RENEW MEMBERSHIP
Oklahoma Farm Bureau
Preserving and protecting our rural way of life since 1942
Oklahoma County Farm Bureau donated $5,000 to the Regional Food Bank of Oklahoma Friday
to provide meals to Oklahomans facing food insecurity
The donation will be matched dollar-for-dollar
doubling Oklahoma County Farm Bureau’s impact
which will provide 30,000 meals to chronically hungry children
families who are struggling to make ends meet and also seniors living on fixed incomes,” said Andrew Shepard
development officer with the regional food bank of Oklahoma
“This will be a huge help to our Oklahoma communities and all 53 counties that we’re all part of.”
“We have been given so much and blessed so much ourselves
and we appreciate the ability to give back,” said Bruce Wilson
Copyright © 2025 Oklahoma Farm Bureau
After four years of playing college basketball at UC Davis
after going undrafted in the 2017 NBA Draft
made his first appearance in European basketball in the 2017/18 season
which he started with Nancy and finished with Caen
and in the 2020/21 season he wore the jerseys of Gaziantep and Reggiana
He joined AEK in February 2023 and joined Hapoel Jerusalem last summer
he played in 13 regular season games in the Israeli league and averaged 11.2 points
Lemar has experience playing in international competitions
having played in the FIBA Europe Cup and the Basketball Champions League
he played in six games in the AEK jersey and recorded 15.7 points
while in the Hapoel Jerusalem jersey he averaged 7.7 points
the Duluth East track team was having a relaxed practice at Ordean Stadium
Senior Leif Ziring was trying to fine-tune his pole vault with a couple other Greyhounds athletes ahead of the Section 7AAA meet Wednesday in Forest Lake
Coach Tim Visina set the practice bar to what Ziring thought was 13 feet
4 inches — the height required to automatically qualify for the state meet
Ziring easily cleared the rubber band practice bar and as he got up
It’s a trick Visina has pulled with some regularity on the Greyhound vaulters
but it typically helps with confidence when they get to meets
Ziring took the Duluth East school record by more than 18 inches at the Matt Kero Invitational May 12 at Public School Stadium and was fourth in Class AAA in 2022
when Ziring got to the Section 7AAA preliminaries Wednesday at Forest Lake High School
failing to advance to Friday’s finals or the state meet next week at St
wet spring limited the outdoor practice time for track teams across northern Minnesota and left a number of them playing catchup all season
Ziring had already broken the Greyhound record as a junior
but was able to do it again with a top height at PSS of 14-3
The East senior said the complexity of pole vault is what initially attracted him to the sport a few years ago
“It’s like you’re competing against yourself every time
“It’s like a puzzle you’re trying to work out — what can I do a bit better to get just a little bit higher.”
has “a tendency to do stuff that’s dangerous,” like hanging off a train bridge or any number of crazy jumps
but his mother — Sarah Ziring — knows her son has plenty of “self-preservation.”
“He’s always been very calculated in what he tries,” Sarah said
“When he was just a tiny kid he would practice something over and over until he could get it right
I don’t think he really takes risks unless he knows that he can be successful at it
He’s not the kid that jumps without looking.”
this year he also qualified for the state meet as a diver
which he found more intimidating than pole vault
“That was much scarier than pole vaulting,” he said
“I was improving really fast and my coach was trying to push me and he told me to do a triple
I over-rotated and landed on my face and I had to get checked for a concussion
After that I finished strong — it was a fun season and I met a lot of good guys.”
The Section 7AAA track meet didn’t go how Ziring envisioned it
but he will have more chances to improve and get higher when he competes next season at Wisconsin-Stout
Please select what you would like included for printing:
Copy the text below and then paste that into your favorite email application
Enter your phone number above to have directions sent via text
This site is protected by reCAPTCHA and the Google Privacy Policy and Terms of Service apply
Service map data © OpenStreetMap contributors
Metrics details
Folate supplementation reduces the occurrence of neural tube defects (NTDs)
birth defects consisting in the failure of the neural tube to form and close
The mechanisms underlying NTDs and their prevention by folate remain unclear
Here we show that folate receptor 1 (FOLR1) is necessary for the formation of neural tube-like structures in human-cell derived neural organoids
FOLR1 knockdown in neural organoids and in Xenopus laevis embryos leads to NTDs that are rescued by pteroate
a folate precursor that is unable to participate in metabolism
We demonstrate that FOLR1 interacts with and opposes the function of CD2-associated protein
molecule essential for apical endocytosis and turnover of C-cadherin in neural plate cells
suggesting that folate and FOLR1 signal intracellularly to regulate neural plate folding
This study identifies a mechanism of action of folate distinct from its vitamin function during neural tube formation
The molecular mechanisms by which FOLR1 regulates neural plate cell apical constriction and whether this function is conserved across species have remained unanswered
Here we show that folate/FOLR1 regulate neural tube formation in human-induced pluripotent stem cell (hiPSC)-based neural organoids and in Xenopus laevis embryos by controlling cadherin turnover in the apical adherens junctions
FOLR1 signals in neural plate cells to counteract the action of FOLR1-interacting protein CD2AP
which is necessary for endocytosis and cadherin trafficking from neural plate cell adherens junctions during apical constriction
Neural organoids were generated from human induced pluripotent stem cells (hiPSCs)
After 18–21-days in vitro neural organoids were fixed
sliced and processed for immunostaining and nuclear labeling
a FOLR1 localizes to the apical surface of neural cells surrounding the neural tube-like structure lumen
Similar pattern of localization was observed in n = 15 neural organoids from N = 3 independent experiments
b–d hiPSC-derived embryoid bodies were incubated with 2 μM control-vivo-morpholino (Control)
FOLR1-vivo morpholino (FOLR1 knockdown (KD)
FOLR1-MO) or FOLR1-MO and 50 μM pteroate (FOLR1 KD + pteroate) until 18–21 days in vitro
b Examples of immunostained neural organoids in control and experimental groups
Graph shows individual and mean ± SD number of neural tube-like structures per 10 μm-thick organoid section
respectively from N = 3 independent experiments
d Examples of immunostained neural tube-like structures
c Yellow lines indicate distance from lumen border to first layer of nuclei
Graph shows individual and mean ± SD lumen-nuclei distance per neural tube-like structure
d α-catenin immunostaining was used to define cellular contour and measure circularity index
Dashed outlined boxes correspond to zoomed-in images
Graph shows individual and mean ± SD circularity index (1: perfect circle; 0: elongated polygon) per neural tube-like structure
n = 6 neural tubes per group in N = 3 independent experiments
e Cultured hiPSCs reaching 75% confluency were transfected with FOLR1-sgRNA/CRISPR/Cas9 (FOLR1 KO) and used for neural organoid cultures
Cultures were supplemented with vehicle or 50 μM pteroate (FOLR1 KO + pteroate) until 18–21 days in vitro
Shown are examples of immunostained neural organoids in control and experimental groups
Source data are provided as a Source Data file
These results demonstrate that FOLR1 is necessary for the formation of human cell-derived neural tubes and suggest that folates act through FOLR1 to rescue neural tube morphogenesis by a non-metabolic mechanism
Two-cell stage Xenopus laevis embryos were microinjected with 3.2 (a
c) or 5.2 (b) pmol Control-MO (Control) or FOLR1-MO (FOLR1 KD) per embryo and incubated with saline or 50 μM pteroate until the neural tube closed in control embryos
sectioned and processed for immunostaining (c)
Arrowheads indicate open neural tube (neural tube defect
Bar graphs represent proportion of phenotypes in each group
c Examples of immunostained transverse sections of the neural tissue; n of embryos sectioned was 25
Graph shows distribution of neural tissue defect score per group
Tukey post-hoc multiple comparison test (a
all suggestive of deficient cell-cell adhesion
FOLR1 may enable cell-cell adhesion during neural tube morphogenesis
a hiPSC-derived embryoid bodies were incubated with 2 μM control-vivo-morpholino (Control)
FOLR1-MO) or FOLR1-MO and 50 μM pteroate (FOLR1 KD + pteroate) until 18–21 days in vitro when neural organoids were fixed and processed for immunostaining and nuclear labeling with DAPI
b Cultured hiPSCs reaching 75% confluency were transfected with FOLR1-sgRNA/CRISPR/Cas9 (FOLR1 KO) and used for neural organoid cultures
Cultures were supplemented with vehicle (Control) or 50 μM pteroate (FOLR1 KO + pteroate) until 18–21 days in vitro when neural organoids were fixed and processed for immunostaining and nuclear labeling with DAPI
b Images are examples of immunostained neural tube-like structures
Graphs show individual and mean ± SD maximum percent change in cadherin immunolabeling fluorescence intensity when crossing the lumen per neural tube-like structure
