RENEW MEMBERSHIP Oklahoma Farm Bureau Preserving and protecting our rural way of life since 1942 Oklahoma County Farm Bureau donated $5,000 to the Regional Food Bank of Oklahoma Friday to provide meals to Oklahomans facing food insecurity The donation will be matched dollar-for-dollar doubling Oklahoma County Farm Bureau’s impact which will provide 30,000 meals to chronically hungry children families who are struggling to make ends meet and also seniors living on fixed incomes,” said Andrew Shepard development officer with the regional food bank of Oklahoma “This will be a huge help to our Oklahoma communities and all 53 counties that we’re all part of.” “We have been given so much and blessed so much ourselves and we appreciate the ability to give back,” said Bruce Wilson Copyright © 2025 Oklahoma Farm Bureau After four years of playing college basketball at UC Davis after going undrafted in the 2017 NBA Draft made his first appearance in European basketball in the 2017/18 season which he started with Nancy and finished with Caen and in the 2020/21 season he wore the jerseys of Gaziantep and Reggiana He joined AEK in February 2023 and joined Hapoel Jerusalem last summer he played in 13 regular season games in the Israeli league and averaged 11.2 points Lemar has experience playing in international competitions having played in the FIBA Europe Cup and the Basketball Champions League he played in six games in the AEK jersey and recorded 15.7 points while in the Hapoel Jerusalem jersey he averaged 7.7 points the Duluth East track team was having a relaxed practice at Ordean Stadium Senior Leif Ziring was trying to fine-tune his pole vault with a couple other Greyhounds athletes ahead of the Section 7AAA meet Wednesday in Forest Lake Coach Tim Visina set the practice bar to what Ziring thought was 13 feet 4 inches — the height required to automatically qualify for the state meet Ziring easily cleared the rubber band practice bar and as he got up It’s a trick Visina has pulled with some regularity on the Greyhound vaulters but it typically helps with confidence when they get to meets Ziring took the Duluth East school record by more than 18 inches at the Matt Kero Invitational May 12 at Public School Stadium and was fourth in Class AAA in 2022 when Ziring got to the Section 7AAA preliminaries Wednesday at Forest Lake High School failing to advance to Friday’s finals or the state meet next week at St wet spring limited the outdoor practice time for track teams across northern Minnesota and left a number of them playing catchup all season Ziring had already broken the Greyhound record as a junior but was able to do it again with a top height at PSS of 14-3 The East senior said the complexity of pole vault is what initially attracted him to the sport a few years ago “It’s like you’re competing against yourself every time “It’s like a puzzle you’re trying to work out — what can I do a bit better to get just a little bit higher.” has “a tendency to do stuff that’s dangerous,” like hanging off a train bridge or any number of crazy jumps but his mother — Sarah Ziring — knows her son has plenty of “self-preservation.” “He’s always been very calculated in what he tries,” Sarah said “When he was just a tiny kid he would practice something over and over until he could get it right I don’t think he really takes risks unless he knows that he can be successful at it He’s not the kid that jumps without looking.” this year he also qualified for the state meet as a diver which he found more intimidating than pole vault “That was much scarier than pole vaulting,” he said “I was improving really fast and my coach was trying to push me and he told me to do a triple I over-rotated and landed on my face and I had to get checked for a concussion After that I finished strong — it was a fun season and I met a lot of good guys.” The Section 7AAA track meet didn’t go how Ziring envisioned it but he will have more chances to improve and get higher when he competes next season at Wisconsin-Stout Please select what you would like included for printing: Copy the text below and then paste that into your favorite email application Enter your phone number above to have directions sent via text This site is protected by reCAPTCHA and the Google Privacy Policy and Terms of Service apply Service map data © OpenStreetMap contributors Metrics details Folate supplementation reduces the occurrence of neural tube defects (NTDs) birth defects consisting in the failure of the neural tube to form and close The mechanisms underlying NTDs and their prevention by folate remain unclear Here we show that folate receptor 1 (FOLR1) is necessary for the formation of neural tube-like structures in human-cell derived neural organoids FOLR1 knockdown in neural organoids and in Xenopus laevis embryos leads to NTDs that are rescued by pteroate a folate precursor that is unable to participate in metabolism We demonstrate that FOLR1 interacts with and opposes the function of CD2-associated protein molecule essential for apical endocytosis and turnover of C-cadherin in neural plate cells suggesting that folate and FOLR1 signal intracellularly to regulate neural plate folding This study identifies a mechanism of action of folate distinct from its vitamin function during neural tube formation The molecular mechanisms by which FOLR1 regulates neural plate cell apical constriction and whether this function is conserved across species have remained unanswered Here we show that folate/FOLR1 regulate neural tube formation in human-induced pluripotent stem cell (hiPSC)-based neural organoids and in Xenopus laevis embryos by controlling cadherin turnover in the apical adherens junctions FOLR1 signals in neural plate cells to counteract the action of FOLR1-interacting protein CD2AP which is necessary for endocytosis and cadherin trafficking from neural plate cell adherens junctions during apical constriction Neural organoids were generated from human induced pluripotent stem cells (hiPSCs) After 18–21-days in vitro neural organoids were fixed sliced and processed for immunostaining and nuclear labeling a FOLR1 localizes to the apical surface of neural cells surrounding the neural tube-like structure lumen Similar pattern of localization was observed in n = 15 neural organoids from N = 3 independent experiments b–d hiPSC-derived embryoid bodies were incubated with 2 μM control-vivo-morpholino (Control) FOLR1-vivo morpholino (FOLR1 knockdown (KD) FOLR1-MO) or FOLR1-MO and 50 μM pteroate (FOLR1 KD + pteroate) until 18–21 days in vitro b Examples of immunostained neural organoids in control and experimental groups Graph shows individual and mean ± SD number of neural tube-like structures per 10 μm-thick organoid section respectively from N = 3 independent experiments d Examples of immunostained neural tube-like structures c Yellow lines indicate distance from lumen border to first layer of nuclei Graph shows individual and mean ± SD lumen-nuclei distance per neural tube-like structure d α-catenin immunostaining was used to define cellular contour and measure circularity index Dashed outlined boxes correspond to zoomed-in images Graph shows individual and mean ± SD circularity index (1: perfect circle; 0: elongated polygon) per neural tube-like structure n = 6 neural tubes per group in N = 3 independent experiments e Cultured hiPSCs reaching 75% confluency were transfected with FOLR1-sgRNA/CRISPR/Cas9 (FOLR1 KO) and used for neural organoid cultures Cultures were supplemented with vehicle or 50 μM pteroate (FOLR1 KO + pteroate) until 18–21 days in vitro Shown are examples of immunostained neural organoids in control and experimental groups Source data are provided as a Source Data file These results demonstrate that FOLR1 is necessary for the formation of human cell-derived neural tubes and suggest that folates act through FOLR1 to rescue neural tube morphogenesis by a non-metabolic mechanism Two-cell stage Xenopus laevis embryos were microinjected with 3.2 (a c) or 5.2 (b) pmol Control-MO (Control) or FOLR1-MO (FOLR1 KD) per embryo and incubated with saline or 50 μM pteroate until the neural tube closed in control embryos sectioned and processed for immunostaining (c) Arrowheads indicate open neural tube (neural tube defect Bar graphs represent proportion of phenotypes in each group c Examples of immunostained transverse sections of the neural tissue; n of embryos sectioned was 25 Graph shows distribution of neural tissue defect score per group Tukey post-hoc multiple comparison test (a all suggestive of deficient cell-cell adhesion FOLR1 may enable cell-cell adhesion during neural tube morphogenesis a hiPSC-derived embryoid bodies were incubated with 2 μM control-vivo-morpholino (Control) FOLR1-MO) or FOLR1-MO and 50 μM pteroate (FOLR1 KD + pteroate) until 18–21 days in vitro when neural organoids were fixed and processed for immunostaining and nuclear labeling with DAPI b Cultured hiPSCs reaching 75% confluency were transfected with FOLR1-sgRNA/CRISPR/Cas9 (FOLR1 KO) and used for neural organoid cultures Cultures were supplemented with vehicle (Control) or 50 μM pteroate (FOLR1 KO + pteroate) until 18–21 days in vitro when neural organoids were fixed and processed for immunostaining and nuclear labeling with DAPI b Images are examples of immunostained neural tube-like structures Graphs show individual and mean ± SD maximum percent change in cadherin immunolabeling fluorescence intensity when crossing the lumen per neural tube-like structure n = 9 (a) and n = 12 (b) neural organoids per group Images are maximum intensity projection of single time frame Dashed lines indicate border between wild-type (WT) and MO-injected neural plate Insets show neural plate injected side with tracer in blue Graphs show distribution between both halves of the neural plate (in %) of the number of EEA1-GFP vesicles and area fraction of labeled endosomes per neural plate cell surface Two-tailed paired t-test; ns: not significant These findings suggest that surplus apical endocytosis in FOLR1-deficient neural tissue may cause excessive removal of C-cadherin from apicolateral adherens junctions and promote its degradation Two-cell stage