviewed video footage of Krieger’s police interview Muramatsu testified that he didn’t believe Krieger had lied to him and that his conclusion was based on the facts of the case and clinical symptoms Krieger is charged with four counts of bodily injury from the July 2022 incident Prosecutors allege he slammed into the group on the streets of Zushi a popular beach town near Yokosuka Naval Base the most severely injured a 33-year-old man with multiple sprained vertebrae and a 58-year-old woman with a broken upper jaw broken nasal bone and other facial injuries 21 recommended charging Krieger with the bodily injury on all five people decide formal charges under Japan’s criminal justice system a logistics specialist assigned to the guided-missile destroyer USS Milius and his attorneys do not deny the allegations but say a previous brain injury and his heavy intoxication that day should absolve him of criminal liability Krieger suffered a brain hemorrhage after intervening in a fight at a train station in Yokosuka he became increasingly irritable and forgetful and a final hearing is tentatively scheduled Sept Shunsuke Muramatsu didn’t want a job that required him to wear a suit after he graduated So he landed a job in the music business in eighties Tokyo at CBS/Sony Group Inc – known today as Sony Music Entertainment (Japan) “I’ve always liked entertainment,” says Mr when asked to reflect on his long career at the company and in Japan’s record business the world’s second-largest after the United States a wholly-owned subsidiary of Japan-headquartered technology and entertainment giant Sony Group Corporation was originally founded as CBS Sony Records in Tokyo in 1968 as a JV between Sony Group Corporation and Columbia Broadcasting System Inc SMEJ’s own history is deeply intertwined with Japan’s physical music business Its predecessor CBS Sony Records started manufacturing records (Simon & Garfunkel’s The Graduate Official Soundtrack was the first) and started making cassette tapes that same year after the compact disc had been co-developed by Sony and Phillips in the late seventies CBS Sony Records started manufacturing CDs and released the first-ever commercial CD in Japan: Billy Joel’s 52nd Street Remarkably, in spite of music streaming’s global growth and dominance in most mature markets, more than 40 years after SMEJ first started manufacturing CDs, the format still reigns supreme in the Japanese market “We believe physical CDs and other disc products are filled with all sorts of creativity from the aesthetics to packaging specs and bonus features,” says Muramatsu “The physical products are an embodiment of what is in the artists’ minds and as such will hold value to the consumers and fans.” “Physical products are an embodiment of what is in the artists’ minds As Muramatsu explains in our interview below while he doesn’t see physical music’s value in Japan losing its dominant position any time soon he’s also hopeful about music streaming’s growth and coexistence with the enduring popularity of CDs SMEJ is split into three business units: the Artist & Music Business Group the Visual & Character Business Group and Entertainment Solution Business Group Muramatsu explains that the three business groups “are not independent but rather work together organically successfully creating a healthy variety of different IPs and solutions also offering users an assortment of methods to enjoy the various IPs” and as a producer in the A&R department at the music company He was then appointed as a regional promotion manager in 1999 and says it was in this role that he “realized the importance of putting together a good team,” which was “a major turning point” for him in his professional career Muramatsu says he was catapulted into the leadership position at the company’s record label division Sony Music Records (now Sony Music Labels) “losing money despite having the longest history within SMEJ” with the next turning point in his career arriving when Sony Music Records signed Japanese rock band ORANGE RANGE to its gr8 I’ll quit’,” remembers Muramatsu “It actually grew to achieve sales of almost 3 million units.” It actually grew to achieve sales of almost 3 million units.” He adds: “Whether it be the artists or staff I have always found the people fascinating and as I continued to work on turning around labels which were struggling I feel like this is the reason that we have been able to make stars from many artists who remain active today.” In addition to the company’s music operations SMEJ is a powerhouse in visual entertainment across various anime projects and games with its Visual & Character Business Group housing anime giant Aniplex As Muramatsu notes in our conversation below SMEJ is becoming increasingly interested in how the global popularity of anime can serve as a gateway for Japanese artists to reach wider audiences around the world With this in mind, just last month, SMEJ teamed up with US-based (and Sony Group-owned) anime streaming platform Crunchyroll to license its music content outside of Japan on Crunchyroll’s new music and content hub Other ambitious non-traditional music activities from SMEJ include major virtual talent projects – one of which, VEE, is described on the website as “the largest virtual talent development and management project in history” SMEJ also launched a global talent audition last year for real-life creators to work as virtual characters via the Tokyo-based ‘PRISM Project’. On PRISM Project’s website, it’s referred to as “a multinational VTuber agency from the future”. Muramatsu is confident about SMEJ’s positioning and future in it “The spectrum of online and offline solutions we offer makes us an all-around and unique entertainment company and gives us a distinctive character that we share with no other company in the Japanese entertainment market,” he says Sony Music Entertainment (Japan) CEO Shunsuke Muramatsu shares his thoughts on virtual talent and the unique challenges Japan faces as the world’s second-largest recorded music market… founded in 1968 as a joint venture between what was then Sony Corporation and CBS Inc. and as such it has the longest history of all the entertainment businesses within the Sony Group manufacturing and distribution of discs and media such as CDs live streaming of online concerts and events The spectrum of online and offline solutions we offer makes us an all-around and unique entertainment company and gives us a distinctive character that we share with no other company in the Japanese entertainment market being part of Sony Group gives us invaluable access to other businesses within the group including the latest technology and unique solutions and we can hopefully continue to grow as a company that generates emotional experiences utilizing a blend of technology and entertainment A music trend possibly unique to Japan with potential outside of the country may be the Vocaloid culture Music production using Vocaloids started in the early 2000s adding the participation of illustrators and animators and more recently actual singers posting cover versions on the internet Each in this trinity plays a vital part in this unique method of music production and relies heavily on what we call community DIY or the role of the community and ecosystem in creating the music Japanese anime has garnered a worldwide following and Japan’s 2D (two-dimensional) entertainment has a promising global future The latest developments in Vocaloid music have seen much variety and diversification with an emergence of creators with global potential SMEJ opened a Web-based platform called “MECRE” for creators to interact now over 7,000 utilizing the DIY community SMEJ serves as headquarters for approximately 20 group companies including subsidiaries and carries out management and administrative operations for the group as well as assisting with creating new businesses The 20 group companies are split into three business groups “Artist & Music,” “Visual & Character,” and “Entertainment Solution,” cooperating as necessary to develop the value and appeal for IPs derived from the creative work generated with artists and creators In a market where CDs still carry substantial weight being able to take initiative in the manufacturing process allows us to accommodate the creativity of artists and record labels There may indeed be times when meeting the specific needs of the artist may not be efficient or easy will reach the fans’ hearts and ultimately reflect positively on and contribute to the business I dare say this may even be the reason the physical product market continues in Japan the share of physical music in 2022 was 65.8% with the production for physical products increasing with live events having been held at restricted capacity due to COVID-19 precautions Although I do think this is likely a temporary phenomenon I don’t believe that the physical market will suddenly disappear as we have seen in some other countries “Fans in Japan are particularly loyal to each artist and many also have a collector’s mindset making them partial to the physical product.” The reason for this is that fans in Japan are particularly loyal to each artist making them partial to the physical product with cumulative growth at 125% between January and December 2022 In comparison to the per capita of countries that are leaders in streaming we want to reach around 30 million paid subscribers in Japan There are people outside of Japan who like Japanese music from the 1980s and “city pop” is now a genre that is being sampled globally and there has been a shift to a digital and borderless world and before we knew it the Japanese music market had become what we call a Galapagosized certainly on the individual artist level but also for J-Pop in its entirety would be our biggest challenge In 2022, there was a live event in Saudi Arabia with performances by artists from SACRA MUSIC, the SMEJ label for those who are extending the range of their activities not only in Japan but also overseas. And YOASOBI an artist whose work fits well with 2D media also had their first performance for a festival in Jakarta where the audience was singing along the Japanese lyrics with the artist “Japanese anime is serving as an important gateway to introducing Japanese music.” I have to believe that a crucial step for further promoting global development will certainly be identifying the countries and regions with the higher potential for it to take off Another point is that many of the tracks with listeners outside of Japan are in some way connected to anime and Japanese anime is serving as an important gateway to introducing Japanese music and further on the opportunity for hits SMEJ started providing video content to Crunchyroll mainly for artists who have repertoire associated with anime Crunchyroll has been part of Sony Group since 2021 and is one of the largest anime streaming services in the world Crunchyroll is optimistic and eager to take on this initiative ready with product development and marketing plans to help SMEJ artists reach a wider audience around the world I honestly could not have predicted that VTubers would grow to be so significant in the entertainment realm there is no way to know how much bigger it will become over the next few years However, I’m convinced that it will become much bigger. Japan currently counts over 20,000 VTubers, and our “VEE” VTuber project auditions in 2021 received over 18,000 entries at the time Although there are many who aspire to be VTubers it seems there are still many obstacles that do not make it an easy path nor accessible to everyone If ongoing advances in technology help resolve the issues becoming a VTuber will be possible for more people It also feels like a type of entertainment that would work well with other recent developments like the metaverse and Web 3.0 and with opportunities to further reach countries around the world beyond Japan and North America TikTok has a vital role in creating the current hit tracks in Japan whether it be the development of new talent or catalogue repertoire many of the new artists who suddenly appear in the charts originally went viral on TikTok “TikTok has a vital role in creating the current hit tracks in Japan.” since the nature of the platform is for users to go through vast amounts of content instantaneously an artist with one hit may not necessarily have a follow-up hit the focus on hits originating from individuals pursuing a social media presence as well as special-interest communities will increase This means understanding the persona and analytics of the audience on social media becomes a key part in the breaking hit of an artist or track In addition to honing their social media presence communication from the artists themselves becomes a critical piece in the process and so the record company also needs updated literacy in the effective use of social media including precautions and strategies to handle negatively viral situations Looking at what kinds of entertainment saw increased demand and not during the COVID-19 pandemic games and video content grew dramatically while music only met fair expectations With various kinds of entertainment competing for the consumers’ discretionary time I’m concerned that the number of hours devoted to music has not increased as much I have always believed in music as an amazing supporting role in our lives Back when music was always there as part of the important page in our lives it meant that hearing a song might bring you back memories of those special moments now that we all have music at our fingertips I once again want music to be fully integrated into our lives and make frequent appearances as the amazing supporting role of life SoundExchange was independently formed in 2003 to build a fairer and more efficient music industry through technology The only organization designated by the U.S government to administer the Section 114 sound recording license SoundExchange collects and distributes digital performance royalties on behalf of 700,000 music creators and growing.Music Business Worldwide Stay on top of the real stories shaping the music industry: Join over 60,000 industry professionals who rely on MBW's FREE daily newsletter and alert emails for essential insights and breaking news Please log in and check your service registration status.To cancel your subscription 1) === '|') document.write("&#"+unescape(l[i].substring(1))+";");else document.write(unescape(l[i]));} The first trailer for upcoming indie anime Tadaima o Kaesu Tabi was released last week on director Takashi Muramatsu‘s YouTube channel who is voiced by VTuber Asano Ruri (Ruri is also a voice actor under the Crocodile agency) According to one of the texts in the trailer she sets out on a journey to search for her memories Muramatsu (Aozora to Akizora, Omoide wo Hakobu Uta) says he has been working on Tadaima o Kaesu Tabi, including as animator, composer, and editor, for four years. A crowdfunding campaign on Motion Gallery was held to help fulfill three goals: screening the anime in Tokyo’s Shimokita Ekimae Cinema K2 mini-theater via Motion Gallery’s Short Film Biotope program producing life-sized cutouts of the VTuber cast members and postcards It raised 446,500 yen (~US$2,888) out of its 100 thousand yen goal The schedule on the crowdfunding page lists a Winter 2024 release for the anime Want to keep up with our anime and anime-adjacent news stories? Subscribe to our newsletter, where you can get updates on our user-voted