n = 9 (a) and n = 12 (b) neural organoids per group
Images are maximum intensity projection of single time frame
Dashed lines indicate border between wild-type (WT) and MO-injected neural plate
Insets show neural plate injected side with tracer in blue
Graphs show distribution between both halves of the neural plate (in %) of the number of EEA1-GFP vesicles and area fraction of labeled endosomes per neural plate cell surface
Two-tailed paired t-test; ns: not significant
These findings suggest that surplus apical endocytosis in FOLR1-deficient neural tissue may cause excessive removal of C-cadherin from apicolateral adherens junctions and promote its degradation
Two-cell stage Xenopus laevis embryos were bilaterally microinjected with 1.6 pmol Control-MO (Control) or FOLR1-MO (FOLR1 KD) per blastomere
incubated from early neural plate stage (stage 12) with vehicle or proteasome and lysosome inhibitors until they reached mid-neural plate stages (stage 16–17) when neural plates were dissected and processed for Western blot (a
a Example of Western blot assay immunoprobed for C-cadherin showing full-length and cleaved (~80 kD) forms
Graph shows individual and mean ± SD percent of optical density (OD) for cleaved C-cadherin band normalized with GAPDH protein band OD and compared to controls
n = 20 and 26 neural plates for Control and FOLR1 KD groups respectively
b Example of immunoprecipitation (IP) assay for C-cadherin followed by Western blot assay for ubiquitin and C-cadherin
Graph shows individual and mean ± SD percent of optical density (OD) for ubiquitinated (Ubiq) C-cadherin band normalized with full-length C-cadherin and compared to controls
n = 16 and 24 neural plates for Control and FOLR1 KD groups respectively
These data suggest that FOLR1 negatively regulates endocytosis and C-cadherin degradative trafficking to preserve adequate levels of cell adherens junction complexes for efficient neural plate cell apical constriction
a Neural plate stage Xenopus laevis embryos were processed for co-immunoprecipitation (IP) assays
Example of Western blot assay from immunoprecipitates with FOLR1 or GFP (control) antibodies and probed for CD2AP or FOLR1
Similar results were observed in N = 3 independent experiments
b Neural plate stage Xenopus laevis embryos were fixed and processed for immunostaining
Images are transverse single z-sections of immunostained neural plate showing apical colocalization of phospho-CD2AP (p-CD2AP) and p-c-Cbl with C-cadherin
c Two-cell stage Xenopus laevis embryos were bilaterally microinjected with 9.9 pmol of Control-morpholino (Control
2.6 pmol CD2AP-MO1 (CD2AP KD1) or 7.4–9.9 pmol CD2AP-MO2 (CD2AP KD2/KD) per blastomere until neural tube closed in control embryos
when they were fixed and photomicrographed
Numbers are embryos presenting closed (green) or open (purple
Bar graph represents proportion of phenotypes in each group
d Two-cell stage Xenopus laevis embryos were unilaterally microinjected with 9.9 pmol Control-MO (Control) and 7.4–9.9 pmol CD2AP-MO2 (CD2AP KD) along with GFP and mCherry mRNA
and allowed to develop until they reached mid-neural plate stages
when they were fixed and processed for immunostaining
Image is a transverse section of the neural plate
Double arrows indicate apical surface length of medial superficial Control (white) and CD2AP KD (magenta) neural plate cells
Graph shows individual and mean ± SD apical length of superficial neural plate cells per embryo
n of cells = 75 in each half of the neural plate
a Two-cell stage Xenopus laevis embryos were bilaterally microinjected with hEEA1-GFP and membrane mCherry mRNAs and unilaterally microinjected with 9.9 pmol CD2AP-MO (CD2AP KD) per blastomere along with fluorescent tracer and allowed to develop until they reached early neural plate stages (stage 13-14)
when they were time-lapse imaged with an acquisition rate of 1 frame/6 min
Image is maximum intensity projection of single time frame
Dashed line indicates border between morpholino-injected and wild-type (WT) neural plate
Inset shows neural plate injected side showing tracer in blue
n = 28 cells analyzed in each group from N = 5 embryos per group
b Two-cell stage Xenopus laevis embryos were bilaterally microinjected with 7.4 pmol Control-MO (Control) or CD2AP-MO (CD2AP KD) per blastomere and allowed to grow until they reached mid-neural plate stages (stage 15–17) when neural plate was dissected and processed for Western blot assays
Graph shows individual and mean ± SD percent of optical density (OD) for C-cadherin immunoblot band normalized with GAPDH protein band OD and compared to controls
n = 28 and 24 neural plates for Control and CD2AP KD groups
Two-cell stage Xenopus laevis embryos were microinjected with 14.8 pmol Control-morpholino (MO
b) per embryo and incubated with saline or proteasome and lysosome inhibitors at the end of gastrulation (stage 12) until neural plate stages (stage 17) when they were processed for Western blot assays
Images are examples of Western blot assays
Graphs show individual and mean ± SD percent of optical density (OD) for CD2AP (a) or FOLR1 (b) immunoblot band normalized with GAPDH protein band OD and compared to controls
n = 34 and 42 neural plates for Control and FOLR1 KD
N = 7 independent experiments; n = 20 and 26 neural plates for Control+inhibitors and FOLR1 KD+inhibitors groups
In (b) n = 16 and 20 for Control and CD2AP KD groups
respectively and n = 16 and 18 neural plates for Control+inhibitors and CD2AP KD+inhibitors
Reciprocally, CD2AP KD upregulates FOLR1 protein levels, effect that is abolished in the presence of proteasome and lysosome inhibitors during neural plate folding (Fig. 8b)
This result can be explained by the inhibitory effect of CD2AP KD on apical membrane endocytosis
diminished FOLR1 endocytosis when CD2AP is depleted may halt FOLR1 turnover upregulating FOLR1 protein levels
Altogether these discoveries indicate that FOLR1 regulates CD2AP protein level to achieve a balanced remodeling of the apicolateral cell membrane by regulating the rate of apical endocytosis and adherens junction turnover necessary for adequate and precisely timed neural plate cell apical constriction during neural tube morphogenesis
a–c Neural plate from mid neural plate stage Xenopus laevis embryos was dissected and dissociated cells plated in vitro
cells were loaded with the Ca2+ sensor Fluo4-AM and time-lapse imaged
a Example of 1-h recording of neural plate cell Ca2+ activity
folic acid (c) or vehicle was added to neural plate cells in culture during time-lapse imaging and the Ca2+ response was recorded in the first minute post addition
b Example of acute transient elicited by 100 μM folinic acid
c Graph shows mean ± SEM folinic- or folic acid-responsive neural plate cells compared to total number of cells with spontaneous Ca2+ transients in 30 min recording
d Two-cell stage embryos were bilaterally microinjected with GCaMP6s mRNA and grown until early and mid-neural plate stages when they were time-lapse imaged before and after addition of vehicle or 300 μM folinic acid
Image shows example of embryo with cells exhibiting Ca2+ transients indicated with circles
Graph shows individual and mean ± SD percent change in Ca2+ transient frequency before and after addition of vehicle or folinic acid
e–h Two-cell stage embryos were bilaterally microinjected with GCaMP6s mRNA (e–h) and unilaterally microinjected with 9.9 pmol FOLR1-MO1 (FOLR1 KD1/KD) or 1.6 pmol FOLR1-MO2 (FOLR1 KD2) per blastomere (e) and grown until mid-neural plate stages when they were time-lapse imaged
Image in (e) shows example of embryo with cells exhibiting Ca2+ transients indicated with circles in WT and FOLR1 KD1 halves
Graphs show individual Ca2+ transient frequency (transients/5 min) in WT and FOLR1 KD1 or KD2 halves (e
n = 6 embryos) and in WT embryos before and after addition of vehicle (f
Na+ and voltage-gated Ca2+ channel blockers (VGCblock: 0.02% tricaine+10 μM nitrendipine+25 μM TTA-2
Two-tailed paired t-test (e–g) and 1-way ANOVA-Tukey multiple comparisons test (h)
i Model of FOLR1 and CD2AP regulation of neural tube formation
suggesting that FOLR1 elicits Ca2+ dynamics during neural plate folding
suggesting that folate/FOLR1-dependent Ca2+ dynamics operate through Ca2+ influx
Altogether these finding suggest that folate/FOLR1 recruit rapid signaling mechanisms important for regulating neural plate cell apical constriction and neural tube formation
Here we show that FOLR1 negatively regulates CD2AP function by controlling CD2AP protein degradation during neural plate folding
Identifying the mechanisms by which FOLR1 regulates CD2AP protein turnover demands further investigation
Folate-FOLR1 interaction may recruit a transmembrane signaling partner that in turn regulates CD2AP-Cbl-mediated endocytosis
ubiquitination and turnover of adherens junction molecules
we find that folates trigger acute changes in Ca2+ dynamics in the neural plate
which are also dependent on FOLR1 expression
Folate/FOLR1-dependent Ca2+ dynamics may serve as the link between the regulated removal of apicolateral membrane and the cytoskeletal dynamics necessary for neural plate cell apical constriction during neural plate folding
The precise relationship and timing of folate/FOLR1-dependent Ca2+ signaling and adherens junction remodeling during apical constriction needs to be further investigated
Despite a single Ca2+ transient may be a faster event than the regulation of the endocytic process during apical constriction