Xenopus laevis embryos were bilaterally microinjected with 1.6 pmol Control-MO (Control) or FOLR1-MO (FOLR1 KD) per blastomere incubated from early neural plate stage (stage 12) with vehicle or proteasome and lysosome inhibitors until they reached mid-neural plate stages (stage 16–17) when neural plates were dissected and processed for Western blot (a a Example of Western blot assay immunoprobed for C-cadherin showing full-length and cleaved (~80 kD) forms Graph shows individual and mean ± SD percent of optical density (OD) for cleaved C-cadherin band normalized with GAPDH protein band OD and compared to controls n = 20 and 26 neural plates for Control and FOLR1 KD groups respectively b Example of immunoprecipitation (IP) assay for C-cadherin followed by Western blot assay for ubiquitin and C-cadherin Graph shows individual and mean ± SD percent of optical density (OD) for ubiquitinated (Ubiq) C-cadherin band normalized with full-length C-cadherin and compared to controls n = 16 and 24 neural plates for Control and FOLR1 KD groups respectively These data suggest that FOLR1 negatively regulates endocytosis and C-cadherin degradative trafficking to preserve adequate levels of cell adherens junction complexes for efficient neural plate cell apical constriction a Neural plate stage Xenopus laevis embryos were processed for co-immunoprecipitation (IP) assays Example of Western blot assay from immunoprecipitates with FOLR1 or GFP (control) antibodies and probed for CD2AP or FOLR1 Similar results were observed in N = 3 independent experiments b Neural plate stage Xenopus laevis embryos were fixed and processed for immunostaining Images are transverse single z-sections of immunostained neural plate showing apical colocalization of phospho-CD2AP (p-CD2AP) and p-c-Cbl with C-cadherin c Two-cell stage Xenopus laevis embryos were bilaterally microinjected with 9.9 pmol of Control-morpholino (Control 2.6 pmol CD2AP-MO1 (CD2AP KD1) or 7.4–9.9 pmol CD2AP-MO2 (CD2AP KD2/KD) per blastomere until neural tube closed in control embryos when they were fixed and photomicrographed Numbers are embryos presenting closed (green) or open (purple Bar graph represents proportion of phenotypes in each group d Two-cell stage Xenopus laevis embryos were unilaterally microinjected with 9.9 pmol Control-MO (Control) and 7.4–9.9 pmol CD2AP-MO2 (CD2AP KD) along with GFP and mCherry mRNA and allowed to develop until they reached mid-neural plate stages when they were fixed and processed for immunostaining Image is a transverse section of the neural plate Double arrows indicate apical surface length of medial superficial Control (white) and CD2AP KD (magenta) neural plate cells Graph shows individual and mean ± SD apical length of superficial neural plate cells per embryo n of cells = 75 in each half of the neural plate a Two-cell stage Xenopus laevis embryos were bilaterally microinjected with hEEA1-GFP and membrane mCherry mRNAs and unilaterally microinjected with 9.9 pmol CD2AP-MO (CD2AP KD) per blastomere along with fluorescent tracer and allowed to develop until they reached early neural plate stages (stage 13-14) when they were time-lapse imaged with an acquisition rate of 1 frame/6 min Image is maximum intensity projection of single time frame Dashed line indicates border between morpholino-injected and wild-type (WT) neural plate Inset shows neural plate injected side showing tracer in blue n = 28 cells analyzed in each group from N = 5 embryos per group b Two-cell stage Xenopus laevis embryos were bilaterally microinjected with 7.4 pmol Control-MO (Control) or CD2AP-MO (CD2AP KD) per blastomere and allowed to grow until they reached mid-neural plate stages (stage 15–17) when neural plate was dissected and processed for Western blot assays Graph shows individual and mean ± SD percent of optical density (OD) for C-cadherin immunoblot band normalized with GAPDH protein band OD and compared to controls n = 28 and 24 neural plates for Control and CD2AP KD groups Two-cell stage Xenopus laevis embryos were microinjected with 14.8 pmol Control-morpholino (MO b) per embryo and incubated with saline or proteasome and lysosome inhibitors at the end of gastrulation (stage 12) until neural plate stages (stage 17) when they were processed for Western blot assays Images are examples of Western blot assays Graphs show individual and mean ± SD percent of optical density (OD) for CD2AP (a) or FOLR1 (b) immunoblot band normalized with GAPDH protein band OD and compared to controls n = 34 and 42 neural plates for Control and FOLR1 KD N = 7 independent experiments; n = 20 and 26 neural plates for Control+inhibitors and FOLR1 KD+inhibitors groups In (b) n = 16 and 20 for Control and CD2AP KD groups respectively and n = 16 and 18 neural plates for Control+inhibitors and CD2AP KD+inhibitors Reciprocally, CD2AP KD upregulates FOLR1 protein levels, effect that is abolished in the presence of proteasome and lysosome inhibitors during neural plate folding (Fig. 8b) This result can be explained by the inhibitory effect of CD2AP KD on apical membrane endocytosis diminished FOLR1 endocytosis when CD2AP is depleted may halt FOLR1 turnover upregulating FOLR1 protein levels Altogether these discoveries indicate that FOLR1 regulates CD2AP protein level to achieve a balanced remodeling of the apicolateral cell membrane by regulating the rate of apical endocytosis and adherens junction turnover necessary for adequate and precisely timed neural plate cell apical constriction during neural tube morphogenesis a–c Neural plate from mid neural plate stage Xenopus laevis embryos was dissected and dissociated cells plated in vitro cells were loaded with the Ca2+ sensor Fluo4-AM and time-lapse imaged a Example of 1-h recording of neural plate cell Ca2+ activity folic acid (c) or vehicle was added to neural plate cells in culture during time-lapse imaging and the Ca2+ response was recorded in the first minute post addition b Example of acute transient elicited by 100 μM folinic acid c Graph shows mean ± SEM folinic- or folic acid-responsive neural plate cells compared to total number of cells with spontaneous Ca2+ transients in 30 min recording d Two-cell stage embryos were bilaterally microinjected with GCaMP6s mRNA and grown until early and mid-neural plate stages when they were time-lapse imaged before and after addition of vehicle or 300 μM folinic acid Image shows example of embryo with cells exhibiting Ca2+ transients indicated with circles Graph shows individual and mean ± SD percent change in Ca2+ transient frequency before and after addition of vehicle or folinic acid e–h Two-cell stage embryos were bilaterally microinjected with GCaMP6s mRNA (e–h) and unilaterally microinjected with 9.9 pmol FOLR1-MO1 (FOLR1 KD1/KD) or 1.6 pmol FOLR1-MO2 (FOLR1 KD2) per blastomere (e) and grown until mid-neural plate stages when they were time-lapse imaged Image in (e) shows example of embryo with cells exhibiting Ca2+ transients indicated with circles in WT and FOLR1 KD1 halves Graphs show individual Ca2+ transient frequency (transients/5 min) in WT and FOLR1 KD1 or KD2 halves (e n = 6 embryos) and in WT embryos before and after addition of vehicle (f Na+ and voltage-gated Ca2+ channel blockers (VGCblock: 0.02% tricaine+10 μM nitrendipine+25 μM TTA-2 Two-tailed paired t-test (e–g) and 1-way ANOVA-Tukey multiple comparisons test (h) i Model of FOLR1 and CD2AP regulation of neural tube formation suggesting that FOLR1 elicits Ca2+ dynamics during neural plate folding suggesting that folate/FOLR1-dependent Ca2+ dynamics operate through Ca2+ influx Altogether these finding suggest that folate/FOLR1 recruit rapid signaling mechanisms important for regulating neural plate cell apical constriction and neural tube formation Here we show that FOLR1 negatively regulates CD2AP function by controlling CD2AP protein degradation during neural plate folding Identifying the mechanisms by which FOLR1 regulates CD2AP protein turnover demands further investigation Folate-FOLR1 interaction may recruit a transmembrane signaling partner that in turn regulates CD2AP-Cbl-mediated endocytosis ubiquitination and turnover of adherens junction molecules we find that folates trigger acute changes in Ca2+ dynamics in the neural plate which are also dependent on FOLR1 expression Folate/FOLR1-dependent Ca2+ dynamics may serve as the link between the regulated removal of apicolateral membrane and the cytoskeletal dynamics necessary for neural plate cell apical constriction during neural plate folding The precise relationship and timing of folate/FOLR1-dependent Ca2+ signaling and adherens junction remodeling during apical constriction needs to be further investigated Despite a single Ca2+ transient may be a faster event than the regulation of the endocytic process during apical constriction the information carried by Ca2+ dynamics in neural cells may be integrated over time and be transduced into regulating apical endocytosis and degradation of adherens junction components A full understanding of the mechanisms of action of folate and FOLR1 during neural tube formation may contribute to developing effective preventative strategies for NTDs and to identifying potential risk factors All experimental procedures and research design utilized in this study complied with ethical regulations The Institutional Animal Care and Use Committee approved the animal protocol #22264 implemented in this study IACUC follows the guidelines established by the Animal Welfare Act and the Public Health Service Policy on Humane Care and Use of Laboratory Animals after hiPSC colonies reached 70–80% confluency in feeder independent conditions in mTESR medium (Stem Cell Technology they were detached with Accutase (Stem Cell Technology The mixture was triturated to obtain single cells and centrifuged for 3 min at 270 g at 23 °C prepared as following for 500 ml: 100 ml KnockOut Serum Replacement (Thermofisher # 11330032) with 50 μM ROCK inhibitor Y27632 (StemCell Technology Resuspended cells were then plated in 96-well ultra-low attachment plates (9000 cells per well) for formation of embryoid bodies (EBs) The hESC medium was renewed every other day until EBs reached 600-μm diameter