Metrics details MicroRNAs are essential molecules that regulate many biological functions including intestinal tight junction (TJ) barriers which protect against inflammation and promote intestinal balance This review explores the role of miRNAs in controlling inflammation and as a potential therapeutic approach for treating IBD and other intestinal disorders Circulating miRNAs can also serve as biomarkers for intestinal damage and disease progression This review summarizes the current state of knowledge on the role of different miRNAs in intestinal diseases and highlights the functions of the most relevant miRNAs that play a specific role in regulating intestinal tight junctions (TJs) we discuss the emerging utility of miRNAs as potential diagnostic biomarkers in prognosis assessment/monitoring of gut diseases and promising aspects of heterogenous miRNAs in therapeutic interventions The distinct composition of tissue-specific and circulatory miRNAs points to a multilevel regulatory machinery with separate autocrine and endocrine roles which may have overlapped Given the complexity of miRNA networks influenced by a variety of factors such as disease subtype and patient characteristics the heterogeneity seen in miRNA expression patterns across studies highlights the necessity for standardized methodologies and protocols in miRNA research this knowledge should stimulate further studies to link circulating or EXO miRNAs to tissue or organ-specific disease pathogenesis and response to different therapies which might be used as routine-powerful non-invasive biomarkers in the diagnosis The role of miRNAs in intestinal diseases and disorders is an area of rapidly growing interest It is becoming increasingly clear that miRNAs can either speed up or slow down specific genes that regulate TJs and their functions can vary depending on the cell type or tissue environment While some effects of miRNAs on target genes are well understood more research is needed to explore their cell-specific regulatory potential and how they are altered in disease conditions The biological importance of extracellular miRNAs which may be especially significant in disorders like cancer and IBD Little is currently understood about how TJs or inflammatory factors are targeted by miRNAs associated with exosomes in disease or injury conditions It is widely recognized that circulating miRNAs are more stable compared to many other biological markers which has led to significant progress in identifying IBD- and cancer-specific miRNA biomarkers understanding the role and changes in miRNAs in regulating TJs and cellular functions in different disease conditions provides a solid foundation for developing treatments that target miRNAs It is reasonable to anticipate that within the next ten years gastroenterologists will have access to miRNA-based therapeutics as a therapy option to treat tight junction aspects of various diseases No datasets were generated or analysed during the current study indicates that thousands of human genes are microRNA targets MicroRNAs control intestinal epithelial differentiation eIF1A augments Ago2-mediated Dicer-independent miRNA biogenesis and RNA interference cell types and biomarkers of the Human Reference Atlas Intestinal lipid metabolism genes regulated by miRNAs Comprehensive analysis of human microRNA-mRNA interactome Functional transcriptomics in diverse intestinal epithelial cell types reveals robust MicroRNA sensitivity in intestinal stem cells to microbial status The impact of MicroRNAs during inflammatory bowel disease: effects on the mucus layer and intercellular junctions for gut permeability Stool microRNA profiles reflect different dietary and gut microbiome patterns in healthy individuals Breast milk and solid food shaping intestinal immunity lineage tracing shows that myelin and remak Schwann cells elongate extensively and branch to form repair Schwann cells The intestinal epithelial barrier: a therapeutic target? Intestinal barrier: an interface between health and disease Endocytosis of intestinal tight junction proteins: in time and space The roles of claudin superfamily proteins in paracellular transport Claudin-2 as a mediator of leaky gut barrier during intestinal inflammation Occludin regulates macromolecule flux across the intestinal epithelial tight junction barrier Lactobacillus acidophilus induces a strain-specific and toll-like receptor 2-dependent enhancement of intestinal epithelial tight junction barrier and protection against intestinal inflammation Interleukin-6 modulation of intestinal epithelial tight junction permeability is mediated by JNK pathway activation of claudin-2 gene MicroRNA regulation of intestinal epithelial tight junction permeability IL-1β and the intestinal epithelial tight junction barrier Chloride channel ClC- 2 enhances intestinal epithelial tight junction barrier function via regulation of caveolin-1 and caveolar trafficking of occludin IL1B increases intestinal tight junction permeability by up-regulation of MIR200C-3p MicroRNAs regulate tight junction proteins and modulate epithelial/endothelial barrier functions Functional implications and clinical potential of MicroRNAs in irritable bowel syndrome: a concise review Whole transcriptome-based ceRNA network analysis revealed ochratoxin A-induced compromised intestinal tight junction proteins through WNT/Ca2+ signaling pathway miR-200b inhibits TNF-α-induced IL-8 secretion and tight junction disruption of intestinal epithelial cells in vitro MiR-144 increases intestinal permeability in IBS-D rats by targeting OCLN and ZO1 miR-16 and miR-125b are involved in barrier function dysregulation through the modulation of claudin-2 and cingulin expression in the jejunum in IBS with diarrhoea Pro-inflammatory miR-223 mediates the cross-talk between the IL23 pathway and the intestinal barrier in inflammatory bowel disease MicroRNA 29 targets nuclear factor-κB-repressing factor and Claudin 1 to increase intestinal permeability MicroRNA-29a mediates the impairment of intestinal epithelial integrity induced by intrauterine growth restriction in pig MicroRNA-29a regulates intestinal membrane permeability in patients with irritable bowel syndrome MicroRNA-29a increased the intestinal membrane permeability of colonic epithelial cells in irritable bowel syndrome rats Inhibition of miRNA-29a regulates intestinal barrier function in diarrhea-predominant irritable bowel syndrome by upregulating ZO-1 and CLDN1 Multiple facets of intestinal permeability and epithelial handling of dietary antigens Cell biology of tight junction barrier regulation and mucosal disease Intestinal epithelial cells: regulators of barrier function and immune homeostasis Cytokine-mediated crosstalk between immune cells and epithelial cells in the gut Mechanism of cytokine modulation of epithelial tight junction barrier Cytokine tuning of intestinal epithelial function Cytokine responsive networks in human colonic epithelial organoids unveil a molecular classification of inflammatory bowel disease TNF-alpha-induced increase in intestinal epithelial tight junction permeability requires NF-kappa B activation Mechanism of TNF-{alpha} modulation of Caco-2 intestinal epithelial tight junction barrier: role of myosin light-chain kinase protein expression Rebeccamycin attenuates TNF-α-induced intestinal epithelial barrier dysfunction by inhibiting myosin light chain kinase production Pleiotropic functions of TNF-α in the regulation of the intestinal epithelial response to inflammation TNF-α modulation of intestinal epithelial tight junction barrier is regulated by ERK1/2 activation of Elk-1 TNF-α modulation of intestinal tight junction permeability is mediated by NIK/IKK-α axis activation of the canonical NF-κB pathway Proinflammatory cytokine-induced tight junction remodeling through dynamic self-assembly of claudins Amelioration of IFN-γ and TNF-α-induced intestinal epithelial barrier dysfunction by berberine via suppression of MLCK-MLC phosphorylation signaling pathway IL-1beta causes an increase in intestinal epithelial tight junction permeability Mechanism of interleukin-1β induced-increase in mouse intestinal permeability in vivo Cellular and molecular mechanism of interleukin-1β modulation of Caco-2 intestinal epithelial tight junction barrier IL-1beta-induced increase in intestinal epithelial tight junction permeability is mediated by MEKK-1 activation of canonical NF-kappaB pathway Epithelial myosin light chain kinase-dependent barrier dysfunction mediates T cell activation-induced diarrhea in vivo Tight junctions as targets and effectors of mucosal immune homeostasis A membrane-permeant peptide that inhibits MLC kinase restores barrier function in in vitro models of intestinal disease Myosin light chain phosphorylation regulates barrier function by remodeling tight junction structure Complex phenotype of mice lacking occludin Epithelial transport and barrier function in occludin-deficient mice Occludin-deficient embryonic stem cells can differentiate into polarized epithelial cells bearing tight junctions Caveolin-1-dependent occludin endocytosis is required for TNF-induced tight junction regulation in vivo Occludin is required for cytokine-induced regulation of tight junction barriers Role of cytokines in inflammatory bowel disease Changes of the cytokine profile in inflammatory bowel diseases Characterization of serum cytokine profile in predominantly colonic inflammatory bowel disease to delineate ulcerative and Crohn’s colitides Mechanism-based treatment strategies for IBD: cytokines Treatment of inflammatory bowel disease: a comprehensive review Cytokine networks in the pathophysiology of inflammatory bowel disease Mechanism of IL-1beta-induced increase in intestinal epithelial tight junction permeability MicroRNA-146b improves intestinal injury in mouse colitis by activating nuclear factor-κB and improving epithelial barrier function Differentially expressed miRNAs in ulcerative colitis and Crohn’s disease MicroRNAs are differentially expressed in ulcerative colitis and alter expression of macrophage inflammatory peptide-2 alpha MicroRNA-193a-3p reduces intestinal inflammation in response to microbiota via down-regulation of colonic PepT1 MicroRNA214 is associated with progression of ulcerative colitis and inhibition reduces development of colitis and colitis-associated cancer in mice MicroRNA-21 regulates intestinal epithelial tight junction permeability Overexpression of miR-21 in patients with ulcerative colitis impairs intestinal epithelial barrier function through targeting the Rho GTPase RhoB MicroRNA-155 is involved in the pathogenesis of ulcerative colitis by targeting FOXO3a Increased expression of microRNA in the inflamed colonic mucosa of patients with active ulcerative colitis Long noncoding RNA BFAL1 mediates enterotoxigenic Bacteroides fragilis-related carcinogenesis in colorectal cancer via the RHEB/mTOR pathway Hypoxia-inducible microRNA-155 negatively regulates epithelial barrier in eosinophilic esophagitis by suppressing tight junction claudin-7 Zhong, W., Chen, J., Xu, G. & Xiao, L. Kaempferol ameliorated alcoholic hepatitis through improving intestinal barrier function by targeting miRNA-155 signaling. Pharmacology https://doi.org/10.1159/000537964 (2024) Alpinetin exerts anti-colitis efficacy by activating AhR and therefore promoting Treg differentiation MicroRNA-146a constrains multiple parameters of intestinal immunity and increases susceptibility to DSS colitis Identification of serum and tissue micro-RNA expression profiles in