the information carried by Ca2+ dynamics in neural cells may be integrated over time and be transduced into regulating apical endocytosis and degradation of adherens junction components
A full understanding of the mechanisms of action of folate and FOLR1 during neural tube formation may contribute to developing effective preventative strategies for NTDs and to identifying potential risk factors
All experimental procedures and research design utilized in this study complied with ethical regulations
The Institutional Animal Care and Use Committee approved the animal protocol #22264 implemented in this study
IACUC follows the guidelines established by the Animal Welfare Act and the Public Health Service Policy on Humane Care and Use of Laboratory Animals
after hiPSC colonies reached 70–80% confluency in feeder independent conditions in mTESR medium (Stem Cell Technology
they were detached with Accutase (Stem Cell Technology
The mixture was triturated to obtain single cells and centrifuged for 3 min at 270 g at 23 °C
prepared as following for 500 ml: 100 ml KnockOut Serum Replacement (Thermofisher
# 11330032) with 50 μM ROCK inhibitor Y27632 (StemCell Technology
Resuspended cells were then plated in 96-well ultra-low attachment plates (9000 cells per well) for formation of embryoid bodies (EBs)
The hESC medium was renewed every other day until EBs reached 600-μm diameter
EBs were transferred into 24-well ultra-low attachment plates and fed every other day with Neural Induction medium: 1% (v/v) N2 supplement
1% (v/v) MEM-NEAA and 1 μg/mL heparin (Stemcell Technology
#7980) in DMEM-F12 until neuroepithelium formation was apparent (usually after 4 days)
EBs were then embedded into 20 μl Matrigel (Corning
# 354230) droplets and transferred into a 60-mm tissue culture plate with 5 ml Cerebral Organoid Differentiation medium without vitamin A
prepared as following for 500 ml: 250 ml Neurobasal medium (Thermofisher
5 ml penicillin-streptomycin (Thermofisher
# 15140122) and 5 ml B27 without vitamin A (Thermofisher
plates with the Matrigel-embedded organoids were transferred into an orbital shaker inside the incubator and fed with Cerebral Organoid Differentiation medium with vitamin A (same as previous but with B27 supplement with vitamin A (Thermofisher
Neural organoids were fixed with 4% paraformaldehyde (PFA) at room temperature for 40 min
dehydrated and embedded in paraffin blocks
blocked with buffer containing 1% bovine serum albumin for 45 min at 23 °C and incubated with primary antibodies: FOLR1
# 13-9700) in blocking buffer overnight at 4 °C
followed by incubation with fluorescently tagged Alexa Fluor secondary antibodies: anti-mouse 647 donkey
# A21206) and anti-goat 596 donkey (Invitrogen
Imaging of 20–25 sections per fluorescently labeled neural organoid was done under a confocal microscope (Nikon A1) through a 1 μm-step z-stack scanning
When hiPSC colonies reached 70–80% confluency
Inc.) or hFOLR1 translation blocking vivo-morpholino
Inc.) was added to the medium and incubated for 48 h
hiPSCs were then dissociated with Accutase solution (Sigma-Aldrich) and centrifuged for 3 min at 288 g to remove enzymatic solution
Cell pellet was resuspended in mTESR medium containing 5 μM ROCK inhibitor and 20 ng/ml bFGF
and then 9000 cells were seeded into Ultra low attachment surface 96-well plates
when FOLR1-MO-treated cultures were incubated either with freshly made 50 μM sodium pteroate or vehicle only
# SC-250800) was dissolved in 0.05 N NaOH by vigorous shaking and solution was shielded from light
Treatments were renewed along with culture medium every other day
hiPSCs at 70% confluency were incubated with 2 μM Control-MO or FOLR1-MO for 48 h
processed as described below for Western blot assays
and immunoblotted with anti-FOLR1 antibody
1:500 in 5% BSA in TBST (Bioworld Technology
# 711-035-152) and ECL2 Western Blotting Substrate (ThermoFisher
Millipore/Sigma) were stripped and reprobed with anti-GAPDH antibody
Approximately 60% confluent hiPSCs were incubated with 1.2 μg targeted synthetic gRNA (AGUUGGGGGAGCACUCGUAG)
6.25 μg Cas9 and Lipofectamine CRISPRMAX Transfection Reagent (TrueCut Cas9 protein v2
To assess efficiency of the KO-CRISPR approach
detection of cleavage was done by the GeneArt Genomic Cleavage Detection Kit (Invitrogen) according to the manufacturer’s guidelines
genomic DNA from transfected hiPSCs was extracted and the sequence of interest was amplified by PCR
smaller size bands indicate indels introduced by Crispr-Cas9
while the largest band represents the WT DNA
Analysis of the gel bands was done by Image Lab software
sequencing of genomic DNA was done to identify the % Indel and KO score
Analysis of the DNA sequences was done by the ICE Analysis online tool (Synthego)
Large field of view images from 20–25 10 μm-thick sections of immunostained and DAPI-labeled neural organoids were used to record
in the section showing the largest extent of the complete organoid
the number of neural tube-like structures per organoid in control and experimental groups
This was based on gross appearance of tubularly-shaped structures and presence of central lumen
Neural organoid images of α-catenin immunostaining (for apical surface staining) and nuclear labeling by DAPI were used to measure the perpendicular distance from the apical surface of the neural tube surrounding the lumen to every nucleus of peri-lumen cells with the line tool in ImageJ software (NIH)
At least 10 neural tube-like structures were measured for each group per experiment and at least 3 experiments were performed
Neural organoid images of α-catenin immunostaining were used to measure the circularity of each peri-lumen cell of neural tube-like structures with the circularity tool in ImageJ software
The score is 1 for a perfect circle and close to 0 for elongated polygons
Neural organoid images of pan-cadherin immunostaining were used to measure the fluorescence intensity profile of cadherin immunostained neural tube-like structures by drawing a linear probe crossing the apical cell surface of the lumen with NIS Elements software (Nikon
The peak values for cadherin fluorescence intensity
that correspond to the apical surface region when apical constriction is apparent
was compared among control and experimental groups by calculating the percent change in cadherin fluorescence intensity when crossing the apical surface
All these measurements were done in at least 10 neural tube-like structures for each group per experiment and at least 3 experiments were performed
Statistical analysis was done with Prism software (Graphpad) by using one-way ANOVA
Animals were handled according to the IACUC guidelines using humane procedures to prevent animal suffering
Two-cell-stage embryos were unilaterally or bilaterally injected with 1.6–3.8 pmol splicing blocking morpholino (MO) complementary to Xenopus laevis folr1 exon-intron junction AAACCTTGGGCCCTGGATCCAGAAGgtaattggaagggggtgatggtgac
FOLR1-MO1 ATCACCCCCTTCCAATTACCTTCTG (FOLR1 KD1/KD) or with 9.9 pmol translation blocking MO (FOLR1 KD2) complementary to Xenopus laevis folr1 mRNA
FOLR1-MO2 GGCCCCCCGTAACATGGTTACAAGC per blastomere
Controls were sibling embryos injected with standard control MO
Control-MO CCTCTTACCTCAGTTACAATTTATA (Control)
Morpholinos were injected along with dextran-Alexa-Fluor conjugates or with GFP or mCherry mRNA to assure permanency of MO reporter after TCA fixation
Rescue experiments were implemented by incubating embryos injected with 1.6 pmol FOLR1-MO1 per blastomere at 2-cell stage (4 h post fertilization (hpf) at 23 oC) with freshly made 50 μM sodium pteroate
FOLR1-MO-injected and control embryos were grown in the solution with pH matched to pteroate-incubated group
Embryos were grown in the dark at 18 oC overnight until stage 13
then transferred in freshly prepared solutions and grown up until early neural tube stages (stage 21
Assessment of FOLR1 splicing blocking MO efficiency was performed by isolating neural plates from 9 stage 16 Xenopus laevis embryos in each group
RNA was extracted with kit according to manufacturer’s instructions (RNeasy Mini Kit
gDNA was eliminated (RapidOut DNA Removal Kit
# 00859896) and cDNA was made (High-Capacity cDNA Reverse Transcription Kit
PCR was performed for Control-MO and FOLR1-MO1 injected embryos with primers located in intron 2 and exon 3 that generates no PCR product from cDNA of mature
spliced folr1 transcript and a 308 bp PCR product when the mRNA is not spliced
Neural tissue defect score was the median score of 3 transverse sections per embryo
Medial neural plate of embryos at stage 14–14.5 were imaged using 60x objective and Z-stack confocal imaging (Sweptfield confocal
Analysis was performed in time-lapse recordings with an acquisition rate of 1 frame/6 min
Number of endosomes and endosome/cell surface fraction were measured in FOLR1 KD
Control and contralateral wild type cells by creating a region of interest outlining cell boundaries and thresholding GFP intensity to at least 2 times over background with 0.4–4 μm size and 0.3–1 circularity limitations using NIS-Elements software (Nikon
Further processing starting with a 2% BSA blocking step was done using SNAP i.d
2.0 System for immunohistochemistry (Millipore)
LAMP1-containing vesicles was done by creating a region of interest outlining cell boundaries in transverse sections of the neural plate and thresholding immunolabeling fluorescence intensities followed by counting stained vesicles in 3 consecutive z-sections (1 μm step) with NIS Elements software (Nikon
