The dates displayed for an article provide information on when various publication milestones were reached at the journal that has published the article activities on preceding journals at which the article was previously under consideration are not shown (for instance submission All content on this site: Copyright © 2025 Elsevier B.V. Egypt • Finland • Japan • Mallorca • Portugal • Transylvania Get your weekly dose of armchair travelling Walking down the approach to Shonai Shrine is a test in concentration flowers tempt with their intoxicating scents and vivid colors and – if you do a full 180 – you’ll face Mount Haguro one of the three holy Dewa Sanzan mountains in Yamagata Prefecture This gargantuan spiritual powerhouse draws pilgrims from all over the country though many miss a visit to this diminutive shrine in central Tsuruoka city Sometimes it’s the smaller spots that offer the most memorable experiences the former stronghold is now a park with one of the nation’s top cherry blossom spots 730 cherry trees explode into flurries of baby pink and snow-white petals wooden trellises spill over with drippings of lilac wisteria Behind the ayame iris garden is the takifuji – a wisteria waterfall it creates the illusion of a rippling flow of lavender-colored water both in the park and the shrine precinct within the purification font is filled with seasonal blossoms The floating petals perform two roles: one they offer an opportunity for stunning photos and two they discourage people from using the fountain for the ritual purification of hands and mouth Shonai Shrine is a relatively recent addition Meiji period leaders ordered the samurai class to be dissolved and all castles – with some exceptions – were dismantled wooden boards and even pillars found new homes in the shrine’s worship hall and other buildings The former head of the Sakai clan was enshrined here a testament to the family’s approximately 250 years of prosperous ruling of the Shonai region The shrine’s emblem – the leaves of a creeping wood sorrel plant – is borrowed from the Sakai family offer more insights into the daily life of samurai in the region but also let them feel closer by showing them festival preparations and sharing new information.” This has been especially important during the Covid-19 pandemic “There are many people who want to come visit but can’t I try to share a piece of this place through photos on social media Ishihara also shares images and videos of seasonal goshuin shrine stamps each one a colorful representation of a timely flower or event One of the most popular themes is of the mizu-omikuji fortune slips Upon first appearance they look like blank pieces of paper but by dipping them in a bowl of water – often decorated with stones or flowers – your level of luck and advice for the future gradually appears Ishihara got an unexpected boost to her social media campaign in 2017 when she posted a picture of Oji (that’s “prince” in Japanese) the shrine cat lounging on the carefully raked karensui dry landscape garden racking up over 100,000 likes and more than 50,000 shares “I uploaded it because I thought it was cute But soon we got calls from TV stations and newspapers from all over Japan we couldn’t tell him what to do,” she recalls Oji became a popular fixture at the shrine and even had his own business card he passed away in early March 2020 at the impressive age of 14 Visitors can ask for one of his cards at the main reception desk and the shrine has held photo exhibitions so that his devil-may-care attitude and striking good looks can live on “More people came to see Oji than any of the shrine staff people smile when they talk about their memories of him We even get asked when Oji the Second will make an appearance or find out more about Shonai Shrine’s activities through their social media posts For more information, visit the shrine’s official website or follow its daily activities on Twitter and Instagram Designed by lauded architect Shigeru Ban, Shonai Hotel Suiden Terrasse’s simple minimalist design creates a seamless connection with the environment around it the surrounding water-filled rice fields create reflections making it seem as if the hotel is floating above them wooden panels and furniture envelope you in a luxurious warmth while the floor-to-ceiling windows keep the natural surroundings close Spend your night relaxing at either the sake bar or sake lounge or in the curated library spaces that boast about 2,000 books on design and more The restaurant prides itself on serving farm-to-table seasonal ingredients and regional wines to match relax in the spa area with its hot spring baths and its most recent addition: genuine Finnish-style saunas please disable the ad blocking feature and reload the page This website uses cookies to collect information about your visit for purposes such as showing you personalized ads and content By clicking “Accept all,” you will allow the use of these cookies Users accessing this site from EEA countries and UK are unable to view this site without your consent said Thursday that its two subsidiary banks will consider merging in fiscal 2026 to enhance operations at a time when their earnings power is declining amid ultralow interest rates and falling populations The envisaged merger would create the first local bank in the Tohoku northeastern Japan region to operate across a prefectural border based in the city of Tsuruoka in Yamagata Prefecture listed on the Tokyo Stock Exchange’s top-tier Prime section was created in 2009 through the business integration between Shonai Bank and Hokuto Bank such as integrating the two banks’ head office functions and back-office operations the group completed repayments of public funds injected for recapitalization in the past The group expects that the merger will create synergies in areas including a matching service for businesses and support for business turnaround in wide areas in Tohoku and help reduce costs through the full adoption of the same computer systems and administrative work procedures If the Bank of Japan raises interest rates in a shift from its current ultraeasy monetary policy in the future that would provide commercial banks with an opportunity to expand their profits The Fidea group aims to support local industries in Tohoku and help the region’s decarbonization efforts by expanding its business scale and reinforcing its business foundations Fidea considered integrating operations with Tohoku Bank But the idea was withdrawn later due to gaps in their management strategies Our weekly ePaper presents the most noteworthy recent topics in an exciting © 2025 The Japan News - by The Yomiuri Shimbun Metrics details One of the main drivers of autism spectrum disorder is risk alleles within hundreds of genes which may interact within shared but unknown protein complexes Here we develop a scalable genome-editing-mediated approach to target 14 high-confidence autism risk genes within the mouse brain for proximity-based endogenous proteomics achieving the identification of high-specificity spatial proteomes The resulting native proximity proteomes are enriched for human genes dysregulated in the brain of autistic individuals and reveal proximity interactions between proteins from high-confidence risk genes with those of lower-confidence that may provide new avenues to prioritize genetic risk the datasets are enriched for shared cellular functions and genetic interactions that may underlie the condition We test this notion by spatial proteomics and CRISPR-based regulation of expression in two autism models demonstrating functional interactions that modulate mechanisms of their dysregulation these results reveal native proteome networks in vivo relevant to autism providing new inroads for understanding and manipulating the cellular drivers underpinning its etiology although these are often derived from non-neuronal cells there is a prevailing notion in the literature that molecular convergence in autism may be optimally reflected at the protein level in the brain due to inherent specificity constraints of antibody-dependent immunoprecipitation or recombinant exogenous promoter-based strategies that express proteins at non-physiologic levels in non-native cell types access to the native proximity proteomes of endogenously expressed autism risk proteins within brain tissue remains a significant challenge high-fidelity proteomes organized around autism risk proteins in the brain are clearly needed for better mechanistic insights We have tested this notion by identifying intersections between HiUGE-iBioID proximity proteomes and co-perturbed proteins in two autism mouse models (Syngap1 synaptopathy and Scn2a channelopathy) we find that its binding with Anks1b is disrupted by an autism-associated Syngap1 mutation and their interaction is essential for shaping neural activity during critical synaptogenesis periods we show that a patient-derived missense mutation results in repetitive behaviors and abnormal social communication in mice The mutation also downregulates a key Scn2a modulatory protein cluster discovered in its proximity proteome and results in aberrant attenuation of neural activity re-expression of this cluster rescues this autism-associated electrophysiological impairment our results establish a scalable platform to engineer endogenous proteins and map native proximity proteomes that are associated with genetic risks for neurodevelopmental conditions such as autism Our findings also reveal an intersectional approach to prioritize candidates based on proteomic co-perturbation These data support a protein-centric model to reveal mechanisms of autism and related neurodevelopmental disorders and potential mitigation approaches A Schematic illustration of HiUGE-iBioID and its workflow Strategies to preserve C-term PDZ-binding motifs of Syngap1 B Overview of 14 proximity proteomes that segregates according to expected bait functions C Enrichment analysis of overlapping SFARI genes using hypergeometric probability The solid red line denotes Bonferroni adjusted p-value at 0.05 D Proximity proteome clustering based on a similarity matrix E Core proximity proteome between Syngap1 and Anks1b that show highly significant overlaps with SFARI genes and Scn8a that are clustered based on similarity Modules of proteins were isolated by MCL clustering or GO analysis These genes represent a resource of moderate autism candidates that likely should be prioritized in future studies of genetic contributions due to their possible functional interactions with high-confidence autism risk genes we noted the proximity proteomes contained numerous potentially druggable targets 18 of which are encoded by SFARI gene mouse orthologs: Camk2a These proximity proteomes may contain proteins that function together with the autism-associated baits modulation of which may reveal the complex genetic risks of autism or serve as potential inroads for normalizing relevant phenotypes we sought to test whether Syngap1 and Anks1b functionally interact in driving neuronal phenotypes A Schematic illustration of the quantitative proteomic characterization of Syngap1-Het synaptosomes B Proteomic alterations identified in the Syngap1-Het synaptosome Proteins that overlap with the Syngap1 proximity proteome are underlined C Co-immunoprecipitation result showing loss of interaction with ANKS1B in frame-shifting c.2214_2217del SYNGAP1 mutation D HiUGE labeling of truncated Syngap1 at exon 13 shows synaptic localization (boxed region) and aberrant somatic mis-localization (arrowhead) Scale bar in the enlarged view represents 2 μm E Schematic illustration of labeling truncated Syngap1 with TurboID by targeting exon 13 F Western blot showing TurboID-HA labeled Syngap1 truncation at the expected molecular mass G Proximity proteomic network showing conserved and neomorphic interactions in Syngap1 truncation Note that interaction with Anks1b is no longer detected H Schematics assessing phenotypes of the Syngap1-Anks1b functional interaction I Western blot confirming disruption of Syngap1 and Anks1b expression I Representative experiments are based on three replicates with similar results J Representative raster plots of neural activities at DIV-08 K–M Neurometrics showing further depletion of Anks1b exacerbates the development of precocious neural activity associated with Syngap1-LOF *p < 0.05; **p < 0.01; ***p < 0.001; n.s.: non-significant One-way ANOVA followed by post-hoc Tukey HSD tests (n = 36 wells) we confirmed that the region identified by structure-function analysis in vitro is also crucial for the Syngap1-Anks1b interaction in vivo primarily during the period of synaptogenesis (DIV 11) the data support a model in which Syngap1 and Anks1b physically and functionally interact within a common pathway to regulate the development of neuronal activity Based on the phenotype and common biological pathways found in the overlapping proximity proteomes this effect may be due to the altered developmental trajectory of the glutamate receptor module found in both networks C Spatial proteomics reveals co-perturbations in Scn2a+/R102Q mutants two-tailed heteroscedastic t-test on log2-transformed data MCL analysis discovered a key cluster associated with voltage-gated channel activity that is downregulated including three targets that intersect with the Scn2a HiUGE-iBioID proximity proteome (underlined) D Scn2a+/R102Q mutant neurons show attenuated activity with the MEA Scn2a-CRISPRa treatment and a “Combo” treatment with additional expression of SCN1B and FGF12 show differential efficacy in restoring neural activity deficits One-way ANOVA followed by post-hoc Tukey HSD tests (n = 48 wells) suggesting the potential dominant-negative effect of the mutation in Scn2a-CRISPRa was overcome by the increased expression of SCN1B and FGF12; thereby confirming the hypothesis that this modulatory cluster is crucial for the phenotypic rescue of Scn2a+/R102Q these results strongly indicate that intersectional proteomics between HiUGE-iBioID and spatial co-perturbation can be an informative approach to discover novel approaches for the functional rescue of abnormal phenotypes and potential therapeutic targets Here we report a strategy combining the advantages of HiUGE and iBioID to resolve native proximity proteomes associated with 14 autism-associated proteins The combination of the interaction data presented for Syngap1 and Anks1b and the Scn2a rescue results validate the HiUGE-iBioID method for discovering the functional links between autism genetics and proteomics The findings also emphasize an effective proteomic-driven systems-biology approach to discover molecular mechanisms and potential treatment targets Compared to immunoprecipitation or recombinant BioID expression methods in vitro HiUGE-iBioID is expected to have four key benefits the bait protein is expressed from the endogenous promoter with native cell-type specificity preserved at physiological levels the cells expressing the bait protein are within the context of the tissue obviating perturbations to their native environment essential for development and cell physiology that can occur in vitro the proximity proteomes are covalently marked as they exist in vivo and thus the proteins can be purified subsequently under stringent conditions without the need to optimize samples for weak or transient interactions This feature is especially important for protein complexes organized by transmembrane baits which must be extracted from the lipid bi-layer under conditions that are unfavorable for maintaining many PPIs the selection of the bait protein is not limited by viral packaging capacity or availability of high-specificity and validated antibodies While the BioID and HiUGE-iBioID proximity proteomes had more in common with each other than the analogous immunoprecipitation comparisons there were again more differences between them than there were similarities While HiUGE-iBioID specific proximity proteomes for each had the top GO term “Glutamate receptor binding” for all three synaptic baits the recombinant BioID specific data were enriched for top GO terms such as “Tubulin binding” and “Acidic amino acid transmembrane transporter activity” While further comparisons are needed to confirm the above observations the available data suggest that endogenous proximity proteomics using HiUGE-iBioID is a valuable addition to the existing methods clusters enriched for “AP-type membrane coat adapter complex” suggesting these may be the trafficking processes that Nbea modulates the analysis suggests Nbea may influence other signaling pathways that have yet to be appreciated including “G-protein-coupled GABA receptors” and “Voltage-gated potassium channel complexes” although additional experimental analyzes will be needed to test these new proteomics-derived hypotheses or new advancements in mass spectrometry scan rates that reduce instrument time an intriguing speculation is that these gene products may play a role in regulating synaptogenesis via acting on the Syngap1/Anks1b complex and contributing to the activity-dependent shuttling of Syngap1/Anks1b during plasticity suggesting the downregulation of these proteins occurs at the post-transcriptional level - likely due to destabilization of VGSC supramolecular assembly The exact mechanisms as to how the loss of a positively charged arginine residue on the N-term intracellular tail of Scn2a affects VGSC assembly remains to be determined the effects of these perturbations need to be assessed further as some alterations may be benign with respect to phenotypes future studies are needed to further dissect their unique subcellular effects our results show that HiUGE-iBioID provides a CRISPR/proximity proteomics method to reveal native proteomes in vivo our intersectional approach offers a generalizable strategy to identify and prioritize candidates for discovering new biology and potential therapeutic targets future work could