different stages of inflammatory bowel disease circSMAD4 promotes experimental colitis and impairs intestinal barrier functions by targeting Janus kinase 2 through sponging miR-135a-5p Role and mechanisms of exosomal miRNAs in IBD pathophysiology Luminal extracellular vesicles (EVs) in inflammatory bowel disease (IBD) exhibit proinflammatory effects on epithelial cells and macrophages Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells Extracellular vesicles-mediated interaction within intestinal microenvironment in inflammatory bowel disease M2 macrophage-derived exosomal miR-590-3p attenuates DSS-induced mucosal damage and promotes epithelial repair via the LATS1/YAP/ β-catenin signalling axis Extracellular vesicles regulate immune responses and cellular function in intestinal inflammation and repair hucMSC-derived exosomes attenuate colitis by regulating macrophage pyroptosis via the miR-378a-5p/NLRP3 axis HucMSC-exosomes carrying miR-326 inhibit neddylation to relieve inflammatory bowel disease in mice MiR-200b in heme oxygenase-1-modified bone marrow mesenchymal stem cell-derived exosomes alleviates inflammatory injury of intestinal epithelial cells by targeting high mobility group box 3 Mast cells-derived MiR-223 destroys intestinal barrier function by inhibition of CLDN8 expression in intestinal epithelial cells MiR-21 in Substance P-induced exosomes promotes cell proliferation and migration in human colonic epithelial cells Human breast milk-derived exosomal miR-148a-3p protects against necrotizing enterocolitis by regulating p53 and Sirtuin 1 Nie, H. et al. Intestinal epithelial Krüppel-like factor 4 alleviates endotoxemia and atherosclerosis through improving NF-κB/miR-34a-mediated intestinal permeability. Acta Pharmacol. Sin https://doi.org/10.1038/s41401-024-01238-3 (2024) Porcine milk exosome miRNAs protect intestinal epithelial cells against deoxynivalenol-induced damage Circulating exosomal microRNA-18a-5p accentuates intestinal inflammation in Hirschsprung-associated enterocolitis by targeting RORA Release of luminal exosomes contributes to TLR4-mediated epithelial antimicrobial defense Circulating microRNA is a biomarker of pediatric Crohn disease MicroRNA biomarkers in IBD-differential diagnosis and prediction of colitis-associated cancer MicroRNAs as innovative biomarkers for inflammatory bowel disease and prediction of colorectal cancer Exosome-induced regulation in inflammatory bowel disease Milk exosomes prevent intestinal inflammation in a genetic mouse model of ulcerative colitis: a pilot experiment Functional flexibility of exosomes and MicroRNAs of intestinal epithelial cells in affecting inflammation Exosome-mediated effects and applications in inflammatory bowel disease Exosomes from mesenchymal stromal cells reduce murine colonic inflammation via a macrophage-dependent mechanism A novel therapeutic approach for inflammatory bowel disease by exosomes derived from human umbilical cord mesenchymal stem cells to repair intestinal barrier via TSG-6 Overexpression of miR-595 and miR-1246 in the sera of patients with active forms of inflammatory bowel disease Serum exosomal microRNA-144-3p: a promising biomarker for monitoring Crohn’s disease MicroRNAs as potential biomarkers for the diagnosis of inflammatory bowel disease: a systematic review and meta-analysis Intestinal and circulating MicroRNAs in coeliac disease Circular RNAs function as ceRNAs to regulate and control human cancer progression Circular RNA-associated competing endogenous RNA network and prognostic nomogram for patients with colorectal cancer A novel circRNA-miRNA-mRNA network revealed exosomal circ-ATP10A as a biomarker for multiple myeloma angiogenesis The role of miR-197-3p in regulating the tight junction permeability of celiac disease patients under gluten free diet Circular RNA_0001187 participates in the regulation of ulcerative colitis development via upregulating myeloid differentiation factor 88 Integrated analysis of circRNAs and mRNAs expression profile revealed the involvement of hsa_circ_0007919 in the pathogenesis of ulcerative colitis Overexpression of circAtp9b in ulcerative colitis is induced by lipopolysaccharides and upregulates PTEN to promote the apoptosis of colonic epithelial cells Expression of circulating let-7e and miR-126 may predict clinical remission in patients with Crohn’s disease treated with anti-TNF-α biologics MALAT1 maintains the intestinal mucosal homeostasis in Crohn’s disease via the miR-146b-5p-CLDN11/NUMB pathway CCAT1 lncRNA promotes inflammatory bowel disease malignancy by destroying intestinal barrier via downregulating miR-185-3p MicroRNA-122a regulates zonulin by targeting EGFR in intestinal epithelial dysfunction Salvianolic acid B restored impaired barrier function via downregulation of MLCK by microRNA-1 in rat colitis model Overexpression of miR-429 impairs intestinal barrier function in diabetic mice by down-regulating occludin expression MiRNA-182-5p aggravates experimental ulcerative colitis via sponging Claudin-2 IL-21 mediates microRNA-423-5p /claudin-5 signal pathway and intestinal barrier function in inflammatory bowel disease Cytokine IL9 triggers the pathogenesis of inflammatory bowel disease through the miR21-CLDN8 pathway Hypermethylation of miR-145 promoter-mediated SOX9-CLDN8 pathway regulates intestinal mucosal barrier in Crohn’s disease MicroRNA-155-5p inhibition alleviates irritable bowel syndrome by increasing claudin-1 and ZO-1 expression Silencing LncRNA-DANCR attenuates inflammation and DSS-induced endothelial injury through miR-125b-5p miR-195-5p regulates tight junctions expression via claudin-2 downregulation in ulcerative colitis The increase of miR-195-5p reduces intestinal permeability in ulcerative colitis Tetrandrine attenuates intestinal epithelial barrier defects caused by colitis through promoting the expression of Occludin via the AhR-miR-429 pathway miR-130a and miR-212 disrupt the intestinal epithelial barrier through modulation of PPARγ and occludin expression in chronic simian immunodeficiency virus-infected Rhesus Macaques MicroRNA-21 increases the expression level of occludin through regulating ROCK1 in prevention of intestinal barrier dysfunction Inhibition of miR-155 alleviates sepsis-induced inflammation and intestinal barrier dysfunction by inactivating NF-κB signaling and miR-122 in pediatric patients with inflammatory bowel disease The role of the miR-21-5p-mediated inflammatory pathway in ulcerative colitis Differential expression of miRNAs regulating NF-κB and STAT3 crosstalk during colitis-associated tumorigenesis MicroRNA-21 plays multiple oncometabolic roles in colitis-associated carcinoma and colorectal cancer via the PI3K/AKT and PDCD4/TNF-α signaling pathways in zebrafish MicroRNA 301A promotes intestinal inflammation and colitis-associated cancer development by inhibiting BTG1 miR-19a promotes colitis-associated colorectal cancer by regulating tumor necrosis factor alpha-induced protein 3-NF-κB feedback loops Stromal miR-20a controls paracrine CXCL8 secretion in colitis and colon cancer miR-148a inhibits colitis and colitis-associated tumorigenesis in mice Elevated MMP10/13 mediated barrier disruption and NF-κB activation aggravate colitis and colon tumorigenesis in both individual or full miR-148/152 family knockout mice MicroRNA 452 regulates IL20RA-mediated JAK1/STAT3 pathway in inflammatory colitis and colorectal cancer miR-26a attenuates colitis and colitis-associated cancer by targeting the multiple intestinal inflammatory pathways MicroRNA-21 knockout improve the survival rate in DSS induced fatal colitis through protecting against inflammation and tissue injury Inhibiting microRNA-7 expression exhibited a protective effect on intestinal mucosal injury in TNBS-induced inflammatory bowel disease animal model Inhibition of miR-16 ameliorates inflammatory bowel disease by modulating Bcl-2 in mouse models MicroRNA-31 reduces inflammatory signaling and promotes regeneration in colon epithelium and delivery of mimics in microspheres reduces colitis in mice Myeloid-derived miR-223 regulates intestinal inflammation via repression of the NLRP3 inflammasome MiR-155 contributes to Th17 cells differentiation in dextran sulfate sodium (DSS)-induced colitis mice via Jarid2 MicroRNA-132 and microRNA-223 control positive feedback circuit by regulating FOXO3a in inflammatory bowel disease NOD2 is regulated by Mir-320 in physiological conditions but this control is altered in inflamed tissues of patients with inflammatory bowel disease Upregulation of miR-665 promotes apoptosis and colitis in inflammatory bowel disease by repressing the endoplasmic reticulum stress components XBP1 and ORMDL3 The signaling axis of microRNA-31/interleukin-25 regulates Th1/Th17-mediated inflammation response in colitis MicroRNA-124 promotes intestinal inflammation by targeting aryl hydrocarbon receptor in Crohn’s disease MicroRNA-16 is putatively involved in the NF-κB pathway regulation in ulcerative colitis through adenosine A2a receptor (A2aAR) mRNA targeting MicroRNA-206 is involved in the pathogenesis of ulcerative colitis via regulation of adenosine A3 receptor MicroRNA 429 regulates mucin gene expression and secretion in murine model of colitis and MicroRNA-338-3p are downregulated in irritable bowel syndrome and are associated with barrier function and MAPK signaling Exosomes-mediated transfer of miR-125a/b in cell-to-cell communication: a novel mechanism of genetic exchange in the intestinal microenvironment CD11c+ myeloid cell exosomes reduce intestinal inflammation during colitis miR-141 regulates colonic leukocytic trafficking by targeting CXCL12β during murine colitis and human Crohn’s disease Exosomes transfer miRNAs from cell-to-cell to inhibit autophagy during infection with Crohn’s disease-associated adherent-invasive E Enterotoxigenic bacteroidesfragilis promotes intestinal inflammation and malignancy by inhibiting exosome-packaged miR-149-3p Transfer of microRNA-25 by colorectal cancer cell-derived extracellular vesicles facilitates colorectal cancer development and metastasis Delivery of anti-miRNA-221 for colorectal carcinoma therapy using modified cord blood mesenchymal stem cells-derived exosomes Cancer-associated fibroblasts derived extracellular vesicles promote angiogenesis of colorectal adenocarcinoma cells through miR-135b-5p/FOXO1 axis MicroRNA-containing T-regulatory-cell-derived exosomes suppress pathogenic T helper 1 cells Dendrobium officinale polysaccharide alleviates intestinal inflammation by promoting small extracellular vesicle packaging of miR-433-3p Neutrophil-induced genomic instability impedes resolution of inflammation and wound healing HucMSC-Ex carrying miR-203a-3p.2 ameliorates colitis through the suppression of caspase11/4-induced macrophage pyroptosis Extracellular vesicles containing miR-146a attenuate experimental colitis by targeting TRAF6 and IRAK1 Visceral adipose tissue derived exosomes exacerbate colitis severity via pro-inflammatory MiRNAs in high fat diet fed mice Serum exosomes derived from irritable bowel syndrome patient increase cell permeability via regulating miR-148b-5p/RGS2 signaling in human colonic epithelium cells Circulating microRNAs as novel non-invasive biomarkers of paediatric celiac disease and adherence to gluten-free diet MicroRNA signatures differentiate Crohn’s disease from ulcerative colitis Elevated miRNA inversely correlates with E-cadherin gene expression in tissue biopsies from Crohn disease patients in contrast to ulcerative colitis patients Plasma microRNA