Samples were from early neural plate stage (stage14–14.5) embryos for C-cadherin/EEA1/ubiquitin and mid neural plate stage (stage 15) embryos for C-cadherin
At least 3 consecutive sections were analyzed per embryo from 5 embryos for each group
neural plates (2 per sample) were dissected from stage 15–17 Xenopus laevis wild type vehicle-/protein degradation inhibitor cocktail-treated embryos or Control/FOLR1 KD/CD2AP KD embryos in collagenase and snap-frozen in liquid nitrogen and stored frozen at −80oC overnight
Samples were thawed on ice and resuspended in RIPA buffer (1% (v/v) Triton X-100
centrifuged at 16,100 g for 10 min and pellet discarded
10% β-mercaptoethanol) was added to supernatant
Samples were separated on 10% polyacrylamide gels and transferred to PVDF membranes (Millipore/Sigma
Membranes were blocked with 0.5% non-fat milk TBST in SNAP i.d
2.0 Protein Detection System (Millipore/Sigma) for 10 min and incubated with monoclonal anti-C-cadherin antibody
1:100 (Developmental Studies Hybridoma Bank
# 6B6) in 5% non-fat milk TBST overnight at 4 °C on rocking platform
membranes were incubated with HRP-conjugated secondary antibodies
# 515-035-003,) in 0.5% milk TBST for 10 min in SNAP i.d
for Western blot and visualized by ECL2 Western Blotting Substrate
Signal was detected using ChemiDocMP Imaging System
PVDF membranes were stripped in 0.2 M glycine HCL buffer
0.05% Tween for 20 min and re-probed with anti-CD2AP and anti-FOLR1 antibodies
Protein loading was detected using anti-GAPDH antibody
followed by incubation with HRP-conjugated secondary antibody
Jackson ImmunoResearch) and ECL Western Blotting Detection reagent (Millipore/Sigma
Neural plates from 9 mid neural plate stage (stage 16) Xenopus laevis embryos in each group were isolated
# 00859896) and cDNA was made (High Capacity cDNA Reverse Transcription Kit
qPCR was performed with SYBR Green Universal Master Mix (Applied Biosystems
# 2107118) in Stratagene Mx3005 real-time PCR machine
28 cycles of 45 s at 95 °C/30 s at 55 °C/ 30 s at 72 °C
C-cadherin forward primer: TGGTGACAGACGATGGTGTT
C-cadherin reverse primer: GCTGTCAAGTTCAGCCTTCC
ODC forward primer: GTCAATGATGGAGTGTATGGATC
ODC reverse primer: TCCATTCCGCTCTCCTGAGCAC
To determine the level of cleaved and ubiquitinated C-cadherin
stage 12–12.5 Xenopus laevis embryos were incubated with lysosome and proteasome inhibitor cocktail: 100 μM chloroquine (Selleckchem
# BML-CM110-0100) and 10 μM MG-132 (Selleckchem
neural plates (4 per sample) were dissected in collagenase
snap-frozen and stored at −80 oC for up to 2 weeks
Samples were thawed on ice and homogenized in 60 μl of lysis buffer containing 0.5% Sodium n-lauroylsarcosinate
# 7130) and protease inhibitors cocktail (Thermo Scientific
After 10 min samples were diluted 4x with lysis buffer containing 1% Triton X-100
instead of 0.5% Sodium n-lauroylsarcosinate
Supernatants were pre-cleared by incubating with 30 μl of protein G-agarose beads suspension (Roche
# 11719416001) for 3 h at 4 °C on a mini-rotator
A quarter of the pre-cleared lysate was mixed with 4x reducing protein loading buffer (200 mM Tris-HCl
10% β-mercaptoethanol) and incubated at 100 oC for 4 min
Samples were separated on 10% polyacrylamide gels and immunoblotted with anti-C-cadherin 1:100 (Developmental Studies Hybridoma Bank
then reprobed with anti-GAPDH antibody (Sicgen
The rest of the sample was incubated with protein G-agarose beads chemically cross-linked to anti-C-cadherin antibody (Developmental Studies Hybridoma Bank
# 6B6) overnight at 4 °C on a mini-rotator
beads were resuspended in 2X protein loading buffer containing 10 mM DTT and incubated for 10 min at 80 °C
Samples were separated on 10% polyacrylamide gels
immunoblotted with anti-ubiquitin antibody 1:500 in 5% BSA TBST (13-1600
Invitrogen) and reprobed with anti-C-cadherin antibody 1:100 in 5% non-fat milk TBST (Developmental Studies Hybridoma Bank
Fifteen mid-neural plate stage (stage 16) embryos were homogenized in lysis buffer containing 0.5% sodium n-lauroylsarcosinate
Samples were diluted 4x with lysis buffer containing 1% Triton X-100
centrifuged at 16,100 g for 10 min and the pellet was discarded
Supernatants were pre-cleared by incubating with 30 μl of protein G-agarose beads (Roche
# 11719416001) for 3 h at 4 °C on mini-rotator
FOLR1 was immunoprecipitated by overnight incubation of lysates with rabbit anti-Xenopus laevis FOLR1 polyclonal affinity purified antibody raised against the peptide KHQKVDPGPEDDLHC (custom made by GenScript)
chemically cross-linked to protein G-agarose beads at 4 °C on a mini-rotator
# TP401,) or normal rabbit IgG (Cell signaling
# 2729) chemically cross-linked to protein G agarose beads were used as controls
beads were washed 3x with 1% Triton X-100 lysis buffer and resuspended in non-reducing 2X protein loading buffer
A quarter of the sample was reduced by addition of 10 mM DTT and heated at 80 oC for 10 min
run on 10% polyacrylamide gel and immunoblotted for FOLR1
The rest of the non-reduced sample was run for 6 mm in resolving 10% polyacrylamide gels
Digested peptides were analyzed by LC-MS/MS on a Thermo Scientific Q Exactive Plus Orbitrap Mass spectrometer in conjunction Proxeon Easy-nLC II HPLC (Thermo Scientific) and Proxeon nanospray source
The digested peptides were loaded in a 100 μm × 25 mm Magic C18 100 Å 5U reverse phase trap where they were desalted online before being separated using a 75 μm × 150 mm Magic C18 200 Å 3U reverse phase column
Peptides were eluted using a 100 min gradient with a flow rate of 300 nl/min
An MS survey scan was obtained for the m/z range 350–1600
MS/MS spectra were acquired using a top 15 method
where the top 15 ions in the MS spectra were subjected to HCD (High Energy Collisional Dissociation)
An isolation mass window of 1.6 m/z was used for the precursor ion selection
and normalized collision energy of 27% was used for fragmentation
A 20 s duration was used for the dynamic exclusion
Tandem mass spectra were extracted and charge state deconvoluted by Proteome Discoverer (Thermo Scientific)
thegpm.org; version CYCLONE (2013.02.01.1))
Tandem was set up to search the uniprot-Xenopus laevis database (March 2017 version
34096 entries) assuming the digestion enzyme trypsin
Tandem was searched with a fragment ion mass tolerance of 20 PPM and a parent ion tolerance of 20 PPM
Carbamidomethylation of cysteine was specified in X
dioxidation of methionine and tryptophan and acetyl of the n-terminus were specified in X
Charge state deconvolution and deisotoping were not performed
Proteomics experiment of FOLR1 co-IP was replicated 3 times; the proteins of interest were identified in all 3 LC-MS/MS runs
Project Name: FOLR1-interacting proteins in neurulating Xenopus laevis embryos
Reviewer account details: Username: reviewer_pxd048476@ebi.ac.uk
Five stage 20 embryos bilaterally injected with 9.9 pmol CD2AP-MO2 (CD2AP KD) or Control-MO (Control
CD2AP immunoprecipitation (IP) experiments) and 15 stage 16 wild type embryos (FOLR1-CD2AP co-IP experiments) were collected and snap frozen
Samples were prepared as mentioned in previous section
One-tenth of the lysates was separated to assess for protein loading
IP/Western blot antibodies were rabbit anti-Xenopus laevis CD2AP polyclonal affinity purified antibody raised against the peptide CRPKSEVEPHSKTKT custom made by GenScript and anti-Xenopus laevis FOLR1 antibody (GenScript)
protein G agarose beads with immunoprecipitates were resuspended in 2X protein loading buffer containing 10 mM DTT and incubated for 10 min at 80 °C
Samples were separated on 10% polyacrylamide gels and immunoblotted with anti-Xenopus laevis CD2AP antibody
1:500 in 5% non-fat milk TBST followed by HRP-conjugated anti-rabbit secondary antibodies
Membranes were stripped and reprobed for FOLR1 antibody
Protein loading was assessed in lysates with anti-β-tubulin
1:300 (Developmental Studies Hybridoma Bank
# E7) in 5% non-fat milk TBST and FOLR1 antibody in 5% non-fat milk TBST (GenScript)
Anti-GFP antibody or normal rabbit IgG were used as controls in FOLR1-CD2AP co-IP experiments
Two-cell-stage embryos were unilaterally or bilaterally injected with 2.6 pmol translation blocking CD2AP-morpholino 1 (MO1
CD2AP knockdown (KD) 1) TGTCACTCTCCGGCCTCTCGCTT
7.4 – 9.9 pmol translation blocking CD2AP-MO2 (CD2AP KD2) CAATGTATTCCACCATTCTGCTGCT complementary to Xenopus laevis CD2-associated protein (CD2AP) mRNA
or standard control-morpholino (Control-MO
Morpholinos were injected along with dextran-Alexa-Fluor conjugates or with GFP or mCherry mRNA to assure permanency of MO reporter in the injected side after TCA fixation
Stereoscope images of embryos injected with 5.2 pmol CD2AP-MO1 or 14.8–19.8 pmol CD2AP-MO2 or Control-MO were taken when control embryos reached early neural tube stages (stage 20)
Observed phenotypes were categorized in “Closed” or open (“NTDs”) neural tube
5 Xenopus laevis embryos from control-MO- and CD2AP-MO2-injected groups were collected for immunoprecipitation assays to assess CD2AP protein level
Procedures of immunoprecipitation and Western blot assays were as described in previous section
Apical constriction was assessed in stage 16.5 embryos unilaterally injected with 7.4–9.9 pmol of CD2AP-MO2 (CD2AP KD) and Control-MO (Control) in single blastomeres at the 2-cell stage
Measurements were done in 3 consecutive CD2AP KD and 3 paired Control medial neural plate cells in 5 consecutive sections from 4 embryos
Mid-neural plate stage embryos (stage 15) were incubated with 1 mg/ml collagenase and neural plate was dissected