EBs were transferred into 24-well ultra-low attachment plates and fed every other day with Neural Induction medium: 1% (v/v) N2 supplement 1% (v/v) MEM-NEAA and 1 μg/mL heparin (Stemcell Technology #7980) in DMEM-F12 until neuroepithelium formation was apparent (usually after 4 days) EBs were then embedded into 20 μl Matrigel (Corning # 354230) droplets and transferred into a 60-mm tissue culture plate with 5 ml Cerebral Organoid Differentiation medium without vitamin A prepared as following for 500 ml: 250 ml Neurobasal medium (Thermofisher 5 ml penicillin-streptomycin (Thermofisher # 15140122) and 5 ml B27 without vitamin A (Thermofisher plates with the Matrigel-embedded organoids were transferred into an orbital shaker inside the incubator and fed with Cerebral Organoid Differentiation medium with vitamin A (same as previous but with B27 supplement with vitamin A (Thermofisher Neural organoids were fixed with 4% paraformaldehyde (PFA) at room temperature for 40 min dehydrated and embedded in paraffin blocks blocked with buffer containing 1% bovine serum albumin for 45 min at 23 °C and incubated with primary antibodies: FOLR1 # 13-9700) in blocking buffer overnight at 4 °C followed by incubation with fluorescently tagged Alexa Fluor secondary antibodies: anti-mouse 647 donkey # A21206) and anti-goat 596 donkey (Invitrogen Imaging of 20–25 sections per fluorescently labeled neural organoid was done under a confocal microscope (Nikon A1) through a 1 μm-step z-stack scanning When hiPSC colonies reached 70–80% confluency Inc.) or hFOLR1 translation blocking vivo-morpholino Inc.) was added to the medium and incubated for 48 h hiPSCs were then dissociated with Accutase solution (Sigma-Aldrich) and centrifuged for 3 min at 288 g to remove enzymatic solution Cell pellet was resuspended in mTESR medium containing 5 μM ROCK inhibitor and 20 ng/ml bFGF and then 9000 cells were seeded into Ultra low attachment surface 96-well plates when FOLR1-MO-treated cultures were incubated either with freshly made 50 μM sodium pteroate or vehicle only # SC-250800) was dissolved in 0.05 N NaOH by vigorous shaking and solution was shielded from light Treatments were renewed along with culture medium every other day hiPSCs at 70% confluency were incubated with 2 μM Control-MO or FOLR1-MO for 48 h processed as described below for Western blot assays and immunoblotted with anti-FOLR1 antibody 1:500 in 5% BSA in TBST (Bioworld Technology # 711-035-152) and ECL2 Western Blotting Substrate (ThermoFisher Millipore/Sigma) were stripped and reprobed with anti-GAPDH antibody Approximately 60% confluent hiPSCs were incubated with 1.2 μg targeted synthetic gRNA (AGUUGGGGGAGCACUCGUAG) 6.25 μg Cas9 and Lipofectamine CRISPRMAX Transfection Reagent (TrueCut Cas9 protein v2 To assess efficiency of the KO-CRISPR approach detection of cleavage was done by the GeneArt Genomic Cleavage Detection Kit (Invitrogen) according to the manufacturer’s guidelines genomic DNA from transfected hiPSCs was extracted and the sequence of interest was amplified by PCR smaller size bands indicate indels introduced by Crispr-Cas9 while the largest band represents the WT DNA Analysis of the gel bands was done by Image Lab software sequencing of genomic DNA was done to identify the % Indel and KO score Analysis of the DNA sequences was done by the ICE Analysis online tool (Synthego) Large field of view images from 20–25 10 μm-thick sections of immunostained and DAPI-labeled neural organoids were used to record in the section showing the largest extent of the complete organoid the number of neural tube-like structures per organoid in control and experimental groups This was based on gross appearance of tubularly-shaped structures and presence of central lumen Neural organoid images of α-catenin immunostaining (for apical surface staining) and nuclear labeling by DAPI were used to measure the perpendicular distance from the apical surface of the neural tube surrounding the lumen to every nucleus of peri-lumen cells with the line tool in ImageJ software (NIH) At least 10 neural tube-like structures were measured for each group per experiment and at least 3 experiments were performed Neural organoid images of α-catenin immunostaining were used to measure the circularity of each peri-lumen cell of neural tube-like structures with the circularity tool in ImageJ software The score is 1 for a perfect circle and close to 0 for elongated polygons Neural organoid images of pan-cadherin immunostaining were used to measure the fluorescence intensity profile of cadherin immunostained neural tube-like structures by drawing a linear probe crossing the apical cell surface of the lumen with NIS Elements software (Nikon The peak values for cadherin fluorescence intensity that correspond to the apical surface region when apical constriction is apparent was compared among control and experimental groups by calculating the percent change in cadherin fluorescence intensity when crossing the apical surface All these measurements were done in at least 10 neural tube-like structures for each group per experiment and at least 3 experiments were performed Statistical analysis was done with Prism software (Graphpad) by using one-way ANOVA Animals were handled according to the IACUC guidelines using humane procedures to prevent animal suffering Two-cell-stage embryos were unilaterally or bilaterally injected with 1.6–3.8 pmol splicing blocking morpholino (MO) complementary to Xenopus laevis folr1 exon-intron junction AAACCTTGGGCCCTGGATCCAGAAGgtaattggaagggggtgatggtgac FOLR1-MO1 ATCACCCCCTTCCAATTACCTTCTG (FOLR1 KD1/KD) or with 9.9 pmol translation blocking MO (FOLR1 KD2) complementary to Xenopus laevis folr1 mRNA FOLR1-MO2 GGCCCCCCGTAACATGGTTACAAGC per blastomere Controls were sibling embryos injected with standard control MO Control-MO CCTCTTACCTCAGTTACAATTTATA (Control) Morpholinos were injected along with dextran-Alexa-Fluor conjugates or with GFP or mCherry mRNA to assure permanency of MO reporter after TCA fixation Rescue experiments were implemented by incubating embryos injected with 1.6 pmol FOLR1-MO1 per blastomere at 2-cell stage (4 h post fertilization (hpf) at 23 oC) with freshly made 50 μM sodium pteroate FOLR1-MO-injected and control embryos were grown in the solution with pH matched to pteroate-incubated group Embryos were grown in the dark at 18 oC overnight until stage 13 then transferred in freshly prepared solutions and grown up until early neural tube stages (stage 21 Assessment of FOLR1 splicing blocking MO efficiency was performed by isolating neural plates from 9 stage 16 Xenopus laevis embryos in each group RNA was extracted with kit according to manufacturer’s instructions (RNeasy Mini Kit gDNA was eliminated (RapidOut DNA Removal Kit # 00859896) and cDNA was made (High-Capacity cDNA Reverse Transcription Kit PCR was performed for Control-MO and FOLR1-MO1 injected embryos with primers located in intron 2 and exon 3 that generates no PCR product from cDNA of mature spliced folr1 transcript and a 308 bp PCR product when the mRNA is not spliced Neural tissue defect score was the median score of 3 transverse sections per embryo Medial neural plate of embryos at stage 14–14.5 were imaged using 60x objective and Z-stack confocal imaging (Sweptfield confocal Analysis was performed in time-lapse recordings with an acquisition rate of 1 frame/6 min Number of endosomes and endosome/cell surface fraction were measured in FOLR1 KD Control and contralateral wild type cells by creating a region of interest outlining cell boundaries and thresholding GFP intensity to at least 2 times over background with 0.4–4 μm size and 0.3–1 circularity limitations using NIS-Elements software (Nikon Further processing starting with a 2% BSA blocking step was done using SNAP i.d 2.0 System for immunohistochemistry (Millipore) LAMP1-containing vesicles was done by creating a region of interest outlining cell boundaries in transverse sections of the neural plate and thresholding immunolabeling fluorescence intensities followed by counting stained vesicles in 3 consecutive z-sections (1 μm step) with NIS Elements software (Nikon Samples were from early neural plate stage (stage14–14.5) embryos for C-cadherin/EEA1/ubiquitin and mid neural plate stage (stage 15) embryos for C-cadherin At least 3 consecutive sections were analyzed per embryo from 5 embryos for each group neural plates (2 per sample) were dissected from stage 15–17 Xenopus laevis wild type vehicle-/protein degradation inhibitor cocktail-treated embryos or Control/FOLR1 KD/CD2AP KD embryos in collagenase and snap-frozen in liquid nitrogen and stored frozen at −80oC overnight Samples were thawed on ice and resuspended in RIPA buffer (1% (v/v) Triton X-100 centrifuged at 16,100 g for 10 min and pellet discarded 10% β-mercaptoethanol) was added to supernatant Samples were separated on 10% polyacrylamide gels and transferred to PVDF membranes (Millipore/Sigma Membranes were blocked with 0.5% non-fat milk TBST in SNAP i.d 2.0 Protein Detection System (Millipore/Sigma) for 10 min and incubated with monoclonal anti-C-cadherin antibody 1:100 (Developmental Studies Hybridoma Bank # 6B6) in 5% non-fat milk TBST overnight at 4 °C on rocking platform membranes were incubated with HRP-conjugated secondary antibodies # 515-035-003,) in 0.5% milk TBST for 10 min in SNAP i.d for Western blot and visualized by ECL2 Western Blotting Substrate Signal was detected using ChemiDocMP Imaging System PVDF membranes were stripped in 0.2 M glycine HCL buffer 0.05% Tween for 20 min and re-probed with anti-CD2AP and anti-FOLR1 antibodies Protein loading was detected using anti-GAPDH antibody followed by incubation with HRP-conjugated secondary antibody Jackson ImmunoResearch) and ECL Western Blotting Detection reagent (Millipore/Sigma Neural plates from 9 mid neural plate stage (stage 16) Xenopus laevis embryos in each group were isolated # 00859896) and cDNA was made (High Capacity cDNA Reverse Transcription Kit qPCR was performed with SYBR Green Universal Master Mix (Applied Biosystems # 2107118) in Stratagene Mx3005 real-time PCR machine 28 cycles of 45 s at 95 °C/30 s at 55 °C/ 30 s at 72 °C C-cadherin forward