anime chart rankings as well We couldn't find the file you were looking for; we apologize for the inconvenience If you have arrived at this page due to a broken link from within the Pomona Web a notification has been automatically reported to the Webmaster for repair Part of  The Claremont Colleges The stars aligned when she relaunched the apparel and home-accessories boutique she co-owns on Beacon Hill. Ahead, the shopkeeper shares more of what inspires her. › Wine is an essential part of my life, as it is an essential part of civilized culture. Nicolas Haegeli, wine manager at Gordon’s in Waltham, has guided me into acquiring the taste for earthy, rich-bodied Bordeaux. At present I’m drinking 2015 Chateau La Vieille Cure Fronsac. We are able to connect with nature through the burning of these elegant sticks of incense. “Murmure de la Forêt,” [which translates to] “whisper of the forest,” blends sandalwood, peppery cistus, patchouli, clove, vetiver, and a touch of raspberry. You will feel transported into another realm. Gemstones are healing for the spirit, but to apply them on the face is absolute decadence. Éminence Organic’s “Charcoal Exfoliating” gel cleanser is made with malachite; the “Camellia Glow” solid face oil is made with pink tourmaline; and the “Turmeric Energizing” treatment is made with citrines. All three combined will make your skin feel completely ecstatic. Louiza Babouryan’s [designs incorporate] tulle, organza, and ruffles: three elements that make my heart sing. They are comfortable, dressy yet casual, and freeing. I am inspired by these fabrics to teach, educate, and show women how to feel their absolute best all of the time. The magical properties of these gemstones, such as raising your inner vibration and clearing the mind and chakras, are only a couple of the elements that they offer in healing when worn. These naturally formed quartz crystals are mined in Herkimer, New York, and are not very easy to find. What I’m EatingStuffed artichokes are my go-to food, with ground beef, herbs, garlic, breadcrumbs, and Parmesan cheese. They are a bit tedious, but the preparation is a skill and an art. What I’m ReadingUnder the Light of the Italian Moon by Jennifer Anton is an inspiration of a true love story during the rise of fascism and World War II. Reading this jogs my memories of what little I knew about my Italian grand-parents and their ancestry. What I’m Listening toI love heavier music that sounds like it’s coming from a church, especially during colder months, but right now French-Egyptian artist and instrumentalist Ashraf Moawad has my attention, as he layers soulful tunes of the Eastern world with electronic melodies of the West. What I’m WearingMy Joseph Brooks–designed bracelets have black tourmaline for grounding, peridot for motivation, and garnet for energy balancing. Having the colors on my wrist inspires me every moment of the day. What I’m BuyingI buy Comme des Garçons “Series 3 Incense: Avignon” eau de toilette whenever I’m in Paris, capturing the essence of my trip in one spray. The notes of vanilla, cedarwood, and ambrette resonate with me after dusk when the environment turns even more seductive. On the Market: A Weston Mansion with an Indoor Basketball Court and Two-Story Tube Slide Boston’s Swankiest New Address? The Ritz-Carlton Residences at South Station Tower On the Market: A Swanky Vermont Retreat Where Don Draper Would Definitely Hide ©2025 Boston Globe Media Partners, LLC 2025Maruhachi Muramatsu are broadening the appeal of dashi and taking it international As ingredients make the base of a beautiful meal authentic dishes are an ingredient in the base of culture Rich experiences through cuisine speak to our common understanding of culture Like cuisine as part of the basis of culture Dashi is the basis for many of Japan’s most popular culinary dishes have specialized in dashi for over 150 years primarily engaging with food manufacturers and kitchens and culinary artists to produce the staples of Japanese cuisine As Japanese food exports continuing to grow, the Japanese Government has set an ambitious JPY 5 trillion target which fifth generation president Zempachi Muramatsu sees as achievable achieving the 5 trillion-yen market goal feels entirely within reach,” he says The health benefits and versatility of dashi are its greatest strength with health-conscious diets on the rise both domestically and globally dashi can be used to reduce the salt and sugar content of dishes Muramatsu says that dashi isn’t limited to Japanese cuisine “With its unique ability to enhance natural tastes yet equally delicious meals.” Dashi isn’t limited to savory foods either and Mr Muramatsu says the company is actively exploring new ingredients to create new flavors He describes how Kombu dashi complements the flavor of sweet red bean paste (anko) and adds “incredible depth” to a risotto This variety of flavor is possible through high quality and diverse which when combined create a complex and enjoyable experience “We have honed techniques to maximize the potential of these ingredients while continuously developing innovative applications to meet our customers’ needs.” By combining their natural ingredients and the umami flavor of dashi Maruhachi Muramatsu supplies these products to restaurants both domestically and abroad Muramatsu says that they offer solutions to kitchens that require authentic dashi can make precise amounts of authentic dashi in just 10 seconds Saving labor in particular is an important differentiator in Japan where the domestic workforce continues to shrink With the domestic market continuing to shrink With Japanese restaurants flourishing in foreign countries and Japanese food increasing in popularity around the world Maruahachi Muramatsu is well positioned to capitalize Muramatsu says that many foreign chefs are already well acquainted with dashi and he is eager to see that recognition diffuse into the public this recognition has been advantageous for Maruhachi Muramatsu “We sell seafood-based dashi and plant-based ramen soups to these restaurants and our sales have been steadily increasing.” But beyond Japanese restaurants the versatility of dashi has proven to be the key to finding new markets “To encourage the use of traditional Japanese seasonings like miso overseas it’s crucial to adapt recipes to align with each country’s unique food culture,” Mr With plant-based diets on the rise and religious diets common in international markets kombu and shiitake-based dashi are also finding vital channels for increased growth “As global palates become more diverse and menus expand I am confident this will lead to further market growth and exciting opportunities.” These opportunities exist beyond the humble dashi with Maruhachi Muramatsu’s R&D division making strides in functional foods and pharmaceutical sectors Muramatsu says that they are committed to tackling global health challenges dementia and swallowing disorders by contributing to research publishing findings and participating in academic conferences Muramatsu hopes that their dashi goes beyond and contributes to the betterment of the world With rising sea temperatures affecting ingredients and processing generates waste he hopes that Maruhachi Muramatsu can contribute meaningfully to its SDGs and a sustainable future To hear more from President Zempachi Muramatsu of Maruhacchi Muramastu, check out this interview with him Maruhachi Muramatsu are broadening the appeal of dashi and taking it international industrial and financial news about global economies with a focus on understanding them from within Metrics details a member of the transforming growth factor-β superfamily is an attractive target for muscle disease therapy because of its role as a negative regulator of muscle growth and strength we describe a novel antibody therapeutic approach that maximizes the potential of myostatin-targeted therapy that specifically binds the latent form of myostatin and inhibits its activation GYM329 reduces or “sweeps” myostatin in the muscle and plasma Compared with conventional anti-myostatin agents GYM329 and its surrogate antibody exhibit superior muscle strength-improvement effects in three different mouse disease models We also demonstrate that the superior efficacy of GYM329 is due to its myostatin specificity and sweeping capability we show that a GYM329 surrogate increases muscle mass in normal cynomolgus monkeys without any obvious toxicity Our findings indicate the potential of GYM329 to improve muscle strength in patients with muscular disorders a new therapeutic approach with better efficacy is needed By repeating this “capture-and-release cycle,” the engineered antibody can reduce the amount of antigen outside the cell we report the generation and in vivo characterization of an antibody we named GYM329 which has myostatin-specific blockade and sweeping capabilities we analyzed the effects of GYM329 and its functional equivalent in mouse models of muscle disease We further demonstrated the effects of GYM329 and its surrogate in cynomolgus macaques We demonstrate that this antibody exhibits better muscle strength improvement activity than conventional anti-myostatin agents showing that GYM329 is a potent novel agent for the treatment of muscle diseases Anti-latent myostatin antibodies were generated in rabbits by alternatively immunizing the animals with recombinant human and mouse latent myostatin to enrich cross-reactive clones Screening of B cell supernatants from the immunized rabbits through a binding assay identified clones that specifically bind the latent and not the mature myostatin They were then functionally screened through the Smad3/4-binding elements-driven secreted alkaline phosphatase (SEAP) reporter gene assay We assessed the candidate antibodies’ inhibitory activity against BMP1-mediated activation of myostatin and MST1032 was finally selected as the lead antibody based on its strong activity Generation of the anti-latent myostatin sweeping antibody (A) Summary of the characteristics engineered into GYM329 (B) Surface plasmon resonance analysis illustrating pH-dependent binding of GYM329 to latent myostatin Binding of GYM329 to human latent myostatin was monitored at pH 7.4 in the association phase (0 to 180 s) and dissociation of GYM329 from latent myostatin at either pH 6.0 or 7.4 were assessed in the dissociation phase (from 180 s) The sensorgram was normalized by adjusting the latent myostatin binding response to ‘100.’ RU: resonance unit (C) Inhibitory effects of GYM329 on latent myostatin Latent myostatin or latent GDF11: 3 nmol/L; mature GDF11 or mature myostatin: 5 ng/mL GYM329 had stronger affinity to FcRn than IgG1 in acidic conditions This is indicative of a long serum half-life for GYM329 as there is more efficient FcRn-mediated recycling of the internalized antibody from the endosome as observed in other engineered antibodies with the same property The mouse surrogate of GYM329 (GYM-mFc) strongly increases muscle strength and muscle mass in three mouse models of muscle disease Changes in (A) whole-body muscle mass and (B) appendicular grip strength 4 weeks after antibody injection in mdx mice (n = 5–6 per group) Changes in (C) whole-body muscle mass and (D) appendicular grip strength 4 weeks after antibody injection in aged mice (n = 9–10 per group) (E) Hindlimb muscle weights after 2 weeks of hindlimb suspension in the muscular atrophy model and soleus) were collected and weighed 2 weeks after treatment (F) Changes in hindlimb grip strength after pre-treatment with the antibodies in the muscular atrophy model Data represent the changes in hindlimb grip strength during 2 weeks of the hindlimb suspension period Data represent mean ± SEM (n = 5–6 per group) Williams’ test compared with the vehicle (150 mmol/L NaCl Much weaker grip strength enhancement was seen at the high bimagrumab dose (100 mg/kg) and no enhancement was observed in mice treated with landogrozumab and domagrozumab GYM-mFc had the most potent effects on muscle mass and muscle strength of all the tested anti-myostatin agents the mechanism of action of all these conventional antibodies includes simple neutralization while GYM329 has a sweeping function that reduces antigen levels by forcing internalization via FcγRs GDF11 signaling blockade negatively affects muscle strength in the muscular atrophy model (A) Changes in hindlimb grip strength 2 weeks after treatment (n = 5–6 per group) and gastrocnemius) were isolated and weighed (n = 5–6 per group) (B) Inhibitory activities of antibodies against mature GDF11 or mature myostatin; 5 ng/mL of mature GDF11 (square) or mature myostatin (circle) was used for the reporter gene assay (C) Changes in hindlimb grip strength over three days Recombinant GDF11 or myostatin were administered (i.p.) on day 0 Data represent mean ± SEM (n = 6 per group) ***P < 0.001 with Tukey test performed without the non-suspension group did not have any suppressive effects on muscle strength reduction these data suggest that GDF11 and myostatin act in opposing directions in terms of muscle strength enhancement where inhibition of GDF11 signaling negatively impacts muscle strength enhancement (D) Confocal imaging of whole mounts of the extensor digitorum longus (EDL) in the muscular atrophy model Pro-/latent myostatin localized in the extracellular space of the skeletal muscles was labeled by the anti-pro-myostatin/latent myostatin antibody followed by the secondary anti-rabbit-IgG Alexa Fluor 568 (red) Representative confocal images of muscles from the non-suspension (left) and hindlimb suspension group (vehicle treatment (E) Plasma concentration–time curve of total myostatin in normal mice after administration of GYM329 or hMST1032-hIgG1 GYM329 or hMST1032-hIgG1 was intravenously injected into normal mice on day 0 Total plasma myostatin concentration was measured by the electrochemiluminescence immunoassay (n = 6 Total myostatin is the C-terminal domain of myostatin including both antibody-bound and unbound Values < 1 ng/mL were considered to be below the limit of quantification (BLQ) the superior activity of GYM329 in this experiment is not due to differences in antibody exposure the sweeping function of GYM329 and its myostatin specificity contributed to its superior activity with lower binding activity to FcγRI and FcγRIII The IC50 of GYM-cyFc against BMP1-mediated activation of cynomolgus myostatin in vitro was determined to be 0.199 μg/mL which is comparable to the IC50 of GYM329 against the activation of human latent myostatin (0.182 μg/mL) These data suggest that GYM-cyFc is a functional equivalent of GYM329 that may be used for studies in cynomolgus monkeys and reduces total myostatin levels in cynomolgus monkeys (A) Muscle section area determined by MRI are presented as the sum of the area of the quadriceps femoris and 55 (8 weeks) from the administration (i.v.) of the first dose of GYM-cyFc GYM-cyFc was administered every 4 weeks for 2 months From the results of anti-drug antibody (ADA) and pharmacokinetic analyses ADA-positive animals were excluded (vehicle group: n = 6; 1.25 mg/kg dose: n = 9; 2.5 mg/kg dose: n = 6; and 5 mg/kg dose: n = 5) Williams’ test for multiple comparisons to the vehicle group (B) The rates of increase in bodyweight relative to baseline after the 1st administration of GYM-cyFc into cynomolgus monkeys Williams test for multiple comparisons to the vehicle group (*: 1.25 mg/kg; #: 2.5 mg/kg; and $: 5 mg/kg) (C) Plasma concentration–time curve of total