Neural plate cells were then dissociated by incubation with a Ca2+/Mg2+ free saline for 45 min
Cells were then plated in saline solution (in mM: 117NaCl
allowed to attach for 2 h and incubated for 45 min with 1 μM of the cell permeant Ca2+ sensitive dye Fluo4-AM
Cultures were then time-lapse imaged in a Swept-field confocal microscope (Nikon) for up to 1 h at 0.2 Hz acquisition rate
Folic and folinic acid dose-dependent effectiveness in eliciting acute Ca2+ transients in neural plate cells was assessed by addition of 1
300 and 1000 μM folic or folinic acid and compared to addition of vehicle only (0 μM)
The number of Ca2+ transients at different developmental stages in the presence or absence of 300 μM folinic acid or vehicle only
or in the presence of ion channel blockers and folic acid in wild type embryos were measured
and significance was assessed by paired t test or one-way ANOVA followed by Tukey’s multiple comparisons test
To assess the Ca2+ source of folic acid-induced Ca2+ transients GCaMP6s-expressing embryos were live imaged for a maximum of 30 min under a confocal microscope (Nikon A1): first 5 min to record baseline activity
followed by addition of a Na+ and Ca2+ channel blocker cocktail (VGCblock): 0.02% tricaine
L-type voltage-gated Ca2+ channel blocker + 25 μM TTA-2
Rigorous research design and analysis was implemented by running all the controls necessary alongside experimental samples
Analysis of data was performed blindly to the analyzer with the exception of analysis of Western blot assays that results were obtained directly from the developer by the experimenter running the gels who knew the order in which samples were loaded
Number of samples for each experiment was determined by pilot experiments and power analysis
Experiments were replicated at least 3 times
Statistical analysis of the data was done with Prism software (Graphpad
Normality test was performed in each set of data and then parametric (normally distributed) or non-parametric statistical analysis was chosen
Paired tests were implemented in unilaterally manipulated embryos
when compared control and microinjected halves of neural tissue or when Ca2+ activity was compared before and after addition of an agent in the same sample
Number of samples analyzed per group were more than 5
Groups were considered statistically different when p < 0.05
Exact p values are included in the Source Data File for data set
Each statistical test used is indicated in each figure legend for every dataset
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article
B vitamins and one-carbon metabolism: implications in human health and disease
and promoting health equity: an urgent call to action for universal mandatory food fortification with folic acid
Maternal metabolism influences neural tube closure
One-carbon metabolism and folate transporter genes: do they factor prominently in the genetic etiology of neural tube defects
Folate action in nervous system development and disease
Structural basis for recognition and transport of folic acid in mammalian cells
Mechanisms of membrane transport of folates into cells and across epithelia
Upregulation of reduced folate carrier by vitamin D enhances brain folate uptake in mice lacking folate receptor alpha
Emerging roles for folate receptor FOLR1 in signaling and cancer
Nuclear localization of folate receptor alpha: a new role as a transcription factor
Quantitative proteomics identifies FOLR1 to drive sorafenib resistance via activating autophagy in hepatocellular carcinoma cells
Bacterial folates provide an exogenous signal for C
Folate receptor β regulates integrin CD11b/CD18 adhesion of a macrophage subset to collagen
Spatial and temporal expression offolate-binding protein 1 (Fbp1) is closely associated with anterior neural tube closure in mice
Folate receptor 1 is necessary for neural plate cell apical constriction during Xenopus neural tube formation
Mice lacking the folic acid-binding protein Folbp1 are defective in early embryonic development
Shroom induces apical constriction and is required for hingepoint formation during neural tube closure
Actomyosin contractility and microtubules drive apical constriction in Xenopus bottle cells
Shroom regulates epithelial cell shape via the apical positioning of an actomyosin network
Endocytosis is required for efficient apical constriction during Xenopus gastrulation
Neural tube closure requires the endocytic receptor Lrp2 and its functional interaction with intracellular scaffolds
Cerebral organoids model human brain development and microcephaly
A loss-of-function NUAK2 mutation in humans causes anencephaly due to impaired Hippo-YAP signaling
Structural basis for molecular recognition of folic acid by folate receptors
N- and E-cadherins in Xenopus are specifically required in the neural and non-neural ectoderm
for F-actin assembly and morphogenetic movements
Endocytosis is required for E-cadherin redistribution at mature adherens junctions
Endocytosis of cadherin from intracellular junctions is the driving force for cadherin adhesive dimer disassembly
The VE-cadherin cytoplasmic domain undergoes proteolytic processing during endocytosis
A novel adaptor protein orchestrates receptor patterning and cytoskeletal polarity in t-cell contacts
Congenital nephrotic syndrome in mice lacking CD2-associated protein
A cortactin-CD2-associated protein (CD2AP) complex provides a novel link between epidermal growth factor receptor endocytosis and the actin cytoskeleton
CD2-associated protein haploinsufficiency is linked to glomerular disease susceptibility
The endophilin–CIN85–Cbl complex mediates ligand-dependent downregulation of c-Met
Cbl–CIN85–endophilin complex mediates ligand-induced downregulation of EGF receptors
CD2AP regulates SUMOylation of CIN85 in podocytes
Genome evolution in the allotetraploid frog Xenopus laevis
CD2AP/SHIP1 complex positively regulates plasmacytoid dendritic cell receptor signaling by inhibiting the E3 ubiquitin ligase Cbl
CD2AP and Cbl-3/Cbl-c constitute a critical checkpoint in the regulation of ret signal transduction
CD2-associated protein (CD2AP) enhances casitas B lineage lymphoma-3/c (Cbl-3/c)-mediated ret isoform-specific ubiquitination and degradation via its amino-terminal src homology 3 domains
ubiquitinates and induces endocytosis of the E-cadherin complex
Cell-autonomous Ca(2+) flashes elicit pulsed contractions of an apical actin network to drive apical constriction during neural tube closure
NMDA receptor signaling is important for neural tube formation and for preventing antiepileptic drug-induced neural tube defects
Action of papaverine and ionophore A23187 on neurulation
Calcium regulation of neural fold formation: visualization of the actin cytoskeleton in living chick embryos
Suzuki, M. et al. Distinct intracellular Ca2+ dynamics regulate apical constriction and differentially contribute to neural tube closure. Development dev.141952. https://doi.org/10.1242/dev.141952
Disruption of the MacMARCKS gene prevents cranial neural tube closure and results in anencephaly
Calpain2 protease: a new member of the Wnt/Ca2+ pathway modulating convergent extension movements in Xenopus
CD2AP in mouse and human podocytes controls a proteolytic program that regulates cytoskeletal structure and cellular survival
The gastric epithelial progenitor cell niche and differentiation of the zymogenic (chief) cell lineage
Tyrosine phosphorylation of CD2AP affects stability of the slit diaphragm complex
T-type calcium channel regulation of neural tube closure and EphrinA/EPHA expression
Brown, J. M. & García-García, M. J. The secretory pathway calcium ATPase 1 (SPCA1) controls neural tube closure by regulating cytoskeletal dynamics. Development dev.170019. https://doi.org/10.1242/dev.170019
A novel calmodulin–β-PIX interaction and its implication in receptor tyrosine kinase regulation
Oscillations and cell development in Dictyostelium discoideum stimulated by folic acid pulses
Intracellular Ca2+ signals in Dictyostelium chemotaxis are mediated exclusively by Ca2+ influx
Changes in actin associated with the cytoskeleton following chemotactic stimulation of Dictyostelium discoideum
Normal Table of Xenopus Laevis (Daudin): A Systematical and Chronological Survey of the Development from the Fertilized Egg till the End of Metamorphosis
The FYVE domain of early endosome antigen 1 is required for both phosphatidylinositol 3-phosphate and Rab5 binding
In toto imaging of embryogenesis with confocal time-lapse microscopy
Reversing the effects of formalin fixation with citraconic anhydride and heat: a universal antigen retrieval method
A statistical model for identifying proteins by tandem mass spectrometry
The PRIDE database resources in 2022: a hub for mass spectrometry-based proteomics evidences
Ultrasensitive fluorescent proteins for imaging neuronal activity
Activity-dependent homeostatic specification of transmitter expression in embryonic neurons
Interplay between electrical activity and bone morphogenetic protein signaling regulates spinal neuron differentiation
Injury-induced Erk1/2 signaling tissue-specifically interacts with Ca2+ activity and is necessary for regeneration of spinal cord and skeletal muscle
Normal Table of Xenopus development: a new graphical resource
Download references
We thank Andrew Hamilton for comments on the manuscript
This work was supported by: National Science Foundation grant 1754340 (L.N.B.)
National Institutes of Health grants R01NS105886 and R01NS113859 (L.N.B.)
Shriners Hospital for Children grant 85111 (L.N.B.) and grant 84306 (O.A.B.)