primer: TGGTGACAGACGATGGTGTT C-cadherin reverse primer: GCTGTCAAGTTCAGCCTTCC ODC forward primer: GTCAATGATGGAGTGTATGGATC ODC reverse primer: TCCATTCCGCTCTCCTGAGCAC To determine the level of cleaved and ubiquitinated C-cadherin stage 12–12.5 Xenopus laevis embryos were incubated with lysosome and proteasome inhibitor cocktail: 100 μM chloroquine (Selleckchem # BML-CM110-0100) and 10 μM MG-132 (Selleckchem neural plates (4 per sample) were dissected in collagenase snap-frozen and stored at −80 oC for up to 2 weeks Samples were thawed on ice and homogenized in 60 μl of lysis buffer containing 0.5% Sodium n-lauroylsarcosinate # 7130) and protease inhibitors cocktail (Thermo Scientific After 10 min samples were diluted 4x with lysis buffer containing 1% Triton X-100 instead of 0.5% Sodium n-lauroylsarcosinate Supernatants were pre-cleared by incubating with 30 μl of protein G-agarose beads suspension (Roche # 11719416001) for 3 h at 4 °C on a mini-rotator A quarter of the pre-cleared lysate was mixed with 4x reducing protein loading buffer (200 mM Tris-HCl 10% β-mercaptoethanol) and incubated at 100 oC for 4 min Samples were separated on 10% polyacrylamide gels and immunoblotted with anti-C-cadherin 1:100 (Developmental Studies Hybridoma Bank then reprobed with anti-GAPDH antibody (Sicgen The rest of the sample was incubated with protein G-agarose beads chemically cross-linked to anti-C-cadherin antibody (Developmental Studies Hybridoma Bank # 6B6) overnight at 4 °C on a mini-rotator beads were resuspended in 2X protein loading buffer containing 10 mM DTT and incubated for 10 min at 80 °C Samples were separated on 10% polyacrylamide gels immunoblotted with anti-ubiquitin antibody 1:500 in 5% BSA TBST (13-1600 Invitrogen) and reprobed with anti-C-cadherin antibody 1:100 in 5% non-fat milk TBST (Developmental Studies Hybridoma Bank Fifteen mid-neural plate stage (stage 16) embryos were homogenized in lysis buffer containing 0.5% sodium n-lauroylsarcosinate Samples were diluted 4x with lysis buffer containing 1% Triton X-100 centrifuged at 16,100 g for 10 min and the pellet was discarded Supernatants were pre-cleared by incubating with 30 μl of protein G-agarose beads (Roche # 11719416001) for 3 h at 4 °C on mini-rotator FOLR1 was immunoprecipitated by overnight incubation of lysates with rabbit anti-Xenopus laevis FOLR1 polyclonal affinity purified antibody raised against the peptide KHQKVDPGPEDDLHC (custom made by GenScript) chemically cross-linked to protein G-agarose beads at 4 °C on a mini-rotator # TP401,) or normal rabbit IgG (Cell signaling # 2729) chemically cross-linked to protein G agarose beads were used as controls beads were washed 3x with 1% Triton X-100 lysis buffer and resuspended in non-reducing 2X protein loading buffer A quarter of the sample was reduced by addition of 10 mM DTT and heated at 80 oC for 10 min run on 10% polyacrylamide gel and immunoblotted for FOLR1 The rest of the non-reduced sample was run for 6 mm in resolving 10% polyacrylamide gels Digested peptides were analyzed by LC-MS/MS on a Thermo Scientific Q Exactive Plus Orbitrap Mass spectrometer in conjunction Proxeon Easy-nLC II HPLC (Thermo Scientific) and Proxeon nanospray source The digested peptides were loaded in a 100 μm × 25 mm Magic C18 100 Å 5U reverse phase trap where they were desalted online before being separated using a 75 μm × 150 mm Magic C18 200 Å 3U reverse phase column Peptides were eluted using a 100 min gradient with a flow rate of 300 nl/min An MS survey scan was obtained for the m/z range 350–1600 MS/MS spectra were acquired using a top 15 method where the top 15 ions in the MS spectra were subjected to HCD (High Energy Collisional Dissociation) An isolation mass window of 1.6 m/z was used for the precursor ion selection and normalized collision energy of 27% was used for fragmentation A 20 s duration was used for the dynamic exclusion Tandem mass spectra were extracted and charge state deconvoluted by Proteome Discoverer (Thermo Scientific) thegpm.org; version CYCLONE (2013.02.01.1)) Tandem was set up to search the uniprot-Xenopus laevis database (March 2017 version 34096 entries) assuming the digestion enzyme trypsin Tandem was searched with a fragment ion mass tolerance of 20 PPM and a parent ion tolerance of 20 PPM Carbamidomethylation of cysteine was specified in X dioxidation of methionine and tryptophan and acetyl of the n-terminus were specified in X Charge state deconvolution and deisotoping were not performed Proteomics experiment of FOLR1 co-IP was replicated 3 times; the proteins of interest were identified in all 3 LC-MS/MS runs Project Name: FOLR1-interacting proteins in neurulating Xenopus laevis embryos Reviewer account details: Username: reviewer_pxd048476@ebi.ac.uk Five stage 20 embryos bilaterally injected with 9.9 pmol CD2AP-MO2 (CD2AP KD) or Control-MO (Control CD2AP immunoprecipitation (IP) experiments) and 15 stage 16 wild type embryos (FOLR1-CD2AP co-IP experiments) were collected and snap frozen Samples were prepared as mentioned in previous section One-tenth of the lysates was separated to assess for protein loading IP/Western blot antibodies were rabbit anti-Xenopus laevis CD2AP polyclonal affinity purified antibody raised against the peptide CRPKSEVEPHSKTKT custom made by GenScript and anti-Xenopus laevis FOLR1 antibody (GenScript) protein G agarose beads with immunoprecipitates were resuspended in 2X protein loading buffer containing 10 mM DTT and incubated for 10 min at 80 °C Samples were separated on 10% polyacrylamide gels and immunoblotted with anti-Xenopus laevis CD2AP antibody 1:500 in 5% non-fat milk TBST followed by HRP-conjugated anti-rabbit secondary antibodies Membranes were stripped and reprobed for FOLR1 antibody Protein loading was assessed in lysates with anti-β-tubulin 1:300 (Developmental Studies Hybridoma Bank # E7) in 5% non-fat milk TBST and FOLR1 antibody in 5% non-fat milk TBST (GenScript) Anti-GFP antibody or normal rabbit IgG were used as controls in FOLR1-CD2AP co-IP experiments Two-cell-stage embryos were unilaterally or bilaterally injected with 2.6 pmol translation blocking CD2AP-morpholino 1 (MO1 CD2AP knockdown (KD) 1) TGTCACTCTCCGGCCTCTCGCTT 7.4 – 9.9 pmol translation blocking CD2AP-MO2 (CD2AP KD2) CAATGTATTCCACCATTCTGCTGCT complementary to Xenopus laevis CD2-associated protein (CD2AP) mRNA or standard control-morpholino (Control-MO Morpholinos were injected along with dextran-Alexa-Fluor conjugates or with GFP or mCherry mRNA to assure permanency of MO reporter in the injected side after TCA fixation Stereoscope images of embryos injected with 5.2 pmol CD2AP-MO1 or 14.8–19.8 pmol CD2AP-MO2 or Control-MO were taken when control embryos reached early neural tube stages (stage 20) Observed phenotypes were categorized in “Closed” or open (“NTDs”) neural tube 5 Xenopus laevis embryos from control-MO- and CD2AP-MO2-injected groups were collected for immunoprecipitation assays to assess CD2AP protein level Procedures of immunoprecipitation and Western blot assays were as described in previous section Apical constriction was assessed in stage 16.5 embryos unilaterally injected with 7.4–9.9 pmol of CD2AP-MO2 (CD2AP KD) and Control-MO (Control) in single blastomeres at the 2-cell stage Measurements were done in 3 consecutive CD2AP KD and 3 paired Control medial neural plate cells in 5 consecutive sections from 4 embryos Mid-neural plate stage embryos (stage 15) were incubated with 1 mg/ml collagenase and neural plate was dissected Neural plate cells were then dissociated by incubation with a Ca2+/Mg2+ free saline for 45 min Cells were then plated in saline solution (in mM: 117NaCl allowed to attach for 2 h and incubated for 45 min with 1 μM of the cell permeant Ca2+ sensitive dye Fluo4-AM Cultures were then time-lapse imaged in a Swept-field confocal microscope (Nikon) for up to 1 h at 0.2 Hz acquisition rate Folic and folinic acid dose-dependent effectiveness in eliciting acute Ca2+ transients in neural plate cells was assessed by addition of 1 300 and 1000 μM folic or folinic acid and compared to addition of vehicle only (0 μM) The number of Ca2+ transients at different developmental stages in the presence or absence of 300 μM folinic acid or vehicle only or in the presence of ion channel blockers and folic acid in wild type embryos were measured and significance was assessed by paired t test or one-way ANOVA followed by Tukey’s multiple comparisons test To assess the Ca2+ source of folic acid-induced Ca2+ transients GCaMP6s-expressing embryos were live imaged for a maximum of 30 min under a confocal microscope (Nikon A1): first 5 min to record baseline activity followed by addition of a Na+ and Ca2+ channel blocker cocktail (VGCblock): 0.02% tricaine L-type voltage-gated Ca2+ channel blocker + 25 μM TTA-2 Rigorous research design and analysis was implemented by running all the controls necessary alongside experimental samples Analysis of data was performed blindly to the analyzer with the exception of analysis of Western blot assays that results were obtained directly from the developer by the experimenter running the gels who knew the order in which samples were loaded Number of samples for each experiment was determined by pilot experiments and power analysis Experiments were replicated at least 3 times Statistical analysis of the data was done with Prism software (Graphpad Normality test was performed in each set of data and then parametric (normally distributed) or non-parametric statistical analysis was chosen Paired tests were implemented in unilaterally manipulated embryos when compared control and microinjected halves of neural tissue or when Ca2+ activity was compared before and after addition of an agent in the same sample Number of samples analyzed per group were more than 5 Groups were considered statistically different when p < 0.05 Exact p values are included in the Source Data File for data set Each statistical test used is indicated in each figure legend for every dataset Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article B vitamins and one-carbon metabolism: implications in human health and disease and promoting health equity: an urgent call to action for