myostatin Values under 0.25 ng/mL were considered to be below the limit of quantification (BLQ) both antibodies failed to improve physical performance (in the Timed Up and GO which is relevant for enhancing the patients’ quality of life new therapeutic approaches that are more effective in improving patient physical function are still needed we attempted to examine the possible advantages of myostatin-specific blockade We also hypothesized that incomplete neutralization of myostatin function in muscle tissues probably due to high levels of myostatin in the muscle microenvironment and poor antibody penetration is another issue for conventional anti-myostatin agents We aimed to overcome this problem by generating an antibody with a sweeping function to reduce myostatin levels in the muscle we generated GYM329 and surrogate antibodies that specifically inhibit myostatin signaling and possess the sweeping function We have demonstrated that GYM329 and its surrogates exhibit superior ability to enhance muscle strength compared to three clinically evaluated anti-myostatin agents These superior effects were seen in three different muscle wasting disease mouse models and a hindlimb suspension-induced atrophy model which demonstrates the potency of this antibody in treating muscular diseases Although these findings suggest possible differential signaling mechanisms between myostatin and GDF11 Further investigation of the molecular mechanism of GDF11 in the musculature would deepen our understanding of muscle growth and strength regulation Although they have shown that their antibody has the capacity to increase muscle mass in vivo using a steroid-mediated atrophy mouse model they did not compare the effects of their antibody with those of anti-mature myostatin antibodies that have GDF11 cross-reactivity Our study is therefore the first to demonstrate the advantages of myostatin-specific blockade in treating muscle diseases we hypothesize that the sweeping of myostatin occurs in these cells although further investigation is needed to confirm this hypothesis Reduction of myostatin via the sweeping function would enable GYM329 to block myostatin signaling more completely even with limited antibody penetration into the muscles which could explain why GYM329 exhibited more potent effects Additional studies on the distribution of GYM329 and the status of myostatin signaling blockade in the muscle microenvironment are necessary to confirm this hypothesis Although muscle function analysis was not performed in the study using cynomolgus monkeys due to technical limitations obvious muscle increment was observed in the monkeys treated with the GYM329 surrogate In the preliminary analysis of safety in the same experiment no obvious toxicological effects were observed Total plasma myostatin was also strongly reduced by the GYM329 surrogate antibody demonstrating that the sweeping function works in different species the superior effect of GYM329 is more evident in muscle strength improvement than in muscle mass increment This characteristic is important for the treatment of patients with disorders such as muscular dystrophy or atrophy because recovery of physical function is considered the most desirable benefit of therapy GYM329 is potentially beneficial to patients with muscle diseases the findings we present here justify a clinical evaluation of GYM329 for improving physical function in patients suffering from muscle dysfunction Binding kinetics of the antibodies against human or mouse latent myostatin were assessed at pH 7.4 and 6.0 at 25 °C using the Biacore T200 (GE Healthcare Life Sciences Antibodies were captured onto the Biacore sensor chip CM5 (GE Healthcare Life Sciences) and immobilized with protein L (BioVision) or mouse latent myostatin was prepared by two-fold serial dilutions (2 nmol/L to 32 nmol/L) The sensor surface was regenerated using Glycine 1.5 (10 mmol/L glycine–HCl Kinetic parameters at pH 7.4 were determined by fitting the sensorgrams to the 1:1 binding model using the Biacore T200 Evaluation Software The pH-dependent binding ability of the antibodies to latent myostatin was evaluated by comparing the dissociation phases of the sensorgrams at pH 7.4 and at pH 6.0 Further details are described in the Supplementary Materials A reporter gene assay was used to assess the biological activity of active myostatin or GDF11 in vitro The detection of bioactive myostatin was achieved by monitoring the activation of activin type 1 and 2 receptors in HEK-Blue TGF-β cells (InvivoGen which stably express Smad3/4-binding elements (SBE)-inducible SEAP as the reporter gene The quantity of SEAP was measured using QUANTI-Blue (InvivoGen) HEK-Blue TGF-β cells were maintained according to the manufacturer’s instructions The culture medium was changed to the assay medium (DMEM with 0.1% bovine serum albumin (BSA) and cells were seeded into 96-well plates before assays or mouse latent myostatin was incubated with 250 ng/mL recombinant human BMP1 (R&D Systems MN) and various concentrations of anti-latent myostatin antibody at 37 °C overnight The sample mixtures were then added to the cells cell supernatants were collected and mixed with QUANTI-Blue and optical density at 620 nm was measured using a colorimetric plate reader 5 ng/mL of mature myostatin or mature GDF11 was added to cells with various concentrations of antibodies for 24 h This study was conducted according ARRIVE guidelines (https://arriveguidelines.org/) All procedures associated with this study were reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) in Chugai Pharmaceutical Co. The test facility is accredited by the Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC) Animal care and experiments were performed according to the animal husbandry policy of Chugai Pharmaceutical Co. Animals were housed in a temperature- and humidity-controlled room with food and water ad libitum Whole-body muscle mass was measured using a body composition analyzer based on Time Domain Nuclear Magnetic Resonance (TD-NMR Whole-body muscle mass was calculated by multiplying muscle mass (%) by bodyweight and dividing by a hundred Grip strength tests were performed using a digital force meter (GPM-100B Before administration of therapeutic agents on day 0 whole-body muscle mass of all animals was measured by TD-NMR and appendicular and hindlimb grip strength were measured by a grip strength meter the animals were selected and allocated to each dosing group so that there was no variation in each group (6 animals per group) each dosing solution was administered at 10 mL/kg of bodyweight (antibody solutions: intravenous i.v.; GDF11 and myostatin solutions: intraperitoneal pH 6.0) was also administrated intravenously to the 6 mice in the control group The antibody injection studies in the hindlimb suspension had a duration of 1 or 2 weeks as indicated in the figure legends and the GDF11 and myostatin injection study lasted for 3 days and extensor digitorum longus from both limbs were isolated and weighed The GDF11 study was performed twice independently and seventy-nine-week-old male C57BL/6J (aged mice Charles River Laboratories Japan) mice were used (10 animals per group) for the DMD model and the aged mouse study The observation duration was 4 weeks after antibody injection in both studies Change in whole-body muscle mass or grip strength was determined by subtracting the value on the last day from it on day 0 The concentration of total myostatin and antibodies were measured by electrochemiluminescence (ECL) immunoassay and each concentration was calculated based on the calibration curve using the analytical software SoftMax Pro (Molecular Devices pH 2.5) was added to diluted mouse plasma samples to dissociate mature myostatin from bound proteins (such as propeptide and follistatin) The samples were applied into MULTI-ARRAY 96-well plates and incubated with immobilized anti-mature myostatin antibodies biotinylated anti-mature myostatin antibodies were added and incubated After incubation with sulfo-tagged streptavidin the signal was detected using MESO SECTOR S600 (Meso Scale Discovery For measurement of antibody concentration in plasma diluted plasma samples were applied onto plates (MULTI-ARRAY 96-well) with immobilized anti-human IgG (I9885 AL) was added and incubated for 1 h at room temperature the signal was detected using MESO SECTOR S600 The cynomolgus macaques were housed at Shin Nippon Biomedical Laboratories This study was approved by the IACUC and was performed in accordance with the animal welfare regulations at SNBL which is accredited by AAALAC International Three-year-old female cynomolgus monkeys (36 animals in total) were used or 5 mg/kg was administered intravenously every 4 weeks for 2 months (a total of 3 times per dose level) to 10 female monkeys per group pH 6.0) was also administrated intravenously to 6 female monkeys as the control group The effects of GYM-cyFc on muscle mass in three muscle groups (quadriceps femoris and erector spinae) were investigated via MRI (MAGNETOM Allegra Germany) at day 0 (baseline) and at weeks 4 and 8 Blood samples were drawn from the left femoral vein before each dosing The concentrations of total myostatin and antibodies were measured by the ECL immunoassay as performed in the mouse studies R&D systems Inc.) as the primary antibody and GAPDH (D16H11 Cell Signaling Technology) as the internal control Quantifications were performed with Image-J ver To detect extracellular latent myostatin secreted locally around the skeletal muscles whole-mount EDL muscles were obtained from suspended hindlimb SCID mice EDL muscles were fixed in 4% paraformaldehyde (FUJIFILM Wako Pure Chemical Corporation muscles were washed in phosphate-buffered saline (PBS) three times (5 min each wash) and incubated with blocking buffer (1% BSA FUJIFILM Wako Pure Chemical Corporation in PBS) for 2 h at room temperature Anti-latent myostatin antibody (MST1098-rabbit IgG generated in-house and confirmed to not be cross-reactive to GYM329 (data not shown)) was used as the primary antibody MST1098-rabbit IgG (1 μg/mL) was diluted with blocking buffer and the samples were incubated with the primary antibody for more than 24 h at 4 °C After washing with PBS three times (15 min each wash) Thermo Fisher Scientific) diluted with blocking buffer and the samples were incubated for 24 h at 4 °C The samples were then washed with PBS three times (15 min each wash) 6-diamidino-2-phenylindole (DAPI) was used for nuclear staining Images were obtained using a Nikon A1 confocal microscope (Nikon The Z-series images were captured with 1.225 μm step size The images were then flattened into a single image for each location using the Nikon software (NIS-elements software) Red areas in individual images were analyzed using Image-J NC) was used for group allocation prior to administration All statistical analyses were performed with JMP software (Williams’ test Statistical significance was assigned for P < 0.05 (Student’s t-test and Tukey test) or P < 0.025 (Williams’ test); results are shown as Mean and SEM or SD All data associated with this study are present in the main text or the Supplementary Materials Materials are available from Chugai Pharmaceutical Co. McPherron, A. C., Lawler, A. M. & Lee, S. J. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 387, 83–90. https://doi.org/10.1038/387083a0 (1997) Szabó, G. et al. A deletion in the myostatin gene causes the compact (Cmpt) hypermuscular mutation in mice. Mamm. Genome 9, 671–672. https://doi.org/10.1007/s003359900843 (1998) Zhu, X., Hadhazy, M., Wehling, M., Tidball, J. G. & McNally, E. M. Dominant negative myostatin produces hypertrophy without hyperplasia in muscle. FEBS Lett. 474, 71–75. https://doi.org/10.1016/s0014-5793(00)01570-2 (2000) Grobet, L. et al. A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nat. Genet. 17, 71–74. https://doi.org/10.1038/ng0997-71 (1997) Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle McPherron, A. C. & Lee, S.-J. Double muscling in cattle due to mutations in the myostatin gene. Proc. Natl. Acad. Sci. USA https://doi.org/10.1073/pnas.94.23.12457 (1997) Mosher, D. S. et al. A mutation in the myostatin gene increases muscle mass and enhances racing performance in heterozygote dogs. PLoS Genet. 3, e79. https://doi.org/10.1371/journal.pgen.0030079 (2007) Schuelke, M. et al. Myostatin mutation associated with gross muscle hypertrophy in a child. N. Engl. J. Med. 350, 2682–2688. https://doi.org/10.1056/NEJMoa040933 (2004) Lee, S.-J. & McPherron, A. C. Regulation of myostatin activity and muscle growth. Proc. Natl. Acad. Sci. USA https://doi.org/10.1073/pnas.151270098 (2001) Thies, R. S. et al. GDF-8 propeptide binds to GDF-8 and antagonizes biological activity by inhibiting GDF-8 receptor binding. Growth Factors https://doi.org/10.3109/08977190109029114 (2001) Zimmers, T. A. et al. Induction of cachexia in mice by systemically administered myostatin. Science 296, 1486–1488. https://doi.org/10.1126/science.1069525 (2002) Wolfman, N. M. et al. Activation of latent myostatin by the BMP-1/tolloid family of metalloproteinases. Proc. Natl. Acad. Sci. USA https://doi.org/10.1073/pnas.2534946100 (2003) Anderson, S. B., Goldberg, A. L. & Whitman, M. Identification of a novel pool of extracellular pro-myostatin in skeletal muscle. J. Biol. Chem. https://doi.org/10.1074/jbc.M706678200 (2008) Lee, S. J. et al. Regulation of muscle growth by multiple ligands signaling through activin type II receptors. Proc. Natl. Acad. Sci. U.S.A. 102, 18117–18122. https://doi.org/10.1073/pnas.0505996102 (2005) Saitoh, M. et al. Myostatin inhibitors as pharmacological treatment for muscle wasting and muscular dystrophy. JCSM Clin. Rep. 2, 1–10. https://doi.org/10.17987/jcsm-cr.v2i1.37 (2017) Becker, C. et al. Myostatin antibody (LY2495655) in older weak fallers: A proof-of-concept, randomised, phase 2 trial. The Lancet 3, 948–957. https://doi.org/10.1016/s2213-8587(15)00298-3 (2015) Woodhouse, L. et al. A Phase 2 Randomized study investigating the efficacy and safety of myostatin antibody LY2495655 versus placebo in patients undergoing elective total hip arthroplasty. J. Frailty Aging 5, 62–70. https://doi.org/10.14283/jfa.2016.81 (2016) Zhu, Y. et al. LC-MS/MS multiplexed assay for the quantitation of a therapeutic protein BMS-986089 and the target protein Myostatin. Bioanalysis 8, 193–204. https://doi.org/10.4155/bio.15.238 (2016) Campbell, C. et al. Myostatin inhibitor ACE-031 treatment of ambulatory boys with Duchenne muscular dystrophy: Results of a randomized, placebo-controlled clinical trial. Muscle Nerve 55, 458–464. https://doi.org/10.1002/mus.25268 (2017) Glasser, C. E. et al. Locally acting ACE-083 increases muscle volume in healthy volunteers. Muscle Nerve 57, 921–926. https://doi.org/10.1002/mus.26113 (2018) Garber, K. No longer going to waste. Nat. Biotechnol. 34, 458–461. https://doi.org/10.1038/nbt.3557 (2016) Madireddi, M. et al. BMS-986089 is a high affinity anti-myostatin adnectin that increases muscle volume in three preclinical species. Neuromusc. Disord. 26, S94–S95. https://doi.org/10.1016/j.nmd.2016.06.036 (2016) Suh, J. & Lee, Y. S. Myostatin inhibitors: Panacea or predicament for musculoskeletal disorders?. J. Bone Metab. 27, 151–165. https://doi.org/10.11005/jbm.2020.27.3.151 (2020) Sinha, M. et al. Restoring systemic GDF11 levels reverses age-related dysfunction in mouse skeletal muscle. Science 344, 649–652. https://doi.org/10.1126/science.1251152 (2014) Egerman, M. A. et al. GDF11 increases with age and inhibits skeletal muscle regeneration. Cell. Metab. 