adopt a similar approach to investigate genetic co-perturbations and PPIs in other models We expect that the framework developed in this study will encourage further research of the native proximity proteomes in the brain enhancing our understanding of proteome organization in various aspects of cellular neurobiology and disease The Scn2a+/R102Q mice were generated using a heterozygous breeding scheme and genotyping was performed by sequencing the amplicon using the following primer set: Scn2a-s C3H/HeJ males (#000659; Jackson Laboratory ME) served as social partners in the resident-intruder and social dyadic tests All procedures were performed with a protocol approved by the Duke University Institutional Animal Care and Use Committee in accordance with US National Institutes of Health guidelines Mice were group-housed in the Duke University’s Division of Laboratory Animal Resources facility where the donor was flanked by intron / exon boundary sequences from an obligatory intron to enable internal TurboID insertion The following intronic sequences were targeted: Syngap1: acttattgagacgcttcgcgggg To insert TurboID while protecting the C-term PDZ-binding motif of Lrrc4c that has only one coding exon a custom donor was used where the coding sequence of a.a ETQI was appended to the C-term of the TurboID donor The genomic target for Lrrc4c: gagttcattcggatcaataacgg Exon 13 of Syngap1 was targeted for Syngap1 truncation and disruption: acggactcggtctcagcccatgg To endogenously express soluble TurboID as a survey for background detection C-term or 3’-UTR sequences were targeted with a stop codon - internal ribosome entry site (IRES) - TurboID-HA donor The genomic target sequences were: Syngap1: aggaggtctgtgacgctgggtgg 0.5 mL AAV-containing supernatant was filtered through the Spin-X column and temporarily stored at 4 °C until ready to use Neonatal (P0-2) H11-Cas9 mice were anesthetized by hypothermia and injected intracranially with the purified AAV (2 µL per hemisphere Donor vector backbone AAV (empty gRNA) was used as negative control mice received daily intraperitoneal injections (i.p.) of biotin (50 mg/kg) over 5 consecutive days Mice were deeply anesthetized with isoflurane and euthanized by decapitation Forebrain tissue was collected one day after the final injection and snap-frozen at −80 °C until purification forebrain tissue from two mice was combined sonicated in RIPA lysis buffer (Cell Signaling #9806) supplemented with cOmplete protease inhibitor cocktail (Sigma #11873580001) and centrifuged at 16,000 × g for 30 min at 4 °C The supernatant lysate was desalted with Zebra columns 7 K MWCO (ThermoFisher #89894 or #89892) The flow-through was combined with 150 µL magnetic Strepavidin beads (Pierce #88816) and incubated at 4 °C overnight the beads were washed with the following steps: RIPA buffer 2 times Biotinylated proteins were eluted by boiling the beads in 90 µL 2× sample buffer and used for downstream LC-MS/MS and Western blot analyzes Samples were spiked with undigested bovine casein at a total of either 120 or 240 fmol as an internal quality control standard samples were supplemented with 12.4 μL of 20% SDS reduced with 10 mM dithiolthreitol for 30 min at 80 °C alkylated with 20 mM iodoacetamide for 30 min at room temperature (RT) then supplemented with a final concentration of 1.2% phosphoric acid and 723 μL of S-Trap (Protifi) binding buffer (90% MeOH/100 mM TEAB) Proteins were trapped on the S-Trap micro cartridge digested using 20 ng/μL sequencing grade trypsin (Promega) for 1 hr at 47 °C and lastly using 50% acetonitrile (ACN) /0.2% FA Samples were resolubilized using 12 μL of 1% TFA/2% ACN with 25 fmol/μL yeast ADH Quantitative LC-MS/MS was performed on 2 μL (~17% of total sample) using a nanoAcquity UPLC system (Waters Corp) coupled to a Thermo Orbitrap Fusion Lumos high resolution accurate mass tandem mass spectrometer (Thermo) equipped with a FAIMSPro device via a nanoelectrospray ionization source the sample was first trapped on a Symmetry C18 20 mm × 180 μm trapping column (5 μl/min at 99.9/0.1 v/v water/ACN) after which the analytical separation was performed using a 1.8 μm Acquity HSS T3 C18 75 μm × 250 mm column (Waters Corp.) with a 90-min linear gradient of 5 to 30% ACN with 0.1% formic acid at a flow rate of 400 nanoliters/minute (nL/min) with a column temperature of 55 °C Data collection on the Fusion Lumos mass spectrometer was performed for three difference compensation voltages (−40v a data-dependent acquisition (DDA) mode of acquisition with a r = 120,000 (@ m/z 200) full MS scan from m/z 375–1600 with a target AGC value of 4e5 ions was performed MS/MS scans were acquired in the ion trap in rapid mode with a target AGC value of 1e4 and max fill time of 35 msec The total cycle time for each CV was 0.66 s with total cycle times of 2 sec between like full MS scans A 20 s dynamic exclusion was employed to increase depth of coverage The total analysis cycle time for each injection was approximately 2 h data were imported into Proteome Discoverer 2.5 (“PD” Thermo Scientific Inc.) and individual LCMS data files were aligned based on the accurate mass and retention time of detected precursor ions (“features”) using Minora Feature Detector algorithm in Proteome Discoverer Relative peptide abundance was measured based on peak intensities of selected ion chromatograms of the aligned features across all runs The MS/MS data was searched against the SwissProt M musculus database and a common contaminant/spiked protein database (bovine albumin and an equal number of reversed- sequence “decoys” for false discovery rate determination Thermo PD) was utilized to produce fragment ion spectra and to perform the database searches Database search parameters included fixed modification on Cys (carbamidomethyl) and variable modification on Met (oxidation) Search tolerances were; 2 ppm precursor and 0.8 Da production with full trypsin enzyme rules Peptide Validator and Protein FDR Validator nodes in Proteome Discoverer were used to annotate the data at a maximum 1% protein false discovery rate based on q-value calculations Note that peptide homology was addressed using razor rules in which a peptide matched to multiple different proteins was exclusively assigned to the protein has more identified peptides Protein homology was addressed by grouping proteins that had the same set of peptides to account for their identification A master protein within a group was assigned based on % coverage a filter was applied such that a peptide was removed if it was not measured in at least 2 unique samples (50% of a single group) any missing data missing values were imputed using the following rules; (1) if only a single signal was missing within the group of three an average of the other two values was used or (2) if two out of three signals were missing within the group of three a randomized intensity within the bottom 2% of the detectable signals was used all peptides belonging to the same protein were summed into a single intensity This protein value was then subjected to a robust mean normalization in which the top and bottom 10 of the signals were removed and then the remaining mean was made to be the same across all samples Proteomic detection was defined as proteins identified by at least 2 peptides in LC-MS/MS Protein abundances were considered significantly enriched if they met FDR < 0.05 (PolySTest) and fold change ≥ 2 (Log2-FC ≥ 1) compared to controls The enriched gene lists were filtered against known experimental and omnipresent biological contaminants Note that this high-stringency filter removed a few well-known interactors such as Dlg4 and Shank3 from the dataset of several baits Synaptosomal preparation was performed with four adult Syngap1-Het mice and four WT controls mice were deeply anesthetized with isoflurane and euthanized by decapitation The rapidly isolated brain tissue was sliced to 1 mm sections using a brain matrix (Zivic Instruments) followed by dissection of cortical and striatal tissue Tissue was homogenized in homogenization buffer (320 mM sucrose The lysate was centrifuged at 1000 × g to remove cell debris and nuclei The supernatant was further centrifuged at 12,000 × g to obtain a crude synaptosomal pellet and it was resuspended in Tris buffer (320 mM sucrose Additional centrifugation in a sucrose density gradient (0.8/1.0/1.2 M) at 85,000 × g was performed to isolate purified synaptosome at the 1.0/1.2 interface The purified synaptosomes were subjected to multiplexed LC-MS/MS quantification following tandem mass tags (TMT) isobaric labeling was used for tandem mass tag (TMT)-multiplexed proteomic analysis Samples were supplemented with 100 μL of 8 M urea and probe sonicated Protein concentrations were determined via Bradford Assay and ranged from 1.8 to 2.3 mg/mL Samples were normalized to 120 μg using 8 M urea and spiked with undigested bovine casein at a total of either 120 or 240 fmol as an internal quality control standard they were supplemented with 13 μL of 20% SDS reduced with 10 mM dithiolthreitol for 45 min at 32 °C alkylated with 20 mM iodoacetamide for 45 min at RT then supplemented with a final concentration of 1.2% phosphoric acid and 70 μL of S-Trap (Protifi) binding buffer (90% MeOH/100 mM TEAB) digested using 100 ng/μL sequencing grade trypsin (Promega) for 1 hr at 47 °C All samples were then lyophilized to dryness each sample was resuspended in 120 μL 200 mM triethylammonium bicarbonate 40uL of each sample was combined to form an SPQC pool which was then aliquoted into 3 SPQC pools Fresh TMT10plex reagents (0.8 mg for each 10-plex reagent) were resuspended in 41 μL 100% ACN and was added to 75 μg of each sample 8 μL of 5% hydroxylamine was added and incubated for 15 min at RT to quench the reaction Samples were combined then lyophilized to dryness samples were resuspended in 300 uL 0.1% formic acid 400 μg was fractionated into 48 unique high pH reversed-phase fractions using pH 9.0 20 mM ammonium formate as mobile phase A and neat ACN as mobile phase B The column used was a 2.1 mm × 50 mm BEH C18 (Waters) and fractionation was performed on an Agilent 1100 HPLC with G1364C fraction collector the flow rate was 0.4 mL/min and the column temperature was 55 °C The gradient method was set as follows: 0 min Forty-eight fractions were collected in equal time segments from 0 to 52 minutes then concatenated into 12 unique samples using every 12th fraction Fractions were frozen and lyophilized overnight Samples were resuspended in 50 μL 1%TFA/2% ACN prior to LC-MS analysis Quantitative LC-MS/MS was performed on 2 μL (1 μg) of each sample using a nanoAcquity UPLC system (Waters Corp) coupled to a Thermo Orbitrap Fusion Lumos high resolution accurate mass tandem mass spectrometer (Thermo) equipped with a FAIMSPro device via a nanoelectrospray ionization source the sample was first trapped on a Symmetry C18 20 mm × 180 μm trapping column (5 μl/min at 99.9/0.1 v/v water/ACN) after which the analytical separation was performed using a 1.8 μm Acquity HSS T3 C18 75 μm ×  250 mm column (Waters Corp.) with a 90-min linear gradient of 5 to 30% ACN with 0.1% formic acid at a flow rate of 400 nanoliters/minute (nL/min) with a column temperature of 55 °C a data-dependent acquisition (DDA) mode of acquisition with a r = 120,000 (@ m/z 200) full MS scan from m/z 375 to 1600 with a target AGC value of 4e5 ions was performed MS/MS scans were acquired in the Orbitrap at r = 50,000 (@ m/z 200) from m/z 100 with a target AGC value of 1e5 and max fill time of 105 msec with total cycle times of 3 s between like full MS scans A 45 s dynamic exclusion was employed to increase depth of coverage The total analysis cycle time for each sample injection was approximately 2 h Data were imported into Proteome Discoverer 2.4 (Thermo Scientific Inc.) and individual LCMS data files were aligned based on the accurate mass and retention time of detected precursor ions (“features”) using Minora Feature Detector algorithm in Proteome Discoverer musculus database (downloaded in Nov 2019) a common contaminant/spiked protein database (bovine albumin Matrix Sciences) were utilized to produce fragment ion spectra and to perform the database searches Lys (TMT6plex) and peptide N-termini (TMT6plex) A master protein within a group was assigned based on percent coverage To account for any missing data (from a misalignment etc.) missing values were imputed by using a randomized intensity within the bottom 2% of the detectable signals The data was then intensity normalized using a trim-mean normalization in which the highest and lowest 10% of the signals from each sample was excluded and then the remaining average intensities of the proteins was made equal across all of the samples The results were then analyzed using the Duke Proteomics and Metabolomics Shared Resource (DPMSR) Proteome Discoverer Data Visualization Tool Proteomic detection was defined as proteins identified by at least 2 peptides in LC-MS/MS following a 1% FDR correction Protein abundance was considered significantly altered if they met p-value < 0.05 (two-tailed t-test) and abs(fold change) ≥ 1.2 (abs(Log2-FC) ≥ 0.263) Those with p-value < 0.1 and abs(fold change) ≥ 1.2 (abs(Log2-FC) ≥ 0.263) were considered indicative candidates To assess the percentage of interactions not reported in STRING queries a low confidence (0.15) threshold was used The Markov Cluster Algorithm in STRING and gene ontology (GO) analysis were used to detect protein communities within each proximity proteome with additional adjustments made based on known protein functions We used genes expressed in each cell type as the background to perform the hypergeometic test for overlap between each bait gene list and a list of autism DEGs in each cell type GO analyzes were conducted using input gene lists unique to each set with ShinyGO Bait self-identifications were excluded from analyzes across studies Gene names were converted to mouse orthologs if applicable For analyzes that lack a consensus statistical domain mouse genome was used as a non-biased background 10μL of HiUGE-iBioID purified samples were subjected to SDS-PAGE After transferring to nitrocellulose membranes the blot was probed for HA-epitope (rabbit anti-HA Equal amounts of input protein from mouse brain lysate were also subjected to SDS-PAGE and the blot was probed for GAPDH (rabbit anti-GAPDH Matching IRDye secondary antibodies (LI-COR 1:10,000) were incubated with the blot for 1 hr at RT and the immunosignal was detected using Odyssey FC imager (LI-COR) Expression vectors of Myc-DDK-tagged human ORF clones of ANKS1B and SYNGAP1 were purchased from Origene (#RC211877 V5-epitope or GFP-tagged mutants were cloned into the same expression backbone Truncations of Syngap1 consisted of the following: N-Trunc: Δ a.a 2-361; C1-Trunc: Δ a.a.730-1343; C2-Trunc: Δ a.a Mutation of Syngap1 (SYNGAP1-c.2214_2217del) was introduced by site-directed mutagenesis (QuikChange Lightning HEK293T cells were co-transfected with expression vectors using Lipofectamin 3000 (ThermoFisher) cells were lysed for Nanobody Trap experiments following the manufacturer’s protocol (Chromotek #gta-20 The bound proteins were eluted by boiling in 2X Western sample buffer and subjected to SDS-PAGE (immunoprecipitated IP fraction) The membrane was probed for Myc-epitope (Santa Cruz #sc-40 The lysate was also subjected to SDS-PAGE (input fraction) the membrane was probed for Myc-epitope (Santa Cruz #sc-40 1:250) and GAPDH (Abcam #ab9485 or Cell Signaling #2118 1:10,000) were used to visualize immuno-signals on an Odyssey FC imager The forebrain tissues were homogenized in T-PER protein extraction reagent (ThermoFisher #78510) cleared by centrifugation following the manufacturer’s instruction The following antibodies were added to the lysate at a final concentration of 10 ug/mL: mouse anti-Anks1b (Santa Cruz #sc-376610) or mouse control IgG (Vector labs #I-2000-1) and incubated overnight on a rotator 25uL Pierce Protein A/G magnetic beads (ThermoFisher #88802) were added to each immunoprecipitation replicates and incubated for 1 hr under RT Beads were washed in wash buffer containing 150 mM NaCl and boiled in 2X sample buffer to elute the precipitated complexes for label-free LC-MS/MS analysis Peptide signals were subjected to trimmed-mean normalization and summed on the protein level Single-peptide detections and contaminants such as mouse IgG were excluded from the analysis Enrichment was defined as Log2-FC ≥ 1 and p-value < 0.05 using the Duke Proteomics and Metabolomics Shared Resource (DPMSR) Proteome Discoverer Data Visualization Tool the following genomic sequences were targeted by gRNAs using AAV: Syngap1: acggactcggtctcagcccatgg; Anks1b: attgtcccactgtttggacaggg AAVs (PHP.eB serotype) were applied to H11-Cas9 primary neuronal cultures with empty gRNA virus serving as negative control Effective disruption of Syngap1 and Anks1b expression was confirmed by Western blot (Syngap1: Sigma #SAB2501893 or ThermoFisher #PA5-58362 Individual gRNAs were purchased as oligonucleotides (Integrated DNA Technologies) and cloned into the gRNA expression plasmids using BsmBI sites DNA was extracted from cells infected with the lentivirus following a 3-day incubation period The multiplicity of infection (MOI) was determined by qPCR The concentrated lentivirus was snap-frozen and stored at −80 °C as single-use aliquots To assess the effect of CRISPRa transcriptional activation cultured neurons were treated with Scn2a-CRISPRa or non-targeting control lentiviral vectors at DIV0 the cDNA was prepared using Cells-to-cDNA kit (ThermoFisher #AM1723) following the manufacturer’s instructions Predesigned KiCqStart SYBR green primers (Sigma #KSPQ12012) targeting mouse Scn2a and Actb were used for qPCR experiments with PowerUp SYBR green master mix (ThermoFisher #A25742) Specific on-target amplifications were confirmed by gel electrophoresis and TOPO sequencing of the PCR products (ThermoFisher #450030) The gRNA2 was