universal mandatory food fortification with folic acid Maternal metabolism influences neural tube closure One-carbon metabolism and folate transporter genes: do they factor prominently in the genetic etiology of neural tube defects Folate action in nervous system development and disease Structural basis for recognition and transport of folic acid in mammalian cells Mechanisms of membrane transport of folates into cells and across epithelia Upregulation of reduced folate carrier by vitamin D enhances brain folate uptake in mice lacking folate receptor alpha Emerging roles for folate receptor FOLR1 in signaling and cancer Nuclear localization of folate receptor alpha: a new role as a transcription factor Quantitative proteomics identifies FOLR1 to drive sorafenib resistance via activating autophagy in hepatocellular carcinoma cells Bacterial folates provide an exogenous signal for C Folate receptor β regulates integrin CD11b/CD18 adhesion of a macrophage subset to collagen Spatial and temporal expression offolate-binding protein 1 (Fbp1) is closely associated with anterior neural tube closure in mice Folate receptor 1 is necessary for neural plate cell apical constriction during Xenopus neural tube formation Mice lacking the folic acid-binding protein Folbp1 are defective in early embryonic development Shroom induces apical constriction and is required for hingepoint formation during neural tube closure Actomyosin contractility and microtubules drive apical constriction in Xenopus bottle cells Shroom regulates epithelial cell shape via the apical positioning of an actomyosin network Endocytosis is required for efficient apical constriction during Xenopus gastrulation Neural tube closure requires the endocytic receptor Lrp2 and its functional interaction with intracellular scaffolds Cerebral organoids model human brain development and microcephaly A loss-of-function NUAK2 mutation in humans causes anencephaly due to impaired Hippo-YAP signaling Structural basis for molecular recognition of folic acid by folate receptors N- and E-cadherins in Xenopus are specifically required in the neural and non-neural ectoderm for F-actin assembly and morphogenetic movements Endocytosis is required for E-cadherin redistribution at mature adherens junctions Endocytosis of cadherin from intracellular junctions is the driving force for cadherin adhesive dimer disassembly The VE-cadherin cytoplasmic domain undergoes proteolytic processing during endocytosis A novel adaptor protein orchestrates receptor patterning and cytoskeletal polarity in t-cell contacts Congenital nephrotic syndrome in mice lacking CD2-associated protein A cortactin-CD2-associated protein (CD2AP) complex provides a novel link between epidermal growth factor receptor endocytosis and the actin cytoskeleton CD2-associated protein haploinsufficiency is linked to glomerular disease susceptibility The endophilin–CIN85–Cbl complex mediates ligand-dependent downregulation of c-Met Cbl–CIN85–endophilin complex mediates ligand-induced downregulation of EGF receptors CD2AP regulates SUMOylation of CIN85 in podocytes Genome evolution in the allotetraploid frog Xenopus laevis CD2AP/SHIP1 complex positively regulates plasmacytoid dendritic cell receptor signaling by inhibiting the E3 ubiquitin ligase Cbl CD2AP and Cbl-3/Cbl-c constitute a critical checkpoint in the regulation of ret signal transduction CD2-associated protein (CD2AP) enhances casitas B lineage lymphoma-3/c (Cbl-3/c)-mediated ret isoform-specific ubiquitination and degradation via its amino-terminal src homology 3 domains ubiquitinates and induces endocytosis of the E-cadherin complex Cell-autonomous Ca(2+) flashes elicit pulsed contractions of an apical actin network to drive apical constriction during neural tube closure NMDA receptor signaling is important for neural tube formation and for preventing antiepileptic drug-induced neural tube defects Action of papaverine and ionophore A23187 on neurulation Calcium regulation of neural fold formation: visualization of the actin cytoskeleton in living chick embryos Suzuki, M. et al. Distinct intracellular Ca2+ dynamics regulate apical constriction and differentially contribute to neural tube closure. Development dev.141952. https://doi.org/10.1242/dev.141952 Disruption of the MacMARCKS gene prevents cranial neural tube closure and results in anencephaly Calpain2 protease: a new member of the Wnt/Ca2+ pathway modulating convergent extension movements in Xenopus CD2AP in mouse and human podocytes controls a proteolytic program that regulates cytoskeletal structure and cellular survival The gastric epithelial progenitor cell niche and differentiation of the zymogenic (chief) cell lineage Tyrosine phosphorylation of CD2AP affects stability of the slit diaphragm complex T-type calcium channel regulation of neural tube closure and EphrinA/EPHA expression Brown, J. M. & García-García, M. J. The secretory pathway calcium ATPase 1 (SPCA1) controls neural tube closure by regulating cytoskeletal dynamics. Development dev.170019. https://doi.org/10.1242/dev.170019 A novel calmodulin–β-PIX interaction and its implication in receptor tyrosine kinase regulation Oscillations and cell development in Dictyostelium discoideum stimulated by folic acid pulses Intracellular Ca2+ signals in Dictyostelium chemotaxis are mediated exclusively by Ca2+ influx Changes in actin associated with the cytoskeleton following chemotactic stimulation of Dictyostelium discoideum Normal Table of Xenopus Laevis (Daudin): A Systematical and Chronological Survey of the Development from the Fertilized Egg till the End of Metamorphosis The FYVE domain of early endosome antigen 1 is required for both phosphatidylinositol 3-phosphate and Rab5 binding In toto imaging of embryogenesis with confocal time-lapse microscopy Reversing the effects of formalin fixation with citraconic anhydride and heat: a universal antigen retrieval method A statistical model for identifying proteins by tandem mass spectrometry The PRIDE database resources in 2022: a hub for mass spectrometry-based proteomics evidences Ultrasensitive fluorescent proteins for imaging neuronal activity Activity-dependent homeostatic specification of transmitter expression in embryonic neurons Interplay between electrical activity and bone morphogenetic protein signaling regulates spinal neuron differentiation Injury-induced Erk1/2 signaling tissue-specifically interacts with Ca2+ activity and is necessary for regeneration of spinal cord and skeletal muscle Normal Table of Xenopus development: a new graphical resource Download references We thank Andrew Hamilton for comments on the manuscript This work was supported by: National Science Foundation grant 1754340 (L.N.B.) National Institutes of Health grants R01NS105886 and R01NS113859 (L.N.B.) Shriners Hospital for Children grant 85111 (L.N.B.) and grant 84306 (O.A.B.) Department of Physiology & Membrane Biology Shriners Hospitals for Children Northern California Tufts–USDA Human Nutrition Research Center on Aging Department of Cell Biology & Human Anatomy The authors declare no competing interests Nature Communications thanks Richard Finnell and the other reviewer(s) for their contribution to the peer review of this work Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations Download citation DOI: https://doi.org/10.1038/s41467-024-45775-1 Anyone you share the following link with will be able to read this content: a shareable link is not currently available for this article Sign up for the Nature Briefing newsletter — what matters in science Bine Prepelič started his career in Slovenska Bistrica where he spent practically the entire period of the younger age categories and for the member team of Bistrica he also played in the 3 This was followed by a move to Kansai Helios Domžale with whom he also signed his first professional contract in 2019 He spent a short period as a loan player of the Domžale team in Ljubljana’s Ilirija in the 2 and then gained experience in the Helios jersey in the NLB League ABA 2 and the Slovenian national championship In his final season in the second regional league averaging 28.4 minutes on the floor while averaging 6.8 points and 8.1 rebounds per game where he played in 29 games in the 2023/24 season He made his debut in the jersey of the Slovenian men’s national team in the qualifiers for the 2023 World Cup and with good performances he also earned a place in the national team that played in the 2023 World Cup He played in eight games in the competition Prepelič also played in two qualifying matches for EuroBasket 2025 and in the summer he was also included in the list of candidates for the Olympic qualifying tournament in Piraeus otherwise a cousin of the Slovenian national team and former Cedevita Olimpija player Klemno Prepelič was a member of the U18 national team in 2018 which won second place in Skopje at the European Championship of Division B and in 2019 he was with the U18 national team at the European Championship of Division A won third place in Greece he took first place with the Slovenian under-20 national team at the Challenger in Heraklion Your Ads Privacy ChoicesIMDb Serbia’s President Vucic stands at a proud 1.99 m towering over his counterparts in many a group photo welcome Serbian President Aleksandar Vucic (2-R) for a meeting of Balkan leaders at the chancellery in Berlin President Trump might not seem like the tallest but at 1.90 m he is relatively tall compared to other world leaders but that can be put down to his hair more than anything Trump walks out of the White House in Washington Canada’s Prime Minister Trudeau stands at 1.88 m Trudeau arrives for the "family photo" on the first day of the Group of Seven leaders summit in Carbis Bay At 1.85 m Turkey’s president might not be the tallest of the politicians but he is taller than the average Turkish man Erdoğan walks to greet Palestinian counterpart Mahmoud Abbas at the Presidential Palace in Ankara Quite a bit shorter and a tad older than his predecessor U.S Biden arrives at an event marking the 31st anniversary of the Americans with Disabilities Act (ADA) in the Rose Garden of the White House in Washington Britain's Prime