22, 164–174. https://doi.org/10.1016/j.cmet.2015.05.010 (2015) Hammers, D. W. et al. Supraphysiological levels of GDF11 induce striated muscle atrophy. EMBO Mol. Med. 9, 531–544. https://doi.org/10.15252/emmm.201607231 (2017) Jin, Q., Qiao, C., Li, J., Li, J. & Xiao, X. Neonatal systemic AAV-mediated gene delivery of GDF11 inhibits skeletal muscle growth. Mol. Ther. 26, 1109–1117. https://doi.org/10.1016/j.ymthe.2018.01.016 (2018) Rinaldi, F., Zhang, Y., Mondragon-Gonzalez, R., Harvey, J. & Perlingeiro, R. C. R. Treatment with rGDF11 does not improve the dystrophic muscle pathology of mdx mice. Skelet. Muscle 6, 21. https://doi.org/10.1186/s13395-016-0092-8 (2016) Walker, R. G. et al. Biochemistry and biology of GDF11 and myostatin: Similarities, differences, and questions for future investigation. Circ. Res. 118, 1125–1141. https://doi.org/10.1161/CIRCRESAHA.116.308391 (2016) Li, Z. et al. Influence of molecular size on tissue distribution of antibody fragments. MAbs 8, 113–119. https://doi.org/10.1080/19420862.2015.1111497 (2016) Shah, D. K. & Betts, A. M. Towards a platform PBPK model to characterize the plasma and tissue disposition of monoclonal antibodies in preclinical species and human. J. Pharmacokinet Pharmacodyn. 39, 67–86. https://doi.org/10.1007/s10928-011-9232-2 (2012) Igawa, T. et al. Antibody recycling by engineered pH-dependent antigen binding improves the duration of antigen neutralization. Nat. Biotechnol. 28, 1203–1207. https://doi.org/10.1038/nbt.1691 (2010) Iwayanagi, Y. et al. Inhibitory FcgammaRIIb-mediated soluble antigen clearance from plasma by a pH-dependent antigen-binding antibody and its enhancement by Fc engineering. J. Immunol. 195, 3198–3205. https://doi.org/10.4049/jimmunol.1401470 (2015) Igawa, T., Haraya, K. & Hattori, K. Sweeping antibody as a novel therapeutic antibody modality capable of eliminating soluble antigens from circulation. Immunol. Rev. 270, 132–151. https://doi.org/10.1111/imr.12392 (2016) Igawa, T., Mimoto, F. & Hattori, K. pH-dependent antigen-binding antibodies as a novel therapeutic modality. Biochim. Biophys. Acta 1943–1950, 2014. https://doi.org/10.1016/j.bbapap.2014.08.003 (1844) Haraya, K., Tachibana, T. & Igawa, T. Improvement of pharmacokinetic properties of therapeutic antibodies by antibody engineering. Drug Metab. Pharmacokinet. 34, 25–41. https://doi.org/10.1016/j.dmpk.2018.10.003 (2019) Ganesan, L. P. et al. FcgammaRIIb on liver sinusoidal endothelium clears small immune complexes. J. Immunol. 189, 4981–4988. https://doi.org/10.4049/jimmunol.1202017 (2012) D’Hooghe, L., Chalmers, A. D., Heywood, S. & Whitley, P. Cell surface dynamics and cellular distribution of endogenous FcRn. PLoS ONE 12, e0182695. https://doi.org/10.1371/journal.pone.0182695 (2017) Sampei, Z. et al. Antibody engineering to generate SKY59, a long-acting anti-C5 recycling antibody. PLoS ONE 13, e0209509. https://doi.org/10.1371/journal.pone.0209509 (2018) Lach-Trifilieff, E. et al. An antibody blocking activin type II receptors induces strong skeletal muscle hypertrophy and protects from atrophy. Mol. Cell. Biol. 34, 606–618. https://doi.org/10.1128/mcb.01307-13 (2014) Melacini, P. et al. Cardiac and respiratory involvement in advanced stage Duchenne muscular dystrophy. Neuromusc. Disord. 6, 367–376. https://doi.org/10.1016/0960-8966(96)00357-4 (1996) McDonald, C. M. et al. Ataluren in patients with nonsense mutation Duchenne muscular dystrophy (ACT DMD): a multicentre, randomised, double-blind, placebo-controlled, phase 3 trial. Lancet (London, England) 390, 1489–1498. https://doi.org/10.1016/s0140-6736(17)31611-2 (2017) Syed, Y. Y. Eteplirsen: First global approval. Drugs 76, 1699–1704. https://doi.org/10.1007/s40265-016-0657-1 (2016) Reinig, A. M., Mirzaei, S. & Berlau, D. J. Advances in the treatment of duchenne muscular dystrophy: New and emerging pharmacotherapies. Pharmacotherapy 37, 492–499. https://doi.org/10.1002/phar.1909 (2017) Rasch, A., Bystrom, A. H., Dalen, N., Martinez-Carranza, N. & Berg, H. E. Persisting muscle atrophy two years after replacement of the hip. J. Bone Joint Surg. 91, 583–588. https://doi.org/10.1302/0301-620x.91b5.21477 (2009) Rosenberg, I. H. Sarcopenia: origins and clinical relevance. J. Nutr. 127, 990s–991s. https://doi.org/10.1093/jn/127.5.990S (1997) Qiu, S. et al. Increasing muscle mass improves vascular function in obese (db/db) mice. J. Am. Heart Assoc. 3, e000854. https://doi.org/10.1161/jaha.114.000854 (2014) Wagner, K. R. et al. A phase I/IItrial of MYO-029 in adult subjects with muscular dystrophy. Ann. Neurol. 63, 561–571. https://doi.org/10.1002/ana.21338 (2008) Wagner, K. R., McPherron, A. C., Winik, N. & Lee, S. J. Loss of myostatin attenuates severity of muscular dystrophy in mdx mice. Ann. Neurol. 52, 832–836. https://doi.org/10.1002/ana.10385 (2002) Walker, R. G. et al. Structural basis for potency differences between GDF8 and GDF11. BMC Biol. 15, 19. https://doi.org/10.1186/s12915-017-0350-1 (2017) Expression of growth/differentiation factor 11 a new member of the BMP/TGFbeta superfamily during mouse embryogenesis Gamer, L. W., Cox, K. A., Small, C. & Rosen, V. Gdf11 is a negative regulator of chondrogenesis and myogenesis in the developing chick limb. Dev. Biol. https://doi.org/10.1006/dbio.2000.9981 (2001) McPherron, A. C., Lawler, A. M. & Lee, S.-J. Regulation of anterior/posterior patterning of the axial skeleton by growth/differentiation factor 11. Nat. Genet. https://doi.org/10.1038/10320 (1999) Suh, J. et al. GDF11 promotes osteogenesis as opposed to MSTN, and follistatin, a MSTN/GDF11 inhibitor, increases muscle mass but weakens bone. Proc. Natl. Acad. Sci. USA 117, 4910–4920. https://doi.org/10.1073/pnas.1916034117 (2020) Zhang, Y. H. et al. GDF11/BMP11 activates both smad1/5/8 and smad2/3 signals but shows no significant effect on proliferation and migration of human umbilical vein endothelial cells. Oncotarget 7, 12063–12074. https://doi.org/10.18632/oncotarget.7642 (2016) Winbanks, C. E. et al. The bone morphogenetic protein axis is a positive regulator of skeletal muscle mass. J. Cell. Biol. 203, 345–357. https://doi.org/10.1083/jcb.201211134 (2013) Pirruccello-Straub, M. et al. Blocking extracellular activation of myostatin as a strategy for treating muscle wasting. Sci. Rep. 8, 24. https://doi.org/10.1038/s41598-018-20524-9 (2018) Tanigaki, K. et al. C-reactive protein causes insulin resistance in mice through Fcgamma receptor IIB-mediated inhibition of skeletal muscle glucose delivery. Diabetes 62, 721–731. https://doi.org/10.2337/db12-0133 (2013) Chazaud, B. et al. Dual and beneficial roles of macrophages during skeletal muscle regeneration. Exerc. Sport Sci. Rev. 37, 18–22. https://doi.org/10.1097/JES.0b013e318190ebdb (2009) Marzuca-Nassr, G. N., Vitzel, K. F., Murata, G. M., Marquez, J. L. & Curi, R. Experimental model of HindLimb suspension-induced skeletal muscle atrophy in rodents. Methods Mol. Biol. 1916, 167–176. https://doi.org/10.1007/978-1-4939-8994-2_16 (2019) Ueyama, A. et al. Inhibition of MEK1 signaling pathway in the liver ameliorates insulin resistance. J. Diabetes Res. 2016, 8264830. https://doi.org/10.1155/2016/8264830 (2016) Download references We thank all the research assistants at Chugai Pharmabody Research Pte We thank Chugai Research Institute for Medical Science This study was funded by Chugai Pharmaceutical Co. performed antibody generation and antibody engineering provided supervisory support and contributed to the critical discussion of this study All authors reviewed and gave their final approval for the manuscript All authors are employees of Chugai Pharmaceutical Co. Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations Download citation DOI: https://doi.org/10.1038/s41598-021-81669-8 Anyone you share the following link with will be able to read this content: a shareable link is not currently available for this article Molecular and Cellular Biochemistry (2025) Sign up for the Nature Briefing newsletter — what matters in science « Back As the baby boomer generation reaches old age the number of people with Alzheimer’s disease and types of dementia is expected to skyrocket these diseases will place uneven burden on individuals and families in underrepresented populations gender and socioeconomic groups who have received less attention in aging research.  A new program at the University of Illinois Chicago called the Center for Health Equity in Cognitive Aging will address these gaps by funding research mentoring early-career faculty and connecting UIC to a national network in this area the center will focus not just on the care that persons with dementia receive but also the experiences and challenges of their care providers paid caregivers and health care professionals.  because it happens in the home and in private spaces,” said Muramatsu “Making the invisible visible is critical for people to recognize and address inequity in the health and well-being of people with or at risk for dementia It’s important for researchers from diverse backgrounds and perspectives to uncover diversity in lived experiences of people deeply affected by the progression of the disease.”  Funded by a $3 million grant from the National Institute of Aging, the Center for Health Equity in Cognitive Aging is the newest of 18 Resource Centers for Minority Aging Research across the U.S. and the first in a Midwestern urban area.   “This network means that we can provide opportunities not just within UIC but also link scientists to the outside world so they have access to leaders in the field from all over the nation,” said Bhatt professor of physical therapy and rehabilitation sciences this center’s strength lies in amalgamating behavioral health promotion and population-science approaches for advancing dementia care and caregiving research.”  The center’s Scientist Program accepted three pilot projects in its first round, and the second call for solicitations is open until Jan. 31 The opportunity is available to researchers from all corners of UIC “This center is about social and behavioral science research on aging and that needs to include all of our departments and colleges,” Muramatsu said “This is an opportunity for us to really work with all parts of campus and engage researchers who may be doing aging research without knowing it That is the real strength of UIC; it has everything.”  Uncovering the links between culture and cognitive health  The first cohort of funded researchers and pilot projects demonstrates the critical work that the Center for Health Equity in Cognitive Aging hopes to accomplish.  Kelechi Ibe-Lamberts clinical associate professor of community health sciences in the School of Public Health considers himself a “1.5-generation” Nigerian American growing up in Africa before moving to the U.S That life experience informs his research interest on individuals who feel their identity draws from the cultures of their former and current countries.  His study will combine focus groups and surveys of caregivers for people with dementia gathering information to build interventions tailored and beneficial to these transnational communities And by tapping into the national network of aging research centers he hopes the results will propagate broadly.  “I would love to be able to use this information to inform physicians about some of the barriers and the uniqueness of transnational African immigrants in their practices and identities and how it plays a role in their day-to-day life and actions and choices,” Ibe-Lamberts said “I want to use this study to be a springboard for pushing the agenda of improving the aging resources for African immigrants that are here in the U.S. especially those that are planning to stay here and potentially die here.”  Jennifer Kwok assistant professor of health policy and administration in the School of Public Health will draw upon her background in economics to examine the health and financial burdens on spouses and other caregivers She will use datasets from the Health and Retirement Study the Centers for Medicare and Medicaid Services and the U.S Census Bureau to analyze this population and characterize the potential needs of caregivers to help inform policies.  one of the things we don’t really know all that much about is the impact of cognitive impairment and dementia on spouses and how that varies across different racial and ethnic minority populations,” Kwok said “Having this information will be useful for us to figure out how we can help people with caregiving.”  Dalmina Arias, clinical assistant professor of occupational therapy in the College of Applied Health Sciences, will use her pilot funding to expand an existing intervention to new populations. IPROACTIF, a primary care-based program developed by Mansha Mirza at UIC connects older adults with chronic health conditions such as hypertension and diabetes with occupational therapists that assess their home environment needs and goals to try and prevent hospitalization.   Arias will adapt the program for Spanish-speaking patients and families going beyond translation to tailor strategies for cultural differences around food family caregiving and use of health care resources with making this ambitious work feel possible.  “I can’t emphasize enough how valuable it is having these connections and this opportunity so early in our careers,” Arias said.  That echoes the mission of the program as it begins its first five-year term “For assistant professors wanting to pursue scholarship and without proper mentorship they cannot launch themselves into research careers,” Bhatt said “We want to build an environment of shared mentoring and advancing science in this field.”  The Center for Health Equity in Cognitive Aging is supported by the National Institute on Aging of the National Institutes of Health (P30AG083255). For more information and to get involved, visit the Center for Health Equity in Cognitive Aging website.  , , , Haruki Muramatsu will begin his defence of the PDC Asian Championship title on Saturday in Manila - watch this weekend on PDCTV the 48-player field for this year's event have now been confirmed - as 16 players joined players from the PDC Asian Tour Order of Merit and a series of international qualifiers A $100,000 prize fund is on offer in the event alongside places in the Mr Vegas Grand Slam of Darts for the eventual champion and the Paddy Power World Darts Championship for both finalists Muramatsu was last year's champion and will be seeded fifth for the 2024 event with seeding based on the PDC Asian Tour Order of Merit and headlined by Philippines stars Alexis Toylo and Lourence Ilagan 2022 Asian Championship winner Christian Perez will be bidding to recapture the title while iconic Singapore ace Paul Lim is also in action Saturday's first of two days of action will feature the round-robin stage before the group winners then progress to play in the last 16 The PDC Asian Championship will be streamed on PDCTV for all subscribers worldwide Powered by Zoocha Volume 3 - 2022 | https://doi.org/10.3389/fdmed.2022.864406 This article is part of the Research TopicInsights in Regenerative Dentistry: 2021View all 5 articles Regenerative endodontic cell-homing procedures are frequently performed on injured immature teeth diagnosed with pulp necrosis and/or apical periodontitis The representative histological finding after those procedures is cementum-like tissues filling in the root canal but details of the healing process remain unknown We investigated that healing process histologically using a mouse in situ model Regenerative endodontic procedures were experimentally performed on noninfected maxillary first molars of 6-week-old male C57BL/6 mice after which the healing process was investigated using histology and immunohistochemistry Immediately after the regenerative endodontic cell-homing procedures blood clots were seen in the root canals that disappeared over time the blot clot in the root canal was replaced by granulation tissue cementum-like tissues were filled in the root canals while the amount of fibrous tissue was reduced positive reactions for periostin were seen in the fibrous tissue in the root canal positive reactions for nestin were not detected in the root canal CD31-positive cells with a luminal structure were also observed in the fibrous tissue around the apex and around the newly formed cementum-like tissues in the root canal we have established an in situ mouse model of regenerative endodontic procedures The results of this study suggest that periodontal ligament cells and vascular endothelial cells grow into the root canals from the apex and participate in the formation of cementum-like tissues with angiogenesis during the healing process of regenerative endodontic procedures small animals are easy to handle and more economical one problem with experimental models using large animals is that it is difficult to perform detailed histological investigations during the healing process over time the process of cell migration into the root canal and new hard tissue formation that was added to the root canal wall and the apical region has not been fully elucidated establishing a small animal model that can easily elucidate histological changes over time is necessary developed a mouse experimental model of regenerative endodontics The purpose of this study was to elucidate the involvement of migrating cells into the root canal immunohistochemically and the formation of hard tissue added to the root canal wall and the apical region All animal experiments were performed according to the Guidelines for the Treatment of Animals at the Tokyo Dental College (Approval No which still had thin root dentin with wide root apex Seven mice were used at each time point for histological and immunohistochemical analyses thirty-four mice that had their temporary seals removed during the postoperative course and had root canal infection or apical lesions were excluded The experimental group was a group in which blood clots were formed on the mesial root of the right maxillary first molar (M1) and then covered and filled The untreated left maxillary first molars on the opposite side were used as a control The procedure was performed according to the method of Xu et al. (29) General anesthesia was administered intraperitoneally using a mixed anesthetic of medetomidine hydrochloride (0.3 mg/kg After the operative field was disinfected with ethanol endodontic access opening into the pulp chamber was performed on the mesial occlusal surface of M1 using a round-type carbide bur (Zipperler; VDW GmbH The dental pulp of the mesial root canal was mechanically removed with a #6 K-file (MANI Japan) under a surgical microscope (Stemi 508; Zeiss and was chemically cleaned with 10% sodium hypochlorite solution (Neo Cleaner; Neo Dental Chemical Products Co. Japan) and 3% ethylenediaminetetraacetic acid (EDTA) solution (Smear Clean; Nishika The #6 K-file was then approached via the mesial root canal and bleeding from the outside of the apical foramen was initiated Hemostasis was done using a sterile article point to form a blood clot The upper part of the blood clot (just below the root canal orifice) was covered with mineral trioxide aggregate (MTA) cement (Bio MTA cement and the cavity was sealed with adhesive resin cement (Super-Bond perfusion fixation with 4% paraformaldehyde in 0.1 M phosphate buffer (PFA; pH 7.4) was performed transcardially and the dissected upper jaws were immersed for 24 h in the same fixative After decalcification with 10% EDTA for 1 week at 4°C the tissues were trimmed at the midline of the palate with a razor and embedded into the paraffin with the midline facing the bottom The paraffin block was cut from the palatal side and the 4-μm-thick serial sagittal sections were prepared The sections were stained with Hematoxylin and eosin (H&E) and were observed and photographed using a universal photographic microscope (UPM Axiophoto2 antigen activation treatment was performed using the microwave method the slides were microwaved at 70°C continuously for 20 min using a microwave processor (Microwave Processor MI-77 Japan) and then were reacted at room temperature for 30 min a 10 mM sodium citrate buffer (pH 6.0) was used and for the anti-periostin and anti-CD31 antibodies The sections were immersed in 3% hydrogen peroxide in methanol for 30 min to inactivate endogenous peroxidase After blocking with 3% bovine serum albumin (BSA; Sigma-Aldrich they were incubated with an anti-nestin antibody (dilution 1:300; anti-nestin monoclonal antibody an anti-periostin antibody (dilution 1:500; anti-periostin antibody and an anti-CD31 antibody (dilution 1:500; anti-CD31 antibody After washing in phosphate buffered saline (PBS) three times the sections were incubated with horseradish peroxidase (HRP) conjugated secondary antibody (EnVision TM+ Dual Link System-HRP a 3,3′-diaminobenzidine-tetrahydrochloride (DAB) solution (ImmPACT® DAB The sections were counterstained with Mayer's hematoxylin solution for 60 s and then were observed and photographed using a photographic microscope (UPM Axiophoto2 the sections were incubated with 3% BSA instead of the primary antibodies We measured the root length and width of the mesial roots of the maxillary M1 in each group postoperatively. The root length was set as the distance from the mesial cement-enamel junction to the apical foramen and was measured at the longest distance. Measurement of root width was carried out according to the method of Lee et al. (30) The root width included the root dentin and cementum in the mesial and distal walls was measured at the widest site If the apex foramen or root canal was obliterated the full width of the root from the mesial wall to the distal wall was measured then half of the value was designated as the root width the length and the width of untreated roots were measured The time course for measuring those parameters was selected from 7 to 28 days postoperatively All quantitative data in the experimental group and the untreated control group are expressed as the mean and SD of each group Analysis software (IBM SPSS 27.0 J for Windows; SPSS Japan Japan) was used for statistical processing and a p < 0.05 is considered significant Statistical analysis of each measurement item was performed as follows: At each postoperative time 2 groups were compared between the experimental group with the control group After confirming the normality of the data and the uniformity of the homogeneity of variance Student's t-test was performed on the comparison between the two homoscedastic groups The root canal wall and the apical foramen became thicker over time The mineralized tissue obliterated the root canal and apical closure was seen We confirmed that the root canal wall and the mineralized tissue were continuous and filled with the mineralized tissue rather than the existing dentin wall no pulp- or dentin-like structures characterized by the presence of polarized odontoblast-like cells adjacent to the dentin-like tissue that had dentinal tubes were seen Histological evaluation of the postoperative healing process (A) One hour post the regenerative endodontics procedure The pulp tissue of the mesial root was removed and no odontoblasts were found The root canal was filled with blood clot-like structures containing erythrocyte components Periodontal ligament tissue around the apex showed debris of torn tissue and partial hemorrhage Dark brown granules are MTA cement (white asterisk) (B) Higher magnification of the black box area in (A) (C) One day post the regenerative endodontics procedure a decrease of blood clot-like structures was observed in the mesial root canal and around the apex Although a decrease in erythrocytes was found around the apex (D) Higher magnification of the black box area in (C) Ingrowth of fibrous tissue from the apex is seen (E) Three days after the regenerative endodontics procedure Further reduction of blood clot-like structures was seen in the root canal and around the apex and the root canal was filled with loose fibrous tissues (F) Higher magnification of the black box area in (E) Spindle-shaped fibroblast-like cells (black asterisk) were observed from the apex instead of blot clots (G) Seven days post the regenerative endodontics procedure No blood clot-like structures were observed in the root canal and dense fibrous tissues with vessels were seen in the root canal (H) Higher magnification of the black box area in (G) Dilated vessels were observed in the root canal (arrowhead) (I) Fourteen days post the regenerative endodontics procedure Newly formed mineralized tissue was observed in the root canal Mineralized tissue was added adjacent to the apex and the root canal wall and was also found directly beneath the MTA cement The area of fibrous connective tissue in the root canal was narrowing (J) Higher magnification of the black box area in (I) The newly formed mineralized tissue in the root canal contained cellular components (black arrow) (K) Twenty-one days post the regenerative endodontics procedure the mineralized tissue added to the root canal wall and the root width around the apex increased over time (L) Higher magnification of the black box area in (K) Extensive mineralized tissue was seen in the root canal and cellular components were present in the matrix (M) Twenty-eight days post the regenerative endodontics procedure Bone-like or cementum-like mineralized tissue was widespread in the root canal wall and apex over time (N) Higher magnification of the black box area in (N) The apical foramen was closed by the addition of mineralized tissue Cells were embedded in the matrix of the mineralized tissue (white arrow) (Scale bars = 200 μm in A Representative IHC-stained images of the experimental group at 3 days Nestin: (A,B); Periostin: (C,D); CD31: (E,F) (A) No nestin-positive cells were observed in the mesial root canal or around the apex No cells showing a nestin-positive reaction were found around the fibroblast-like cells growing from the apex (C) Localization of periostin-positive cells was markedly observed in the mesial root canal and the PDL area around the apex Periostin-positive cells were observed around the spindle-shaped fibroblast-like cells growing in the root canal from the periapical tissue (E) Positive cells showing immunoreactivity to CD31 were markedly observed in the PDL region around the mesial root and directly under the gingival epithelium Spindle-shaped vascular endothelial cells showing immunoreactivity to CD31 (black arrow) were observed near the apex of the root canal (Scale bars = 200 μm in A Representative IHC-stained images of the experimental group at 7 days No cells showing a nestin-positive reaction were observed in the immature granulation tissue that filled the root canal (C) Periostin-positive cells were markedly observed in the mesial root canal and in the surrounding PDL region A marked periostin-positive reaction was observed in the periapical fibrotic connective tissue and in the immature granulation tissue that filled the root canal (E) CD31-positive reaction was observed in the immature granulation tissue of the mesial root canal spindle-shaped vascular endothelial cells (arrowhead) and new blood vessels with a luminal structure (black arrow) were observed that were positive for CD31 (Scale bars = 200 μm in A Representative IHC-stained images of the experimental group at 14 days (A) No cells showing a nestin-positive reaction were observed in the root canal and periapical tissues No cells showing nestin-positive reaction were observed around the newly formed mineralized tissue in the root canal (C) A marked periostin-positive reaction was observed in the PDL region around the mesial root and in the newly formed calcified tissue in the root canal a marked periostin-positive reaction was observed around the newly formed mineralized tissue and in cells embedded in the matrix of the cementum-like hard tissue (E) CD31-positive reaction was observed in the center area of the root canal The presence of a new blood vessel with a lumen-like structure showing a CD31-positive reaction (black arrow) was observed at the center area of the root canal (Scale bars = 200 μm in A In both the control and the experimental groups, gradual root development was observed over time (Figure 5) The root length of the untreated control group became elongated from 890 to 950 μm over time the root length of the experimental group became elongated from 860 to 940 μm over time The root length in the control group was significantly higher than in the experimental group at 7 and 14 days but there was no significant difference between the two groups at 21 and 28 days Comparison of postoperative root elongation between the experimental and the untreated control groups at 7 In both the untreated control and the experimental groups with blood clots gradual root elongation was observed over time The root length of the control group became elongated from 890 to 950 μm over time The root length in the control group was significantly higher than in the experimental group at 7 and 14 days there was no statistically significant difference between the two groups at 21 and 28 days (n = 7 per group) In both the control and the experimental groups, a gradual increase in root width was observed over time (Figure 6) The root width in the untreated control group increased from 380 to 450 μm and the root width in the experimental group increased from 410 to 530 μm There was not a statistically significant difference in the root width between the control group and the experimental group at 7 days but the root width in the experimental group was significantly thicker than in the control group at 14 Comparison of postoperative root width between the experimental and the control groups at 7 gradually thickened roots were observed over time The root width in the control group increased from 380 to 450 μm and that in the experimental group increased from 410 to 530 μm There was not a statistically significant difference in the root width between the two groups at 7 days the root width in the experimental group was significantly thicker than in the control group at 14 This is the first report detailing histological findings during the healing process of regenerative endodontics over time as far as we know These results should allow the identification of the origin of cells associated with the healing process using gene-altered mice in the future the mineralized tissue contains cells in the matrix and would be osteoid but the tissue is continuous with the cellular cementum at the apex along the root canal wall cementum does not contain vessels in the matrix and our immunohistochemical finding also shows the newly formed mineralized tissue does not contain CD31 positive blood vessels in the matrix our results suggest that the mineralized tissue is cementum-like hard tissue Angiogenesis is necessary for tissue regeneration or repair to supply