Department of Physiology & Membrane Biology
Shriners Hospitals for Children Northern California
Tufts–USDA Human Nutrition Research Center on Aging
Department of Cell Biology & Human Anatomy
The authors declare no competing interests
Nature Communications thanks Richard Finnell and the other
reviewer(s) for their contribution to the peer review of this work
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations
Download citation
DOI: https://doi.org/10.1038/s41467-024-45775-1
Anyone you share the following link with will be able to read this content:
a shareable link is not currently available for this article
Sign up for the Nature Briefing newsletter — what matters in science
Bine Prepelič started his career in Slovenska Bistrica
where he spent practically the entire period of the younger age categories
and for the member team of Bistrica he also played in the 3
This was followed by a move to Kansai Helios Domžale
with whom he also signed his first professional contract in 2019
He spent a short period as a loan player of the Domžale team in Ljubljana’s Ilirija in the 2
and then gained experience in the Helios jersey in the NLB League ABA 2 and the Slovenian national championship
In his final season in the second regional league
averaging 28.4 minutes on the floor while averaging 6.8 points and 8.1 rebounds per game
where he played in 29 games in the 2023/24 season
He made his debut in the jersey of the Slovenian men’s national team in the qualifiers for the 2023 World Cup
and with good performances he also earned a place in the national team that played in the 2023 World Cup
He played in eight games in the competition
Prepelič also played in two qualifying matches for EuroBasket 2025
and in the summer he was also included in the list of candidates for the Olympic qualifying tournament in Piraeus
otherwise a cousin of the Slovenian national team and former Cedevita Olimpija player Klemno Prepelič
was a member of the U18 national team in 2018
which won second place in Skopje at the European Championship of Division B
and in 2019 he was with the U18 national team at the European Championship of Division A won third place in Greece
he took first place with the Slovenian under-20 national team at the Challenger in Heraklion
Your Ads Privacy ChoicesIMDb
Serbia’s President Vucic stands at a proud 1.99 m
towering over his counterparts in many a group photo
welcome Serbian President Aleksandar Vucic (2-R) for a meeting of Balkan leaders at the chancellery in Berlin
President Trump might not seem like the tallest but at 1.90 m he is relatively tall compared to other world leaders
but that can be put down to his hair more than anything
Trump walks out of the White House in Washington
Canada’s Prime Minister Trudeau stands at 1.88 m
Trudeau arrives for the "family photo" on the first day of the Group of Seven leaders summit in Carbis Bay
At 1.85 m Turkey’s president might not be the tallest of the politicians but he is taller than the average Turkish man
Erdoğan walks to greet Palestinian counterpart Mahmoud Abbas at the Presidential Palace in Ankara
Quite a bit shorter and a tad older than his predecessor U.S
Biden arrives at an event marking the 31st anniversary of the Americans with Disabilities Act (ADA) in the Rose Garden of the White House in Washington
Britain's Prime Minister doesn’t only represent his country as a politician but also the average height of a U.K
Johnson delivers a speech about plans to "level up" the country during his visit to the U.K
Battery Industrialisation Centre in Coventry
China’s president is taller than his predecessors at 1.75 m
Xi walks off the stage during an inauguration ceremony in Macau
Putin is seen during a military parade marking Russia's Navy Day
Germany’s departing Chancellor Merkel stands at 1.65 m – the average height of a German woman
Merkel addresses the media after a virtual "summit of the Berlin process on the western Balkans 2021" in Berlin
North Korea’s leader is just a tad shorter than Merkel at 1.63 m
In this image released by the country's Korean Central News Agency
Kim Jong Un speaks during the fourth-day sitting of the 3rd Plenary Meeting of 8th Central Committee of the Workers' Party of Korea in Pyongyang
North Korea in this image released June 18
Irish President Higgins is the shortest active world leader at 1.60 m
Duchess of Cambridge walk around the grounds of Aras an Uachtarain with President of Ireland Michael D
Higgins and his wife Sabina Coyne in Dublin
The former president of Iran tops Higgins by three centimeters
Ahmadinejad addresses the U..N General Assembly in New York
Here is everything you need to know following the release of her debut album
from her height and age to where she's from and her ethnicity
Tyla has been making a huge splash in the music scene for the past year
thanks to the viral success of Grammy Award winning song 'Water'
and her recently-released debut album 'TYLA'
which has had a deluxe edition released in October 2024
The South-African born singer started releasing music in 2019 after finishing high school, and shot to fame after her debut single 'Getting Late' went viral on social media. She frequently talks about her heritage as a South African born woman, and has frequently spoken out when criticised about her racial identity and ethnicity from the perspective of a South African
where is she originally from and what is her ethnicity
Here is everything you need to know about the 'Push 2 Start' singer Tyla
Tyla would go to recording studios on the weekend to write and record music in the hopes she could start a career as a singer
Tyla has revealed that she is 5'3 after a fan asked her on TikTok how tall she was
She used a Nicki Minaj sound to answer the question that she stands at 5'3 (160cm)
She is one of five children, and says "Music is in my family and I’ve known since I was a little girl that I wanted to be a singer."
Tyla set the record straight on her Instagram stories to double down on how she identifies and cleared up any questions on her race
idk where that came from… I’m mixed with black/Zulu
Mauritian/Indian and Coloured" Tyla said on her stories
"In Southa I would be classified as a Coloured woman and other places I would be classified as a black women
Race is classified differently in different parts of the world.I don’t expect to be identified as Coloured outside of Southa by anyone not comfortable doing so because i understand the weight of that word outside of SA
South Africa to her parents Sharleen and Sherwin Seethall
She references her hometown of Johannesburg frequently in her music: "They never had a pretty girl from Jo'burg" / "From Jozi to Ibiza."
Tyla has said numerous times that her dream is to become the first global pop star from Africa
and the fact that all of that managed to translate overseas is crazy
It’s opening more doors for other South African artists and creatives to just have a place,” she tells Billboard
I always wanted to be the biggest pop star in general
I didn’t want to be the biggest African pop star
I just want to be the biggest pop star that was born and raised in Africa
"And the fact that I’m already getting a good response from the world [means] I’m one step closer to that dream.”And the fact that I’m already getting a good response from the world [means] I’m one step closer to that dream.”
Tyla reacts to 'Water' going viral
dance challenges & the biggest celebs in her DMs💿
See more Latest Music News
Tickets
Đorđe Adžić came to Ljubljana after spending many years on the bench of the German Euroleague team Bayern Basketball
and before that he was part of the coaching staff in Anadolu Efes
where he worked together with the legendary Dušan Ivković
and spent part of his career as a scout for NBA teams
He was part of the professional staffs of the junior national team selections of the Serbian national teams
among them was the team that won the silver medal at the world championship in the Czech Republic with Nikola Jokić and Vasilije Micić
Slovenian basketball fans also had the opportunity to watch him on the bench of the Serbian national team at the EuroBasket in Slovenia
Gran Canaria and in the previous season the French Élan Chalon
The 29-year-old from Postojna played with Bamberg in the Euroleague between 2015 and 2018
ten of which he started in the starting five of his team
1.4 assists and 0.7 rebounds per game in just over 10 minutes he spent on the floor
he played a total of 27 games with Partizan and Brescia
3.1 assists and 1.9 rebounds per faceoff in just over 20 minutes of play
Nikolić also competed with Burgos and Sassari in the Basketball Champions League
He averaged 6.2 points and 3.5 assists for Burgos
and 7.3 points and 3.0 assists per game for Sassari
Nikolić won the title of Italian Cup champion from 2023 and German Cup champion from 2017
we have been able to follow him in the jersey of the national team at two world championships (2014
2023) and two European championships (2017
2022) and at the 2021 Olympic Games in Tokyo
He was part of the national team in all the qualifiers for major competitions in recent years
He played in eight games at the 2014 World Cup and averaged 8.3 points
He is part of the Slovenian national team from the age category up to the age of 16
and he achieved his greatest success with the Slovenian men’s national team in 2017
when together with the rest of the members of the Golden National Team
The experienced Montenegrin expert Zvezdan Mitrović who last coached Galatasaray
he won the EuroCup championship with Monaco
and he also won national championship titles of France and Ukraine
He won the title of French national champion in 2019 with Asvel
and the title of Ukrainian national champion in 2009 with Krivbas
he was the Head Coach of the Montenegrin men’s national team
and basketball fans in Slovenia could also watch him on the Montenegro bench at EuroBasket 2013
Mitrović started his coaching career in 1992 on the bench of Pikadili
and in 1995 he moved to Budućnost as assistant coach
and in 2001 he returned to Podgorica as head coach
Between 2002 and 2007 and in the 2012/12 season
and then in 2015 he sat on the Monaco bench for the first time
where he remained in the first period until 2018
He managed Galatasaray in the 2023/24 season until the end of January 2024
wore the jersey of the Sioux Falls Skyforce and Austin Spurs
he averaged 14.4 points in 14 games of the regular season
he appeared in 38 regular season games for the Skyforce
where he wore the jersey of the Marineros team
and in five games spent an average of 21.8 minutes on the floor per game
and spent a little more than 29 minutes on the court
He played in 27 games in the regional league
2.1 assists and 1.6 steals in 25.5 minutes
we had the opportunity to follow him in the NBA Summer League
where he wore the Washington Wizards jersey
He played in four games and averaged 17.0 minutes on the floor
The height of celebrities often piques public interest, and Bianca Censori is no exception. As the reported wife of the renowned artist Kanye West
especially when comparing her height to that of her husband
Let's delve into the details of Bianca Censori's height and dispel some myths surrounding it