Minister doesn’t only represent his country as a politician but also the average height of a U.K Johnson delivers a speech about plans to "level up" the country during his visit to the U.K Battery Industrialisation Centre in Coventry China’s president is taller than his predecessors at 1.75 m Xi walks off the stage during an inauguration ceremony in Macau Putin is seen during a military parade marking Russia's Navy Day Germany’s departing Chancellor Merkel stands at 1.65 m – the average height of a German woman Merkel addresses the media after a virtual "summit of the Berlin process on the western Balkans 2021" in Berlin North Korea’s leader is just a tad shorter than Merkel at 1.63 m In this image released by the country's Korean Central News Agency Kim Jong Un speaks during the fourth-day sitting of the 3rd Plenary Meeting of 8th Central Committee of the Workers' Party of Korea in Pyongyang North Korea in this image released June 18 Irish President Higgins is the shortest active world leader at 1.60 m Duchess of Cambridge walk around the grounds of Aras an Uachtarain with President of Ireland Michael D Higgins and his wife Sabina Coyne in Dublin The former president of Iran tops Higgins by three centimeters Ahmadinejad addresses the U..N General Assembly in New York Here is everything you need to know following the release of her debut album from her height and age to where she's from and her ethnicity Tyla has been making a huge splash in the music scene for the past year thanks to the viral success of Grammy Award winning song 'Water' and her recently-released debut album 'TYLA' which has had a deluxe edition released in October 2024 The South-African born singer started releasing music in 2019 after finishing high school, and shot to fame after her debut single 'Getting Late' went viral on social media. She frequently talks about her heritage as a South African born woman, and has frequently spoken out when criticised about her racial identity and ethnicity from the perspective of a South African where is she originally from and what is her ethnicity Here is everything you need to know about the 'Push 2 Start' singer Tyla Tyla would go to recording studios on the weekend to write and record music in the hopes she could start a career as a singer Tyla has revealed that she is 5'3 after a fan asked her on TikTok how tall she was She used a Nicki Minaj sound to answer the question that she stands at 5'3 (160cm) She is one of five children, and says "Music is in my family and I’ve known since I was a little girl that I wanted to be a singer." Tyla set the record straight on her Instagram stories to double down on how she identifies and cleared up any questions on her race idk where that came from… I’m mixed with black/Zulu Mauritian/Indian and Coloured" Tyla said on her stories "In Southa I would be classified as a Coloured woman and other places I would be classified as a black women Race is classified differently in different parts of the world.I don’t expect to be identified as Coloured outside of Southa by anyone not comfortable doing so because i understand the weight of that word outside of SA South Africa to her parents Sharleen and Sherwin Seethall She references her hometown of Johannesburg frequently in her music: "They never had a pretty girl from Jo'burg" / "From Jozi to Ibiza." Tyla has said numerous times that her dream is to become the first global pop star from Africa and the fact that all of that managed to translate overseas is crazy It’s opening more doors for other South African artists and creatives to just have a place,” she tells Billboard I always wanted to be the biggest pop star in general I didn’t want to be the biggest African pop star I just want to be the biggest pop star that was born and raised in Africa "And the fact that I’m already getting a good response from the world [means] I’m one step closer to that dream.”And the fact that I’m already getting a good response from the world [means] I’m one step closer to that dream.” Tyla reacts to 'Water' going viral dance challenges & the biggest celebs in her DMs💿 See more Latest Music News Tickets Đorđe Adžić came to Ljubljana after spending many years on the bench of the German Euroleague team Bayern Basketball and before that he was part of the coaching staff in Anadolu Efes where he worked together with the legendary Dušan Ivković and spent part of his career as a scout for NBA teams He was part of the professional staffs of the junior national team selections of the Serbian national teams among them was the team that won the silver medal at the world championship in the Czech Republic with Nikola Jokić and Vasilije Micić Slovenian basketball fans also had the opportunity to watch him on the bench of the Serbian national team at the EuroBasket in Slovenia Gran Canaria and in the previous season the French Élan Chalon The 29-year-old from Postojna played with Bamberg in the Euroleague between 2015 and 2018 ten of which he started in the starting five of his team 1.4 assists and 0.7 rebounds per game in just over 10 minutes he spent on the floor he played a total of 27 games with Partizan and Brescia 3.1 assists and 1.9 rebounds per faceoff in just over 20 minutes of play Nikolić also competed with Burgos and Sassari in the Basketball Champions League He averaged 6.2 points and 3.5 assists for Burgos and 7.3 points and 3.0 assists per game for Sassari Nikolić won the title of Italian Cup champion from 2023 and German Cup champion from 2017 we have been able to follow him in the jersey of the national team at two world championships (2014 2023) and two European championships (2017 2022) and at the 2021 Olympic Games in Tokyo He was part of the national team in all the qualifiers for major competitions in recent years He played in eight games at the 2014 World Cup and averaged 8.3 points He is part of the Slovenian national team from the age category up to the age of 16 and he achieved his greatest success with the Slovenian men’s national team in 2017 when together with the rest of the members of the Golden National Team The experienced Montenegrin expert Zvezdan Mitrović who last coached Galatasaray he won the EuroCup championship with Monaco and he also won national championship titles of France and Ukraine He won the title of French national champion in 2019 with Asvel and the title of Ukrainian national champion in 2009 with Krivbas he was the Head Coach of the Montenegrin men’s national team and basketball fans in Slovenia could also watch him on the Montenegro bench at EuroBasket 2013 Mitrović started his coaching career in 1992 on the bench of Pikadili and in 1995 he moved to Budućnost as assistant coach and in 2001 he returned to Podgorica as head coach Between 2002 and 2007 and in the 2012/12 season and then in 2015 he sat on the Monaco bench for the first time where he remained in the first period until 2018 He managed Galatasaray in the 2023/24 season until the end of January 2024 wore the jersey of the Sioux Falls Skyforce and Austin Spurs he averaged 14.4 points in 14 games of the regular season he appeared in 38 regular season games for the Skyforce where he wore the jersey of the Marineros team and in five games spent an average of 21.8 minutes on the floor per game and spent a little more than 29 minutes on the court He played in 27 games in the regional league 2.1 assists and 1.6 steals in 25.5 minutes we had the opportunity to follow him in the NBA Summer League where he wore the Washington Wizards jersey He played in four games and averaged 17.0 minutes on the floor The height of celebrities often piques public interest, and Bianca Censori is no exception. As the reported wife of the renowned artist Kanye West especially when comparing her height to that of her husband Let's delve into the details of Bianca Censori's height and dispel some myths surrounding it During one of Bianca and Kanye's outings at the Nobu restaurant keen observers noted the footwear choices of the couple Even though both types of footwear might have heels that could potentially elevate one's height This observation further solidifies that her height is 164 cm or 5ft 4 inches the height comparison doesn't end with just Bianca who was married to Kanye from 2014 to 2022 stands at a height of 158 cm or 5 feet 2 inches which is below the average height as per American standards her height has been a subject of much speculation she stands at a height of 158 cm or 5 feet 2 inches It's essential to approach such topics with accurate information ensuring that myths and misconceptions are dispelled Romania’s Social Democratic Party (PSD) has proposed Paul Stanescu to replace Sevil Shhaideh as development minister and deputy prime minister in the Mihai Tudose cabinet He will manage the ministry with the largest budget in Romania which distributes money from the national budget to city halls and county councils Stanescu, the head of PSD Olt, is one of the party leaders with great influence in the party, reports local Hotnews.ro He was the president of the Olt County Council for eight years Stanescu also managed to squeeze his brother on the parliamentary lists who was an elementary school teacher in the village of Visina His father was mayor in Visina until he was 75 Paul Stanescu is considered one of the most powerful local leaders in PSD with a major influence at the central level his relationship with the party leader has cooled in recent months Romania’s ruling party names three new ministers Business Insider SRL is a carrier of data with personal character registered in the “Registrul de Evidenta a Prelucrarilor de Date cu Caracter Personal” with the no Romania-Insider.com is a trademark registered with the help of NOMENIUS and all exclusivity rights are reserved to the owner of Business Insider SRL Any unauthorized use will be sanctioned according to the provisions of trademarks law 84/1998 young Glas wore the jersey of Sixt and Koper Primorska He showed his best performances in the Dynamic jersey 4.2 rebounds and 2.9 assists per faceoff in the 2020/21 season Glas has always been a part of Slovenia’s national teams of younger age categories and in 2021 he showed his best