profile differentiates Crohn’s colitis from ulcerative colitis Circulating microRNA146b-5p is superior to C-reactive protein as a novel biomarker for monitoring inflammatory bowel disease Faecal Micro-RNAs in inflammatory bowel diseases Circulating and fecal microRNAs as biomarkers for inflammatory bowel diseases Identification of microRNAs associated with ileal and colonic Crohn’s disease In Crohn’s disease fibrosis-reduced expression of the miR-29 family enhances collagen expression in intestinal fibroblasts Fecal MicroRNAs show promise as noninvasive Crohn’s disease biomarkers and let-7e* as new potential diagnostic biomarkers in ulcerative colitis Expression and localization of miR-21 and miR-126 in mucosal tissue from patients with inflammatory bowel disease Association of fecal and serum microRNA profiles with gastrointestinal cancer and chronic inflammatory enteropathy in dogs Identification of restricted subsets of mature microRNA abnormally expressed in inactive colonic mucosa of patients with inflammatory bowel disease Down-regulation of microRNAs of the miR-200 family and up-regulation of Snail and Slug in inflammatory bowel diseases - hallmark of epithelial-mesenchymal transition Peripheral blood microRNAs distinguish active ulcerative colitis and Crohn’s disease Circulating MicroRNA in inflammatory bowel disease MicroRNA-320a monitors intestinal disease activity in patients with inflammatory bowel disease Identification of microRNA-16-5p and microRNA-21-5p in feces as potential noninvasive biomarkers for inflammatory bowel disease Profiling circulating microRNA expression in experimental sepsis using cecal ligation and puncture Elevated circulating miR-150 and miR-342-3p in patients with irritable bowel syndrome Download references We thank Penn State College of Medicine for their constant support. We also acknowledge NIH BIOART source(https://bioart.niaid.nih.gov) for some of the copyright free images used in this manuscript Manmeet Rawat’s startup grant number: ‘BA/SU/MED/GAS/Rawat_M_ 120000003048’ from Penn State Department of Medicine The Penn State University College of Medicine All authors contributed substantially to discussion of the content All authors reviewed and/or edited the manuscript before submission The authors declare no competing interests Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations Reprints and permissions Download citation DOI: https://doi.org/10.1038/s44355-025-00022-2 Anyone you share the following link with will be able to read this content: a shareable link is not currently available for this article Sign up for the Nature Briefing newsletter — what matters in science Health Care Heroes Maryland Commission on Civil Rights Yolanda F Sonnier serves as deputy director of the Maryland Commission on[...] Paula Turner-Coleman serves as supervisor of science physical education and environmental literac[...] Kristen Stamile Kinkopf serves as executive director of The Richman Foundation serves as the executive director and CEO of the Maryland State Bar Association (MSBA) serves as a partner at Griffith Immigration Law in Baltimore a full-service law firm based in Baltimore[...] Sign up for your daily digest of Maryland news Supporting small businesses is an investment in Maryland’s prosperity – one that drives growth a[...] Listen to this article As I write this shortly after Earth Day 2025 I have on my desk a 46-page pub[...] Listen to this article Based on recent data provided by the U.S there was a si[...] I took the oath prescribed in Maryland Business Occupations[...] Listen to this article Maryland has a lot to celebrate when it comes to climate action but also muc[...] Lawmakers in Annapolis have passed hastily considered extended [...] Listen to this article In the past decade employers who sponsor pension plans have been subject to [...] Submit an entry for the business calendar The Daily Record is a digital-first daily news media company focused on law Get our free e-alerts & breaking news notifications Subscribe for access to the latest digital and special editions Click here for information about plaques permissions and reprints of previous editions Javascript is disabled in your web browser You can't access site without javascript so please enable it for your seamless and unintruppted user experience of our website that play a crucial role in regulating gene expression They function by binding to complementary sequences on messenger RNA (mRNA) molecules leading to mRNA degradation or inhibition of protein translation Several companies are advancing candidates relying on miRNAs in 2024 miRNAs have garnered significant attention due to their involvement in various diseases – alterations in miRNA expression profiles have been linked to cancer This connection positions miRNAs as both potential biomarkers for disease diagnosis and as therapeutic targets The therapeutic potential of miRNAs lies in their ability to modulate gene expression pathways researchers aim to restore normal gene expression patterns disrupted in disease states.  we take a look at seven up-and-coming companies in the field of miRNA aceRNA Technologies specializes in the development of mRNA-based therapeutics that leverage its proprietary RNA Switch technology the company focuses on enhancing the precision and safety of gene therapies by incorporating cell-type-specific control mechanisms The company’s RNA Switch technology is designed to regulate therapeutic gene expression based on the activity of specific miRNAs within target cells This approach enables the activation or suppression of therapeutic genes in response to intracellular miRNA levels reducing off-target effects and improving treatment specificity.  Incorporating miRNA-responsive elements allows aceRNA’s therapeutics to detect miRNA signatures unique to specific cell types or disease states the RNA Switch can ensure that therapeutic genes are only activated in cancer cells or other target tissues In May 2024, aceRNA Technologies announced the successful completion of a series B funding round raising $6.1 million (960 million JPY).  aceRNA Technologies’ innovative use of miRNA-responsive mRNA therapeutics positions it as a promising player in the RNA therapeutic landscape Founded as a spin-off from the University of Valencia ARTHEx focuses on creating RNA treatments for genetic diseases with a particular emphasis on myotonic dystrophy type 1 (DM1) DM1 is a genetic disorder characterized by progressive muscle wasting caused by an abnormal expansion of CTG repeats in the DMPK gene leading to toxic RNA accumulation and disrupted cellular functions The company’s lead investigational compound, ATX-01, is an antisense oligonucleotide designed to bind specifically to microRNAs that are abnormally overexpressed in the tissues of patients with DM1 By addressing the root cause of the disease – specifically toxic DMPK RNA and insufficient MBNL protein – ATX-01 aims to restore normal cellular function The therapy utilizes a fatty acid-conjugated oligonucleotide to enhance delivery to muscle tissue Food and Drug Administration (FDA) to initiate the phase 1/2a ArthemiR trial of ATX-01 for DM1.  Biorchestra is a South Korean biotechnology company specializing in RNA-based therapeutics aimed at treating neurodegenerative diseases the company focuses on developing solutions for conditions such as Alzheimer’s disease and amyotrophic lateral sclerosis (ALS) The company’s lead candidate, BMD-001, is designed to target microRNA-485-3p (miR-485-3p), which has been implicated in the pathogenesis of Alzheimer’s disease. Indeed, overexpression of miR-485-3p is associated with neuroinflammation and neurodegeneration. BMD-001 employs an antisense oligonucleotide approach to inhibit miR-485-3p, aiming to reduce amyloid-beta and tau protein accumulation To enhance delivery across the blood-brain barrier Biorchestra has developed a proprietary brain drug delivery system (BDDS) This system uses a polymeric complex based on polyethylene glycol (PEG) to enhance the stability and delivery of the antisense oligonucleotide This helps the therapeutic agent cross the blood-brain barrier and target neurological cells it ensures precise delivery to the central nervous system as well as decreased neuroinflammation.  In April 2023, Biorchestra announced progress in the BMD-001 program reporting broad biodistribution across the brain and effective target engagement These results support the progression of BMD-001 toward formal clinical studies for Alzheimer’s disease Cardior Pharmaceuticals is a German company specializing in the development of non-coding RNA-based therapeutics for cardiovascular diseases.  is an antisense oligonucleotide designed to inhibit microRNA-132 (miR-132) a regulator in pathological cardiac remodeling processes Elevated levels of miR-132 in cardiac tissue are associated with adverse remodeling and heart failure CDR132L aims to halt and reverse detrimental cardiac remodeling The miRNA targeting candidate cleared phase 1b clinical trial in 2020 and demonstrated a favorable safety profile and beneficial cardiac effects in heart failure patients CDR132L is currently in phase 2 for patients with reduced left ventricular ejection fraction after myocardial infarction The primary endpoint focuses on changes in left ventricular end-systolic volume In March, Novo Nordisk announced it would acquire Cardior Pharmaceuticals for up to €1.03 billion ($1.08 billion) The acquisition aims to bolster Novo Nordisk’s cardiovascular disease pipeline with CDR132L being a central component of the acquisition.  Ceria Therapeutics develops treatments for inflammatory disorders using miRNA delivery platforms The company’s proprietary technology focuses on conjugating miRNAs with cerium oxide nanoparticles (CNPs) to create stable therapeutics This approach enhances the delivery and activity of miRNA molecules.  The company’s first candidates rely on CNP-miR146a a miRNA with potent anti-inflammatory properties By targeting key pathways involved in inflammation and oxidative stress CNP-miR146a acts as a “molecular brake,” offering a novel approach to managing inflammatory diseases.  