oxygen and eliminate waste products Although regenerative endodontics has been called pulp revascularization angiogenesis during the procedure has not well been investigated histologically We assessed the localization of CD31-positive cells to detect endothelial cells and confirmed that CD31-positive vascular cells had grown in from the apex CD31-positive cells with a vascular luminal structure were observed in the root canal and around the mineralized tissue over time The histological replacement of blot clots with fibrous tissues with vessels is well described in the earlier reports but was not characterized The results of this study show histological evidence of that replacement process during the wound healing after the procedure This study identified new vessels that had grown in from the apical tissue and were observed adjacent to newly mineralized tissue These findings imply that the ingrowth of vessels contributes not only to angiogenesis but also to the formation of newly mineralized tissue during the wound healing process Further study is needed to further clarify the mechanism involved Increased root width ensures that the root is held firmly by the PDL and alveolar fossa we think that the new structure with an increase in root width results in resistance to external stress which leads to the prevention of root fracture and occlusal force of the mice were different from those of humans and dogs The point is a limitation of the fracture resistance we have established a new animal model of regenerative endodontics using mice We demonstrated histological and immunohistochemical findings after the procedure in detail The results of this study suggest that blood clots are replaced by PDL cells (periostin-positive cells) and that vessels around the apex have grown into the root canal the fibrous tissue derived from PDL cells formed newly cementum-like mineralized tissue in the root canal and the apex over time These results serve as a basis for understanding the healing process after the regenerative endodontics procedure in detail and should contribute to further investigations of the procedure in the future The animal study was reviewed and approved by Animal Experiment Committee at Tokyo Dental College (approval number: 302101) All authors have read and agreed with submitting the article by a Private University Research Branding Project from MEXT of Japan (Multidisciplinary Research Center for Jaw Disease (MRCJD); Archiving Longevity and Sustainability by Comprehensive Reconstruction of Oral and Maxillofacial Functions) Shin-ichi Iwaya (Iwaya Dental Clinic) for their helpful discussion The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fdmed.2022.864406/full#supplementary-material Treatment of the immature tooth with a non-vital pulp and apical periodontitis PubMed Abstract | CrossRef Full Text | Google Scholar PubMed Abstract | CrossRef Full Text | Google Scholar Therapy for the divergent pulpless tooth by continued apical formation PubMed Abstract | CrossRef Full Text | Google Scholar Long-term calcium hydroxide as a root canal dressing may increase risk of root fracture Intrusive luxation of 60 permanent incisors: a retrospective study of treatment and outcome Prognosis of luxated non-vital maxillary incisors treated with calcium hydroxide and filled with gutta-percha Mahidol study 1: comparison of radiographic and survival outcomes of immature teeth treated with either regenerative endodontic or apexification methods: a retrospective study Revascularization of an immature permanent tooth with apical periodontitis and sinus tract Revascularization of immature permanent teeth with apical periodontitis: new treatment protocol Revascularization of an immature permanent tooth with periradicular abscess after luxation Efficacy of revascularization to induce apexification/apexogensis in infected Regenerative endodontic treatment (revascularization) for necrotic immature permanent molars: a review and report of two cases with a new biomaterial Pulp revascularization of immature teeth with apical periodontitis: a clinical study Functional dental pulp regeneration: Basic research and clinical translation Regenerative endodontics: a review of current status and a call for action Regenerative endodontic procedures: Clinical outcomes PubMed Abstract | CrossRef Full Text | Google Scholar Clinical and radiographic outcomes of immature teeth treated with different treatment protocols of regenerative endodontic procedures: a retrospective cohort study Histological findings of revascularized/revitalized immature permanent molar with apical periodontitis using platelet-rich plasma and histological observation of a human immature permanent tooth with chronic apical abscess after revitalization treatment Histologic and immunohistochemical findings of a human immature permanent tooth with apical periodontitis after regenerative endodontic treatment Histologic outcomes of uninfected human immature teeth treated with regenerative endodontics: 2 case reports Pulp revascularization of immature dog teeth with apical periodontitis Histologic characterization of regenerated tissues in canal space after the revitalization/revascularization procedure of immature dog teeth with apical periodontitis Tissue engineering strategies for immature teeth with apical periodontitis Histologic characterization of engineered tissues in the canal space of closed-apex teeth with apical periodontitis Histologic analysis of the influence of a gelatin-based scaffold in the repair of immature dog teeth subjected to regenerative endodontic treatment Histologic examination of teeth with necrotic pulps and periapical lesions treated with 2 scaffolds: an animal investigation Effect of residual bacteria on the outcome of pulp regeneration in vivo Systemically transplanted bone marrow-derived cells contribute to dental pulp regeneration in a chimeric mouse model The role of angiogenesis and pulpal healing in tooth replantation and allograft transplantation Impact of remnant healthy pulp and apical tissue on outcomes after simulated regenerative endodontic procedure in rat molars Histologic study of a human immature permanent premolar with chronic apical abscess after revascularization/revitalization Histologic findings of a human immature revascularized/regenerated tooth with symptomatic irreversible pulpitis Comprehensive characterization of 2 immature teeth treated with regenerative endodontic procedures PERIOSTIN: role in formation and maintenance of dental tissues Effects of various thicknesses and levels of mineral trioxide aggregate coronal plugs on nanoleakage and fracture resistance in revascularization: an in vitro study Evaluation of the delivery of mesenchymal stem cells into the root canal space of necrotic immature teeth after clinical regenerative endodontic procedure Perivascular niche of postnatal mesenchymal stem cells in human bone marrow and dental pulp Decision-making and management of immature permanent teeth with crown fractures in small animals- a review and Biomechanical Evaluation of Combined Application of Platelet-rich Fibrin with Blood Clot in Regenerative Endodontics Effect of mineral trioxide aggregate plug location on root development in regenerative endodontic procedure Keywords: regenerative endodontic procedures Jung H-S and Muramatsu T (2022) Periodontal Ligament Cells Are Involved in the Formation of Intracanal Cementum-Like Tissue After Regenerative Endodontic Procedures: A Mouse in situ Model Received: 28 January 2022; Accepted: 06 April 2022; Published: 11 May 2022 Copyright © 2022 Komada, Mitomo, Ikarashi, Shimono, Jung and Muramatsu. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) *Correspondence: Takashi Muramatsu, dG11cmFtYXRAdGRjLmFjLmpw This website is using a security service to protect itself from online attacks The action you just performed triggered the security solution There are several actions that could trigger this block including submitting a certain word or phrase You can email the site owner to let them know you were blocked Please include what you were doing when this page came up and the Cloudflare Ray ID found at the bottom of this page Jichi Children’s Medical Center in Tochigi Prefecture Four gene-therapy clinical trials starting in 2020 will make use of improved delivery viruses from Jichi Medical University to tackle serious neurological disorders Adeno-associated viral (AAV) vectors are viruses used to deliver gene therapies to different cells They are considered one of the field’s most effective delivery tools AAVs show particular promise in the treatment of neurological disorders and aromatic L-amino acid decarboxylase (AADC) deficiency and ability to cross the blood–brain barrier much research has focused on establishing the safety and long-term efficacy of AAV vector-mediated gene therapies including navigating problems such as ectopic gene expression and long-term persistence “We have seen remarkable results from clinical trials using AAV vectors for AADC gene transfer,” says Shin-ichi Muramatsu and a professor in Jichi Medical University’s Neurology Department “Children with AADC deficiency at a hospital in Taiwan showed improvement in motor function while other patients in Japan have also shown recovery of swallowing and respiratory functions Increased uptake of an aromatic L-amino acid decarboxylase tracer after a gene-therapy clinical trial Such successes have contributed to the growing recognition of gene therapies as viable treatment strategies in Japan Clinical trials starting in 2020 for neurological conditions GM2 gangliosidosis and spinocerebellar ataxia type 1 have been approved for funding by the Japan Agency for Medical Research and Development (AMED) Muramatsu points out that Jichi Medical University — including the aforementioned AADC work by Takanori Yamagata’s group at Jichi’s paediatric hospital — is currently the only Japanese centre conducting clinical studies using AAV vectors Muramatsu has been at the forefront of this area for decades while working as a visiting associate at the National Institutes of Health (NIH) and subsequently developed other vectors for tissue-specific targeting he has been working on optimizing AAV vectors for haemophilia B and for liver-directed gene therapies and has led pre-clinical studies on rare diseases including Niemann Pick Disease Type C and ornithine transcarbamylase (OTC) deficiency “We are also now exploring ways to combine AAV vectors with gene-editing tools such as CRISPR/Cas9,” he says Such hybrid technologies could overcome the capacity limitation (roughly 4.5 kilobases) of AAV vectors and eventually help treat a wider range of diseases associated with larger genes such as haemophilia A and Duchenne muscular dystrophy Although developing gene therapies involves balancing safety interests The hozaki higan yaezakura is a rare species found growing in Muramatsu Park with countless blossoms on each branch The park was built in 1906 in commemoration of the Russo-Japanese military campaign so efforts are being made by the city of Gosen to preserve is proud and beautiful heritage for future generations is held when the blossoms are at their best With its spacious grounds and many attractions Muramatsu Park is an ideal destination for a leisurely hanami outing Sakura 100: Japan’s Best Blossoms Japan’s position as a center for monozukuri has been weakening against the backdrop of the remarkable growth of China which has positioned manufacturing as a national priority there are still many companies in Japan that can boast of a top share of their given markets One of those is the flute-maker Muramatsu Inc The gold flutes made by the company enjoy a huge share of the domestic and overseas markets “Our market share seems to be around 50% or 60% although I’m not sure of the exact figure,” explains the company’s president and CEO a student in Europe conducted a study that found that around 60% of the flutists in professional orchestras were using our flutes.” TANAKA Precious Metals (TANAKA) supplies the gold used to make Muramatsu flutes The company draws on its know-how in the manufacture and processing of precious metals for industrial use to provide Muramatsu with special seamless gold pipes that are manufactured without welding in the case of commodities produced in large lots automation is employed for processes like cutting and drawing to improve productivity but the seamless pipes supplied to Muramatsu are all made using hand-operated machines This is necessary because Muramatsu requires exquisite precision for its flutes Since subtle adjustments have to be made for every manufacturing process involved the work can only be performed by highly skilled craftsmen The manufacturing process to produce a seamless pipe begins with the melting and casting of the raw precious metal to create a cylindrical ingot The periphery of this ingot is then shaved down until the circumference is perfectly round and the inside of the metal is then hollowed out until it is also perfectly round who is the section chief manager of the Target Processing Section and the Rolling & Drawing Section of the Tomioka plant of TANAKA “If the work at this stage is not completed in a very precise manner the finished product will not be a high precision The person in charge makes minute adjustments down to the tenth of a millimeter to make sure the pipe is perfectly rounded and of uniform thickness." The hollowed-out gold pipe is many times thicker than the finished flute So the pipe has to be cold drawn using a draw bench but tens of times so that little by little it is pulled out to decrease the diameter The person in charge of this process is Masahiro Minakawa of the Rolling & Drawing Section at the Tomioka plant “I also rely on the intuition I have built through experience to create a finished pipe that meets the specifications,” he says Why is it important to have analog-based experience in an age when digitalization and IT technology are advancing so far One reason is the quality that TANAKA and Muramatsu have continually been raising through their partnership Tamura explains more about how the approach to quality was developed at Muramatsu: “We receive feedback on the quality of our flutes but since the music and musical instruments are a world of sensitivity most of this feedback does not take the form of numerical data we introduced various types of quality management from what we learned from the verification methods of the flute industry and other sources and try to use what we can to develop our production techniques.” There are many manufacturers in Japan and overseas that provide metal pipes When asked if Muramatsu has ever considered obtaining supplies from a maker other than TANAKA he immediately responds: “TANAKA is a company that supplies precious metals on a global scale but at the same time they can respond to high-quality have a beautiful tone and a luster that is like a work of art And each one is of course produced by hand TANAKA has been proud to be able to combine its own industry perspective to the traditional skills involved to create the handcrafted flutes of Muramatsu that have won a loyal following around the world Metrics details Clinical evidence has implicated diabetes mellitus as one of the risk factors for the development and progression of Alzheimer’s disease (AD) the neurotoxic pathway activated due to abnormalities in glucose metabolism has not yet been identified in AD In order to investigate the relationship between