selected for the experiments in this study based upon its superior ability to upregulate Scn2a over gRNA1 and gRNA3 in cultured neurons #RC215868) were cloned into an AAV-expression vector downstream of the hSyn promotor A non-targeting AAV-Flex-GFP vector (from Dr Il Hwan Kim) was used as a negative control Cultured neurons were treated with these AAV vectors (PHP.eB serotype) at DIV0 and lysed for Western blot analysis on DIV 11 Effective expression was confirmed by Western blot (SCN1B: Cell Signaling #13950 S 48-well MEA plates (Axion Biosystems #M768-KAP-48 or #M768-tMEA-48W) were coated with 1 mg/mL poly-L-lysine in borate buffer (pH 8.5) and spotted at a density of 150,000 cells per the inner growth area of each well brain tissue was temporarily stored in Hibernate A solution (ThermoFisher #A1247501) at 4 °C following the manufacturer’s instructions until ready for dissociation and plating Viral treatments were applied at the day of plating Recordings were conducted on a Maestro MEA system (Axion Biosystems) on DIV 8 after 10 min of acclimation to the recording chamber (37 °C a half-change of growth media (Neurobasal A supplemented with B27 Recording data were analyzed using the Axion Neural Metric Tool Single electrode bursts were defined as a minimum of 5 spikes separated by an inter-spike interval (ISI) of no more than 100 msec Network bursts were defined as a minimum of 10 spikes separated by an ISI of no more than 100 msec with at least 25% of the electrodes active Statistical analyzes (one-way ANOVA followed by pair-wise Tukey HSD post-hoc tests) were performed using JMP Pro (SAS) Anxiety-like behaviors were assessed in the elevated zero maze as described under 40–60 lux illumination114 Mice were housed overnight in the test room and tested individually the next day Animals were placed into a closed area of the maze and provided 5 min of free exploration Videos were scored by trained observers blinded to the genotype and sex of the animals using the Noldus Observer XT15 program (Leesburg VA) for the percent time in the open areas and the distance traveled Mice were housed in the test room overnight and the next day were examined in the hole-board test as described114 Individual mice were placed into a 4; 2 × 42 × 30 cm open field (Omnitech Electronics OH) and given free exploration of the apparatus for 10 min under 180 lux illumination The hole-board apparatus consisted of a white Plexiglas floor with 16 equally spaced holes (3 cm in diameter) arranged in 4 rows Head-dips into the holes were filmed and the videos were scored with the TopScan program (CleverSys VA) for the numbers of head-dips and the location of each head-dip Mice were filmed for 10 min for self-induced grooming the videos were converted for analysis using Noldus MediaRecorder2 Grooming behavior was scored using TopScan software (CleverSys Male WT and Scn2a+/R102Q mice were housed individually 1 week before testing males were primed twice with soiled bedding from estrous C57BL/6 J females for 2 days males were placed on clean bedding for 1 day and finally were returned to clean bedding overnight They were acclimated to the recording chambers for 2 min and then were introduced to an unfamiliar C57BL/6 J female (12–16 weeks of age) for 8 min Ultrasonic calls were recorded over the entire 10 min test as waveform audio files The data were analyzed by scorers blinded to the genotypes of the mice using Avisoft SASLab Pro (Glienicke/Nordbahn Social testing began within two hr after the lights had extinguished and was conducted under red light and metal frame holding the water bottle were removed The filter was removed from the top of the cage so behaviors could be filmed and the mouse could not escape Tests were terminated if attacks by either Scn2a or C3H/HeJ males occurred for more than 1 min or if a mouse was injured All behaviors were tested in the Social StereoScan apparatus (Cleversys) where behaviors can be filmed simultaneously from the top and sides of the test chamber All videos were scored using Noldus Observer (version 15) by trained personnel blinded to the genotypes of the mice Mild-social investigation consisted of approaching and/or jumping in the presence of the partner Agonistic behaviors denoted tail rattling to the partner and/or feinting Withdrawal behaviors (no acknowledgement of partner) included walking-away turning-away (without leaving proximity of the partner) or digging in the bedding when the partner contacts or attempts to interact The data were presented as means and standard errors of the mean (SEMs) and USV data were analyzed by independent-samples t-tests and the social behavior data were analyzed by repeated-measures ANOVA followed by Bonferroni corrected pair-wise comparisons All statistical analyzes were performed with IBM SPSS Statistics 28 programs (IBM IL) and the data were graphed using GraphPad Prism (Boston Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article Requests for custom computer code used in this study should be directed to and will be fulfilled by the Corresponding Author Scott Soderling (scott.soderling@duke.edu) Code used in this study is also available in a public Github repository (git@github.com:lauragails/gene_baiting.git) SFARI Gene: an evolving database for the autism research community Large-Scale Exome Sequencing Study Implicates Both Developmental and Functional Changes in the Neurobiology of Autism Large-scale targeted sequencing identifies risk genes for neurodevelopmental disorders Postnatal neurodevelopmental disorders: meeting at the synapse Regulatory genes and pathways disrupted in autism spectrum disorders Rare coding variation provides insight into the genetic architecture and phenotypic context of autism Single-cell genomics identifies cell type-specific molecular changes in autism Co-expression profiling of autism genes in the mouse brain Transcriptomic analysis of autistic brain reveals convergent molecular pathology Autism spectrum disorder: insights into convergent mechanisms from transcriptomics Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations A scored human protein-protein interaction network to catalyze genomic interpretation Patterns and rates of exonic de novo mutations in autism spectrum disorders Protein interactome reveals converging molecular pathways among autism disorders Neuronal sub-compartmentalization: a strategy to optimize neuronal function Compartmentalized signaling in neurons: from cell biology to neuroscience transcriptional and chromatin genes disrupted in autism Reciprocal signaling between translational control pathways and synaptic proteins in autism spectrum disorders Pathophysiological roles of abnormal axon initial segments in neurodevelopmental disorders SCN2A channelopathies in the autism spectrum of neuropsychiatric disorders: a role for pluripotent stem cells Identification of an elaborate complex mediating postsynaptic inhibition Mapping axon initial segment structure and function by multiplexed proximity biotinylation diseases and evolution of the human postsynaptic density In-depth protein profiling of the postsynaptic density from mouse hippocampus using data-independent acquisition proteomics Neuron-specific protein network mapping of autism risk genes identifies shared biological mechanisms and disease-relevant pathologies Protein interaction studies in human induced neurons indicate convergent biology underlying autism spectrum disorders Cross-linking mass spectrometry for investigating protein conformations and protein-protein interactions - a method for all seasons Combining LOPIT with differential ultracentrifugation for high-resolution spatial proteomics Plug-and-play protein modification using homology-independent universal genome engineering Efficient proximity labeling in living cells and organisms with TurboID and reversible labeling of endogenous proteins using CRISPR-based designer exon insertion The STRING database in 2021: customizable protein-protein networks and functional characterization of user-uploaded gene/measurement sets STRING: a web-server to retrieve and display the repeatedly occurring neighbourhood of a gene DeepND: deep multitask learning of gene risk for comorbid neurodevelopmental disorders Modulating effects of FGF12 variants on Na(V)1.2 and Na(V)1.6 being associated with developmental and epileptic encephalopathy and Autism spectrum disorder: A case series Integrating de novo and inherited variants in 42,607 autism cases identifies mutations in new moderate-risk genes Action potential-coupled Rho GTPase signaling drives presynaptic plasticity Stockhammer, A. et al. When less is more – Endogenous tagging with TurboID as a tool to study the native interactome of adaptor protein complexes. bioRxiv. https://doi.org/10.1101/2021.11.19.469212 (2022) S.SPARK: a US cohort of 50,000 families to accelerate autism research Simons Variation in Individuals Project (Simons VIP): a genetics-first approach to studying autism spectrum and related neurodevelopmental disorders High-performance probes for light and electron microscopy Identification of common genetic risk variants for autism spectrum disorder An efficient algorithm for large-scale detection of protein families Long-term potentiation modulates synaptic phosphorylation networks and reshapes the structure of the postsynaptic interactome Spatiotemporal profile of postsynaptic interactomes integrates components of complex brain disorders Synaptic GAP and GEF complexes cluster proteins essential for GTP signaling ANKS1B gene product AIDA-1 controls hippocampal synaptic transmission by regulating GluN2B subunit localization Twenty years of SynGAP research: from synapses to cognition CaMKII-mediated displacement of AIDA-1 out of the postsynaptic density core SynGAP moves out of the core of the postsynaptic density upon depolarization Rapid dispersion of SynGAP from synaptic spines triggers AMPA receptor insertion and spine enlargement during LTP Haploinsufficiency in the ANKS1B gene encoding AIDA-1 leads to a neurodevelopmental syndrome Mutations in SYNGAP1 cause intellectual disability and a specific form of epilepsy by inducing haploinsufficiency The role of synaptic GTPase-activating protein in neuronal development and synaptic plasticity Comprehensive behavioral analysis of heterozygous Syngap1 knockout mice and learning in the complex with postsynaptic density 95 and NMDA receptor Isolation and characterization of postsynaptic densities from various brain regions: enrichment of different types of postsynaptic densities Autistic-like behaviours and hyperactivity in mice lacking ProSAP1/Shank2 Genetic and neurodevelopmental spectrum of SYNGAP1-associated intellectual disability and epilepsy Endogenous Syngap1 alpha splice forms promote cognitive function and seizure protection SYNGAP1 controls the maturation of dendrites and network activity in developing human neurons Pathogenic SYNGAP1 mutations impair cognitive development by disrupting maturation of dendritic spine synapses The autism-associated gene Scn2a contributes to dendritic excitability and synaptic function in the prefrontal cortex Opposing effects on NaV1.2 function underlie differences between SCN2A variants observed in individuals with autism spectrum disorder or infantile seizures De novo mutations revealed by whole-exome sequencing are strongly associated with autism De novo genic mutations among a Chinese autism spectrum disorder cohort Whole genome sequencing and variant discovery in the ASPIRE autism spectrum disorder cohort Functional correlates of clinical phenotype and severity in recurrent SCN2A variants Genetic disruption of WASHC4 drives endo-lysosomal dysfunction and cognitive-movement impairments in mice and humans Na Channel beta subunits: overachievers of the ion channel family The fibroblast growth factor family: neuromodulation of affective behavior Tamura, S. et al. CRISPR activation rescues abnormalities in SCN2A haploinsufficiency-associated autism spectrum disorder. bioRxiv. https://doi.org/10.1101/2022.03.30.486483 (2022) Quantitative proteomics reveals protein-protein interactions with fibroblast growth factor 12 as a component of the voltage-gated sodium channel 1.2 (nav1.2) macromolecular complex in Mammalian brain Molecular dissection of neurobeachin function at excitatory synapses Neurobeachin and the kinesin KIF21B are critical for endocytic recycling of NMDA receptors and regulate social behavior Neurobeachin: a protein kinase A-Anchoring,beige/Chediak-Higashi protein homolog implicated in neuronal membrane traffic Neurobeachin regulates neurotransmitter receptor trafficking to synapses NBEA: developmental disease gene with early generalized epilepsy phenotypes The neurobeachin gene is disrupted by a translocation in a patient with idiopathic autism Neurobeachin regulates glutamate- and GABA-receptor targeting to synapses via distinct pathways Tandem mass tags: a novel quantification strategy for comparative analysis of complex protein mixtures by MS/MS Trends in the design of new isobaric labeling reagents for quantitative proteomics Chemico-genetic discovery of astrocytic control of inhibition in vivo BioGRID: a general repository for interaction datasets Highly accurate protein structure prediction with AlphaFold Evolutionary-scale prediction of atomic-level protein structure with a language model Accurate prediction of protein structures and interactions using a three-track neural network Fully automated sample processing and analysis workflow for low-input proteome profiling Making single-cell proteomics biologically relevant A machine learning approach to predicting autism risk genes: validation of known genes and discovery of new candidates Forecasting risk gene discovery in autism with machine learning and genome-scale data Quantitative single-cell proteomics as a tool to characterize cellular hierarchies Ultra-high sensitivity mass spectrometry quantifies single-cell proteome changes upon perturbation Phosphorylation of synaptic GTPase-activating protein (synGAP) by Ca2+/calmodulin-dependent protein kinase II (CaMKII) and cyclin-dependent kinase 5 (CDK5) alters the ratio of its GAP activity toward Ras and Rap GTPases A model for regulation by SynGAP-alpha1 of binding of synaptic proteins to PDZ-domain ‘Slots’ in the postsynaptic density Fibroblast growth factor homologous factors control neuronal excitability through modulation of voltage-gated sodium channels Sodium channel subtypes are differentially localized to pre- and post-synaptic sites in rat hippocampus CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens Engineered AAVs for efficient noninvasive gene delivery to the central and peripheral nervous systems PolySTest: robust statistical testing of proteomics data with missing values improves detection of biologically relevant features Hallett, P. J., Collins, T. L., Standaert, D. G. & Dunah, A. W. Biochemical fractionation of brain tissue for studies of receptor distribution and trafficking. Curr Protoc Neurosci Chapter 1, Unit 1 16. https://doi.org/10.1002/0471142301.ns0116s42 (2008) Cytoscape: a software environment for integrated models of biomolecular interaction networks ShinyGO: a graphical gene-set enrichment tool for animals and plants expert-curated knowledge base for the synapse MAGMA: generalized gene-set analysis of GWAS data Fiji: an open-source platform for biological-image analysis Optimized libraries for CRISPR-Cas9 genetic screens with multiple modalities CRISPR activation and interference screens decode stimulation responses in primary human T cells lentiMPRA and MPRAflow for high-throughput functional characterization of gene regulatory elements Synaptic dysfunction and abnormal behaviors in mice lacking major isoforms of Shank3 Deficiency of Shank2 causes mania-like behavior that responds to mood stabilizers Aberrant responses in social interaction of dopamine transporter knockout mice An anxiety-like phenotype in mice selectively bred for aggression BioVenn - a web application for the comparison and visualization of biological lists using area-proportional Venn diagrams Download references Department of Molecular Genetics and Microbiology Proteomics and Metabolomics Shared Resource Department of Psychiatry and Behavioral Sciences Mouse Behavioral and Neuroendocrine Analysis Core Facility Seaver Autism Center for Research and Treatment The Mindich Child Health and Development Institute performed HiUGE-iBioID experiments and analyzes designed and managed the behavioral experiments and statistical analyzes contributed to the generation of Scn2a+/R102Q model All authors contributed to manuscript editing and revision have a patent application related to the HiUGE technology (16/968,904) The intellectual property was licensed to CasTag Biosciences is a founder of CasTag Biosciences; Duke University as an institution holds equity in CasTag Biosciences is an inventor on patents and patent applications related to CRISPR-based gene activation Dawson is on the Scientific Advisory Boards of Akili Interactive and/or products that have been licensed to Apple and Dawson and Duke University have benefited financially The remaining authors declare no competing interests Nature Communications thanks the anonymous reviewer(s) for their contribution to the peer review of this work Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations Download citation DOI: https://doi.org/10.1038/s41467-024-51037-x Anyone you share the following link with will be able to read this content: a shareable link is not currently available for this article Sign up for the Nature Briefing newsletter — what matters in science Look out for your first newsletter in your inbox soon We help you navigate a myriad of possibilities Sign up for our newsletter for the best of the city By entering your email address you agree to our Terms of Use and Privacy Policy and consent to receive emails from Time Out about news, events, offers and partner promotions. Tokyo Opened in 2018, Shonai Hotel Suiden Terrasse in Yamagata was the first hotel to be designed by award-winning Japanese architect Shigeru Ban the hotel makes for a peaceful retreat with a bright minimalist interior and an emphasis on sustainable living.  