Resalis Therapeutics develops RNA-based therapies for the treatment of metabolic disorders the company focuses on targeting miRNA pathways to address conditions such as obesity is an antisense oligonucleotide designed to inhibit microRNA-22 (miR-22) a key regulator of lipid metabolism and energy homeostasis Overexpression of miR-22 has been linked to metabolic dysfunctions including increased lipid biosynthesis and reduced energy expenditure RES-010 aims to restore balance in these metabolic pathways offering a novel therapeutic approach to metabolic disorders In October 2024, Resalis Therapeutics announced a strategic equity investment from Sanofi to accelerate the development of RES-010 through clinical trials Resalis Therapeutics’ focus on miRNA-based therapies positions it as a promising player in the RNA therapeutics space With its innovative approach and growing support from major industry partners the company is poised to make significant contributions to the treatment of metabolic diseases TransCode Therapeutics is a clinical-stage oncology company based in Boston focused on developing RNA-based therapeutics to treat metastatic diseases The company aims to address advanced solid tumors by targeting specific miRNAs implicated in cancer progression is designed to inhibit microRNA-10b (miR-10b) which is recognized as a regulator of metastasis in various solid tumors Overexpression of miR-10b has been linked to increased tumor cell migration and invasion This trial is designed to evaluate the safety and preliminary efficacy of TTX-MC138 in patients with advanced solid tumors According to Grand View Research the global miRNA market was valued at approximately $1.58 billion and is projected to expand at a compound annual growth rate (CAGR) of 12.87% This growth is driven by the increasing recognition of miRNAs as critical regulators in various diseases the development of miRNA-based therapeutics faces several challenges Efficiently delivering miRNA therapeutics to specific tissues or cells remains a significant hurdle Ensuring that these molecules reach their intended targets without degradation or unintended effects is crucial for therapeutic efficacy miRNAs can also potentially interact with multiple mRNA targets Minimizing these off-target effects is essential to prevent adverse outcomes Ensuring the stability of miRNA therapeutics in the bloodstream and reducing potential immune responses are other critical challenges in the area Advancements in nanotechnology and targeted delivery systems are paving the way for more effective miRNA-based therapies Oncology R&D trends and breakthrough innovations As Europe’s top biotech website for over a decade Labiotech.eu offers trusted insights and updates for the global life sciences community Volume 15 - 2024 | https://doi.org/10.3389/fimmu.2024.1441733 This review will briefly introduce microRNAs (miRNAs) and dissect their contribution to multiple sclerosis (MS) and its clinical outcomes we provide a concise overview of the present knowledge of MS pathophysiology delving into the role of selectively expressed miRNAs in clinical forms of this disease as measured in several biofluids such as serum up-to-date information on current strategies applied to miRNA-based therapeutics will be provided including miRNA restoration therapy (lentivirus expressing a specific type of miRNA and miRNA mimic) and miRNA inhibition therapy such as antisense oligonucleotides it will highlight future directions and potential limitations associated with their application in MS therapy emphasizing the need for improved delivery methods and validation of therapeutic efficacy MicroRNA (miRNAs) are crucial in regulating gene expression mainly operating via post-transcriptional mechanisms that may influence various physiological processes Multiple sclerosis (MS) is a chronic immune-mediated disorder of the central nervous system (CNS) there has been a crucial advancement in MS etiology and treatment which motives us to explore novel therapeutic strategies This review will cover the current knowledge of miRNAs in MS and explore their role in disease pathogenesis as biomarkers with therapeutic potentials we will examine novel miRNA-based therapeutic approaches such as miRNA restoration and inhibition therapies highlighting their potential in MS therapeutic arsenal we will address the challenges and future direction of miRNA-based therapies in MS emphasizing the utmost need for overcoming barriers to clinical translation miRNAs are small, single stranded, non-coding RNA molecules ranging in size from 18 to 24 nucleotides long, with an average length of 22 nucleotides. They play a crucial role in post-transcription regulation of gene expression by binding to complementary sequences in the messenger RNA (mRNA), leading to either mRNA degradation or inhibition of its translation into protein (1) where RNA polymerase II (RNAPII)-dependent transcription produces a capped and polyadenylated transcript termed primary miRNA (pri-miRNA) The pri-miRNA undergoes processing mediated by the Drosha yielding smaller stem-looped structures termed precursor miRNA (pre-miRNA) These pre-miRNAs are eventually exported from the nucleus by their transporter a RNase III endonuclease (Dicer) further processes the pre-miRNA the mature miRNA then integrates into the miRNA-induced silencing complex (miRISC) the mature miRNA interacts with the complementary sequences predominantly situated in the 3’-untranslated regions (3’-UTRs) of mRNA leading to post-translational gene silencing Overview of blocking and activation strategies to modulate miRNA expression: Blocking miRNA expression can be achieved through various methods such as antisense oligonucleotides (ASOs) which are single-stranded oligodeoxynucleotides bind to RNA and prevent its attachment to the ribosome or block protein translation Small molecule inhibitors regulate post-transcriptional expression of disease-associated genes potentially reversing dysfunctional pathways prevent miRNA from interacting with its target mRNA bind specific target molecules and can prevent miRNA-mRNA interactions or induce miRNA degradation block miRNA expression by forming stable duplexes or preventing their interaction with target mRNAs activation or restoration therapy involves using miRNA mimics These are double-stranded and chemically modified to improve cellular uptake and stability mimicking the function of mature endogenous miRNAs shRNA lentivirus expression systems efficiently overexpress specific miRNAs Both approaches are utilized in gain-of-function studies MS is a chronic immune-mediated disease affecting the CNS. Although its exact etiology remains unknown, it is believed to result from a combination of genetic and environmental factors, such as past Epstein Barr virus (EBV) infection, tobacco exposure, or low vitamin D (13–16) Significant strides have been made in our understanding of cell-free miRNAs in MS over the past decade. Studies highlight the advantages of these easily accessible biomarkers for potential clinical use (32) research has revealed various cell-free miRNAs may have implication in the pathogenesis of MS miR-23a and miR-15b levels showed high diagnostic prospect Differential CSF miRNA expression (e.g miR-142-5p) correlated with clinical progression DMTs have unveiled associations between miRNAs expression levels- such as miR-142-3p and miR-146a-5p- and treatment response to DMF miR-548a-3p expression has been associated with treatment response to fingolimod Significant progress has been made in the study of exosomal miRNAs in MS. A recent study identified miR-18a-5p, Let-7g-5p, miR-374a-5p and miR-145-5p as having both pro- and anti-inflammatory actions. Notably, miR-342-3p and miR-150-5p exhibited anti-inflammatory properties. These miRNAs were significantly upregulated in both serum-derived exosomes and CSF of patients with RRMS compared to HC (47) Selected miRNA-based biomarkers in multiple sclerosis these studies elucidated the role of miRNAs distinct miRNAs panel shows promise for differentiating between clinical forms of MS MiRNAs offer several advantages as biomarkers for disease and treatment response monitoring They exhibit high stability in body fluids such as serum The use of miRNAs facilitates non-invasive techniques for sample collection An approach to blocking miRNAs expression includes antisense oligonucleotides (ASOs), small molecule inhibitors, LNAs, anti-miRNAs oligonucleotides (AMO), aptamers, and antagomirs (Figure 1B) To date, some miRNAs therapeutics have been in clinical trials for Hepatitis C (NCT02452814), wounds (NCT03603431), and non-small-cell lung cancer (NCT02369198), among other conditions (62) Potential applications of miRNAs should focus on identifying molecules related to demyelination and remyelination and investigating their therapeutic potential to develop strategies for promoting neurorepair and reducing neuroinflammation in MS Challenges associated with miRNAs research include identifying the most promising miRNAs candidates for therapeutic applications in MS This challenge arises primarily due to the limited sample sizes often encountered in miRNAs studies making it unclear whether observed effects are consistent and reproducible across larger populations Robust validation through larger-scale studies or meta-analyses is essential to confirm the therapeutic potential of identified miRNAs Another significant complication in miRNAs therapeutics is the mode of delivery Many current delivery methods face barriers in efficiently transporting miRNAs across biological barriers such as the BBB in the case of MS Overcoming the delivery challenges is crucial to ensure therapeutic miRNAs can reach the CNS and exert their intended effects there is a high need to minimize variability by implementing standardized protocols both intra and inter lab environment Optimization of normalization methods is crucial to ensure accurate representation of biological conditions rigorous application of quality control protocols is essential to mitigate sources of error and enhance the predictive power of miRNA-based assays achieving CNS-specific targeting is essential for miRNAs therapeutics to minimize off-target effects and maximize efficacy Designing delivery systems or modifying miRNAs to enhance CNS specificity can help tailor treatments to the disease sites while minimizing adverse effects on healthy tissues addressing toxicity-related concerns is vital for the safe and effective use of miRNAs therapeutics It is crucial to ensure that therapeutic miRNAs do not elicit harmful immune responses or undesired side effects where miRNAs inadvertently modulate unintended gene expression pose another challenge that must be solved Designing miRNAs mimics or inhibitors with improved specificity can help mitigate off-target effects and may improve the precision of miRNA-based therapies in MS The stability of therapeutic miRNAs during storage and delivery is another critical consideration that needs to be addressed Developing strategies to protect miRNAs from degradation and maintain their activity over time is essential for ensuring the efficacy of miRNAs-based treatments while miRNAs therapeutics hold significant promise for treating various diseases addressing the challenges of candidate selection and stability is essential for realizing their full potential in clinical applications by developing new therapies in MS The author(s) declare financial support was received for the research SM was supported by the grant from Instituto Salud Carlos III (PI20/01697) and cofunded by the European Union During the preparation of this work the author(s) used Chat GPT to improve the readability of the content The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher MicroRNAs: small RNAs with a big role in gene regulation PubMed Abstract | Crossref Full Text | Google Scholar The Drosha-DGCR8 complex in primary microRNA processing Microprocessor of microRNAs: regulation and potential for therapeutic intervention and degradation of RNA-induced silencing complex The non-canonical aspects of microRNAs: many roads to gene regulation PubMed Abstract | Crossref Full Text | Google Scholar miRNA nomenclature: A view incorporating genetic origins PubMed Abstract | Crossref Full Text | Google Scholar Extracellular miRNAs: from biomarkers to mediators of physiology and disease Extracellular miRNAs and cell-cell communication: problems and prospects and methods for exosome isolation and analysis MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins PubMed Abstract | Crossref Full Text | Google Scholar Longitudinal analysis reveals high prevalence of Epstein-Barr virus associated with multiple sclerosis International Multiple Sclerosis Genetics Consortium Multiple sclerosis genomic map implicates peripheral immune cells and microglia in susceptibility Environmental risk factors and multiple sclerosis: an umbrella review of systematic reviews and