performances at the Challenger for national teams under the age of 20 Glas started the 2022/23 season in Partizan Belgrade signed a contract with Cedevita Olimpija in early January 2023 and was then loaned to Montenegrin Mornar from Bar 2.2 rebounds and 2.5 assists per game in the 2022/23 AdmiralBet ABA League Gregor also excelled in the 2023 World Cup qualifiers 1.8 rebounds and 0.2 assists per game in five games Žiga Daneu has been part of the structure of Cedevita Olimpija since his early youth His grandfather is the legendary Ivo Daneu left their mark on the Ljubljana club and Slovenian basketball Žiga Daneu tasted the pleasure of playing in the strongest Slovenian basketball competition for the first time in his career and in five games he spent an average of just over 16 minutes on the floor SKL in the jersey of the Cedevita Olimpija mladi where he averaged 21.4 points per game in 16 games and in the Nova KBM League in the Cedevita Olimpija jersey for which he played in eight games and averaged 9.8 points and 3.8 rebounds in just over 20 minutes on the floor Žiga also got a taste of playing in the EuroCup for the first time where he played against Umana Reyer at home but he failed to score in the two minutes of the game Daneu spent the 2022/23 season in Ljubljana’s Ilirija as a loan player from Cedevita Olimpija He played in 28 matches of the Slovenian national championship and spent an average of just over 22 minutes on the court Daneu wore the jersey of Kansai Helios Domžale with whom he also played in the final of the national championship He appeared in 32 games of the Slovenian national championship and in the 19.9 minutes he spent on the floor he also played in 12 games of the NLB Liga ABA 2 spending an average of 10.5 minutes on the floor and scoring 2.5 points and 2.0 rebounds per game Rok Radović signed his first professional contract with Zagreb’s Cedevita and before that Radović had trained in the younger categories of the Zagreb club The young Slovenian basketball player moved to the Croatian capital in 2016 and spent part of his career in the Domžale Helios Suns the 200-centimeter-tall defender played in two ABA Youth League tournaments 3.7 assists and 3.3 rebounds in three games we could see Radović in the Cedevita Olimpija jersey in one match He played in 15 matches in the Slovenian national championship and averaged 6.4 points he played in six games and recorded 1.7 points he stepped on the floor in six games and scored 1.0 points Rok spent the 2021/22 season in Cedevita Junior as the player on loan from Cedevita Olimpija Radović returned to Ljubljana and became a regular in Cedevita Olimpija’s game He played in 24 games in the AdmiralBet ABA League spent an average of 13.5 minutes on the floor per game He appeared in 13 games in the 7DAYS EuroCup scoring 5.0 points and 2.8 rebounds per game Radović was the best individual of the Slovenian cadet national team at the European Championships in 2017 He has worn the Slovenian jersey in three European competitions so far but Radović is certainly considered the future Radović also presented himself at the Jordan Brand Classic match and a year later at the match of the same name in Barcelona With the Slovenian national team under the age of 20 Radović became the winner of the U20 national team tournament in Heraklion 8.8 rebounds and 1.4 assists per game in five games Jaka Blažič started his professional sports career in 2007 in the jersey of Triglav from Carniola and after two years of playing for the Gorenjska team he went to Ljubljana for the first time and wore the jersey of Slovan in 2009 and then in 2011 he transferred to the then Union Olimpija The path then led him to Crvena Zvezda Belgrade and before the start of the 2019/20 season he returned to Cedevita Olimpija and played in 21 matches in the regional competition in the 2019/20 competitive season 4.0 rebounds and 2.4 assists per game in 27.5 minutes He was named the round’s most valuable player of the regular season of the ABA League three times and with this achievement he became the only basketball player who performed on the regional scene in the prematurely ended 2019/20 season Blažič was selected as the most valuable player of the month in the regional league in November Jaka was also selected in the First Team of the regional competition for the 2020/21 season and at the same time he was part of the Second Team of the 7DAYS EuroCup competition Blažič also concluded the European Cup as the top scorer in the 2020/21 competitive season the last one that Blažič spent at Cedevita Olimpija 4.8 rebounds and 3.6 assists per game in the 7DAYS EuroCup and recorded 14.1 points in the regional league Blažič was selected in the second five in the European Cup and in the regional league he was selected in the Ideal Five for the second season in a row Blažič moved to the Turkish team Bahçeşehir Koleji where he played in 11 games of the Champions League this season averaging 5.5 points and 1.9 rebounds per game Jaka is also a permanent member of the Slovenian men’s national team with which he won the title of European champion in 2017 and in 2021 he won fourth place at the Olympic Games in Tokyo he played in seven games and averaged 10.1 points and at EuroBasket 2022 he also appeared in seven games Please sign in with your Snow-Forecast account details below Create a free account to receive instant Snow-Alerts and save your favourite resorts on your personal MySnow page Popova Sapka Weather (Next 3 days): The snow forecast for Popova Sapka is: Moderate rain (total 17.0mm) Mild temperatures (max 8°C on Tue morning Popova Sapka Weather (Days 4-6): Mild with moderate rain (total 19.0mm) on Fri afternoon Becoming colder with a light covering of snow Freeze-thaw conditions (max 5°C on Fri morning Mild with moderate rain (total 19.0mm) on Fri afternoon Several North American ski areas that are still open plan to celebrate the unofficial Star Wars Day tomorrow The above table gives the weather forecast for Popova Sapka at the specific elevation of 2035 m. Our sophisticated weather models allow us to provide snow forecasts for the top, middle and bottom ski stations of Popova Sapka. To access the weather forecasts for the other elevations, use the tab navigation above the table. For a wider view of the weather, check out the Weather Map of Rep. of N. Macedonia Click here to read further information on freezing levels and how we forecast our temperatures Overall 3.7 Based on 36 votes and 15 reviews Overall: 3.7 Based on 36 votes and 14 reviews Read 14 more reviews of Popova Sapka or submit your own View detailed snow forecast for Popova Sapka at:snow-forecast.com The Bansko snow report is: out of 14 Lifts open Our Snow Report for Bansko brings daily updates on the snow conditions, snow depths, piste and offpiste conditions and the number of open ski lifts. The latest Bansko snow report shown below was updated on 14 Apr 2025. Snow Reports are provided regularly throughout the ski season courtesy of our own network of ski resort managers and Skiresort Service International GmbH In addition to the current report on ski conditions we also provide webcams (including a 4 week cam archive) current live observations from nearby weather stations and also historical snow data for Bansko ):Last 7 daysThis monthThis season0Bluebird Powder days0Powder days3Bluebird daysBansko Last 3 days snowfall mapSnow Radar Latest snow reports near Bansko: Recorded snow depths for the upper and lower slopes in Bansko 2024 - 2025 The long term average for the upper slopes is also shown for comparison Find the best conditions for skiing and snowboarding near Bansko using our Snowfinder page. Last Updated on29 March, 2024 | 9:44 AM EDT Petar Celik is a legendary bodybuilder from Serbia. Celik is revered as one of the pioneers of the Serbian bodybuilding scene. He is credited for spreading awareness about bodybuilding in Eastern Europe and erstwhile Yugoslavia by being a successful competitor, entrepreneur, author, publisher, and president of several bodybuilding federations. This is his complete profile, biography, competition history, and statistics. A post shared by Petar Čelik (@petarcelikfitness) Petar Celik was born on December 25, 1949, in Belgrade, former Yugoslavia. His family moved to Backa Palanka when he was young where he completed his high school education. Celik started learning music after school and eventually turned towards bodybuilding. Level Up Your Fitness: Join our 💪 strong community in Fitness Volt Newsletter. Get daily inspiration, expert-backed workouts, nutrition tips, the latest in strength sports, and the support you need to reach your goals. Subscribe for free! Expect expert-backed workouts, nutrition advice, the latest in strength sports, and a whole lot of motivation heading your way. In Yugoslavia, bodybuilding had no recognition as a sport or there was no way one could make a living or a good career as a bodybuilder. As a result, there was no guidance, study material, or books that were available in the country that could help someone get started in bodybuilding. However, one of Celik’s friends, who was of German descent, received bodybuilding and fitness magazines from West Germany. This served as the only study material that Celik could use to learn and understand bodybuilding. “Of course, that wasn’t enough, but it was “something.” Along with that, I watched foreign movies like Hercules with American actor Steve Reeves in the main role and Reg Park too. They had developed bodybuilding figures which inspired us here.” Celik used these modest means to start his bodybuilding journey and worked hard to achieve the physique he desired. According to him, Steve Reeves’ physique was something he looked up to while growing up. But with time, Celik was more interested in building a physique like Frank Zane and Arnold Schwarzenegger. With time, Celik gained more knowledge and realized that he could not blindly try to achieve a physique that looked like someone else’s. He decided to follow his path and understand his body better to know what he could achieve with it. By 1969, Celik had dedicated his life to bodybuilding and traveled to Germany