The hotel provides everything you could want for a rejuvenating getaway onsen baths and a stunning indoor playground Adding to the list of sumptuous facilities is a new designer sauna hotel guests can sprinkle water over heated stones to create a steam-room effect which is preferred in Finland over scorching dry saunas.   were also designed by Shigeru Ban; they feature the same architectural styles as the rest of the hotel features hexagonal wooden benches and ceiling that tie in with the geometric design of the spa building the seating mimics Ban’s iconic paper tube structures A panel made with wood from Yamagata fruit trees including cherry and pear emanates a sweet calming scent as you gaze out at the rice terrace through the window you can cool down by enjoying local craft beer from the tap at the hotel bar or with a cup of gelato in the adjacent library.   You might think that the designer hotel with its fancy new spa is only for the megarich Currently, room rates start at a low ¥5,750 per person (excluding meals) a one-month membership will only set you back ¥8,800 Tell us what life is like in Tokyo – we want to hear from you Japan may reopen international travel with ‘vaccine passports' 'Pretty Guardian Sailor Moon Eternal the Movie' is coming to Netflix in June TikTok’s favourite instant ramen hack will upgrade your two-minute noodles This new beachfront glamping site in Awaji has dome tents and a heart-shaped pool Want to be the first to know what’s cool in Tokyo? Sign up to our newsletter for the latest updates from Tokyo and Japan. facebooktwitterpinterestinstagramAbout us Support APA with a purchase of one of our products All income generated from sales of these items goes to supporting our website Mike Kelley (USA) and Simon Devitt (NZ) are back for another architectural photography workshop group attendees will venture to Japan to visit the Shonai Hotel Suiden Terrasse in Japan’s Yamagata Prefecture Building on our experiences with past workshops this adventure promises to be an unforgettable experience for participants Please read the itinerary thoroughly for details on what is included in the price of the workshop Mike Kelley and Simon Devitt are back for another architectural photography workshop Ther are three separate groups available for this workshop The itinerary below details what is and is not included for each day of the workshop Suiden Terrace opened in 2018  was designed by award-winning architect Shigeru Ban Ban studied architecture at both California’s SCI-Arc and New York’s Cooper Union and has become one of the most respected architects in the world pioneering one-of-a-kind design languages via the use of thoughtful and innovative materials Ban has consistently and successfully blended modern designs with innovative materials such as cardboard and paper; for example he was the first architect in the world to design a code-passing structure made out of paper Ban has also taken on many humanitarian causes such as refugee shelters and short-term pavilions all of which are made out of sustainable materials The hotel sits atop rice fields and beautifully reflects its natural surroundings and features bright minimalist decor inside – an inspiring setting for making photos learning more about the business of architectural photography and enjoying the company of other professionals looking to improve their technique and level-up in their careers As Suiden Terrasse is located in an agricultural area their on-site restaurants feature farm-to-table menus filled with seasonal produce and seafood Tuition is due in full upon reserving your spot Tuition is non-refundable but is transferable you’re welcome to give your spot to a friend — just let us know beforehand We have taught many workshops in our careers and agree that it’s nearly impossible to teach adequately as soon as class sizes get larger than eight people Due to the specialized equipment and wide open spaces required to have everyone not only learn about we kept it small and intimate so that attendees not only get a chance to make amazing photos but also have plenty of time interfacing with instructors The nearest airport is Yamagata Airport (GAJ) It is located ~30 minutes from Daiwa Roynet Hotel Yamagata-ekimae How do we get from the airport to Daiwa Roynet Hotel Yamagata-ekimae All attendees will be responsible for their own transportation – traditional taxis are recommended as Uber is not available in the area An APA representative will meet you at Daiwa Roynet Hotel Yamagata-ekimae at 12:00 pm and help you board a private shuttle which will take all students to Suiden Terrace transportation to and from Shonai Hotel Suiden Terrasse (unless you need to leave earlier than our planned departure) A breakdown of what is included on each day is listed in the tentative itinerary above Airfare is not included and must be booked by attendees separately we cannot accommodate guests beyond the workshop participant car and meal reservations have been made to account for only the number of attendees + instructors and assistants Mike Kelley is a photographer based in Los Angeles with an established local practice and occasional travel assignments when he can be lured beyond the idyllic weather of Southern California California who specializes in photographing architecture; I also have a mild airplane obsession Massachusetts: a small coastal town that’s one part postcard and one part dramatic Boston movie Here I was lucky enough to meet a number of amazing teachers who opened my eyes to the world of art and design; this would alter the path of my life in more ways than I could ever imagine After studying studio art and environmental science at the University of Vermont in hopes of becoming a professional snowboarder (graduating right after the ’08 recession made this seem like a great idea) A couple of years and too many injuries later I found myself taking up an offer to photograph a few homes for a client I’d met while recuperating What started by chance turned out to be the perfect mix of technical challenge and creative outlet and I decided right there and then that it absolutely must be my career In 2018, I founded the Architectural Photography Almanac a resource for architecture photographers and those in the architecture industry seeking to learn about the craft and theory of architectural photography Simon Devitt is a photographer based in Wellington with an established international practice throughout Australasia and further afield I am a photographer with a strong practice focus in Photography of Architecture currently based in Whanganui-a-Tara Wellington in Aotearoa New Zealand; with an established international practice throughout Australasia and further afield I have both a strong sense of home and a wanderlust which goes right back to when I was born in a sandstorm beside a sleeping camel in 1973 Working in many different settings across cultures around the world has had a great impact on my professional practice which has been greatly enriched by my experience of each particular context: Shanghai and its people the fruitful silence of a Japanese bamboo forest as if a giant soft box had been placed over the sun standing with my camera equipment in a very suburban street in Echo Park I noticed that I had caught the neighbours’ attention all of them appearing to act as a neighbourhood watch of sorts over the house I was photographing and for each other I felt a great sense of community and a few of them even made it into one of my pictures I intentionally add people to my photos—their appearance allows a sense of scale and a place in time I am the author of the award-winning photo-book Rannoch and the All Things Considered series Photo-books bring together my passion for image which started in 2013 with the launch of Portrait of a House my first self-published photo-book on the Athfield residence in Wellington I have published the Ripe Fruit series (2018-2019) and Cape to Bluff (2022) My images feature in many books and collaborations including Long Live the Modern (2009) Group Architects: Towards a New Zealand Architecture (2010) Summer Houses (2011); as well as in numerous national and international magazines such as Elle Decor (Italy I lectured in Photography of Architecture at the University of Auckland for 10 years where I have also had the pleasure of offering the annual Simon Devitt Prize for Photography since 2008 Your browser does not support JavaScript, or it is disabled．Please check the site policy for more information Yamagata Prefecture--Sayaka Kirie used to have a less than 20-minute commute to work--four minutes on foot and 10 minutes by train a flight attendant with All Nippon Airways Co involving a 30-minute bus ride and a 60-minute flight Kirie moved from Tokyo’s Ota Ward to Sakata She uses her employer’s air service to “commute” from Shonai Airport here to her workplace at Haneda Airport in the Japanese capital Her life in the Shonai area of northwestern Yamagata Prefecture because I hail from the Goto islands of Nagasaki Prefecture (where there is little snow),” Kirie said I was caught up in the drifting snow while I was walking to a convenience store at night this is it.’ It felt as if I were diving in the water.” along with four of her fellow flight attendants as “ANA Shonai Blue Ambassadors” (ASBAs) since October last year The ASBA project has ANA flight attendants reside in the Shonai area while remaining in active service based at Haneda They spend the remaining half of the month posting information online on the Shonai area cooperating with the development and advertisement of local products and otherwise engaging in regional promotion efforts the quintet has appeared in their flight attendant uniforms at events held in Tsuruoka a workshop on personal grooming and a Christmas-related festivity The coronavirus pandemic has dealt a major blow to air travel demand Flight attendants have suffered sharp drops in their incomes from fewer opportunities to serve aboard flights ANA has presented new work style options for them including temporary transfers on loan to other companies and offering a new housing system that motivates them to move to live in other prefectures and commute by air Some 1,200 ANA workers have so far been reassigned on loan to other entities mass home electric appliance retailer Nojima Corp and supermarket chain operator Seijo Ishii Co differs from those other programs because the duty of goodwill ambassadors for commemorating the 30th anniversary of Shonai Airport’s opening is defined as a “side job.” “The ASBAs are supposed to remain ANA flight attendants who are only drawing on their expertise,” said Makoto Maeda “That’s certainly about something other than flight duties but the ASBAs are not supposed to be taking a temporary leave to be on loan to a different business sector That setup makes quite a difference in the level of their motivation.” Many are watching with great interest to see the outcome of the innovative measure which provides a unique combination of personal relocation She is qualified to serve as chief purser on domestic flights and as business class purser on international flights She was literally flying around the world until the pandemic struck “And suddenly I had to be at home day after day and my income took a sharp dive,” Kirie said “I grew so anxious about the future that I switched to a whole life insurance policy.” A call for applicants for the ASBA program came around the time she was deciding if she would have to rethink her lifestyle The positions on offer had a limited term ending in March 2023 Taking one would certainly allow her to earn more but would also reduce her opportunities to be aboard flights by one-half and would limit them to domestic flights alone during her term And fewer opportunities to work flights could hurt her career plans for the years to come The jobs being offered were therefore not going to help her career “I had always wanted to do something that would sow seeds for the future,” she said “The opportunity to live in the countryside also appeared attractive Kirie’s job basically comprised only standing by on board a plane until needed But she now has opportunities to take the initiative in approaching a large number of strangers Kirie said she believes the experience will empower her for the future and will pay off in the long run The ASBA program was born on the sidelines of ANA’s group-wide business structure reform which was put into practice last April in response to the COVID-19 pandemic a group company that was in charge of airline ticket sales and a travel business was split up and replaced by ANA Akindo Co. a new corporate entity that combines airline ticket sales with a regional development business The measure is intended to stimulate the mobility of humans and goods and to create air travel demand by extension by not just selling airline tickets but also engaging actively in regional communities The latest appointment of the flight attendants in active service to the ASBA positions is also intended to achieve a more broad-based penetration of the ANA brand Izumo recruits flight attendants to help local tourism lift off Airlines working on the ground to lift struggling rural areas All Nippon Airways to offer weddings on grounded planes EDITORIAL: Rules needed to protect workers on loan to other companies Star geisha hangs up kimono so she can see the ‘broader world’ Information on the latest cherry blossom conditions Please right click to use your browser’s translation function.) A series based on diplomatic documents declassified by Japan’s Foreign Ministry Here is a collection of first-hand accounts by “hibakusha” atomic bomb survivors chefs and others involved in the field of food introduce their special recipes intertwined with their paths in life A series about Japanese-Americans and their memories of World War II In-house News and Messages Copyright © The Asahi Shimbun Company. All rights reserved. No reproduction or republication without written permission. the last descendant of a Japanese samurai clan LifeBy Judith FeinJan. 10, 2018About 150 years ago, at the end of Japan’s Edo period a civil war resulted in the end of the samurai culture and the birth of modern Japan One rebel clan of samurai chose mass suicide the Sakai clan of samurai opted for a dignified surrender They gave up their swords and destroyed their castle created a regional bank and a silk farming industry and threw their support behind the new Meiji government Sixteen generations have passed since the first feudal Sakai clan leader presided over Shonai 71-year-old Tadahisa Sakai — whom locals refer to as “the last descendant” — is a revered man in the Shonai region which is a two-hour flight or four-hour train ride from Tokyo Sakai is the curator of the Chido Museum in Yamagata prefecture the museum houses a collection of invaluable samurai helmets fishing poles (the longest measures 30 feet) and drums used during battles to signal warriors I spoke to the impeccably groomed Sakai through a translator at the museum about how the teachings of his samurai ancestors apply to issues we face today “Never walk or run away from difficult situations,” he added “Face the situation from the bottom of your heart Once you decide to deal directly with conflict try to be neither optimistic nor pessimistic “Do your best to deal with the problem,” he explained When asked how he faces conflict in his intimate relationships is almost never asked personal questions — was refreshingly forthcoming “I understand that Western males want to escape confrontation and conflict Paul Ross/MicSakai said he used the same principles when he had conflicts with his young children He also praised them when it was called for In addition to the Shonai museum, Sakai is opening a sword museum in Tokyo in January It is the first exhibition of modern art swords that were created using ancient techniques “Art swords are used for rituals or in religious facilities,” he said “The surface of the sword is like human skin “What I do is a tiny achievement compared to my ancestors,” he said “I can’t even call myself traditional because I am not up to the accomplishments of those who came before me.” He didn’t hesitate in addressing increasing Japanese militarism and whether it concerns him Sakai said he doesn’t worry because he trusts the younger generation He said they are trying to adjust to the world today so they can fit in and maneuver in their own way “They will inherit the traditions that came before them — the essence of the traditions,” Sakai said who is a 17th-generation Sakai: “He is already at the mastery level of kendo Sakai paused for a moment before adding: “I send my best wishes and regards to the younger generation.” He said they will know what is important from their ancestors and apply it to their own lives “The future of the world depends on them.” Metrics details MEK/ERK-mediated signals have recently been found to inhibit Fas-mediated cell death through inhibition of caspase-8 activity It remains unknown whether MEK/ERK-mediated signals affect ionizing radiation (IR)-induced cell death Here we demonstrate that MEK/ERK-mediated signals selectively inhibit IR-induced loss of mitochondrial membrane potential (ΔΨm) and subsequent cell death TPA strongly activated ERK and inhibited the IR-induced caspase-8/Bid cleavage and the loss of ΔΨm The inhibitory effect of TPA was mostly abrogated by pretreatment of a specific MEK inhibitor PD98059 indicating that the effect depends upon MEK/ERK-mediated signals BAF-B03 transfectants expressing IL-2 receptor (IL-2R) βc chain lacking the acidic region which is responsible for MEK/ERK-mediated signals revealed higher sensitivity