meta-analyses Defining the clinical course of multiple sclerosis: the 2013 revisions Multiple sclerosis progression: time for a new mechanism-driven framework Diagnosis of multiple sclerosis: 2017 revisions of the McDonald criteria Multiple sclerosis: time for early treatment with high-efficacy drugs Effect of changes in MS diagnostic criteria over 25 years on time to treatment and prognosis in patients with clinically isolated syndrome Association of very early treatment initiation with the risk of long-term disability in patients with a first demyelinating event Practice guideline recommendations summary: Disease-modifying therapies for adults with multiple sclerosis: Report of the Guideline Development and Implementation Subcommittee of the American Academy of Neurology ECTRIMS/EAN Guideline on the pharmacological treatment of people with multiple sclerosis Ocrelizumab versus placebo in primary progressive multiple sclerosis Atrophied brain T2 lesion volume at MRI is associated with disability progression and conversion to secondary progressive multiple sclerosis Paramagnetic rim lesions predict greater long-term relapse rates and clinical progression over 10 years Central nervous system atrophy predicts future dynamics of disability progression in a real-world multiple sclerosis cohort The potential of serum neurofilament as biomarker for multiple sclerosis Body fluid biomarkers in multiple sclerosis PubMed Abstract | Crossref Full Text | Google Scholar Circulating miRNAs as potential biomarkers distinguishing relapsing-remitting from secondary progressive multiple sclerosis Circulating microRNAs correlate with structural and functional MRI parameters in patients with multiple sclerosis and miR-376c-3 in multiple sclerosis patients Decreased circulating miRNA levels in patients with primary progressive multiple sclerosis miRNA signature in CSF from patients with primary progressive multiple sclerosis MicroRNA regulation of inflammatory responses doi: 10.1146/annurev-immunol-030409-101333 Crossref Full Text | Google Scholar Potential prognostic value of circulating inflamma-miR-146a-5p and miR-125a-5p in relapsing-remitting multiple sclerosis Analysis of miRNA signatures in CSF identifies upregulation of miR-21 and miR-146a/b in patients with multiple sclerosis and active lesions Alterations of the miR-126-3p/POU2AF1/spi-B axis and JCPyV reactivation in multiple sclerosis patients receiving natalizumab Association between serum microRNAs and magnetic resonance imaging measures of multiple sclerosis severity Early miR-320b and miR-25-3p miRNA levels correlate with multiple sclerosis severity at 10 years: a cohort study MiR-142-3p regulates synaptopathy-driven disease progression in multiple sclerosis Natalizumab alters transcriptional expression profiles of blood cell subpopulations of multiple sclerosis patients miRNA 548a-3p as biomarker of NEDA-3 at 2 years in multiple sclerosis patients treated with fingolimod Multiplex analysis of cerebrospinal fluid and serum exosomes microRNAs of untreated relapsing remitting multiple sclerosis (RRMS) and proposing noninvasive diagnostic biomarkers Mesenchymal stem cell-derived exosomal microRNA-367-3p alleviates experimental autoimmune encephalomyelitis via inhibition of microglial ferroptosis by targeting EZH2 Altered expression of miR-326 in T cell-derived exosomes of patients with relapsing-remitting multiple sclerosis The role for exosomal microRNAs in disruption of regulatory T cell homeostasis in multiple sclerosis Exosomal microRNA signatures in multiple sclerosis reflect disease status Lentivirus-mediated long-term overexpression of specific microRNA for complementary miRNA pairs in mammalian cells Crossref Full Text | Google Scholar Next-generation poly-L-histidine formulations for miRNA mimic delivery Antisense oligonucleotides: an emerging area in drug discovery and development Small molecule-mediated targeting of microRNAs for drug discovery: Experiments Locked nucleic acid (LNA): A modern approach to cancer diagnosis and treatment miRNA: A promising therapeutic target in cancer Anti-miRNA oligonucleotides: A comprehensive guide for design Recent advances in aptamer discovery and applications PubMed Abstract | Crossref Full Text | Google Scholar Advances in detection of infectious agents by aptamer-based technologies Utilizing antagomiR (antisense microRNA) to knock down microRNA in murine bone marrow cells RNA-based therapeutics: from antisense oligonucleotides to miRNAs PubMed Abstract | Crossref Full Text | Google Scholar Montalban X and Malhotra S (2024) MiRNA-based therapeutic potential in multiple sclerosis Received: 31 May 2024; Accepted: 13 August 2024;Published: 29 August 2024 Copyright © 2024 Zabalza, Pappolla, Comabella, Montalban and Malhotra. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) distribution or reproduction in other forums is permitted provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited in accordance with accepted academic practice distribution or reproduction is permitted which does not comply with these terms *Correspondence: Sunny Malhotra, c3VubnkubWFsaG90cmFAdmhpci5vcmc= †These authors have contributed equally to this work and share first authorship Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher 94% of researchers rate our articles as excellent or goodLearn more about the work of our research integrity team to safeguard the quality of each article we publish Metrics details which can be controlled by alteration of gene expression is considered a key event in Amyotrophic Lateral Sclerosis (ALS) Transcriptomic deregulation of miRNAs expression can spread via “horizontal” RNA transfer through extracellular vesicles (EVs) to act in conjunction with proteins which can provide early signals to indicate forthcoming neuropathological changes in the brain The aim of this work is to compare expression profiles (obtained by miRNA-seq) from different tissues to highlight commonly expressed and tissue-specific miRNAs miRNA species from plasma EVs were correlated with miRNA profiles obtained from peripheral blood mononuclear cells (PBMCs) Each tissue from ALS patients was compared to controls revealing 159 deregulated (DE) miRNAs in Exosomes (EXOs) 247 DE miRNAs in PBMCs and 162 DE miRNAs in Microvesicles (MVs) data were filtered to include only miRNAs expressed in disease samples (not in healthy subjects) to reduce the number of tissue- and ALS- specific miRNAs (EXO n = 22 We identified specific miRNAs and pathways related to each tissue in PBMCs we found mainly neuro-linked pathways we found miRNAs implicated in MAPK and ERB signaling the altered pathways in MVs were not specific This study shows that the composition of small RNA differs significantly between blood cells and its respective EVs fraction Differentially expressed miRNAs can target definite transcripts in different cellular and molecular fractions future studies will focus on the interaction between cells and EXOs Emerging evidence suggests dysregulation of miRNAs expression profiles in ALS patients as well as in cellular and animal models of the disease Altered expression levels of specific miRNAs have been implicated in the modulation of key pathways involved in ALS pathogenesis several miRNAs have been identified as potential biomarkers for disease diagnosis it is possible that miRNA expression can spread via “horizontal” RNA transfer through EVs to act in conjunction with proteins This study aims to investigate the miRNA landscape within EVs Our primary objectives are to identify miRNAs that exhibit disease-specific signatures and discern their tissue specificity we endeavor to unravel the gene targets of these identified miRNAs shedding light on the molecular pathways contributing to ALS pathogenesis The investigation into EVs and PBMCs serves as a strategic approach taking advantage of the systemic nature of ALS pathology and the potential of these compartments to reflect disease-related alterations Through advanced miRNA profiling techniques we aim to pinpoint specific miRNAs that may serve as robust biomarkers distinguishing ALS patients from healthy controls and shedding light on the underlying molecular events This study strives to contribute to the growing body of knowledge surrounding ALS by providing a comprehensive analysis of miRNA profiles in EVs and PBMCs The integration of bioinformatics and experimental approaches aims to unravel the intricate web of miRNA-gene interactions Recruitment resulted in 26 ALS patients and 11 age- and sex-matched healthy controls (Table 1, Table S1)) All subjects provided written informed consent (Protocol n° 20180034329) Only subjects not affected by any neurological condition or other relevant comorbidities were selected as “healthy controls” Italy) conducted clinical and neurological checkups of ALS patients who were diagnosed with ALS as defined by the El Escorial criteria genetic screening was conducted to exclude patients carrying mutations in FUS The control subjects were recruited at the Transfusional Service and Centre of Transplantation Immunology The Ethical Committee of the IRCCS Mondino Foundation (Pavia Italy) approved the study protocol to obtain peripheral blood from patients and controls All the experiments were performed in accordance with relevant guidelines and regulations The obtained EXOs pellet was processed for analysis Total RNA have been extracted from PBMCs using TRIzol™ reagent (ThermoFisher Scientific) while for EVs (both EXOs and MVS) miRNeasy Serum/Plasma kit (QIAGEN) have been employed RNA quantification and quality evaluation have been carried out using a Nanodrop ND-100 Spectrophotometer (Nanodrop Technologies) and a Tape Station 4200 (Agilent) respectively Libraries for miRNA sequencing have been prepared using the Small RNA-Seq Library Prep kit (Lexogen) according to the user manual. Sequencing steps have been carried out on the Illumina NextSeq 500. FastQ files were generated via Illumina bcl2fastq2 (Version 2.17.1.14 http://support.illumina.com/downloads/bcl2fastq-conversion-software-v217.html) Once the abundance of each miRNA was calculated and counts were available removing miRNAs with zero counts in more than 2/3 of the samples in the same tissue different thresholds were applied for different tissues (t1 for EXO and MV Expressed miRNA: a miRNA for which reads count is above the threshold in at least one sample per condition (or tissue); Tissue specific miRNA: a miRNA for which reads count is above the threshold for more than 50% of the samples from the same tissue; Condition specific miRNA: a tissue-specific miRNA (as described above) that is expressed only in samples from patients affected by the same condition (“overall” if expressed in EXO or specifically for each tissue otherwise) and absent from samples of all the other patients MiRNAs have been mapped on miRBase hairpins using SHRiMP Differential expression analysis for miRNAs has been performed with the R package DESeq Transcripts have been considered differentially expressed (DE) and retained for further analysis with |log2(disease sample/healthy control)| ≥ 1 and a FDR ≤ 0.1 In this work, we analyzed miRNA cargo in PBMCs and plasmatic EXOs and MVs from ALS patients and matched controls. The goal was to compare expression profiles from different tissues such as PBMCs, EXOs and MVs, in order to highlight commonly expressed miRNAs and perform functional enrichment analysis. Differential expression analysis in EXO MV and PBMCs of sALS patients and Healthy Controls (A) Heatmap for top abundant miRNAs and (B) Principal component analysis (PCA) for expressed miRNAs in all tissues The heatmap shows a clear clustering based on tissue type and differences between ALS patients and controls The PCA plot further emphasizes these distinctions with PBMC samples forming a separate cluster along PC1 ALS samples shift within their respective clusters indicating disease-specific miRNA regulation The lower dysregulation observed in PBMCs may be explained by their stability as whole cells which are less influenced by transient changes compared to EVs EVs are constantly changing and act like messengers carrying information about the state of the cells they come from This could explain why the miRNA levels in EVs vary more compared to other samples Despite the adoption of stringent measures to reduce noise in the data (miRNA filtering and different thresholds for each tissue type) the dynamic nature of EVs can still inherently bring noise in terms of the differences analyzed let-7b-5p and miRNA 10a-5p are expressed in a common way in all analyzed tissues In order to understand common miRNAs of the six groups, we calculated the intersection of expressed miRNAs with http://bioinformatics.psb.ugent.be/webtools/Venn/ Venn diagram showing numbers of common miRNAs between MVs and PBMCs (A) between EXOs and MVs (B) and between PBMCS and EXOs (C) from ALS patients (Disease) and controls miRNAs are listed in Table supplementary S2 we analyzed miRNA data to identify miRNAs that were specific for tissues and All miRNAs were classified with respect to the classes described above (“expressed miRNA” is strictly linked to the rules and thresholds imposed on read counts during the analysis step due to the variability of the tissues and the different number of samples per tissue t1 = 5 and t2 = 50 were used as thresholds These values were empirically determined by evaluating the expressed miRNAs in all classes for each threshold pair considering an increment of 1 and an increment of 10 for t1 and t2 respectively (from t1 = 1 and t2 = 10 to t1 = 5 and t2 = 50) Once the thresholds were chosen and the expression table generated we focused on all tissue-specific miRNAs for ALS samples thus identifying all overexpressed or underexpressed miRNAs Tissue-specific miRNAs for ALS samples Box orange showed the number of miRNAs expressed in ALS samples the second box showed the number of miRNAs expressed in ALS but not in CTR The same workflow is rappresented in blue for EXOs and green for MVs All miRNAs are listed in Table supplementary S4 In PBMCs, we identified 11 miRNAs that were expressed exclusively in ALS patients, 22 expressed only in ALS EXOs and 8 specific for MVs from ALS patients (Fig. 3) EXOs showed the greatest number of specific miRNAs suggesting the importance of miRNAs cargo in EXOs in ALS patients Pathway analysis for miRNAs MVs-specific (Fig. 4) showed an important involvement of synaptic vesicle principally related to miR-4284. Heatmap map calculator of pathways for selected miRNAs MVs-specific, selection is based on evidence “experimental strong” (https://mpd.bioinf.uni-sb.de/heatmap_calculator.html?organism=hsa), so the numer of rapresented miRNA is lower than reported in Fig. 3 On Y axes are reported miRNAs while in X axes are reported associated pathways Graphical representation of experimentally validated targets of Hsa-miR-4284 (A) 331-3p (B) and 664-3p (C) found by miRWalk in miRTarBase for MVs samples In EXOs, 22 miRNAs specific for this tissue and for ALS disease have been identified. Based on the literature, numerous targets of these miRNAs have not been described; in fact, only 8 miRNAs have been included in pathway analysis (Fig. 6). Heatmap map calculator of pathways for selected miRNAs EVs-specific, selection is based on evidence “experimental strong” (https://mpd.bioinf.uni-sb.de/heatmap_calculator.html?organism=hsa) Graphical representation of experimentally validated targets Hsa-miR-133a-3p (A) 320c (B) and 449a (C) found by miRWalk in miRTarBase for EXOs samples Heatmap map calculator of pathways for selected miRNAs PBMCs-specific, selection is based on evidence “experimental strong” (https://mpd.bioinf.uni-sb.de/heatmap_calculator.html?_organism=hsa). On Y axes are reported miRNAs while in X axes are reported associated pathways. Graphical representation of experimentally validated targets Hsa-miR-206 (found by miRWalk in miRTarBase for EXOs samples Validated miRNA have been selected based on relation to association with gene target and ALS disease miRNAs and gene target validation by qPCR in PBMCs (A and B) and in EXOs (C and D) samples a specific molecular signature given by the different gene expression profiles detectable in the various phenotypes of sporadic ALS patients have yet been done on miRNA deregulation profiles the future challenge of the work we are proposing will be to identify a molecular signature based on miRNA deregulation that is specific to the different phenotypic groups of sporadic ALS patients The combined study of the two molecular profiles will laid the groundwork for the inclusion of ALS patients in future clinical trials that consider phenotypic biomarkers in addition to clinical parameters ensuring the best patient response and the most appropriate assignment of the patient into a specific therapeutic procedure We then compared the expression profiles in each tissue between ALS patients and controls finding that EVs were most affected by changes in miRNA expression This suggests that the differentially expressed miRNAs in EVs may be consistent data which is involved in intracellular signal transduction and angiogenesis in response to extracellular signals This study demonstrates that ALS may have a specific signature in different blood components allowing detection of miRNAs that show disease-specific characteristics and tissue specificity we observed significant changes in miRNAs related to muscle development the main altered miRNAs are linked to the extracellular matrix Our data suggest a more specific signature related to pathways and miRNA targets in exosomes and PBMCs we propose that miRNA levels may serve as a starting point for identifying a specific signature for ALS potentially leading to a future study focused on a small group of miRNAs that could serve as peripheral biomarkers for ALS Further research is needed with larger cohorts at different stages of the disease to understand whether the deregulation of these RNAs correlates with specific clinical windows (e.g. The study we are proposing includes a rather homogenous cohort of sALS patients although the rarity of the condition limited recruitment and sample size It should also be noted that from the same starting sample miRNA-seq analysis and validation by RT-qPCR This certainly limited the possibility of confirming our data with different techniques other than those proposed or augmenting the studies performed on this cohort of ALS patients our data demonstrate significant differences’ in the composition of small RNA between blood cells and its respective EVs fraction Differentially expressed miRNAs target specific transcripts across different cellular and molecular fractions MVs do not exhibit ALS-specific miRNA cargo while the miRNA cargo in EXOs and the interaction with PBMCs present interesting points for further investigation in ALS research The RNA-sequencing datasets for this manuscript are publicly available as they are linked to the GEO repository (GSE155700 Hardiman, O. et al. Amyotrophic lateral sclerosis. Nat. Rev. Dis. Prim. 3, 17071. https://doi.org/10.1038/nrdp.2017.71 (2017) D’Erchia, A. M. et al. Massive transcriptome sequencing of human spinal cord tissues provides new insights into motor neuron degeneration in ALS. Sci. Rep. 7. https://doi.org/10.1038/s41598-017-10488-7 (2017) Zhao, W. et al. Characterization of gene expression phenotype in amyotrophic lateral sclerosis monocytes. JAMA Neurol. 74, 677–685. https://doi.org/10.1001/jamaneurol.2017.0357 (2017) Gagliardi, S. et al. Long non-coding and coding RNAs characterization in peripheral blood mononuclear cells and spinal cord from amyotrophic lateral sclerosis patients. Sci. Rep. 8. https://doi.org/10.1038/s41598-018-20679-5 (2018) Zucca, S. et al. RNA-Seq profiling in peripheral blood mononuclear cells of amyotrophic lateral sclerosis patients and controls. Sci. Data. 6, 190006. https://doi.org/10.1038/sdata.2019.6 (2019) Garofalo, M. et al. RNA molecular signature profiling in PBMCs of sporadic ALS patients: HSP70 overexpression is associated with nuclear SOD1. Cells 11 https://doi.org/10.3390/cells11020293 (2022) Gomes, B. C. et al. Differential expression of MiRNAs in amyotrophic lateral sclerosis patients. Mol. Neurobiol. 60 (12), 7104–7117. https://doi.org/10.1007/s12035-023-03520-7 (2023) Théry, C. et al. A position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. J. Extracell. Vesicles. 7, 1535750. https://doi.org/10.1080/20013078.2018.1535750 (2018) Minimal information for studies of extracellular vesicles 2018 (MISEV2018 Cocucci, E. & Meldolesi, J. Ectosomes and exossomes: shedding the confusion between extracellular vesicles. Trends Cell. Biol. 25, 364–372. https://doi.org/10.1016/j.tcb.2015.01.004 (2015) Sproviero, D. et al. Different MiRNA profiles in plasma derived small and large extracellular vesicles from patients with neurodegenerative diseases. Int. J. Mol. Sci. (2021) Mar. 8, 22(5):2737. https://doi.org/10.3390/ijms22052737 Sproviero, D. et al. Extracellular vesicles derived from plasma of patients with neurodegenerative disease have common transcriptomic profiling. Front. Aging Neurosci. (2022) Feb 16, 14:785741. https://doi.org/10.3389/fnagi.2022.785741 Kim, J. A. et al. Small RNA sequencing of Circulating small extracellular vesicles MicroRNAs in patients with amyotrophic lateral sclerosis. Sci. Rep. (2023) Apr 4, 13(1):5528. https://doi.org/10.1038/s41598-023-32717-y Cordero, F. et al. Optimizing a massive parallel sequencing workflow for quantitative MiRNA expression analysis. PLoS One. 7 (2), e31630. https://doi.org/10.1371/journal.pone.0031630 (2012) Kulkarni, N. et al. Reproducible bioinformatics project: a community for reproducible bioinformatics analysis pipelines. BMC Bioinform. Oct 15 (Suppl 10), 349. https://doi.org/10.1186/s12859-018-2296-x (2018) Mazin, A. V. et al. Rad54, the motor of homologous recombination, DNA repair (Amst). Mar 2, 9(3):286–302. (2010). https://doi.org/10.1016/j.dnarep.2009.12.006 Kuleshov, M. V. S. et al. Enrichr: a comprehensive gene set enrichment analysis web server 2016 update. Nucleic Acids Res. 44 (1), 90–97. https://doi.org/10.1093/nar/gkw377 (2016) Bi, F. et al. Reactive astrocytes secrete lcn2 to promote neuron death. Proc. Natl. Acad. Sci. U S A. Mar 5 (10), 4069–4074. https://doi.org/10.1073/pnas.1218497110 (2013) Sticht, C. et al. MiRWalk: an online resource for prediction of MicroRNA binding sites. PLoS One. Oct 18 (10). https://doi.org/10.1371/journal.pone.0206239 (2018) Raheja, R. et al. Correlating serum Micrornas and clinical parameters in amyotrophic lateral sclerosis. Muscle Nerve. 58 (2), 261–269. https://doi.org/10.1002/mus.26106 (2018) Afonso, G. J. M., Cavaleiro, C., Valero, J. & Mota, S. I. Ferreiro. Recent advances in extracellular vesicles in amyotrophic lateral sclerosis and emergent perspectives. Cells 12 (13), J1. https://doi.org/10.3390/cells12131763 (2023) Perner, C. et al. Dysregulation of chemokine receptor expression and function in leukocytes from ALS patients. J. Neuroinflammation. Mar 28 (1), 99. https://doi.org/10.1186/s12974-018-1135-3 (2018) Wong, K. M. et al. Mutations in TAF8 cause a neurodegenerative disorder. Brain (2022) Sep. 14, 145(9):3022–3034. https://doi.org/10.1093/brain/awac154 Pegoraro, V., Merico, A. & Angelini, C. Micro-RNAs in ALS muscle: differences in gender, age at onset and disease duration. J. Neurol. Sci. 380, 58–63. https://doi.org/10.1016/j.jns.2017.07.008 (2017) Freischmidt, A. et al. Systemic dysregulation of TDP-43 binding MicroRNAs in amyotrophic lateral sclerosis. Acta Neuropathol. Commun. 