to become a certified trainer. This helped Celik advance in his career. Petar Celik started the first bodybuilding federation in Yugoslavia in 1971, which contributed tremendously to the growth of the sport in the region. He is also credited for opening a gym in Blanca Palanka, which was the first of its kind in Yugoslavia. In 1972, Celik started publishing the Herkules magazine, which was Yugoslavia’s first magazine for health and fitness. The magazine steadily grew in popularity over the years and started selling as many as 57,000 copies. The magazine has sold over 700,000 copies and is in circulation with the Republic of Macedonia today. Petar Celik made huge progress in the fitness industry in the following years and also started a factory that made protein supplements. This was happening at the same time when his bodybuilding career was also shaping up. A post shared by Petar Čelik (@petarcelikfitness) Petar Celik started competing fairly early and won his first bodybuilding competition when he took home the 1975 Yugoslavian Championships trophy. The following year, he won the 1976 Slovenian championships. Celik was the most successful and the most popular bodybuilder in Yugoslavia at the time, a country where the sport was still in its nascent stages. In 1980, Celik captured the Serbian Championships and also the DBBV European Championships organized by the German Bodybuilding and Fitness Association. Petar Celik won the competition in the middleweight division and also became the overall winner. In doing so, he defeated the likes of two-time European champion Janko Rudman and 1978 NABBA Mr. Universe Salvador Ruiz. Celik regards this as the biggest and most valuable victory of his career because of the competition he defeated. A post shared by Petar Čelik (@petarcelikfitness) In 2003, Petar Celik won the first of his 10 World Championships and continued to dominate the scene for the next decade. He retired from competition after winning the 2012 IFBB World Championships in the 60+ category. Throughout his career, Petar Celik won the Mr. Yugoslavia competition in all the bodybuilding federations active in the erstwhile nation at the time. One of the most prominent bodybuilders to come out of Serbia, Celik believes that there have been instances of prejudice against Eastern European bodybuilders in the Western bodybuilding scene. However, he also believes that if you are better than the competition, no one can deny you success if you stay committed to your craft. “The one who is persistent and doesn’t give up after the first few losses, that person will have a successful career over time. Of course, for that, you need enough years of appearances at competitions.” Apart from being a competitive bodybuilder, Celik played a major role in running the bodybuilding federation in Yugoslavia. He was the IFBB and NABBA President for Yugoslavia and organized the 1984 NABBA Mr. World competition in Belgrade. Petar Celik also served as the President of the Federation for Weightlifting of Yugoslavia and as a delegate in the Olympic Committee of Yugoslavia. After reducing his activity level in competitions, Petar Celik became an associate professor of bodybuilding at the Higher School for Sports Coaches in Belgrade, Serbia. A post shared by Petar Čelik (@petarcelikfitness) Petar Celik has always maintained a stance that bodybuilding, physical activity, and involvement in sports are not just a matter of personal well-being but an issue of national interest. Celik believes that everyone needs to participate in physical activities, be it as a part of the job or an activity for fitness purposes. Despite crossing on the wrong side of 70, Petar Celik maintains a hardcore training routine and his muscular physique stands testimony to that. Speaking about the secret of his good health in the 70s, Celik once said: “The secret to my fit physique is that I do not just prepare for a competition. I am always in shape, and I focus more on my diet before a competition. Also, I always pay attention to my line and never stop training.” A post shared by Petar Čelik (@petarcelikfitness) Petar Celik firmly believes that 80 percent of the success in bodybuilding depends upon what and how you eat. While many bodybuilders and fitness enthusiasts tend to believe that training hard will nullify all the negative aspects of their dietary practices, Celik cautions that it is a big mistake and that building a great physique without a proper diet is next to impossible. According to Celik, understanding diet from the point of view of performance as well as long-term health is equally important. If performance is the sole focus, it could yield negative results in the long run when you start getting older. Celik has always been critical of steroids and other substances used in the bodybuilding world today. He claims that PEDs are a particularly Western phenomenon where the means of reaching the goal are not valued: “They say about Americans that in the first half of their life they sell their health for money then, if they succeed in that, in the second half of their life they want to buy their health back with that money. But it doesn’t work. Health is to be taken care of while you still have it and sports should contribute to that and not harm your health.” Celik relies on an organic, whole-food diet for nutrition and stays away from chemically loaded and ultra-processed foods. He believes that human beings have been disconnected from nature as civilization has advanced and thinks that following a healthy and natural diet is the first and most important step to reconnecting with nature. Petar Celik has five children. He coaches in the local health institute in Backa Palanka and works as an associate professor at the University of Belgrade. Celik is still active in the competitive bodybuilding sphere today and helps young bodybuilders prepare for bodybuilding shows. A post shared by Petar Čelik (@petarcelikfitness) Petar Celik’s life story shows that even a single individual can make a significant impact on history Not only did Celik become a popular and successful bodybuilder but he created opportunities and an environment for younger generations to be able to pursue bodybuilding and fitness His contribution to the sport goes far beyond the trophies or titles he won If you have any questions or need further clarification about this article, please leave a comment below and Ash will get back to you as soon as possible Δdocument.getElementById( "ak_js_1" ).setAttribute( "value" At Fitness Volt, our mission is to empower every individual on their fitness journey by providing expert advice, the latest research, and comprehensive resources. Whether you are a beginner or an elite athlete, we are here to support your goals with trustworthy and up-to-date information in strength, fitness, and nutrition. Read more Email: [email protected] About Us | Careers | Contact Form ' + scriptOptions._localizedStrings.webview_notification_text + ' " + scriptOptions._localizedStrings.redirect_overlay_title + " " + scriptOptions._localizedStrings.redirect_overlay_text + " Anna Maria Sieklucka is best known to people as Laura from the multi-lingual Netflix drama 365 Days The actress has been in theatre for a while and has honed her acting skills Her talent has earned her a significant social media following from different parts of the world PAY ATTENTION: Click “See First” under the “Following” tab to see Legit.ng News on your Facebook News Feed! The actress posing for pictures in elegant outfits. Photo: @anna_maria.sieklucka (modified by author)Source: InstagramAnna Maria Sieklucka has worked with renowned directors such as Barbara Bialowas and Tomasz Mandes. She has also collaborated with top actors from her home country and beyond. Read on to discover more about her age, height, career, and relationship. Read also Anna Maria Sieklucka is a talented actress PAY ATTENTION: Follow us on Instagram - get the most important news directly in your favourite app The actress' father is Jerzy Antoni, and her mother is Joanna. Her father is a practising lawyer. She has one sibling, Piotr. Her family is close-knit, and her parents have encouraged and supported her in pursuing her interests. The actress' nationality is Polish, and her ethnicity is White. Read also She went to the AST National Academy of Theatre Arts She was at the institution's Wrocław-based Faculty of Puppetry and graduated in 2018 she made her debut on the big screen in Poland She featured in an episode of Na dobre i na złe a series that showcased the lives of hospital staff and paramedics Her first film was 365 Days, an erot*c drama film. Initially, she was hesitant to accept the role. She has been in the film and television industry for a short while, and fans hope to see her in more productions in the future. Read also The actress is also a model and social media personality She often posts amazing pictures of herself on social media She uses her accounts to endorse different brands The actress is yet to get married. However, she is in a relationship. Who is Anna Maria Sieklucka dating? She is dating Łukasz Witt-Michałowski Anna Maria Sieklucka's partner is also from Lublin The two first met at AST National Academy of Theatre Arts They were friends for a while before they decided to become a couple There have been speculations that she is in a relationship with co-star Michele Morrone. The two are colleagues and friends with no romantic association in real life. Read also Anna-Maria Sieklucka's height is 5’ 4” or 163 centimetres tall and her weight is about 110 pounds or 50 kilogrammes Her body measurements in inches are 34-24-32 Anna Maria Sieklucka is a talented Polish dancer and actress Her excellent portrayal of various characters has earned her fame and media attention READ ALSO: EJ Johnson's bio: age, height, net worth, and weight loss Legit.ng recently published EJ Johnson's biography. EJ is the son of Magic Johnson a former American retired basketball player His mother is Earletha "Cookie" Kelly He starred in The Rich Kids of Beverly Hills The openly gay television personality considered transitioning after Caitlyn Jenner transitioned