to IR than the transfectants expressing wild-type IL-2R the signals could neither protect the ΔΨm loss nor cell death in UV-irradiated cells These data imply that the anti-apoptotic effect of MEK/ERK-mediated signals appears to selectively inhibit the IR-induced cell death through protection of the ΔΨm loss Our data enlighten an anti-apoptotic function of MEK/ERK pathway against IR-induced apoptosis thereby implying its contribution to radioresistance it is likely that caspase-8 is marginal for IR-induced apoptosis This raises the possibility that ERK-mediated signals cannot suppress IR-induced apoptosis if caspase-8/Bid activation is marginal for the IR-induced apoptotic process We thus investigated whether TPA-mediated ERK activation can protect Jurkat cells from IR-induced apoptosis We report here that MEK/ERK-mediated signals can unexpectedly protect Jurkat cells from IR-induced apoptosis inhibition of caspase-8/Bid activation alone could not protect Jurkat cells from either cell death or the ΔΨm loss though caspase 3/8 activation and DNA fragmentation were substantially inhibited by a caspase inhibitor which cannot introduce MEK/ERK-mediated signals revealed higher sensitivity to IR than control F7 transfectants the anti-apoptotic effect of MEK/ERK-mediated signals appears to be due to inhibition of the ΔΨm loss in IR-exposed cells implying that MEK/ERK triggers an anti-apoptotic signal discriminating from its inhibitory signal against caspase-8/Bid activation we show that the MEK/ERK-mediated signals cannot inhibit the UV-induced apoptosis our data imply an unidentified anti-apoptotic action of MEK/ERK-mediated signals which lies upstream of the ΔΨm loss and selectively contributes to IR-exposed cells Induction of apoptosis in IR-exposed Jurkat cells Cell death was assessed by Trypan blue exclusion assay at 18 h after exposure to the indicated dose of IR The columns display the mean standard deviation (S.D.) of data from three separate experiments (B) DNA fragmentation of low-molecular weight DNA prepared from the cells at 12 h after exposure to the indicated doses of IR (C) Time-course of cell death after 20 Gy-irradiation Cell viability was evaluated at the indicated hours (D) The disruption of ΔΨm at the indicated hours after exposure to 20 Gy-irradiation the ΔΨm was measured and is shown in histogram plot of FL-1 fluorescence intensity The percentages express rates of the ΔΨm loss (E) PE at the indicated hours after 20 Gy-irradiation Annexin V-binding capability was evaluated using an ApoAlert Annexin V-FITC kit and is shown in a histogram plot of FL-1 fluorescence intensity (F) Cleavage of caspases and Bid at the indicated hours after 20 Gy-irradiation Their cleavage was determined by immunoblotting with the indicated antibodies HSC70 protein levels show the same amount of protein loaded in each lane Effect of caspase inhibitor on caspase 3/8 and Bid activation (A) Jurkat cells were incubated with the indicated concentrations of z-IETD-FMK (a caspase-8 and Granzyme B inhibitor) z-AAD-CMK (a Granzyme B inhibitor) or 0.3% DMSO (solvent) 30 min before exposure to 20 Gy-irradiation Caspase-8 and -3 activities were measured at 9 h after IR-exposure using Caspase-8 and Caspase-3 colorimetric protease assay kits from which data of unirradiated control cells were subtracted (B) Cells were incubated with 15 μM z-IETD-FMK or 15 μM z-AAD-CMK 30 min before exposure to 20 Gy-irradiation cleavage of caspases and Bid was detected by Western blots Inhibition of caspase activation was insufficient to suppress IR-induced apoptosis (A) Effect of z-IETD-FMK or z-AAD-CMK on IR-induced DNA fragmentation Jurkat cells were incubated with each inhibitor (15 μM) for 30 min prior to 20 Gy-irradiation DNA fragmentation of low-molecular weight DNA prepared from the cells at 12 h after irradiation (B) Effect of z-IETD-FMK or z-AAD-CMK on IR-induced cell death Cells were incubated with each inhibitor (15 μM) for 30 min prior to 20 Gy-irradiation cell death was evaluated by Trypan blue exclusion assay and each column displays the mean±S.D (C) Effect of z-IETD-FMK (15 μM) on disruption of ΔΨm the ΔΨm was measured by a DePsipher™ Kit and is shown in a histogram plot of FL-1 fluorescence intensity (D) Representative electron micrographs of Jurkat cells with or without incubation of z-IETD-FMK for 30 min prior to 20 Gy-irradiation The irradiated cells were fixed at 12 h after exposure N refers to nucleus and original magnification is 10 000× Anti-apoptotic effect of TPA on IR-induced apoptosis (A) A dose-dependent antiapoptotic effect of TPA Jurkat cells were incubated with the indicated concentrations of TPA for 1 h prior to 20 Gy-irradiation cell death was evaluated by trypan blue exclusion assay (B) TPA inhibited cleavage of caspases and Bid during IR-induced apoptosis Cells were incubated with (+) or without (−) 100 nM TPA for 1 h prior to 20 Gy-irradiation cleavage of the indicated molecules was evaluated by immunoblotting (C) Augmentation of anti-apoptotic effect of TPA by prolonged preincubation Cells were cultured in the presence of 100 nM TPA for the indicated hours prior to 20 Gy-irradiation of data from three separate experiments (A and C) (D) Augmentation of TPA-mediated suppression of caspases and Bid cleavage by prolonged preincubation Total cell lysates were prepared at 8 h after 40 Gy-irradiation HSC70 protein levels indicate an equal amount of protein loaded in each lane (B and D) (E) No distinct effect of TPA on expression levels of FLIP Total cell lysates (80 μg/lane) were prepared at the indicated periods after incubation with 100 nM TPA and expression levels of the indicated molecules were evaluated by Western blots (F) Representative electron micrographs of Jurkat cells with (+) or without (−) incubation of 20 nM TPA for 1 h prior to 20 Gy-irradiation MEK/ERK activation is required for anti-apoptotic effect of TPA against IR-induced apoptosis (A) A dose-dependent inhibitory effect of a MEK inhibitor PD98059 on TPA-induced ERK phosphorylation The indicated doses of PD98059 were added for 30 min prior to incubation with 20 nM TPA and its inhibitory effect was evaluated by decrease of ERK phosphorylation (B) Inhibitory effect of PD98059 on TPA-mediated protection of caspases and Bid cleavages Twenty μM PD98059 was added for 30 min prior to incubation with 20 nM TPA for 1 h After incubation with (+) or without (−) the indicated reagents Jurkat cells were irradiated at 20 Gy and harvested at 9 h after exposure The cleavage of caspases and Bid was determined by immunoblotting with the indicated antibodies (C) PD98059 inhibits the anti-apoptotic effect of TPA on PE Cells ware preincubated with 20 nM TPA and/or 20 μM PD98059 as experiments in B PE was evaluated by detection of binding capability to Annexin V at 12 h after 20 Gy-irradiation and data from three independent experiments are shown in a histogram plot of FL-1 fluorescence intensity (D) PD98059 inhibits the TPA-mediated suppression of ΔΨm loss Cells were harvested at 15 h after 20 Gy-irradiation with (+) or without (−) preincubation with 20 nM TPA and/or 20 μM PD98059 as experiments in B Effect of TPA on apoptosis induced by UV-irradiation in Jurkat cells (A) A dose-dependent cell death by UV-irradiation Cell death was assessed by Trypan blue exclusion assay at 24 h after exposure to the indicated dose of UV-irradiation (B) Cleavage of Bid and caspase-3 at 9 h after exposure to the indicated dose of UV-irradiation (C) Disruption of ΔΨm at 12 h after exposure to the indicated dose of UV-irradiation (D) Cell death assessed by Trypan blue exclusion assay at 24 h after exposure of data from three separate experiments in A (E) Cleavage of Bid and caspase-3 at 9 h after exposure ERK protein levels show the same amount of protein loaded in each lane in B (F) Disruption of ΔΨm at 12 h after exposure The ΔΨm is shown in a histogram plot of FL-1 fluorescence intensity The percentages express rates of the ΔΨm loss from three independent experiments in C Cells were incubated with (+) or without (−) 100 nM TPA for 1 h prior to exposure to UV (30 or 60 J/m2) in D Induction of apoptosis in IR-exposed BAF-B03 transfectants (A) A15 has no distinct ERK activation in response to IL-2 The proliferating F7 and A15 cells were deprived of IL-2 for 12 h and thereafter incubated with 400 IU/ml IL-2 for the indicated minutes Phosphorylation levels of ERK were evaluated by immunoblotting with anti-phosphorylated ERK specific antibody ERK protein levels show the same amount of protein loaded in each lane (B) IR-induced caspase-3 activation in F7 and A15 transfectants F7 and A15 cells were cultured in the presence of IL-2 for 7 days and caspase-3 activity was measured at 12 h after 20 Gy-irradiation using a Caspase-3 colorimetric protease assay kit (C) Disruption of ΔΨm at 18 h after 20 Gy-irradiation and the ΔΨm is shown in a histogram plot of FL-1 fluorescence intensity F7 and A15 cells were cultured in the presence of IL-2 or IL-3 for 7 days prior to 20 Gy-irradiation of data from three separate experiments in C MEK/ERK-mediated signals could not protect either the breakdown of ΔΨm or subsequent cell death in UV-mediated apoptosis IR may induce apoptosis with different machinery by which the ΔΨm is disrupted independently of caspase-8/Bid and this process is discriminated by sensitivity to MEK/ERK-mediated signals by which the ΔΨm is disrupted during IR-induced apoptosis in p53 (−/−) cells a variety of proteins have been identified to be targeted to mitochondrial membrane and disrupt ΔΨm in a wide range of apoptotic stimuli Further studies will reveal a molecule which selectively contributes to the IR-induced ΔΨm breakdown and clarify the mechanism for the anti-apoptotic function of MEK/ERK-mediated signals further clarification of the precise molecular mechanism(s) is required to understand variable radiosensitivity of the malignant cells obtained from the Japanese Cancer Research Resources Bank (Tokyo were grown in RPMI supplemented with 10% fetal calf serum (FCS) Murine IL-3-dependent hematopoietic cell line BAF-B03 transfectants (F7 and A15) were kindly gifted from Dr and maintained in RPMI supplementaed with 10% FCS plus 10% WEHI-3B conditioned medium (as a source of murine IL-3) or human IL-2 (400 IU/ml; kindly provided by Shionogi Chemical Pharmacy Cells were exposed at room temperature to IR using a 150 kV X-ray equipment (M-150WE Tokyo) that can provide a dose rate of approximately 110 cGy/min or to UV using a 254 nm UV crosslinker (CL-1000 cells were mixed with the same volume of 0.4% Trypan blue solution and immediately examined to determine whether they can exclude the dye under light microscopical observation z-IETD-FMK (caspase-8 and Granzyme B inhibitor) Phorbol-12-myristate-13-accetate (TPA) and PD98059 (a MEK inhibitor 2′-Amino-3′-methoxyflavone) were obtained from Calbiochem-Novabiochem Co The anti-caspase-3/CPP32 antibody was purchased from BD PharMingen (SanDiego The anti-caspase-8 and anti-Bid antibodies were from MBL (Nagoya The anti-phospho-p42/44 MAP kinase antibody was from NEB (Beverly The anti-ERK1 and anti-HSC70 antibodies were from Santa Cruz Biotechnology Inc pH 7.4) was treated with 400 μg/ml of RNase A and Proteinase K for 1 h at 37°C ethanol precipitated and subjected onto 1.0% agarose gels The gels were stained with 1 μg/ml of ethidium bromide Following the manufacturer's protocol (ApoAlert Annexin V Apoptosis Kit 1×106 cells were incubated with Annexin V at room temperature for 15 min in the dark The cells were then analyzed by flow cytometry (FACSCalibur USA) using a single laser emitting excitation light at 488 nm The data were converted to histogram (FL1) plots using CellQuest software cells were lyzed by adding 50 μl of RIPA buffer (100 mM NaCl Total cell lysates were collected and their protein concentration was evaluated using a Protein Assay (BioRad The lysates (80 μg/lane) were separated by 10–15% SDS–PAGE gels and then electrophoretically transferred to PVDF membranes (Millipore Membranes were soaked into Block Ace (Dainippon Pharmacia Co. Tokyo) overnight at 4°C and washed with the washing buffer (140 mM NaCl 25 mM Tris-HCl (pH 7.8) and 0.05% Tween 20) The membranes were incubated with primary antibodies overnight at 4°C and thereafter incubated with the corresponding peroxidase-linked secondary antibodies (Amersham or MBL) for 1 h at room temperature Signals were developed by a standard enhanced chemiluminescence (ECL) method following the manufacturer's protocol (Amersham) Following the manufacturer's protocol (FLICE/Caspase-8 and CPP32/Caspase-3 Colorimetric Protease Assay Kit 2×106 cells were lyzed in 250 μl of chilled Cell Lysis Buffer and incubated on ice for 10 min Total cell lysates were collected and their protein concentration was evaluated using a Protein Assay (BioRad) Total cell lysates (100–200 μg) were mixed with the same volume of 2× Reaction Buffer The mixtures were incubated with the 4 mM IETD-pNA or VETD-pNA Substrate (200 μM) at 37°C for 1 h The samples were then analyzed at 400 nm in a spectrophotometer (Shimadzu Following the manufacturer's protocol (DePsipherTM Kit 1×106 cells were suspended in 1 ml of prewarmed DePsipher solution (5 μg/ml) the cells were analyzed by flow cytometry (FACSCalibur Becton Dickinson) using a single laser emitting excitation light at 488 nm Cells were fixed by the addition of the same volume of 2.5% glutaraldehyde and post-fixed in 1% osmium tetroxide (TAAB washed again in propylene oxide twice and embedded in epoxy resin (TAAB) stained with uranium acetate and lead citrate and thereafter mitochondrial structure was observed by Electron microscope (JEM-1200EX 1989 Checkpoints: controls that ensure the order of cell cycle events Science 246: 629–634 1993 Thymocyte apoptosis induced by p53-dependent and independent pathways Nature 362: 849–852 1996 Gamma-radiation induces upregulation of Bax protein and apoptosis in radiosensitive cells in vivo Oncogene 12: 187–192 a BH3-only member of the Bcl-2 family and candidate mediator of p53-induced apoptosis Science 288: 1053–1058 a potential mediator of p53-dependent apoptosis and its regulation by Ser-46-phosphorylated p53 Cell 102: 849–862 1998 Mitochondria and apoptosis Science 281: 1309–1312 1997 Implication of mitochondria in apoptosis Mol 2000 Changes in intramitochondrial and cytosolic pH: early events that modulate caspase activation during apoptosis Nat 1997 Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade Cell 91: 479–489 mediates cytochrome c release from mitochondria in response to activation of cell surface death receptors Cell 94: 481–490 2000 Bid acts on the permeability transition pore complex to induce apoptosis Oncogene 19: 6342–6350 1999 Anticancer drugs induce caspase-8/FLICE activation and apoptosis in the absence of CD95 receptor/ligand interaction Blood 93: 3053–3063 1998 Ultraviolet-irradiation-induced apoptosis is mediated via ligand independent activation of tumor necrosis factor receptor 1 Oncogene 17: 2555–2563 2000 Differential role of caspase-8 and BID activation during radiation- and CD95-induced apoptosis Oncogene 19: 1181–1190 1998 FLIP prevents apoptosis induced by death receptors but not by perforin/granzyme B 1999 MEK1 activation rescues Jurkat T cells from Fas-induced apoptosis Cell Immunol 2000 MAPK/ERK signaling in activated T cells inhibits CD95/Fas-mediated apoptosis downstream of DISC assembly EMBO J 1998 A caspase-activated DNase that degrades DNA during apoptosis 1998 Cleavage of CAD inhibitor in CAD activation and DNA degradation during apoptosis Nature 391: 96–99 1998 Signal transduction through MAP kinase cascades Adv 1992 IL-2 and EGF receptors stimulate the hematopoietic cell cycle via different signaling pathways: demonstration of a novel role for c-myc Cell 70: 57–67 1995 Three distinct IL-2 signaling pathways mediated by bcl-2 and lck cooperate in hematopoietic cell proliferation Cell 81: 223–231 1996 Interleukin-2 (IL-2) upregulates BAG-1 gene expression through serine-rich region within IL-2 receptor beta c chain Blood 88: 4118–4123 2000 Requirement of JNK for stress-induced activation of the cytochrome c-mediated death pathway Science 288: 870–874 1995 Activation of the c-Abl tyrosine kinase in the stress response to DNA-damaging agents Nature 376: 785–788 1997 Absence of excitotoxicity-induced apoptosis in the hippocampus of mice lacking the Jnk3 gene Nature 389: 865–870 1996 Persistent activation of c-Jun N-terminal kinase 1 (JNK1) in gamma radiation-induced apoptosis J 1998 The c-Jun N-terminal kinase cascade plays a role in stress-induced apoptosis in Jurkat cells by up-regulating Fas ligand expression J 1996 The role of c-Jun N-terminal kinase (JNK) in apoptosis induced by ultraviolet C and gamma radiation Duration of JNK activation may determine cell death and proliferation J 1998 Apoptosis induction by caspase-8 is amplified through the mitochondrial release of cytochrome c J 1998 Cyclophilin-D binds strongly to complexes of the voltage-dependent anion channel and the adenine nucleotide translocase to form the permeability transition pore Eur 1999 The mitochondrial permeability transition pore and its role in cell death Biochem 1999 Bcl-2 family proteins regulate the release of apoptogenic cytochrome c by the mitochondrial channel VDAC Nature 399: 483–487 2000 Protein kinase C theta and epsilon promote T-cell survival by a rsk-dependent phosphorylation and inactivation of BAD J 2000 MEK/ERK signaling pathway regulates the expression of Bcl-2 and Mcl-1 and promotes survival of human pancreatic cancer cells J 1994 Bcl-2 and the regulation of programmed cell death J 1989 Analysis of ras gene mutations and methylation state in human leukemias Oncogene 4: 1029–1036 1991 Aberrant DNA topoisomerase II activity radioresistance and inherited susceptibility to cancer Br c-raf and p53 expression in squamous cell carcinoma of the head and neck: implication in drug and radioresistance Eur 1994 C-raf-1 proto-oncogene