1 (42). https://doi.org/10.1186/2051-5960-1-42 (2013) Ma, G. et al. MiR-206, a key modulator of skeletal muscle development and disease. Int. J. Biol. Sci. Feb 5 (3), 345–352. https://doi.org/10.7150/ijbs.10921 (2015) Chiò, A. et al. Phenotypic heterogeneity of amyotrophic lateral sclerosis: a population based study. J. Neurol. Neurosurg. Psychiatry. https://doi.org/10.1136/jnnp.2010.235952 (2011) Dragoni, F. et al. Whole transcriptome analysis of unmutated sporadic ALS patients’ peripheral blood reveals phenotype-specific gene expression signature. Neurobiol. Dis. 206, 106823. https://doi.org/10.1016/j.nbd.2025.106823 (2025) Albanese, M. et al. Hammerschmidt. MicroRNAs are minor constituents of extracellular vesicles that are rarely delivered to target cells. PLoS Genet. 17 (12), e1009951. https://doi.org/10.1371/journal.pgen.1009951 (2021) Ayka, A. & Şehirli, A. Ö. The role of the SLC transporters protein in the neurodegenerative disorders. Clin. Psychopharmacol. Neurosci. (2020) May 31, 18(2):174–187. https://doi.org/10.9758/cpn.2020.18.2.174 Xue, Y. C. et al. Dysregulation of RNA-Binding proteins in amyotrophic lateral sclerosis. Front. Mol. Neurosci. (2020) May 29, 13:78. https://doi.org/10.3389/fnmol.2020.00078 Conlon, E. G., Manley, J. L. & Genes Dev. RNA-binding proteins in neurodegeneration: mechanisms in aggregate,. Aug 1, 31(15):1509–1528. (2017). https://doi.org/10.1101/gad.304055.117 Podmanicky, O. et al. Mitochondrial aminoacyl-tRNA synthetases trigger unique compensatory mechanisms in neurons. Hum. Mol. Genet. 435–447. https://doi.org/10.1093/hmg/ddad196 (2024) Nataf, S. & Pays, L. Gene co-expression analysis unravels a link between C9orf72 and RNA metabolism in myeloid cells. Acta Neuropathol. Commun. (2015) Oct. 15, 3:64. https://doi.org/10.1186/s40478-015-0242-y Baker, D. J. et al. Lysosomal and phagocytic activity is increased in astrocytes during disease progression in the SOD1 (G93A) mouse model of amyotrophic lateral sclerosis. Front. Cell. Neurosci. (2015) Oct. 15;9:410. https://doi.org/10.3389/fncel.2015.00410 ADAM10 as a therapeutic target for brain diseases: from developmental disorders to Alzheimer’s disease Foggin, S. et al. Biological significance of MicroRNA biomarkers in ALS-Innocent bystanders or disease culprits?? Front neurol. Jun 11, 10:578. https://doi.org/10.3389/fneur.2019.00578 (2019) Sogorb-Esteve, A. et al. Levels of ADAM10 are reduced in Alzheimer’s disease CSF. J. Neuroinflammation. 15, 213. https://doi.org/10.1186/s12974-018-1255-9 (2018) Song, F. et al. Cleavage site-directed antibodies reveal the prion protein in humans is shed by ADAM10 at Y226 and associates with misfolded protein deposits in neurodegenerative diseases. Acta Neuropathol. 148, 2. https://doi.org/10.1007/s00401-024-02763-5 (2024) Chen, E. Y. Enrichr: interactive and collaborative HTML5 gene list enrichment analysis tool. BMC Bioinform. 14, 128. https://doi.org/10.1186/1471-2105-14-128 (2013) Ferrari, R. et al. FTD and ALS: a Tale of two diseases. Curr. Alzheimer Res. (2011) May, 8(3):273–294. https://doi.org/10.2174/156720511795563700 Przanowska, R. K. et al. miR-206 family is important for mitochondrial and muscle function, but not essential for myogenesis in vitro. FASEB J. (2020) Jun, 34(6):7687–7702. https://doi.org/10.1096/fj.201902855RR Liscic, R. M. Als and Ftd: insights into the disease mechanisms and therapeutic targets. Eur. J. Pharmacol. 15, 817: 2–6. https://doi.org/10.1016/j.ejphar.2017.10.012 (2017) Takahashi, Y. et al. ERBB4 mutations that disrupt the neuregulin-ErbB4 pathway cause amyotrophic lateral sclerosis type 19. Am. J. Hum. Genet. (2013) Nov 7, 93(5):900–905. https://doi.org/10.1016/j.ajhg.2013.09.008 Arbour, D., Vande Velde, C. & Robitaille, R. New perspectives on amyotrophic lateral sclerosis: the role of glial cells at the neuromuscular junction. J. Physiol. Feb 1 (3), 647–661. https://doi.org/10.1113/JP270213 (2017) Tan, Y. et al. Downregulated miR-204 promotes skeletal muscle regeneration. Biomed. Res. Int. Nov 17, 2020 (3183296). https://doi.org/10.1155/2020/3183296 (2020) Margiotta, A. Role of snares in neurodegenerative diseases. Cells 10 (5), 991. https://doi.org/10.3390/cells10050991 (2021) Download references We would like to thank patients and their families who participated in the study without whom this work would have not been possible This study was funded by Ricerca Corrente 2025-2027 Writing - original draft; CV: Validation; DL: Funding acquisition; Investigation; MB RB: Methodology; DGR: data curation; OP: Supervision Writing – original draft and Writing - review & editing All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the Helsinki declaration and its later amendments or comparable ethical standards The study design was examined by the IRBs of the enrolling institutions The study protocol to obtain blood from patients and healthy controls was approved by the Ethical Committee of the IRCCS Mondino Foundation (Pavia Informed consent was obtained from all subjects involved in the study Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations Below is the link to the electronic supplementary material Download citation DOI: https://doi.org/10.1038/s41598-025-99206-2 Metrics details This study aims to screen and identify microRNA (miRNA) expression profiles across different stages of prostate cancer (PCa) and benign prostatic hyperplasia (BPH) using high-throughput sequencing The study seeks to determine whether specific miRNAs show consistent differential expression across various stages of PCa with the goal of identifying potential biomarkers relevant to disease progression a total of 12 specimens of PCa and BPH were collected from September 2021 to June 2022 in the Second Affiliated Hospital of Nanchang University China (including 3 specimens of early localized tumor and distant metastasis tumor and 3 specimens of BPH) The expression profile of miRNA was screened by high-throughput sequencing technology and the differentially expressed miRNA between each group was screened by relevant bioinformatics analysis Further targeted miRNA site analysis GO enrichment analysis and KEGG enrichment analysis of miRNA-derived genes were performed on the above differentially expressed miRNAs the expression of hsa-miR-6715b-3p in PCa tissues was verified using qRT-PCR assay A total of 1526 miRNAs were identified through high-throughput sequencing 228 differentially expressed miRNAs were identified with 100 upregulated and 128 downregulated qRT-PCR results showed that hsa-miR-6715b-3p was highly expressed in PCa tissues compared to BPH tissues This study presents a preliminary investigation of the miRNA expression profiles in PCa and identifies hsa-miR-6715b-3p as a promising biomarker for disease progression Our findings validate the high expression of hsa-miR-6715b-3p in PCa tissues and highlight its potential role in critical oncogenic pathways These results provide a theoretical foundation for further functional studies to explore its clinical utility and its role in therapy resistance and disease progression contributing to the growing knowledge of miRNA-based biomarkers in PCa We hypothesize that specific miRNAs are consistently dysregulated across multiple stages of PCa and may serve as potential biomarkers for disease progression we conducted high-throughput sequencing to compare miRNA expression profiles in early localized Our goal was to identify common differentially expressed miRNAs across all PCa stages and validate their expression in independent patient samples By demonstrating that hsa-miR-6715b-3p is significantly overexpressed in PCa tissues this study aims to establish a foundation for miRNA-based biomarkers and precision medicine in prostate cancer With the development of protein and messenger RNA (mRNA) in different clinical application scenarios the potential of miRNA as a biomarker of PCa has been paid more and more attention and is expected to play a greater role The RNA Nano 6000 Assay Kit (Agilent Technologies TruSeq PE Cluster Kit v3-cBot-HS (Illumia) the Bioanalyzer 2100 system (Agilent Technologies all selected PCa tissue specimens and BPH specimens were obtained in advance with the patient’s informed consent and signed the informed consent form The clinical records of all patients were recorded prostate tissue specimens from 10 PCa and 10 BPH patients were collected to validate the differentially expressed miRNAs by real-time fluorescence quantitative PCR (qRT-PCR) detection They were divided into two groups: experimental group: 10 PCa patients; control group: 10 BPH patients Total RNA was extracted using the Trizol method Agarose gel electrophoresis was employed to assess DNA contamination and RNA integrity while RNA concentration and purity (OD260/280) were measured using a Nanodrop spectrophotometer The principle diagram of cDNA library construction the concentration is initially quantified using the Qubit 2.0 and diluted to 1 ng/µl The library insert size is assessed using the Agilent 2100 Bioanalyzer with the insert size distribution ranging from 250 to 300 bp qPCR is performed for precise quantification of the library’s effective concentration the samples were pooled according to the effective concentrations of different libraries and standards and then sequenced using the Illumina SE50 platform The constructed RNA sequencing library was then loaded into the sequencer for sequencing to generate raw sequencing data.Sequencing of RNA samples was performed by Shanghai Jikai Gene Technology Co We then retrieved the common target miRNAs from these two databases and ultimately constructed a network graph of AURKB with the target miRNAs The clean sequencing data are compared with the reference genome to determine the origin and localisation of RNA sequences The high-throughput sequencing matrix is obtained by calculating the coverage and number of RNA sequences By normalising the matrix data in TPM format and applying the DEGseq 2.0 package of R software we can effectively detect and identify expression differences in miRNAs Screening criteria: |Fold change (FC)|>2 To better understand the functional significance of these differentially expressed miRNAs we performed Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses Enrichment pathways with corrected p-values < 0.05 are significant enrichment results Volcano map of differentially expressed miRNAs in prostate cancer. (early localized PCa, ELPCa; local invasion PCa, LIPCa; late-stage metastasis PCa, LSM-PCa; Benign prostatic hyperplasia, BPH; Prostate cancer, PCa). The venn diagram of differentially expressed miRNAs in different stages of prostate cancer (Prostate cancer GO enrichment analysis of differentially expressed miRNAs. (A early localized PCa VS BPH; B local invasion PCa VS BPH; C late-stage metastasis PCa VS BPH; D local invasion PCa VS early localized PCa; E late-stage metastasis PCa VS early localized PCa; F late-stage metastasis PCa VS local invasion PCa. Benign prostatic hyperplasia, BPH; Prostate cancer, PCa). (A) Early localized PCa VS BPH; (B) local invasion PCa VS BPH; (C) late-stage