During one of Bianca and Kanye's outings at the Nobu restaurant
keen observers noted the footwear choices of the couple
Even though both types of footwear might have heels that could potentially elevate one's height
This observation further solidifies that her height is 164 cm or 5ft 4 inches
the height comparison doesn't end with just Bianca
who was married to Kanye from 2014 to 2022
stands at a height of 158 cm or 5 feet 2 inches
which is below the average height as per American standards
her height has been a subject of much speculation
she stands at a height of 158 cm or 5 feet 2 inches
It's essential to approach such topics with accurate information
ensuring that myths and misconceptions are dispelled
Romania’s Social Democratic Party (PSD) has proposed Paul Stanescu to replace Sevil Shhaideh as development minister and deputy prime minister in the Mihai Tudose cabinet
He will manage the ministry with the largest budget in Romania
which distributes money from the national budget to city halls and county councils
Stanescu, the head of PSD Olt, is one of the party leaders with great influence in the party, reports local Hotnews.ro
He was the president of the Olt County Council for eight years
Stanescu also managed to squeeze his brother on the parliamentary lists
who was an elementary school teacher in the village of Visina
His father was mayor in Visina until he was 75
Paul Stanescu is considered one of the most powerful local leaders in PSD
with a major influence at the central level
his relationship with the party leader has cooled in recent months
Romania’s ruling party names three new ministers
Business Insider SRL is a carrier of data with personal character
registered in the “Registrul de Evidenta a Prelucrarilor de Date cu Caracter Personal” with the no
Romania-Insider.com is a trademark registered with the help of NOMENIUS and all exclusivity rights are reserved to the owner of Business Insider SRL
Any unauthorized use will be sanctioned according to the provisions of trademarks law 84/1998
young Glas wore the jersey of Sixt and Koper Primorska
He showed his best performances in the Dynamic jersey
4.2 rebounds and 2.9 assists per faceoff in the 2020/21 season
Glas has always been a part of Slovenia’s national teams of younger age categories
and in 2021 he showed his best performances at the Challenger for national teams under the age of 20
Glas started the 2022/23 season in Partizan Belgrade
signed a contract with Cedevita Olimpija in early January 2023
and was then loaned to Montenegrin Mornar from Bar
2.2 rebounds and 2.5 assists per game in the 2022/23 AdmiralBet ABA League
Gregor also excelled in the 2023 World Cup qualifiers
1.8 rebounds and 0.2 assists per game in five games
Žiga Daneu has been part of the structure of Cedevita Olimpija since his early youth
His grandfather is the legendary Ivo Daneu
left their mark on the Ljubljana club and Slovenian basketball
Žiga Daneu tasted the pleasure of playing in the strongest Slovenian basketball competition for the first time in his career
and in five games he spent an average of just over 16 minutes on the floor
SKL in the jersey of the Cedevita Olimpija mladi
where he averaged 21.4 points per game in 16 games
and in the Nova KBM League in the Cedevita Olimpija jersey
for which he played in eight games and averaged 9.8 points and 3.8 rebounds in just over 20 minutes on the floor
Žiga also got a taste of playing in the EuroCup for the first time
where he played against Umana Reyer at home
but he failed to score in the two minutes of the game
Daneu spent the 2022/23 season in Ljubljana’s Ilirija as a loan player from Cedevita Olimpija
He played in 28 matches of the Slovenian national championship and spent an average of just over 22 minutes on the court
Daneu wore the jersey of Kansai Helios Domžale
with whom he also played in the final of the national championship
He appeared in 32 games of the Slovenian national championship
and in the 19.9 minutes he spent on the floor
he also played in 12 games of the NLB Liga ABA 2
spending an average of 10.5 minutes on the floor and scoring 2.5 points and 2.0 rebounds per game
Rok Radović signed his first professional contract with Zagreb’s Cedevita
and before that Radović had trained in the younger categories of the Zagreb club
The young Slovenian basketball player moved to the Croatian capital in 2016
and spent part of his career in the Domžale Helios Suns
the 200-centimeter-tall defender played in two ABA Youth League tournaments
3.7 assists and 3.3 rebounds in three games
we could see Radović in the Cedevita Olimpija jersey in one match
He played in 15 matches in the Slovenian national championship and averaged 6.4 points
he played in six games and recorded 1.7 points
he stepped on the floor in six games and scored 1.0 points
Rok spent the 2021/22 season in Cedevita Junior as the player on loan from Cedevita Olimpija
Radović returned to Ljubljana and became a regular in Cedevita Olimpija’s game
He played in 24 games in the AdmiralBet ABA League
spent an average of 13.5 minutes on the floor per game
He appeared in 13 games in the 7DAYS EuroCup
scoring 5.0 points and 2.8 rebounds per game
Radović was the best individual of the Slovenian cadet national team at the European Championships in 2017
He has worn the Slovenian jersey in three European competitions so far
but Radović is certainly considered the future
Radović also presented himself at the Jordan Brand Classic match
and a year later at the match of the same name in Barcelona
With the Slovenian national team under the age of 20
Radović became the winner of the U20 national team tournament in Heraklion
8.8 rebounds and 1.4 assists per game in five games
Jaka Blažič started his professional sports career in 2007 in the jersey of Triglav from Carniola
and after two years of playing for the Gorenjska team
he went to Ljubljana for the first time and wore the jersey of Slovan in 2009
and then in 2011 he transferred to the then Union Olimpija
The path then led him to Crvena Zvezda Belgrade
and before the start of the 2019/20 season
he returned to Cedevita Olimpija and played in 21 matches
in the regional competition in the 2019/20 competitive season
4.0 rebounds and 2.4 assists per game in 27.5 minutes
He was named the round’s most valuable player of the regular season of the ABA League three times
and with this achievement he became the only basketball player who performed on the regional scene in the prematurely ended 2019/20 season
Blažič was selected as the most valuable player of the month in the regional league in November
Jaka was also selected in the First Team of the regional competition for the 2020/21 season
and at the same time he was part of the Second Team of the 7DAYS EuroCup competition
Blažič also concluded the European Cup as the top scorer in the 2020/21 competitive season
the last one that Blažič spent at Cedevita Olimpija
4.8 rebounds and 3.6 assists per game in the 7DAYS EuroCup
and recorded 14.1 points in the regional league
Blažič was selected in the second five in the European Cup
and in the regional league he was selected in the Ideal Five for the second season in a row
Blažič moved to the Turkish team Bahçeşehir Koleji
where he played in 11 games of the Champions League this season
averaging 5.5 points and 1.9 rebounds per game
Jaka is also a permanent member of the Slovenian men’s national team
with which he won the title of European champion in 2017
and in 2021 he won fourth place at the Olympic Games in Tokyo
he played in seven games and averaged 10.1 points
and at EuroBasket 2022 he also appeared in seven games
Please sign in with your Snow-Forecast account details below
Create a free account to receive instant Snow-Alerts and save your favourite resorts on your personal MySnow page
Popova Sapka Weather (Next 3 days): The snow forecast for Popova Sapka is: Moderate rain (total 17.0mm)
Mild temperatures (max 8°C on Tue morning
Popova Sapka Weather (Days 4-6): Mild with moderate rain (total 19.0mm) on Fri afternoon
Becoming colder with a light covering of snow
Freeze-thaw conditions (max 5°C on Fri morning
Mild with moderate rain (total 19.0mm) on Fri afternoon
Several North American ski areas that are still open plan to celebrate the unofficial Star Wars Day tomorrow
The above table gives the weather forecast for Popova Sapka at the specific elevation of 2035 m. Our sophisticated weather models allow us to provide snow forecasts for the top, middle and bottom ski stations of Popova Sapka. To access the weather forecasts for the other elevations, use the tab navigation above the table. For a wider view of the weather, check out the Weather Map of Rep. of N. Macedonia
Click here to read further information on freezing levels and how we forecast our temperatures
Overall 3.7 Based on 36 votes and 15 reviews
Overall: 3.7 Based on 36 votes and 14 reviews
Read 14 more reviews of Popova Sapka or submit your own
View detailed snow forecast for Popova Sapka at:snow-forecast.com
The Bansko snow report is: out of 14 Lifts open
Our Snow Report for Bansko brings daily updates on the snow conditions, snow depths, piste and offpiste conditions and the number of open ski lifts. The latest Bansko snow report shown below was updated on 14 Apr 2025. Snow Reports are provided regularly throughout the ski season courtesy of our own network of ski resort managers and Skiresort Service International GmbH
In addition to the current report on ski conditions
we also provide webcams (including a 4 week cam archive)
current live observations from nearby weather stations and also historical snow data for Bansko
):Last 7 daysThis monthThis season0Bluebird Powder days0Powder days3Bluebird daysBansko Last 3 days snowfall mapSnow Radar Latest snow reports near Bansko:
Recorded snow depths for the upper and lower slopes in Bansko 2024 - 2025
The long term average for the upper slopes is also shown for comparison
Find the best conditions for skiing and snowboarding near Bansko using our Snowfinder page.
Last Updated on29 March, 2024 | 9:44 AM EDT
Petar Celik is a legendary bodybuilder from Serbia. Celik is revered as one of the pioneers of the Serbian bodybuilding scene. He is credited for spreading awareness about bodybuilding in Eastern Europe and erstwhile Yugoslavia by being a successful competitor, entrepreneur, author, publisher, and president of several bodybuilding federations. This is his complete profile, biography, competition history, and statistics.
A post shared by Petar Čelik (@petarcelikfitness)
Petar Celik was born on December 25, 1949, in Belgrade, former Yugoslavia. His family moved to Backa Palanka when he was young where he completed his high school education. Celik started learning music after school and eventually turned towards bodybuilding.
Level Up Your Fitness: Join our 💪 strong community in Fitness Volt Newsletter. Get daily inspiration, expert-backed workouts, nutrition tips, the latest in strength sports, and the support you need to reach your goals. Subscribe for free!
Expect expert-backed workouts, nutrition advice, the latest in strength sports, and a whole lot of motivation heading your way.