expression relates to radiosensitivity rather than radioresistance Eur 2000 RAS-Mediated radiation resistance is not linked to MAP kinase activation in two bladder carcinoma cell lines Radiat 2000 Histone deacetylase inhibitors suppress IL-2-mediated gene expression prior to induction of apoptosis Blood 96: 1490–1495 Download references Tadatsugu Taniguchi (Tokyo University) for the BAF-B03 transfectants (F7 and A15) Robert Holmes for help with preparation of this manuscript Supported by Grants-in-Aid for Cancer Research and for Scientific Research from the Ministry of Education M Hareyama) and the Novartis Foundation for the Promotion of Science (M Adachi) Sapporo Medical University School of Medicine Japan Science and Technology Corporation (JST) Download citation DOI: https://doi.org/10.1038/sj.cdd.4401050 By Ryowa Kashiwabara / Yomiuri Shimbun Staff Writer newly elected assembly member Nour Soltan posed his first question to the town assembly of Shonai “What does the town think about accepting foreign workers?” His commitment to the issue could be heard in his voice successfully ran for a seat in the assembly last summer he is now determined to live life as a Japanese and sports a topknot in homage to the sumo wrestling he loves Soltan moved to Egypt with his family when he was 12 because of constant instability in his Syrian homeland he swam competitively and coached Paralympic swimmers for the 1996 Atlanta and 2000 Sydney Games he applied for the Japan International Cooperation Agency’s invitation program Unable to forget Japan’s rich nature and food he decided to live in Japan and returned to the country in 2003 After studying swimming training theory at University of Tsukuba he called up about 10 swimming schools in the Kanto region asking for a job but kept being rejected with such comments as “Try elsewhere.” Even when he did get through to managers faced with the deep gap between Japanese and foreigners He was most saddened by the fact that he couldn’t utilize his skill as a swimming instructor and started working at a car parts factory he opened an Arab restaurant and ran it for four years He has been involved in the used car business since 2011 I need to participate in politics,” he thought not to be elected because he had found a traditional kominka farmhouse that seemed comfortable to live in In a town with a population of about 20,000 only 15 people ran for the town assembly of 16 seats When a by-election was announced last summer to fill the remaining seat “Become a politician and help people in need.” He passed away in the summer of 2020 at the age of 76 after contracting the novel coronavirus Soltan could not visit his ailing father in Egypt because of the pandemic but his father told him to aim to become a politician when Soltan called him a few days before his death Soltan decided to run for the seat three days before the five-day official campaign period kicked off The seat was contested between him and another newcomer He went around the town with posters on his car he was nervous because few people came out when he called out on the streets “Let’s change the town for the good.” From the third day or so more people started waving to him and cheering him on Perhaps there was an expectation that a foreign-born person could revolutionize the town He won the election by securing 5,269 votes banzai!” While throwing up hands in a Japanese-style celebration he recalled many hardships he had encountered since coming to Japan Soltan’s election victory also made news in the Middle East and he was contacted by a Syrian man living in the Kansai region through an introduction by a person who had seen the news report The man told Soltan he was refused a medical consultation at a hospital because he was a foreigner Soltan immediately called the hospital to protest and made the hospital promise to treat the man The incident reminded him of the depths of prejudice as someone with a Syrian and Egyptian background to work to build a bridge between Japan and the Arab world and more generally to narrow the gap between Japanese and foreigners The number of foreigners living in Japan increased from 1.69 million in 2000 to 2.09 million in 2010 and then 2.89 million in 2020 more foreign workers are being accepted in fields such as elderly care The number of foreign workers reached an all-time high of 1.72 million at the end of October 2020 forecasts that the number of foreign workers will reach 2.09 million in 2030 Public Relations Office, Government of Japan Home > Highlighting JAPAN > Highlighting Japan NOVEMBER 2011 > Walk into the Movies No article or any part there of may be reproduced without the express permission of the Cabinet Office. Copyright inquiries should be made through this form Today's print edition Home Delivery Kiyokawa Elementary School stands abandoned its walls and roof crumbling because there are no longer enough pupils to fill it and the town can't afford to demolish the building is one of thousands of derelict buildings in Japan known as "haikyo," legacies of the boom years in the 1960s and '70s As the populations of towns grow older or move to cities indebted local governments have left the structures to rot prompting Prime Minister Shinzo Abe's administration to come up with a novel solution: demolition bonds.googletag.cmd.push(function() { googletag.display('div-gpt-ad-1499653692894-0'); }); the turnaround from a rising population to depopulation," said Akiyoshi Takumori chief economist at Sumitomo Mitsui Asset Management Co "The shedding of old structures is necessary for the rebirth of regions and will test their creativity." In a time of both misinformation and too much information quality journalism is more crucial than ever.By subscribing Your subscription plan doesn't allow commenting. To learn more see our FAQ Sponsored contents planned and edited by JT Media Enterprise Division No account yet? Create one now By signing up, you agree to GTR Privacy Policy and Terms of Use A group of Japanese banks have funded a biomass project financing in the north-west of the country ¥11.7bn (around US$105mn) was extended by banks led by Shinsei Bank while Ashikaga Bank and Shonai Bank joined as lenders The borrower is Japan Renewable Energy Corporation (JRE) a company backed by investment bank Goldman Sachs Goldman Sachs founded JRE in 2012 and has built or helped build 27 large-scale solar farms since then the Japanese government has been promoting renewable energy through generous feed-in tariffs for the past five years have been cut in half over the past 12 months with biomass seen as a lucrative alternative Construction on the plant in Kamisu started in June and is due to complete in May 2019 The finished wood biomass power facility will have a capacity of 24MW JRE is intending to build more than 10 new biomass facilities by the end of the decades The government is hoping to triple Japan’s biomass power generation capacity by 2030 It views biomass as a less volatile sector than wind or solar energy since it does not depend on favourable weather conditions trade and industry in Japan has set targets of increasing renewable energy’s share of the power generation mix to 24% by 2030 Japan is currently the world’s fifth biggest polluter After the Fukushima nuclear accident in 2011 the country increased its imports of fossil fuels The debate over energy rages on in Japan: nuclear has come back into favour with Shinzo Abe’s government but there is also a clear directive towards renewables Become a part of the most comprehensive contact listing of service providers in the global trade This Privacy Policy outlines the information we may collect about you in relation to your use of our websites related publications and services (“personal data”) and how we may use that personal data It also outlines the methods by which we and our service providers may (subject to necessary consents) monitor your online behaviour to deliver customised advertisements marketing materials and other tailored services This Privacy Policy also tells you how you can verify the accuracy of your personal data and how you can request that we delete or update it This Privacy Policy applies to all websites operated by Exporta Publishing & Events Ltd (as indicated on the relevant website) This privacy statement does not cover the activities of third parties and you should consult those third-party sites’ privacy policies for information on how your data is used by them Any questions regarding this Policy and our privacy practices should be sent by e-mail to privacy@gtreview.com or by writing to Data Protection Officer at you can telephone our London headquarters at +44 (0) 20 8673 9666 Established in 2002 and with offices in London and Singapore Exporta Publishing & Events Ltd is the world’s leading trade and trade finance media company events and services for companies and individuals involved in global trade Exporta Publishing & Events Ltd is a company registered in the United Kingdom with company number 4407327 | VAT Registration: 799 1585 59 This Data Protection Policy explains when and why we collect personal information about people who visit our website the conditions under which we may disclose it to others and how we keep it secure We also collect certain personal data from other group companies to whom you have given information through their websites (including Exporta Publishing & Events Ltd and subsidiaries in accordance with the purposes listed below) Should we discover that any such personal data has been delivered to any of the Sites we will remove that information as soon as possible This Data Protection Policy ensures Exporta Publishing & Events Ltd: We may change this Policy from time to time so please check this page occasionally to ensure that you’re happy with any changes you’re agreeing to be bound by this Policy The Data Protection Act 1998 described how organisations – including Exporta Publishing & Events Ltd – must collect These rules apply regardless of whether data is stored electronically personal information collected must be stored safely The Data Protection Act is underpinned by eight important principles We obtain information about you when you use our website when you contact us about products and services subscribe or register for a trial to our GTR magazine/website Exporta Publishing & Events Ltd collects personal data such as your name in order to register you for access to certain content we may also store information including IP address and page analytics including information regarding what pages are accessed This information is used to administer and deliver to you the products and/or services you have requested to operate our Sites efficiently and improve our service to you and to retain records of our business transactions and communications By using the Sites and submitting personal information through the registration process you are agreeing that we may collect process and use your information (including personal information) for the purpose of providing you with the Site services and developing our business which shall include (without limitation) the purposes described in the below paragraphs we enable you to post information or materials on our Site we may access and monitor any information which you upload or input including in any password-protected sections we also monitor and/or record the different Sites you visit and actions taken on those Sites This enables your access to content and services that viewing an article – will be recorded (subject to any necessary consents) We may use technology or a service provider to do this for us This information may be used for one or more of the following purposes: Please see paragraph 5 below for more information on cookies and similar technologies and a link to a page where you can turn them on or off We may analyse your personal information to create a profile of your interests and preferences so that we can contact you with information relevant to you All our Sites use cookies and similar technical tools to collect information about your access to the Site and the services we provide your computer will be issued with a cookie Cookies are text files that identify your computer to servers Cookies in themselves do not identify the individual user Many sites do this whenever a user visits their site in order to track traffic flows recording those areas of the site that have been visited by the computer in question Users have the opportunity to set their computers to accept all cookies Selecting not to receive means that certain personalised services Exporta Publishing & Events Ltd offers cannot then be provided to that user Most web browsers automatically accept cookies but you can change your browser to prevent that or to notify you each time a cookie is set You can also learn more about cookies in general by visiting www.allaboutcookies.org which includes additional useful information on cookies and how to block cookies using different types of browser deleting or turning off cookies used on the Site you may not be able to take full advantage of the Site E-mail tracking is a method for monitoring the e-mail delivery to those subscribers who have opted-in to receive marketing e-mails from GTR So that we can better understand our users’ needs subscription behaviour and engagement to our e-mails – for example to see which links are the most popular in newsletters They enable us to understand the consumers journey through metrics including open rate Any other purposes for which Exporta Publishing & Events Ltd wishes to use your personal data will be notified to you and your personal data will not be used for any such purpose without obtaining your prior consent also known as “pixel tags” – these are small image files that are placed within the body of our e-mail messages When that image is downloaded from our web servers By using some form of digitally time-stamped record to reveal the exact time and date that an e-mail was received or opened You can give your consent to opt-out of all or any particular uses of your data as indicated above by: Information collected at one Site may be shared between Exporta Publishing & Events Ltd and other group companies for the purposes listed above sell or assign any of the information described in this policy to third parties as a result of a sale transfer of assets or reorganisation of our business Some of our Sites may have a message board blogs or other facilities for user generated content available and users can participate in these facilities Any information that is disclosed in these areas becomes public information and you should always be careful when deciding to disclose your personal information Services on the Internet are accessible globally so collection and transmission of personal data is not always limited to one country Exporta Publishing & Events Ltd may transfer your personal data for the above-listed purposes to other third parties which may be located outside the European Economic Area and/or with a different level of personal data protection we take all necessary steps to ensure that your data is treated reasonably securely and in accordance with this Privacy Statement We are committed to keeping the data you provide us secure and will take reasonable precautions to protect your personal data from loss the transmission of information via the internet is not completely secure Although we will do our best to protect your personal data we cannot guarantee the security of your data transmitted to our Site; any transmission is at your own risk we will use strict procedures and security features described above to try to prevent unauthorised access We have implemented information security policies rules and technical measures to protect the personal data that we have under our control from: those who process your personal data on our behalf and are associated with the processing of your personal data are obliged to keep the information confidential and not use it for any other purpose than to carry out the services they are performing for us The Data Controller is Exporta Publishing & Events Ltd Exporta Publishing & Events Ltd is subject to the UK Data Protection Act 1998 and is registered in the UK with the Information Commissioner`s Office If you wish to know whether we are keeping personal data about you or if you have an enquiry about our privacy policy or your personal data held by us you can contact the Data Protection Officer via: we will provide you with a readable copy of the personal data which we keep about you We may require proof of your identity and may charge a small fee (not exceeding the statutory maximum fee that can be charged) to cover administration and postage Exporta Publishing & Events Ltd allows you to challenge the data that we hold about you and where appropriate in accordance with applicable laws the Data Protection Act allows personal data to be disclosed to law enforcement agencies without the consent of the data subject the Data Controller will ensure the request is legitimate seeking assistance from the board and from the company’s legal advisors where necessary We will occasionally update this Privacy Statement to reflect new legislation or industry practice group company changes and customer feedback We encourage you to review this Privacy Statement periodically to be informed of how we are protecting your personal data Exporta Publishing & Events Ltd aims to ensure that individuals are aware that their data is being processed setting out how data relating to individuals is used by the company This is available on request and available on the company’s website This Privacy Statement was last updated in April 2018 a 49-year-old Japanese Egyptian car dealer was elected in a by-election in Shonai Town According to the Prefectural Election Commission this is the first time a foreigner has been elected to a prefectural assembly Sultan quoted by local media as saying in Japanese “I want to boost the local economy by utilizing foreign human resources We will listen to the opinions of the residents and work together to build the city.” Sultan reportedly came to Japan in 2001 and worked as a swimming instructor in Tsuruoka City where he acquired Japanese citizenship in 2013 He moved to Shonai-cho in 2016 and is currently working there he told local media he felt that there were many shortcomings in the children’s medical system and sports environment He toured the town during his campaign to appeal for support “I was happy to hear that the farmers told me to do my best We want to make it a town where young people can work locally and elderly people can also easily work.” Former town council chairman Toru Tomikashi (58) who was elected mayor for the first time in the same election “We will create an opportunity for enthusiastic townspeople to raise their hands and run for office in June next year.” The election of the first Muslim with Arab origin to a local town council has cought to the attention of the Japanese media and political circles City councils in Japan are involved in domestic affairs in administration and financial affairs They are not involved in national politics including defense and diplomacy Please enable JS and disable any ad blocker Uncover the unique charm of this historical destination where East meets West in architectural harmony The city of Tsuruoka is known primarily as the gateway to the Dewa Sanzan or the Three Mountains of Dewa: Mount Haguro And while those sacred mountains and their pilgrimage trails and rituals may be the area’s major draw History and architecture buffs in particular will find a wealth of buildings and exhibits to explore from the Chido Museum and its National Important Treasures to the Tsuruoka Catholic Church home of the only Black Madonna in the whole of Japan Here are some of the best things to do in Tsuruoka city After it was dismantled — a fate shared by many of Japan’s castles as the country distanced itself from its feudal past — Shonai Shrine was built where the inner citadel once stood maintains a connection to the area’s former rulers with four Sakai clan lords enshrined as deities including armor and dolls once belonging to the Sakai family are also on display in the shrine’s treasure hall Before visiting, be sure to check out Shonai Shrine’s official Instagram page, where the shrine’s enthusiastic caretakers share information on events and traditions, such as mochi-tsuki (pounding rice into mochi) and the annual fire festival. Other events are decidedly more modern and involve projection mapping and DJs A short walk from Shonai Shrine will bring you to the Chido Museum a repository of information on the history of the Shonai region of which Tsuruoka is a part The museum has been maintained by the family of the former Sakai feudal lords and it is still loved today by locals who refer to it fondly as Tono-sama made up of a Japanese-style garden and several historical buildings of both Japanese and Western styles houses archeological items unearthed in the area and various articles once used by the residents and feudal lords of the Shonai area Visitors to the museum, named after the Chidokan the old Shonai domain school operated by the Sakai clan brilliant displays of structural craftsmanship and the cultural riches contained within await Architectural aficionados will also want to check out the neighboring Shogin Tact Tsuruoka cultural hall designed by Kazuyo Sejima co-founder of renowned Tokyo-based architectural firm SANAA Not only does its sweeping curvature make for an impressive silhouette on the landscape the hall also offers an interesting view of the Chido Museum through its smooth polished glass and metallic structure making for a fantastic juxtaposition of new and old Of the buildings that make up the Chido Museum the Former Tsuruoka Police Station and the Former Nishitagawa District Office both designated as National Important Treasures the Former Tsuruoka Police Station is an example of giyofu architecture a Meiji-period style of construction notable for its semblance to Western architecture and seems to come straight out of a period movie which can only be admired from the outside conveys information on police trials of the Meiji era Across from the police station is the Former Nishitagawa District Office it boasts an eye-catching clock tower and a balcony the building hosts exhibitions on the Shonai region through the ages Don’t miss the museum’s traditional Japanese buildings including the thatched-roofed Former Shibuya Family Home a dry waterfall and a tranquil pond enclosed by smooth rocks Make sure to peer into the Japanese Folklore Materials House for interesting exhibits showcasing the lifestyle that was once common in the area On the other side of Shonai Shrine stands the Tsuruoka Catholic Church, consecrated in 1903. That same year, a Black Madonna was gifted to the church from France, making Tsuruoka Catholic Church one of the relatively few custodians worldwide — and the only custodian in Japan — of a Black Madonna is also notable for its stunning windows that appear to be stained glass but aren’t drawings encased between two panels of glass Tsuruoka Catholic Church — one of only two churches in Japan with a samurai gate and the seventh-oldest surviving wooden church in the country — is designated as a National Important Cultural Property Designed by the French priest Jacques Papinot it is considered an excellent example of Romanesque architecture and an enchanting instance of the blending of Japanese and Western styles visitors are requested to appreciate the space respectfully This is but the beginning of Tsuruoka’s incredible architecture, as in addition to its traditional and Japanese-Western fusion structures, the city has interesting examples of newer architecture, such as the prize-winning Tsuruoka Art Forum so much so that it was named Japan’s first UNESCO Creative City of Gastronomy Be sure to take the time to savor local cuisine as you survey the cityscape Ease your exploration with a stay at the Tokyo Dai-Ichi Hotel Tsuruoka Not only is the hotel a mere three-minute walk from Tsuruoka Station it’s also directly connected to the bus terminal intercity buses and buses bound for the regional Shonai Airport and Mount Haguro Please view the main text area of the page by skipping the main menu. The page may not be displayed properly if the JavaScript is deactivated on your browser Japanese version The Yamagata Prefectural Government will resume direct bus services between Sendai Airport and Yamagata Prefecture for the upcoming cherry blossom season allowing greater ease of access to famed sakura-viewing spots Services will be operated by Yamako Bus Co of which the latter will also resume direct bus services between Sendai Airport and Shonai (Sakata city) in the north-eastern Japanese prefecture of Yamagata The direct bus services will allow travellers entering Japan through Sendai Airport to enjoy trips to Yamagata Prefecture which is home to many famous cherry blossom-viewing spots during the cherry blossom season from early to late April More information can be found on the Yamagata Prefecture website.‌ Seafront stays and heritage charm at Penang Marriott Hotel Is Your Business Listed On TTGmice Planner Online is the first Arab Muslim to have been elected into a local prefectural assembly in Japan Sultan became a naturalized Japanese citizen in 2013 and was voted into the Shonai Town Assembly in Yamagata Prefecture as a councilor in 2021 I worked for the Ministry of Youth and Sport and as a swim coach I met numerous JICA volunteers who encouraged me to apply for a cultural education exchange program to teach swimming here in Yamagata for 10 months.googletag.cmd.push(function() { googletag.display('div-gpt-ad-1499653692894-0'); }); I eventually was able to come back to Japan to continue my studies in Tsukuba I still longed for Yamagata and so I decided to move back for work is home to one of the world’s biggest collections of jellyfish Aneesh Nirmal (AUS) and Mimi Ngo (AUS) together with their coaches the last few days have been ones of new opportunities Competing at the International Badminton U16 SHONAI Invitational 2024 in Japan these four young shuttlers have had the most unbelievable opportunities to be emersed into an International Badminton Tournament with their peers from around the world Coach Brent Miller from Australia only has good things to say about their time in Japan outlining the experience his players have had such as “training with and playing practice games with juniors from Scotland The players had to contend with one thing they don’t get in New Zealand it was a new experience that Yanxi described as “an interesting learning” the level of opposition and the size of the stadium was a factor that had to be overcome Mimi Ngo ‘found it hard to adjust to the different atmosphere and courts…but found it fun meeting other international players.” Aneesh Nirmal sums up his experience well saying “it has been a good experience playing against the best of my age from around the world Traveling and playing in a new country that has a different culture to ones own can be daunting coach of the New Zealand team has been impressed with his young players who have worked hard to adapt to something new He said “the players are absolutely loving the people and culture here and have been amazed at the professionalism of the tournament and venue”’ Even though being on the podium was not to be for these Oceania juniors in 2024 the experience of what they have been a part of what they accomplished and the connections they have made while in Japan is priceless Full Draws & Results For all other contacts details Click Here Sign In Register These corporate claims were filed with the BC Supreme Court registry in Vancouver Information is derived from notices of civil claim Civil claims have not been tested or proven in court.  and Pinnacle Living (Capstan Village) Lands Inc $53,156 in a lien against a Richmond property for unpaid invoices for supply of materials $45,234 for deficiencies in a home renovation project and overcharges by the defendants and Ranbir Singh Nahal and John Doe #1-John Doe #3 and ABC Company #1-ABC Company #3 as represented by National Home Warranty Group Inc Damages for breach of contract for construction defects in the construction of a home and ABC Company and DEF Company and GHI Company Damages for a sprinkler system installed by the defendants that burst in a building owned by the plaintiff and ABC Company #1 and ABC Company #2 and ABC Company #3 and John Doe Damages for defects in plumbing installed by the defendants that caused or contributed to a flood in the plaintiffs’ home Indemnity from a separate legal claim involving Mahon on a property formerly owned in part by the plaintiff Valentin Bocancea and Simon Anbrosishvili and Standard Construction Ltd and Tiffany Logan and Janet Visnoski and Susette Rosanne Matusiak and Violet Wiebe and Caroline Shonai and Julie Margaret Bratkowski and Joseph Martin Fontaine Damages for breach of duties of care after a fire broke out on a balcony and spread to other units of a building after flammable materials were improperly handled stored or disposed of on the balcony by the defendants in the course of their work Japanese version an Air Zimbabwe Airbus 320 with 125 passengers touched down at Julius Nyerere International Airport (JNIA) in Dar es Salaam in a maiden flight to re-launch Harare-Dar-Harare route "It was a smooth touchdown," said Captain Otis Shinai (41) who congratulates the ground staff for making his coming back journey after several years You have selected an article from the AllAfrica archive, which requires a subscription. You can subscribe by visiting our subscription page. Or for more information about becoming a subscriber, you can read our subscription and contribution overview You can also freely access - without a subscription - hundreds of today's top Africa stories and thousands of recent news articles from our home page » AllAfrica publishes around 500 reports a day from more than 110 news organizations and over 500 other institutions and individuals representing a diversity of positions on every topic We publish news and views ranging from vigorous opponents of governments to government publications and spokespersons Publishers named above each report are responsible for their own content which AllAfrica does not have the legal right to edit or correct Articles and commentaries that identify allAfrica.com as the publisher are produced or commissioned by AllAfrica. To address comments or complaints, please Contact us Get the latest in African news delivered straight to your inbox By submitting above, you agree to our privacy policy please follow the instructions in the email we just sent you There was a problem processing your submission National youth director for  ruling Democratic Progressive Party (DPP) has said there many of them supporting  former First Lady Callista Mutharika within the rank and file of DPP in backing calls for Vice President Saulos Chilima to be torchbearer bearer  under the DPP banner at the expense of incumbent Peter Mutharika He said  Chilima-for-President crusade  is gaining support and is a movement which he said is unstoppable he is offering “full support” to Chilima to run for presidency as DPP candidate “I am urging him to represent the party in 2019 I am also in agreement with what the founding member has said  that there are so many problems in the party,” Ngalande said Hecsaid DPP has not met at National Governing Council since 2013 before getting into  power saying Callista was on point when she said President Mutharika  has been surrounded by “beasts of prey” who are misleading him for their selfish gains “The former First Lady was right when she spoke of beasts and thieves surrounding the President these things are there and we know it,” he said “If the party was meeting at executive level we could have been airing these things but there are no avenues so we will resort to the media and engaging the people to express our views,” he said DPP’s secretary general Greselder Jeffrey declined to comment Guys anthuwa anali limozi nthawi yonseyi .Atiberabera,abale anthu kuwakhapa.Kutigawanisa Amalawi.Ndiye pano tsiku lachiweruzo layandikira aziti ine ndi mngelo.Fumwe munali kwayani mose zinthu zikatowongeka.Pano tizingovumera kuti ndidye nao .Koma sikulo mkachonga pa Chakwera kuti chongi nanga mokatoziwa A Presdent ndi a vice anu gwirani ncthito limodzi mpaka 2024 ngati mmene munayambira .Nkhani ndiyakuti tinazolowera .Ma president M’malawi amadana.Akufuna kuti mudane.They are not doing it in good faith.Ozindikira anaonapo kale Achititseni manyazi.Nonse asayankhaso zimenezi mutaya nazo nthawi Hahahahaha someone once said mavuto akuti ali mu MCP ndi chabe and its veryyyyy interesting tizimva winanso akuti wakalambitsa mdala daily hahahahahaha THEY DON’T CARE (ALINE POLOBOLEMU) Ngati wafika poyera Ngalande that means akudziwapo kanthu Bon Kalindonso wanenetsa kuti pitala ndi Cindere cakufikapo kkkkkkkkkkkkkkk Madam Jeffrey wa Jeffrey,whats your comment All characters who made Bingu and DPP look bad in the eyes of Malawians APM was seeing them and has since chosen to sideline them for good of the nation This is also the main reason he reached out to outsider in terms of runningmate for the party You cannot separate APM/SKC relationship because you dont know the glue between them Your devide-and-rule approach wont work either But this is a national youth director speaking Your denial of the obviuos zikudwalitsani chabe za zii MKADZAONA WAPAKHOMO GALU AKUKULUMANI DZADZIWENI MMALODZA SIZILIBWINODI…….MULUNGU SIMUNTHU AKULUAKULU!!!!!