impaired cerebral glucose metabolism and the pathophysiology of AD SH-SY5Y human neuroblastoma cells were exposed to glyceraldehyde (GA) GA induced the production of GA-derived advanced glycation end-products (GA-AGEs) and cell apoptosis decreases in the medium concentrations of diagnostic markers of AD such as amyloid β 1-42 (Aβ42) and increases in tau phosphorylation These results suggest that the production of GA-AGEs and/or inhibition of glycolysis induce AD-like alterations and this model may be useful for examining the pathophysiology of AD are one of the missing links between AD and DM it currently remains unclear whether reductions in the utilization of glucose lead to the development of AD total tau and p-tauT181 proteins in culture media as well as the phosphorylation ratio of intracellular tau were then performed in order to determine the involvement of glucose metabolism in the pathophysiology of AD (a–d) Microscopic images of SH-SY5Y cells after a 24 h treatment with GA at 0 (a) (e) GA dose-dependently induced cell death in SH-SY5Y cells (f–i) GA-induced apoptosis was observed by staining with green fluorescent YO-PRO®-1 (g (f) and (h) show the same visual field of phase contrast images to (g) and (i) Characterization of GA-induced cytotoxicity in SH-SY5Y cells (a) GAPDH mRNA levels increased in a dose-dependent manner (b) Production of GA-AGEs by the GA treatment for 24 h GA-AGEs were measured by slot blotting analyses with an immunopurified anti-GA-AGE antibody Graphical representation of GA-AGE bands in the slot blot (c) Evaluation of lactic acid concentrations after the treatment with GA SH-SY5Y cells were pre-incubated with ACAC at concentrations of 0 (d) ACAC prevented GA-induced cytotoxicity ACAC significantly recovered cell death induced by 1 mM GA in a dose-dependent manner Changes in AD biomarkers after the GA treatment (a-c) Changes in AD biomarkers of Aβ42 (a) (d) Intracellular changes in T-tau and P-tau after a 24 h treatment with GA GA-dose dependently increased P-tau/T-tau after the GA treatment (e,f) Level changes in other AD biomarkers after the GA treatment mRNA expression levels were analyzed by real-time PCR after the GA treatment for 24 h GA significantly increased the levels of VEGF (e) and TGF-β (f) from a GA concentration of 0.7 mM The present study has three salient results: 1) GA induced the formation of GA-AGEs and exhibited cytotoxicity in SH-SY5Y cells 2) The mechanism underlying GA-induced cell death involved the inhibition of glycolysis and concomitant induction of GAPDH 3) Changes in the levels of AD biomarkers in GA-treated culture media were consistent with those in the CSF of AD patients these findings may partly explain the clinical link between DM and AD GA-AGEs are powerful candidate molecules for neurodegeneration in AD we focused on the mechanism underlying GA-AGE-induced neurotoxicity in the present study Glu-AGEs were detected in intracellular and extracellular sites whereas GA-AGEs were only found intracellularly This discrepancy indicated that the mechanisms underlying the neurotoxicity induced by Glu-AGEs and GA-AGEs differed suggesting that abnormalities in glycolysis may be involved in the neurotoxicity mechanism GAPDH inactivation due to intracellular GA production further increases intracellular GA concentrations resulting in increased GA-AGE production and nerve cell toxicity GA-AGEs may be one of the general causative agents of the development of neurodegenerative diseases These findings suggest that high levels of glycation and/or GA may be mimicked by AD CSF alterations and accompanied by numerous neuropathological consequences due to GA-AGEs rather than Glu-AGEs Although the exact mechanisms underlying the target of GA-AGEs and its downstream signaling pathway currently remain unclear the measurement of GA-AGE levels in the CSF and/or serum may be a useful biomarker for the early detection of AD SH-SY5Y human neuroblastoma cells were purchased from ECACC (The European Collection of Cell Cultures) Dulbecco’s Modified Eagle Medium (DMEM) and ACAC were obtained from Sigma-Aldrich (St All other chemicals not indicated were purchased from Wako Pure Chemical Industries Cells were cultured in DMEM on 6-well plates for 24 h followed by the addition of various concentrations (0 0.7 and 1 mM) of GA and all assays were performed after a further incubation for 24 h Cell viability was assessed using Cell counting kit-8 (Dojin Japan) according to the manufacturer’s instructions Apoptosis was examined by fluorescent microscopy using Vybrant® Apoptosis Assay Kit #4 (Invitrogen Corporation in which early apoptotic cells were detected with green fluorescent YO-PRO®-1 an aliquot of medium was centrifuged (600 g 4 °C) followed by recentrifugation of the supernatants (21,000 g 4 °C) and the resulting supernatants were used total tau protein and p-tauT181 protein were examined by ELISA kits (for the tau protein the kit was obtained from Invitrogen Corporation Lactic acid concentrations were measured by Determiner-LA (Kyowa Medex cells were treated with ACAC 15 min before the addition of GA the anti-GA-AGE antibody specifically recognized unique unknown GA-AGE structures Cells were harvested and homogenized after being treated for 24 h with GA An equal amount of protein was applied to a Hybri-SLOT apparatus (Gibco BRL) and transferred to a nitrocellulose membrane (Whatman) by vacuum filtration After blocking with 3% bovine serum albumin for 1 h at room temperature samples were incubated with the anti-GA-AGE antibody at 4 °C overnight followed by incubation with an anti-rabbit IgG antibody (Sigma Aldrich) Antibody-bound protein bands were detected using a BCIP-NBT Kit and densitometrically analyzed Total RNA was isolated using ISOGEN (Nippon Gene Japan) and complementary DNA was synthesized with the Exscript RT reagent kit (Takara Bio Inc. Real-time RT-PCR was performed using the Smart Cycler II system (Cepheid USA) and SYBR Premix Ex Taq reagent (Takara Bio Inc. The following primers were designed to produce mRNA-specific amplification products: β-actin 5′- TCC ACC TTC CAG CAG ATG TGG -3′ and 5′- GCA TTT GCG GTG GAC GAT -3′; GAPDH 5′- TGG GCT ACA CTG AGC ACC AG-3′ and 5′- CAG CGT CAA AGG TGG AGG AG-3′ ; VEGF 5′- TGC AGA TTA TGC GGA TCA AAC C-3′ and 5′- TGC ATT CAC ATT TGT TGT GCT GTA C-3′; TGF-β 5′- GCG TGC TAA TGG TGG AAA CC-3′ and 5′- CGG AGC TCT GAT GTG TTG AAG A-3′ Intracellular concentrations of tau and phosphorylated tau proteins were measured as follows: Cells were dissolved in extraction buffer containing 10 mM Tris HCl (pH 7.4) 0.5% deoxycholate and complete (Roche Diagnostics supernatants were applied to the ELISA kit Intracellular protein concentrations were measured using Bradford ULTRA (Expedeon Data are expressed as the mean ± SD and were examined by a one-way analysis of variance (n = 3 or n = 6) More than two experiments were performed and similar results were obtained P values less than 0.05 were considered to be significant Glyceraldehyde caused Alzheimer’s disease-like alterations in diagnostic marker levels in SH-SY5Y human neuroblastoma cells Involvement of advanced glycation end-products (AGEs) in Alzheimer’s disease Normal and abnormal biology of the beta-amyloid precursor protein Alternative routes for the formation of immunochemically distinct advanced glycation end-products in vivo TAGE (toxic AGEs) hypothesis in various chronic diseases Involvement of the toxic AGEs (TAGE)-RAGE system in the pathogenesis of diabetic vascular complications: A novel therapeutic strategy Toxic advanced glycation end products (TAGE) theory in Alzheimer’s disease Advanced glycation end products in Alzheimer’s disease and other neurodegenerative diseases Neurotoxicity of advanced glycation end-products for cultured cortical neurons CSF markers for incipient Alzheimer’s disease Cerebrospinal fluid protein biomarkers for Alzheimer’s disease A beta and phosphorylated tau protein for the diagnosis of Alzheimer’s disease Assessments of the accumulation severities of amyloid beta-protein and hyperphosphorylated tau in the medial temporal cortex of control and Alzheimer’s brains Increased intrathecal levels of the angiogenic factors VEGF and TGF-beta in Alzheimer’s disease and vascular dementia Reduced cerebral glucose metabolism in patients at risk for Alzheimer’s disease Brain glucose hypometabolism and oxidative stress in preclinical Alzheimer’s disease The mechanism by which glyceraldehyde inhibits glycolysis On the mechanism of the inhibition of glycolysis by glyceraldehyde Diabetes mellitus and risk of Alzheimer disease and decline in cognitive function Diabetes mellitus and the risk of dementia: The Rotterdam Study Does insulin dysfunction play a role in Alzheimer’s disease The role of insulin resistance in the pathogenesis of Alzheimer’s disease: implications for treatment APOE gene and the risk for dementia and related pathologies: The Honolulu-Asia Aging Study RAGE and amyloid-beta peptide neurotoxicity in Alzheimer’s disease Advanced Maillard reaction end products are associated with Alzheimer disease pathology Non-enzymatically glycated tau in Alzheimer’s disease induces neuronal oxidant stress resulting in cytokine gene expression and release of amyloid beta-peptide Advanced glycation end products contribute to amyloidosis in Alzheimer disease Cytotoxicity of advanced glycation endproducts is mediated by oxidative stress Advanced glycation endproducts induce changes in glucose consumption lactate production and ATP levels in SH-SY5Y neuroblastoma cells by a redox-sensitive mechanism Differential effects of “Advanced glycation endproducts” and beta-amyloid peptide on glucose utilization and ATP levels in the neuronal cell line SH-SY5Y Detection of noncarboxymethyllysine and carboxymethyllysine advanced glycation end products (AGE) in serum of diabetic patients Immunological evidence that non-carboxymethyllysine advanced glycation end-products are produced from short chain sugars and dicarbonyl compounds in vivo Glyceraldehyde-derived advanced glycation end products in Alzheimer’s disease Reduction of glyceraldehyde-3-phosphate dehydrogenase activity in Alzheimer’s disease and in Huntington’s disease fibroblasts Subcellular alteration of glyceraldehyde-3-phosphate dehydrogenase in Alzheimer’s disease fibroblasts Role of cerebrospinal fluid biomarkers in clinical trials for Alzheimer’s disease modifying therapies Increased cerebrospinal fluid levels of transforming growth factor-β1 in Alzheimer’s disease Increased protein glycation in cerebrospinal fluid of Alzheimer’s disease Glucagon-like peptide-1 protects hippocampal neurons against advanced glycation end product-induced tau hyperphosphorylation Possible involvement of advanced glycation end-products (AGEs) in the pathogenesis of Alzheimer’s disease Polyol pathway and diabetic peripheral neuropathy Uptake and metabolism of fructose by rat neocortical cells in vivo and by isolated nerve terminals in vitro The purification and properties of human liver ketohexokinase A role for ketohexokinase and fructose-bisphosphate aldolase in the metabolic production of oxalate from xylitol Positive association between serum level of glyceraldehyde-derived advanced glycation end products (AGEs) and vascular inflammation evaluated by 18F-fluorodeoxyglucose positron emission tomography (FDG-PET) Download references This work was supported in part by the Japan Society for the Promotion of Science (JSPS) KAKENHI Grant Number 22300264 & 25282029 Graduate School and Faculty of Pharmaceutical Sciences conducted the research and data management; Y.K. The authors declare no competing financial interests Download citation Sign up for the Nature Briefing: Translational Research newsletter — top stories in biotechnology There was a wake and funeral for close relatives Muramatsu founded his own agency Office Kaoru in 1992 Muramatsu's roles include Tom in One Piece, Pisco and others in Detective Conan, Iou in Naruto Shippūden, Johann Ibrahim Revil in Mobile Suit Gundam, and Vernon Aldo Vimac IV in Chaika the Coffin Princess Source: Office Kaoru Male fiddler crabs have one oversized claw which they use to both attract females and to fight other males for the best breeding burrows on the beach and crabs will sometimes lose their big fighting claw in the process Fiddler crabs have the ability to regrow their claw though the new one will never be as sturdy as the original Even in their weakened state, the crabs must fight. Yet based on his new research Muramatsu argues that fiddler crabs are more strategic fighters than we’ve given them credit for: he says they pick battles that account for their handicap and use a strategy of bluff and counter-bluff to end disputes before they begin Muramatsu spent days observing crabs tussling on the beach near Wakayama in Japan He divided the fights into three distinct stages: contact which may involve some pushing and shoving; interlock when they grasp each other’s claw in a vicious handshake; and fling when they try to throw or flip their opponent Muramatsu found that crabs with regenerated claws tend to engage in fights with opponents with smaller claws or try to choose opponents whose major claw is on the opposite side which makes it harder to get a grip and results in a less intense (and potentially less damaging) fight He thinks this is a sign that the crabs are trying to protect their weakened limbs Crabs with regenerated claws also act more aggressively during the initial contact stage bluffing in order to scare off opponents before the contest gets too dangerous Crabs don’t seem to be able to tell when an opponent has a regenerated claw But they do seem wise to the possibility of a bluff Crabs with their original claws still intact will choose same-handed opponents and counter-bluff by persisting in the fight even when facing a larger adversary a marine biologist from Rutgers University in New Jersey is not convinced that regenerated claws are weaker than originals “I wouldn’t be surprised if after the first molt it was weaker But by the time it has molted several times to get back to its original size there is no reason it would be weaker,” she says She also thinks Muramatsu and his colleagues may be reading too much into the crabs’ behavior with their ideas about the bluff and counter-bluff strategies “They’re attributing more intelligence to crabs than I’ve ever observed,” she says Muramatsu doesn’t think this behavior can teach us much about crab cognition he thinks the crabs have two fixed behaviors—protective bluffers or aggressive counter-bluffers—and losing a claw causes them to switch from one to the other Part of the Tula Foundation and Hakai Institute family Over the past weekend, the grand finale of the 49th Annual Texas Open 9 Ball Championships took place. Hosted by owners Kim and Tracy Sanders The $20,000 added 9 Ball Open had an entry fee of $200 The double elimination event was races to nine and winner breaks the nine was racked on the spot with three point rule in effect the 128 player field was whittled down by Sunday to the final 32 A second players auction was held and when it was over Two players battled their way through the very tough field to the hot seat match – Ukraine’s Vitaliy Patsura and BCA Hall of Famer Alex Pagulayan the hot seat match saw Patsura claim his seat in the finals with a 9-5 victory over Pagulayan Over on the one loss side, Josh Roberts kept Jesus Atencio in his chair with a 9-4 win. John Morra eliminated the always tough Naoyuki Oi 9-5 Morra