In Yugoslavia, bodybuilding had no recognition as a sport or there was no way one could make a living or a good career as a bodybuilder. As a result, there was no guidance, study material, or books that were available in the country that could help someone get started in bodybuilding.
However, one of Celik’s friends, who was of German descent, received bodybuilding and fitness magazines from West Germany. This served as the only study material that Celik could use to learn and understand bodybuilding.
“Of course, that wasn’t enough, but it was “something.” Along with that, I watched foreign movies like Hercules with American actor Steve Reeves in the main role and Reg Park too. They had developed bodybuilding figures which inspired us here.”
Celik used these modest means to start his bodybuilding journey and worked hard to achieve the physique he desired. According to him, Steve Reeves’ physique was something he looked up to while growing up. But with time, Celik was more interested in building a physique like Frank Zane and Arnold Schwarzenegger.
With time, Celik gained more knowledge and realized that he could not blindly try to achieve a physique that looked like someone else’s. He decided to follow his path and understand his body better to know what he could achieve with it.
By 1969, Celik had dedicated his life to bodybuilding and traveled to Germany to become a certified trainer. This helped Celik advance in his career. Petar Celik started the first bodybuilding federation in Yugoslavia in 1971, which contributed tremendously to the growth of the sport in the region. He is also credited for opening a gym in Blanca Palanka, which was the first of its kind in Yugoslavia.
In 1972, Celik started publishing the Herkules magazine, which was Yugoslavia’s first magazine for health and fitness. The magazine steadily grew in popularity over the years and started selling as many as 57,000 copies. The magazine has sold over 700,000 copies and is in circulation with the Republic of Macedonia today.
Petar Celik made huge progress in the fitness industry in the following years and also started a factory that made protein supplements. This was happening at the same time when his bodybuilding career was also shaping up.
A post shared by Petar Čelik (@petarcelikfitness)
Petar Celik started competing fairly early and won his first bodybuilding competition when he took home the 1975 Yugoslavian Championships trophy. The following year, he won the 1976 Slovenian championships. Celik was the most successful and the most popular bodybuilder in Yugoslavia at the time, a country where the sport was still in its nascent stages.
In 1980, Celik captured the Serbian Championships and also the DBBV European Championships organized by the German Bodybuilding and Fitness Association. Petar Celik won the competition in the middleweight division and also became the overall winner. In doing so, he defeated the likes of two-time European champion Janko Rudman and 1978 NABBA Mr. Universe Salvador Ruiz. Celik regards this as the biggest and most valuable victory of his career because of the competition he defeated.
A post shared by Petar Čelik (@petarcelikfitness)
In 2003, Petar Celik won the first of his 10 World Championships and continued to dominate the scene for the next decade. He retired from competition after winning the 2012 IFBB World Championships in the 60+ category.
Throughout his career, Petar Celik won the Mr. Yugoslavia competition in all the bodybuilding federations active in the erstwhile nation at the time.
One of the most prominent bodybuilders to come out of Serbia, Celik believes that there have been instances of prejudice against Eastern European bodybuilders in the Western bodybuilding scene. However, he also believes that if you are better than the competition, no one can deny you success if you stay committed to your craft.
“The one who is persistent and doesn’t give up after the first few losses, that person will have a successful career over time. Of course, for that, you need enough years of appearances at competitions.”
Apart from being a competitive bodybuilder, Celik played a major role in running the bodybuilding federation in Yugoslavia. He was the IFBB and NABBA President for Yugoslavia and organized the 1984 NABBA Mr. World competition in Belgrade.
Petar Celik also served as the President of the Federation for Weightlifting of Yugoslavia and as a delegate in the Olympic Committee of Yugoslavia.
After reducing his activity level in competitions, Petar Celik became an associate professor of bodybuilding at the Higher School for Sports Coaches in Belgrade, Serbia.
A post shared by Petar Čelik (@petarcelikfitness)
Petar Celik has always maintained a stance that bodybuilding, physical activity, and involvement in sports are not just a matter of personal well-being but an issue of national interest.
Celik believes that everyone needs to participate in physical activities, be it as a part of the job or an activity for fitness purposes.
Despite crossing on the wrong side of 70, Petar Celik maintains a hardcore training routine and his muscular physique stands testimony to that. Speaking about the secret of his good health in the 70s, Celik once said:
“The secret to my fit physique is that I do not just prepare for a competition. I am always in shape, and I focus more on my diet before a competition. Also, I always pay attention to my line and never stop training.”
A post shared by Petar Čelik (@petarcelikfitness)
Petar Celik firmly believes that 80 percent of the success in bodybuilding depends upon what and how you eat. While many bodybuilders and fitness enthusiasts tend to believe that training hard will nullify all the negative aspects of their dietary practices, Celik cautions that it is a big mistake and that building a great physique without a proper diet is next to impossible.
According to Celik, understanding diet from the point of view of performance as well as long-term health is equally important. If performance is the sole focus, it could yield negative results in the long run when you start getting older.
Celik has always been critical of steroids and other substances used in the bodybuilding world today. He claims that PEDs are a particularly Western phenomenon where the means of reaching the goal are not valued:
“They say about Americans that in the first half of their life they sell their health for money then, if they succeed in that, in the second half of their life they want to buy their health back with that money. But it doesn’t work. Health is to be taken care of while you still have it and sports should contribute to that and not harm your health.”
Celik relies on an organic, whole-food diet for nutrition and stays away from chemically loaded and ultra-processed foods. He believes that human beings have been disconnected from nature as civilization has advanced and thinks that following a healthy and natural diet is the first and most important step to reconnecting with nature.
Petar Celik has five children. He coaches in the local health institute in Backa Palanka and works as an associate professor at the University of Belgrade. Celik is still active in the competitive bodybuilding sphere today and helps young bodybuilders prepare for bodybuilding shows.
A post shared by Petar Čelik (@petarcelikfitness)
Petar Celik’s life story shows that even a single individual can make a significant impact on history
Not only did Celik become a popular and successful bodybuilder
but he created opportunities and an environment for younger generations to be able to pursue bodybuilding and fitness
His contribution to the sport goes far beyond the trophies or titles he won
If you have any questions or need further clarification about this article, please leave a comment below
and Ash will get back to you as soon as possible
Δdocument.getElementById( "ak_js_1" ).setAttribute( "value"
At Fitness Volt, our mission is to empower every individual on their fitness journey by providing expert advice, the latest research, and comprehensive resources. Whether you are a beginner or an elite athlete, we are here to support your goals with trustworthy and up-to-date information in strength, fitness, and nutrition. Read more
Email: [email protected]
About Us | Careers | Contact Form
' + scriptOptions._localizedStrings.webview_notification_text + '
" + scriptOptions._localizedStrings.redirect_overlay_title + "
" + scriptOptions._localizedStrings.redirect_overlay_text + "
Anna Maria Sieklucka is best known to people as Laura from the multi-lingual Netflix drama 365 Days
The actress has been in theatre for a while and has honed her acting skills
Her talent has earned her a significant social media following from different parts of the world
PAY ATTENTION: Click “See First” under the “Following” tab to see Legit.ng News on your Facebook News Feed!
The actress posing for pictures in elegant outfits. Photo: @anna_maria.sieklucka (modified by author)Source: InstagramAnna Maria Sieklucka has worked with renowned directors such as Barbara Bialowas and Tomasz Mandes. She has also collaborated with top actors from her home country and beyond. Read on to discover more about her age, height, career, and relationship.
Read also
Anna Maria Sieklucka is a talented actress
PAY ATTENTION: Follow us on Instagram - get the most important news directly in your favourite app
The actress' father is Jerzy Antoni, and her mother is Joanna. Her father is a practising lawyer. She has one sibling, Piotr.
Her family is close-knit, and her parents have encouraged and supported her in pursuing her interests. The actress' nationality is Polish, and her ethnicity is White.
Read also
She went to the AST National Academy of Theatre Arts
She was at the institution's Wrocław-based Faculty of Puppetry and graduated in 2018
she made her debut on the big screen in Poland
She featured in an episode of Na dobre i na złe
a series that showcased the lives of hospital staff and paramedics
Her first film was 365 Days, an erot*c drama film. Initially, she was hesitant to accept the role. She has been in the film and television industry for a short while, and fans hope to see her in more productions in the future.
Read also
The actress is also a model and social media personality
She often posts amazing pictures of herself on social media
She uses her accounts to endorse different brands
The actress is yet to get married. However, she is in a relationship. Who is Anna Maria Sieklucka dating? She is dating Łukasz Witt-Michałowski
Anna Maria Sieklucka's partner is also from Lublin
The two first met at AST National Academy of Theatre Arts
They were friends for a while before they decided to become a couple
There have been speculations that she is in a relationship with co-star Michele Morrone. The two are colleagues and friends with no romantic association in real life.
Read also
Anna-Maria Sieklucka's height is 5’ 4” or 163 centimetres tall
and her weight is about 110 pounds or 50 kilogrammes
Her body measurements in inches are 34-24-32
Anna Maria Sieklucka is a talented Polish dancer and actress
Her excellent portrayal of various characters has earned her fame and media attention
READ ALSO: EJ Johnson's bio: age, height, net worth, and weight loss
Legit.ng recently published EJ Johnson's biography. EJ is the son of Magic Johnson
a former American retired basketball player
His mother is Earletha "Cookie" Kelly
He starred in The Rich Kids of Beverly Hills
The openly gay television personality considered transitioning after Caitlyn Jenner transitioned