…..CHACHIKULU CHICHITIKA KUTSOGOLOKU…… Ngalande was frustrated long time ago because the DPP executive supported Wild Ndipo over him for the position of Mayor of Blantyre City Such thugs should not be entertained anywhere near power You probably are right Suzgo and its so painful to accept But then I still go back to when Chilima started as a politician It wasn’t his own making or decision it was rather Peter who called and “forced” him to join politics Chilima is not the type of person who would raise his hand but rather would wait for someone to nominate him Unfortunately politics isn’t that straight forward This is why Honourable Goodall Gondwe has categorically said “presidency isn’t for babies” and thats certainly true You need someone who’s a firebrand and an orator who can rock the… Read more » Callista Mutharika made a statement in a WhatsApp group chat of former Members.. Acting police Inspector General Duncan Mwapasa on Wednesday faced parliament’s Women Caucus which wanted to find out how far the police have gone with their inquiry on the infamous Nsundwe rapes Mwapasa has conceded the police have not yet interviewed the victims of the alleged rapes at Nsundwe “We are finding it extremely hard to interview the victims because they are refusing to be interviewed by the police,” said Mwapasa The relationship between the police and the people in the three areas has gone bad since the violent arrests of suspects in the murder of a police officer at Nsundwe and those involved in violence Mwapasa told the women parliamentarians sitting on the Caucus that the police has zero tolerance to sexual abuse all the perpetrators will be brought to book,” he said He backed the decision to let the police investigate themselves on the rape allegations saying this is not the first time that such an investigation has been done within the police file and rank The NGO Gender Coordination Network (NGO-GCN) documented accounts from women and girls who said they had been sexually assaulted by police officers “While NGO-GCN advocate justice on the case [the killing of the police officer] the network is disturbed with reports that some of the police officers dispatched in the area … raped women tortured people and looted private property,” read its report which described how police officers threw teargas and broke into houses demanded that the president and other authorities ensure the allegations were thoroughly investigated and perpetrators punished “ No one is above the law and the rule of law must be respected,” said the report the alleged sexual violence and called for “light to be shed on what happened.” The British high commissioner to Malawi, Holly Tett, also called for a thorough investigation Tett said: “The UK believes that the best way to restore the police and public trust is through a thorough investigation.” KOMA MUKUFUNA AKHALE ANTHU AKUKASUNGU BASI TAONANI MMENE ALI ANTHU AKUKASUNGU KU TIMES AKASAKULA NDI ANZAWO CHIDZUKULU CHA AMWASE NO MUMANGONENA ANZANU KUTI ANGOLEMBANA ABALE OKHAKHA INUYO BWA TAONANI KOMITI YA MCP KU PARLIAMENT BWA OKHAOKHA A CENTRAL REGION KOMA ZBS NDI TIMES SANGANENE KANTHU COZ AMASAPOTA CHIPANICHI ZBS KODI NKHANI NDI MANEGATIVE OKHAOKHA BASI NGATI MBONI ZANENAKO ZABWINO HEADLINE KOMA AKAKAMBA MBWERERA IMENOYO SI NKHANI AMATERO?PAJA KULI A MARIA CHIDZANJA YOU ARE AN AN MCP CADET REMEMBER IN THE 1990S AT MBC YOU WERE AGAINST MULTIPARTY AND YOU WENT AWAY WHE… Read more » Ndilipano’s level of thinking is too shallow to be honest Sometimes it’s better to keep quiet than spew rubbish His contribution clearly shows he’s cadet probably recommended into the police service by Mwapasa or Jose Why cant the parliament form a separate group to investgate Those women were abused by police and you let police to investige what Dont you think those women are troumatised and are in no way to see a police officer as a friend anymore How foolish are you parliamentarians cant you think these kind of simple things on your own Where is that stupid idiot white who was crying for ansah and cant cry for poor women who suffered these horrific acts by law enforcers Is this not enough to call this idiot mwapasa to resign Mwapasa is hard core climinals him self and he reached that rank by killing some of good citizens at the land so Malawian you can see your selves the way this climinal responding for this case HOW CAN HE SAY INVESTIGATIONS ARE OVER AT SAME HIS CADETS ARE UNABLE TO INTERVIEW TH E VICTIMS Hahahaha…a waste of tax payers money again what can you expect from a big cadet like Mwampasa Is busy lying in their presence ‘when investigations are done’. but is also saying ‘victims are refusing to be interviewed by police’ Investigations may only identify those that did from the contingent But one thing for sure is to take the issue to court The evidence and medical reports of the victims will help to determine the issue Conclusion of this case like any other case will be evidence based Human rights lawyers help these abused women KIKIKI…HOW CAN A CADET INVESTIGATE HIS BOYS THE CADETS WHOM HE SENT THEM TO DO THE OPERATION AT MSUNDWE How long can it take investigated a straight forward thing.When you deploy police officers on duty.I thought you record them on the stations that the officer and vehicle have gone this side.Stop fooling the country if those were DPP cadets acting like police then just come out and say the truth to restore your public imagine Chirima ndi nyau.They did it themselves.Ukaziputa limba.Iwo Ali kumpanda ndi Ana ao Matenant athu munya chaka chino mminda ya fodya muzigonera maungu ndi mbewa.Inu muona ngati chifukwa choti a blue eyed police ali mbali yanu ndiye kuti ziri bwino tiyana tanu tatikazi mfodyamu tikweredwa ndi nyau mukuzinenazo It shows the high level of stupidity in the blue camp It tippex Peter mutharika raped the women and girls in fact after he took so much of gondolosi he couldn’t resist his manhood rather than raping innocent women and girls Deputy Permanent Representative/Deputy Ambassador of Malawi to the United Nations Fire at Bailey Road shopping mall doused Some banks hit by capital squeeze Air purifiers for Dhaka: hope or hype? Chinmoy shown arrested in Saiful murder case Chanchal Chowdhury and Farhana Mili in Monpura |মতামতভুয়া খবরের পেছনে রাজনীতি-অর্থনীতিইউটিউবে খবর ও ‘টক-শো’র নামে কিংবা ইচ্ছামাফিক ভিডিও ও কনটেন্ট বানিয়ে অপতথ্য ছড়ানো হচ্ছে। ৫ আগস্ট রাজনৈতিক পটপরিবর্তনের পর এটি নতুন মাত্রা পেয়েছে। দেশের বড় একটি অংশের মানুষ এ ধরনের ‘খবরে’ বিভ্রান্ত.. Lawyers for the Malawi Congress Party (MCP) have finished cross examining the  Malawi Electoral Commission (MEC) chief elections officer  Sam Alfandika regarding the conduct of the May 21 Tripartite Elections whose results the MCP and UTM Party are disputing to have been dogged with irregularities second petitioner’s lead counsel Modercai Msisha focused on supply of correction fluid the auditors (BDO Jordan) report and the letter by the electoral body to the auditors authorizing them to accept tally sheets which had signature of the presiding officer only The hearing in the morning kicked off with a duel between the lawyers regarding request by the MCP legal team to play a clip from an interview which MEC Chairperson Jane Ansah had with Joab Chakhaza of Zodiak Broadcasting Station in his famed Cruise 5 programme Tamando Chokhotho argued that allowing the clip it court amounted to bringing of new evidence using the backdoor but Senior Councel (SC0  Msisha insisted that the clip was not new evidence but was material to the issue Alfandika was being cross examined on After consulting the othe four judges in the panel Judge Dingiswayo Madise allowed the clip to be played in court In the clip Justice Ansah was telling Chakhaza that there was no investigation done as to who supplied the Tip-Ex to the presiding officers And when it was put to Alfandika if the MEC chairperson was lying since he told the court that an investigation by MEC showed that the Tip-Ex came from the Teacher Development Centres “The MEC chairperson answered that question in reference to the time the results were being received By that time there was no investigation done This investigation was done later,” he explained though lawyer Msisha still wanted to push his way to exert pressure on Alfandika to admit contradiction had alluded to the fact that since MEC never supplied Tip-Ex  but was used during tallying and the fact that most Constituency Tally Centres were based in  Teachers Development Centre (TDCs) then the TDCs were the source of the Tip-Ex Counsel Msisha wanted to prove that some tally centres were not in TDCs but still had results that had Tip-Ex and therefore laying a base of his argument that Tip-Ex might have been supplied by the electoral body or someone with an aforethought Senior Counsel Msisha also tried to corner Alfandika regarding the source of Tip-Ex by producing several results forms and asked him to identify which Constituency Tally Centre they were from and also confirm if the tally centre was a TDC or not Alfandika answered that he could not know by heart whether a centre was a TDC or other public places that were used by MEC to serve such purposes The MEC CEO explained that majority of the TDCs but some were located in public places that were convenient for that purpose “If we say the Tip-Ex originated from the TDCs we also have to look at the fact that the Constituency Returning Officers were Primary Education Advisors who are from TDCs and we have also have to look at the distance of the places from the TDCs,” he explained  the MEC chief elections officer  tussled with counsel Msisha regarding the report by auditors Msisha queried whether the report was discussed by the Commission if there were minutes and why it was not cited that the pages were missing Alfandika said they had noted everything the lawyer had presented that the Commission had deliberated on the report and that the minutes were not presented in court but were available Then Msisha went on to cross examine Alfandika on the letter by MEC to the auditors authorizing them to accept results that were altered manually and with only signature of the presiding officers and none of the monitors Msisha wanted the letter and Alfandika explained that the letter was available but not brought to court Alfandika explained that the auditors were not supposed to reject results because it was not within their scope of terms of reference By law it was only the Malawi Electoral that was supposed to accept or reject election results The court is expected to reconvene later in the afternoon of Monday 2019 for re-examination of Sam Alfandika by MEC lawyers So why did you hire Auditors if you knew they have nothing to do You have removed some pages on BDO report a report that was not your report but Malawians suicidal iyooooooo!!! The contrary results achokereso kuti bwana Alfandika We were told that MCP had its own parallel Tally Centre Where are the results from its Centre that can contradict MEC results?? i would be extremely happy if MCP had produced results from every polling centre from Chitipa to Nsanje and compare them with MEC MEC yimeneyi zikadayivuta kale kale zinthu Kodi mukungoti tippex tippex mesa achakwera NDA chilima adakana kuti tippex sadasokoneze ma results akwafusa kaphare mukuwona ngati taiwara kare Malawi sometimes choose to become deaf and shortsighted to meet their wishes Chakwera and many more had clearly said that no altered figures had advantaged any candidate But went on saying that there were irregularities In addition nobody from the petitioners had brought to court evidence disputing the valid candidate votes Now if none had brought that how would you say the elections were rigged malawi pls learn to follow issues impartially Timanena chatsitsa dzaye kuti njovu ithyoke nyanga wosamangolubwa yayi Evidence thats what the court will use to determine whether elections were rigged… Read more » Dolph ndiwe mbuli they were saying yes with an explanation kupusa basi alipo yemwe angakane kuti TipEx sanagwiritsidwe ntchito MEC ARRIVED AT IT’S DECISION BASING ON THE FACT THAT THERE WERE NO CONTRARY RESULTS FROM BOTH OF THE PETITIONERS Which means you do not understand English Mr Candet You mean it is only u who understands english if auditors were not given the mandate to reject or accept then why using them were they there just to eat our money and go without having any input the auditors were just a quality assurance measure to enhance acceptability by a wide range of stakeholders but the authority to determine results lies with MEC and can not be deligated to any other body What is critical is for the petioners monitors to bring the contrary results to that which MEC had annaunced The end of the story but if they dont then agwa nayo all the petitioners Who doesn’t no the use of tipex?Even lowyers pretending to be ignorant on the use of tipex.Go back to the dictionary.Moti zoonadi poyerayera ngakhale kufa mutu munthu angabe vote ndi tipex.Waisting time and money dicusing tipex,tipex.The point is what was it used for.All those people can’t be fools.On Mps it was the same What is special with the president.If anything then it must affect the whole election Yea and what is amazing is that Chakwera position as mp is by tippex and is failing to challenge this shameeee Was 147 complaints from only president 😆😆😪😪 The bottom line is was tipex used to advantage someone or not CHECK UR SPELLINGS BRO…GO BACK TO UR DICTIONARY Koma spelling za chuzungu ndiye za kuvuta Shonai You are a cadet and need to go back to school Tippex was used to change figures said mutharika even his alfandika The changing of the figures was right if in my thinking rased with one line intead ot tippex for the sake of accountability .The mec had final whistle to blow as referee wheather supposed to be penalty ignored yes the last hope is five panel judges for their judgment then the this book closed i guess you cry i Lough or u Lough i cry if the crying vocals be the same then can wipe wheather tears or joy or laughter everyone individually will eat from his sweat crying… Read more » then one CEO claims that this interview was being conducted before investigation Alfandika the genuis kumuonetsa utsi Mordecai Msisha In what language is your radio broadcasting this case KKKKKKK MBULI IWE USANAKAMBEPO NKHANI NGAKHALE YOTI AKAZI AKO ANYENGESA Kodi Court ati inaimaso kaye chifukwa choti Mec yabweletsa fake papers Yankhani ndinu awirinu iwe uli pamwamba ndiwe uli pansipa How did Alufandeka showed Modecai a smoke.Don’t b passive Alfandika’s arguments are misplaced/ ill-advised The very man who is supposed to be chief elections officer of the electoral body is clearly implicating himself by admitting that there were gross electoral irregularities in front of a panel of judges In fact to the extent that he cannot even remember all the sites where irregularities had occurred But the big question is whose responsibility was that And this is exactly what petitioners looking for as reasons for nullification More over uncle Ben did not do him any favours he also admitted ALL (countrywide) teachers whom… Read more » having irregulaties is different altogether the question is did the irregulaties affect the valid candidate vote This is what has been brought to court by petitioners but are failing to prove whether the irregulaties had any impact on the overall results Chakwera and other witnesses had admitted that they are in court not in dispute for candidate valid votes but irregularites whcih is uncalled for Because irregularities according to MEC consititution says any breach of the law thats what is refered to as irregularity So when asked have you pointed out any law which MEc had breached they answered… Read more » denial is a very ineffective coping mechanisms Sure Alfandika has made a point thru re-examination by his lawyer Wakumva wamva kuti ohooo this how it happened A newly-formed development-oriented organisation is set to be officially launched on Saturday The route to Shonai station looks like this The Kiha 147 diesel railcar will carry you from Oita Station It connects Oita Station and Shonai Station by one-man operation The Kyudai Main Line, which leaves Oita Station and separates from the Nippou Main Line and Hohi Main Line. Draw a large U-shape and run westward. I will run in Oita city for a while Route 210 runs in parallel with the Oita River I continued to run along the river and arrived at Shonai station Get off here and transfer to the substitute bus that stops in front of the station but most of the flights run to the front of the station on the way Occasionally away from the railroad tracks the community bus stop along the national highway is not the station front the national roads on which the substitute buses run were also being constructed with alternating traffic in some places I arrived at the parking lot near Yufuin Station this bus will be bound for Bungomori Station 2020 (Friday) 15:09: Yufuin Station I came to Yufuin station but 'Yufuin' is used as a tourist destination Yufuin Town was formed by the merger of Kita Yufu Village and Minami Yufu Village in 1948 and later merged with Yufuin Town to become Yufuin Town Yufuin Town merged with Shonai Town and Hasama Town in 2005 to become Yufu City but trains are detained inside the station and can be visited by purchasing an admission ticket And the direction of Bungo-Mori going forward is like this I will return to the bus again and head for Bungomori the waiting time for alternating traffic is set to 1 minute or more It seemed that the rockfall prevention net was being constructed a bridge on the Kyudai Main Line crossed the road The area around Era Station where the trains stopped coming and the railroad tracks were buried in flowers collapsed on the way and was completely closed the bus arrived in front of Bungomori Station 2020 (Friday) 16:45: Bungomori Station To make sure you don't forget at the station for the stamp rally for the first time in about 4 hours first check in with GPS and get a stamp of the snake pillar The poster had not been posted yet because there was no place to put it so I went to the former Bungo Mori Roundhouse In the era when steam locomotives were needed to operate railways steam locomotives were distinguished from front to back so we used the turntable of this locomotive to change direction the operation of steam locomotives decreased with the times and in 1970 the Kyudai Main Line also achieved smokelessness The Bungo Mori Roundhouse was abolished in April 1971 The engine room and site were purchased by Kusu Town in 2006 and maintained as a park It was certified as a modern industrial heritage in 2009 and became a nationally registered tangible cultural property in 2012 Only Unit 29612 is on display and preserved and the inside of the engine cabinet is empty Return to the station before the train departure time The limited express 'Yufuin no Mori' that stops at Bungo Mori Station and the former Bungo Mori Roundhouse on the far right take the Yufuin no Mori and return to Hakata Station at once but the number of passengers from Bungo-Mori was not so large 2020 (Friday) 17:34: Bungomori Station → Hakata Station 'Yufuin no Mori No 6' departs from Bungo Mori Station at 17:34 'Yufuin no Mori' leaves the center of Kusu Town and heads west along the Kusu River The state of the Kusu River on the way to Hita after passing Amagase It can be seen that it caused considerable damage to the embankment a beautiful scene can spread with a gentle flow I'm running through the green that is approaching the railroad tracks By the time I came out on the flat land in the Chikugo River basin which has a stadium in front of the station is the last station for the stamp rally of the day but since you are no longer in a state where you can enjoy the car window I got 6 stamps on the first day of the rally but the distance traveled from here was difficult again .. Research results show that a 'sustainable and poverty-free future' can be achieved without reducing the population Oyster fry with plenty of umami in crispy clothes and thick large-sized oyster fry appeared in Matsunoya, so I tried it Oct 07, 2020 23:45:00 in Coverage,   Vehicle