was ahead with a 5-3 lead until Roberts stepped on the gas Josh won the last two games and took the win 9-7 The Alex Pagulayan-Josh Roberts match began – each player looking to get into the finals Alex leaped out to a 5-1 advantage but here came Josh Alex won the next three games to reach the hill 8-5 here came Josh again to take the next two games Alex decided to finish it right there and took the match 9-7 He moved on to the finals leaving Josh in third place Pagulayan would have to defeat Patsura twice to win the tournament Alex won the first game and Vitaliy won the next three Then he started to really pull ahead – 5-2 Alex managed to win one more game and then Vitaliy ran out to claim the title!! While the main event was going on, Sky Woodward took the $500 added Banks Ring Game mini over Raed Shabib and Sakura Muramatsu defeated Jennifer Kraber to win the Ladies Ring 9 Ball Game The $3,500 added Ladies 9 Ball Division had a full field of 32 players with races to seven After several matches, room owner Kim Sanders and last year’s third place finisher Sakura Muramatsu battled for the hot seat Sakura cruised to a 7-3 win to claim her spot in the finals Kim was sent to the west side to await the victor of the Jennifer Kraber-Michelle Cortez match Michelle prevailed 7-5 leaving Jennifer in fourth place Cooling her heels waiting for an opponent didn’t seem to faze Sanders any as she took the match over Cortez 7-4 Sanders would have to defeat Muramatsu twice to win the tournament but it was not to be – Sakura won the final match 7-3 Congratulations to Vitaliy and Sakura for becoming the 2022 Texas Open 9 Ball Champions thanks again to everyone at Skinny Bob’s for a first class event Big thanks to the local sponsors – they included Diamond Billiard Products Thanks to Tournament Director Jason Hill for an exemplary job juggling multiple events We’d also like to thank Scott Rabon, Larry Schwartz, Raymond Linares and Ray Hansen for their excellent commentary PoolActionTV would like to thank our fans and sponsors OH and the Fort Worth Billiards Superstore of Fort Worth Our next event is the Ten Ball Champions Challenge featuring Roberto Gomez and John Morra Held at Railyard Billiards & Sports Pub in Louisville Go to discussion... © AZBilliards.com EPPA inc. 1998-2025 All Rights Reserved. Site design by GRIN tech Introducing the all-new Astronomy.com Forum! Become a part of our Community!  >> Visit Now There are only a handful of known comets where this phenomenon of temporary satellite capture has occurred and the capture duration in the case of Kushida-Muramatsu which orbited Jupiter between 1949 and 1961 An international team led by Katsuhito Ohtsuka modeled the trajectories of 18 “quasi-Hilda comets,” objects with the potential to go through a temporary satellite capture by Jupiter that results in them either leaving or joining the “Hilda” group of objects in the asteroid belt Most of the cases of temporary capture were flybys where the comets did not complete a full orbit Ohtsuka’s team used recent observations tracking Kushida-Muramatsu over 9 years to calculate hundreds of possible orbital paths for the comet over the previous century Kushida-Muramatsu completed two full revolutions of Jupiter making it only the fifth captured orbiter to be identified “Our results demonstrate some of the routes taken by cometary bodies through interplanetary space that can allow them to either enter or escape situations where they are in orbit around the planet Jupiter,” said Asher Asteroids and comets can sometimes be distorted or fragmented by tidal effects induced by the gravitational field of a capturing planet or may even impact with the planet The most famous victim of both these effects was comet D/1993 F2 (Shoemaker-Levy 9) which was torn apart on passing close to Jupiter and whose fragments then collided with that planet in 1994 Previous computational studies have shown that Shoemaker-Levy 9 may well have been a quasi-Hilda comet before Jupiter captured it as the most massive planet with the greatest gravity sucks objects towards it more readily than other planets and we expect to observe large impacts there more often than on Earth Comet Kushida-Muramatsu has escaped from the giant planet and will avoid the fate of Shoemaker-Levy 9 for the foreseeable future,” said Asher The object that impacted Jupiter this July causing the new dark spot discovered by Australian amateur astronomer Anthony Wesley even if it did not suffer tidal disruption like Shoemaker-Levy “Our work has become very topical again with the discovery this July of an expanding debris plume created by the dust from the colliding object which is the evident signature of an impact The results of our study suggest that impacts on Jupiter and temporary satellite capture events may happen more frequently than we previously expected,” said Asher The team has also confirmed a future moon of Jupiter which has already orbited Jupiter three times between 1967 and 1985 is due to complete six laps of the giant planet between 2068 and 2086 updates and special offers via email from Astronomy.com Astronomy leads the astronomy hobby as the most popular magazine of its kind in the world Count me in Subscribers can access their digital magazine issues and registered users can participate in our Community forums and galleries Please enable JS and disable any ad blocker The third staging of the PDC Asian Championship will take place in the Philippines in October as a 48-player field compete for the coveted title across four days of action The PDC Asian Championship was introduced in 2022 with Christian Perez and Haruki Muramatsu winning the first two editions in Fukuoka and Shimonoseki respectively This year's showpiece will be staged from October 17-20 in Manila as the biggest names in Asian darts battle it out in the capital of the Philippines The top 16 players from the final 2024 Asian Tour Order of Merit will be seeded for this year's PDC Asian Championship with Order of Merit leader Alexis Toylo set to headline on home soil 2022 runner-up Paolo Nebrida will also feature alongside Japan's Tomoya Goto Hong Kong's Man Lok Leung and India's Nitin Kumar while Singapore icon Paul Lim is also poised to be amongst the seeded stars A series of national qualifying events will also take place to determine qualifying players while territories without a national qualifier will see their top-ranked player on the PDC Asian Tour Order of Merit secure a spot in the event The Asian Championship Qualifiers on October 17-18 will then produce the final 16 players (or more if there are places from national qualifying events) with the final four players from each of the four events qualifying for the main event The 48 players will compete in a round-robin phase of 16 groups of three on Saturday October 19 with the group winners progressing to play in the last 16 before the tournament concludes with the quarter-finals semi-finals and final on Sunday October 20 The 2024 PDC Asian Championship will be streamed through PDCTV, with the Asian Series Qualifiers being streamed through PDCTV from the last 16 onwards the final weekend of the 2024 PDC Asian Tour has now been confirmed China from October 4-6 in a bumper weekend of action The PDC Asian Tour returns on August 10-11 with Events 16-18 in Singapore – with coverage to be streamed on PDCTV from 1000 local time on each day Olympic Membership - Free Live Stream Sports & Original Series - join now! 🥇 junior world number one Fan took the first game against Muramatsu only for the Japanese to hit back in a classic attack-versus-defence encounter and win the next two games “It was very intense and difficult but what I’m satisfied with was how I reacted when the going got tough,” said Fan after his hard-fought 4-2 (11-8 The turning point came in the fourth game when China called a timeout in a bid to halt Muramatsu’s momentum “These two days I’ve had problems but I went all out,” said the champion Liu had no such problems in winning her gold 11-3) in the final and conceding only five games in her seven matches because I figured out all the difficulties,” she said who owed her higher ranking to having played more tournaments recently accepted that she had been second-best: “I feel like I didn’t play well Zhang and Calderano respectively won USA and Brazil’s first ever Olympic table tennis medals “I think I did really well because I was able to just calm down when I was losing a few points in a row,” said the American Women’s singles champion Liu Gaoyang eased to a 3-0 (11-3 11-9) victory over Miyu Kato before men’s singles winner Fan Zhendong recovered from an early hiccup to beat Yuto Muramatsu sealing the title for China with a game to spare “I’m not feeling well so I didn’t perform well in my singles match and lost it,” Kato said We were putting our hope in the mixed doubles and hoping our teamwork could help.” Her team-mate Muramatsu pushed Fan hard in their match The Japanese player took the first game and led 8-5 in the second “Today the points lost were of my own doing,” said Fan following his 3-1 (10-12 “I was relaxed at the start and everything went according to plan But losing the first game put me in a spot.” he said: “We didn’t change much because the experience of the singles final had already taught us what game plan to use Maybe what it did more was calm me down and ready myself for a tiring match.” with junior world number one Doo Hoi Kem easing past Tamolwan Khetkhuan 3-0 (11-4 11-5) and Hung Ka Tak beating Padasak Tanviriyavechakul 3-1 (8-11 “[This team medal] is more meaningful because we practised for a long time in Hong Kong,” said Doo after collecting her second medal of Nanjing 2014 “The team event means more because there are two people and it also wasn’t easy for him [Hung] For him to survive the last game wasn’t easy,” he added and B Palomarez preparing for Fashion Design & Merchandising’s LA Mode fashion show in their studios on the SMC Main Campus on Thursday Fashion Designers Washington and Palomarez will have their work featured in the show and Fashion Merchandisers Dillman and Muramatsu are producing the show including promoting it on social media LA Mode will be held at Barnum Hall in Santa Monica on Thursday “One day you’re in and the next day you’re out,” a phrase coined by super model Heidi Klum has been quoted by members of the fashion industry since the saying’s inception during her tenure on the hit reality show Project Runway These words speak to the demanding and often cut throat aspects of an ever-evolving industry one that if you’re unable to keep up with you’ll be forgotten there are those that take this as a challenge and grab the proverbial bull by the horns Students at Santa Monica College’s (SMC) Fashion Design & Merchandising program are just these people SMC’s Fashion Design department hosts LA Mode a runway presentation showcasing the work done by students Although the official show date isn’t until June 13 students are well underway preparing for the main event student involvement is shown in the way of show production and fashion design Students Angela Dillman and Ayano Muramatsu are assisting with production aspects of the show loves visual arts and expresses her passion through taking candid photographs of the designers and the progress they make with their designs “These photos will be posted and shown on a video that plays during the show,” said Dillman Making sure designers meet their design deadlines is also part of Dillman’s responsibilities who acts as a bridge between the students and La Tanya Louis a fashion professor at Santa Monica College who has produced LA Mode since 2015 a professor of 15 years and the LA Mode collections director “Right now for this month your deadlines are the designs the second look complete by next month and then the third and final look,” said Dillman SMC Fashion Merchandising students Ayano Muramatsu in the Fashion Design & Merchandising studios on Thursday discussing production aspects for the department’s upcoming fashion show LA Mode records a social media video of Fashion Design student Durryl Washington (left) in the Fashion Design & Merchandising studios at SMC Washington invites people to the department’s LA Mode fashion show an international student who moved to Los Angeles two years ago from Japan works on marketing the show through social media platforms like Twitter A lot of people can see it and it’s a very good for advertising It’s very useful for us to promote [LA Mode],” said Maramatsu “The production team has a lot of different pieces but it’s great because we help each other to make one big show.” Palomarez and Durryl Washington are well underway in executing their visions to tangible reality landed on her life-long love for fashion design after trying both culinary and music theory school “Fashion is something I’ve always been fascinated with I just didn’t focus on it as my career until a few years ago” Being from the desert and having a love for plants incorporating these elements into her collection “It’s like taking something that somebody wouldn’t really see beauty in and turning it into something beautiful,” said Palomarez SMC Fashion Design student B Palomarez works on a design project in the Fashion Design and Merchandising studios at SMC on Thursday Palomarez’ work will be featured in the department’s upcoming LA Mode fashion show at Barnum Hall in Santa Monica on Thursday Washington found his place in fashion design after the photography classes he needed were no longer available Washington took a fashion design sewing class “This was pretty much a silver lining moment,” said Washington “I completely fell in love with [fashion design] and now I’m making garments for everyone.” Washington’s process for his design esthetic is to draw inspiration from everywhere “If you keep your mind in a box you’re only going to stay in that box,” said Washington Having grown up seeing his mother and grandmother getting ready for work every morning Washington’s collection is described as “luxury but luxury on a budget feel really glamourous in and still be comfortable.” With aspirations to own his own label one day and at the same time knowing the pressures of the industry Updated 4/18/2019 to fix a misquote by Angela Dillman About   Contact © Santa Monica College / The Corsair. All rights reserved. PlayLoading... Michaela Haet of Australia dashed the hope of local Nudnida Luangnam 6-0 6-4 to set up the final showdown with Japanese Chihiro Muramatsu, who outlast top seed Harriet Dart of UK 7-6 5-7 7-5, in the US$15,000 Cal-Comp & XYZ Printing ITF Pro Circuit W2 at the True Arena Hua Hin on Friday.  The 18-year-old Haet who came from the qualifying round just like Nudnida proved more solid from the baseline battle which she won in just 68 minutes. Haet and Muramatsu will play for the first ITF singles title of their career. The lefthanded Japanese won the marathon battle with Dart which consumed up to hour and 5 minutes. The 18-year-old Japanese will go to the final with a 2-0 head-to-head record over the Australian whom she beat twice in their junior events two years ago.  Thai Schools Gear Up for Term Start with Safety Checks and Tablet Rollout Tawee visits Narathiwat, pledges to tighten security for Buddhist communities Trump orders 100% tariff on foreign-made movies to save 'dying' Hollywood Ratchada Night Market Shuts Doors Suddenly, Leaving Businesses in the Lurch Chadchart confident search for 14 missing workers will be completed in four days