metastasis PCa VS BPH; (D) local invasion PCa VS early localized PCa; (E) late-stage metastasis PCa VS early localized PCa; (F) late-stage metastasis PCa VS local invasion PCa QRT-PCR validation of hsa-miR−6715b−3p expression in PCa and BPH tissues Although this study did not specifically investigate the direct relationship between APE and hsa-miR-6715b-3p the potential association between the two merits further research particularly in the context of PSA gray zone patients identifying miRNAs involved in PCa is particularly important This study provides the first evidence that hsa-miR-6715b-3p is consistently overexpressed across different stages of PCa supporting its potential as a robust biomarker for disease progression Our findings align with previous studies demonstrating the role of miRNAs in PCa but extend this knowledge by identifying a novel miRNA that exhibits differential expression from early localized tumors to metastatic PCa functional enrichment analysis suggests that hsa-miR-6715b-3p may regulate key pathways involved in PCa progression particularly the MAPK and autophagy pathways which are known to contribute to androgen receptor signaling These findings highlight a previously unrecognized miRNA that may serve as both a biomarker and a potential therapeutic target Future studies should focus on the functional characterization of hsa-miR-6715b-3p and its downstream targets to determine its role in PCa progression and treatment response Our study lays the groundwork for the integration of miRNA-based biomarkers into PCa diagnostics and precision medicine approaches This aligns with our qRT-PCR findings of elevated miR-6715b-3p levels in PCa tissues This is closely related to the proliferation and metastasis of prostate cancer cells future research could further explore the interactions between miR-6715b-3p and other key genes as well as their impact on the prostate cancer microenvironment Our study leverages current high-throughput sequencing techniques to analyze miRNA expression profiles in prostate tissues from PCa and BPH patients across various clinical stages We conducted preliminary functional predictions and analyses of differentially expressed miRNAs and validated the novel miRNA miR-6715b-3p providing new targets for studying the molecular mechanisms underlying PCa limitations include the small sample size for high-throughput sequencing which restricts the clinical data available for correlational analysis with clinical parameters and staging some identified miRNAs are not currently cataloged or formally named in existing databases we verified only the differential expression of miR-6715b-3p between PCa and BPH without delving into its specific molecular regulation in PCa This study presents a comprehensive analysis of miRNA expression in prostate cancer across different clinical stages and identifies hsa-miR-6715b-3p as a promising novel biomarker for disease progression Our findings highlight its potential role in critical oncogenic pathways and provide a basis for further functional studies to explore its clinical utility Given its significant overexpression in PCa tissues and its potential role in oncogenic pathways further functional studies are warranted to determine its precise molecular mechanism and clinical utility future research should validate other differentially expressed miRNAs identified in this study and explore their roles in therapy resistance and disease progression These findings contribute to the expanding knowledge of miRNA-based biomarkers and provide potential targets for precision medicine approaches in prostate cancer The data generated during this study is available from the corresponding author on reasonable request. The miRNA data supporting the findings of this study have been deposited in the NCBI BioProject database (accession PRJNA1226508). To review BioProject accession PRJNA1226508: Go to http://www.ncbi.nlm.nih.gov/bioproject/1226508 Global Cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries Prevalence and associated risk factors of prostate cancer among a large Chinese population Targeting metastatic hormone sensitive prostate cancer: chemohormonal therapy and new combinatorial approaches Prostate cancer diagnosis in the PSA Gray zone: current challenges and future prospects MicroRNAs as biomarkers for prostate cancer detection and prognosis Role of MicroRNA in the diagnosis of prostate cancer in the PSA Gray zone Current treatment strategies for advanced prostate cancer MicroRNA-21 in urologic cancers: from molecular mechanisms to clinical implications In Silico analysis shows slc1a4 as a potential target of hsa-mir-133a for regulating glutamine metabolism in gastric cancer Screening model for bladder cancer early detection with serum MiRNAs based on machine learning: A mixed-cohort study based on 16,189 participants Bioinformatic and experimental analyses of GATA3 and its regulatory MiRNAs in breast Cancer Cuproptosis-related MiR-21-5p/FDX1 axis in clear cell renal cell carcinoma and its potential impact on tumor microenvironment inhibits gastric cancer by regulating MicroRNA biogenesis Bone sialoprotein facilitates Anoikis resistance in lung cancer by inhibiting miR-150-5p expression APE1 and its role in the repair of oxidative DNA damage in cancer The potential role of hsa-miR-6715b-3p in tumor progression MiR-21 is induced by hypoxia and down-regulates RHOB in prostate cancer Increased oncogenic microRNA-18a expression in the peripheral blood of patients with prostate cancer: A potential novel non-invasive biomarker The role of the MAPK/ERK pathway in androgen receptor regulation in prostate cancer The interplay between autophagy and PI3K/AKT signaling in prostate cancer A review of advances in mitochondrial research in cancer MEK Inhibition prevents CAR-T cell exhaustion and differentiation via downregulation of c-Fos and JunB Ubiquitination regulates autophagy in cancer: simple modifications Anillin contributes to prostate cancer progression through the regulation of IGF2BP1 to promote c-Myc and MAPK signaling Targeting autophagy in urological system cancers: from underlying mechanisms to therapeutic implications Alteration of autophagy and glial activity in nilotinib-treated Huntington’s disease patients Novel Siglec-15-Sia axis inhibitor leads to colorectal cancer cell death by targeting miR-6715b-3p and oncogenes PTEN as a tumor suppressor in prostate cancer miR-6715b-3p promotes prostate cancer cell proliferation by targeting PTEN The clinical potential of MiRNAs in prostate cancer diagnosis and therapy Toward Understanding the origin and evolution of cellular organisms KEGG for taxonomy-based analysis of pathways and genomes Download references The authors are indebted to all the donors whose names were not included in the author list but who participated in our study This project is funded by the Science and Technology Plan of Jiangxi Provincial Health and Family Planning Commission (No.20195215) Jian Ling and Zuhuan Xu contributed equally to this work The Second Affiliated Hospital of Nanchang University All authors read and approved the final manuscript This study was approved by the Second Affiliated Hospital of Nanchang University (Nanchang All procedures performed in this study using human data were in accordance with the Declaration of Helsinki (as revised in 2013) And written informed consents were obtained from each patient Data Availability Statement Download citation DOI: https://doi.org/10.1038/s41598-025-92091-9 Metrics details The simultaneous sequencing of multiple types of biomolecules can facilitate understanding various forms of regulation occurring in cells Cosequencing of miRNA and mRNA at single-cell resolution is challenging only a few such studies (examining a quite limited number of cells) have been reported we developed a parallel single-cell small RNA and mRNA coprofiling method (PSCSR-seq V2) that enables miRNA and mRNA coexpression analysis in many cells The PSCSR-seq V2 method is highly sensitive for miRNA analysis and it also provides rich mRNA information about the examined cells at the same time We employed PSCSR-seq V2 to profile miRNA and mRNA in 2310 cultured cells and detected an average of 181 miRNA species and 7354 mRNA species per cell An integrated analysis of miRNA and mRNA profiles linked miRNA functions with the negative regulation of tumor suppressor and reprogramming of cellular metabolism We coprofiled miRNA and mRNA in 9403 lung cells and generated a coexpression atlas for known cell populations in mouse lungs and detected conserved expression patterns of miRNAs among lineage-related cells we identified informative age-associated miRNAs in mouse and human lung cells including miR-29 which can be understood as a conserved marker for immunosenescence PSCSR-seq V2 offers unique functionality to users conducting functional studies of miRNAs in clinical and basic biological research “lysis and splitting” methods are limited by scale and make it difficult to analyze tissue samples but the miRNA content analyzed is sparse (generally less than 0.5% of total sequencing reads in cultured cells) Thus there is no practical way of coprofiling miRNA and mRNA expression in tissues at single-cell resolution we developed a parallel small RNA and mRNA coprofiling method (called PSCSR-seq V2) which can generate small RNA libraries and mRNA libraries simultaneously in many cells while preserving cell identity using barcoding sequences We used PSCSR-seq V2 to analyze the regulation between miRNA and mRNAs in cultured cells We also investigated aged-associated miRNAs in lung tissues at single-cell resolution and ultimately found that miR-29 can be understood as a conserved marker for immunosenescence in mice and humans High-quality single-cell small RNA and mRNA cosequencing using PSCSR-seq V2 Single-cell suspensions were dispensed into a nanowell chip for cell imaging and screening Selected single live cells were lysed to release total RNA; then and mRNAs were reverse transcribed and linked with the adapter using a template switching oligo (TSO) and 5’ adapters were ligated to small RNAs The ligated small RNAs were then reverse-transcribed Cell barcodes were introduced by PCR to label individual cells (PCR-1) small RNA and mRNA libraries were separately collected the small RNA and mRNA libraries were amplified for high-throughput sequencing (PCR-2) Violin plots showing the distribution of miRNA species number per cell (B) and the mRNA species number per cell (C) detected by the indicated methods (comparing PSCSR-seq V2 and the Wang method; the PSCSR-seq V1 and Takara 3DE sequencing methods were used as references for standalone miRNA and mRNA comparison separately) we sampled 100 K reads for small RNA library analysis and 200K reads for mRNA library analysis E) Correlation of miRNA (D) and mRNA (E) normalized expression (log2_RPM reads per million library size) in aggregated profiles of K562 cells from PSCSR-seq V2 and reference methods Pearson correlation coefficients were presented This sequence of steps enables library construction for both small RNA and mRNA in one tube Because of the different lengths of small RNA and mRNA molecules a size selection step is used to separate the small RNA library the libraries are sequenced separately (see Methods) cells are demultiplexed during data analysis based on their dual-indexed barcode sequences and the miRNA and mRNA expression levels are estimated using unique molecular identifier (UMI) counts We subsequently assessed PSCSR-seq V2 for applications in cultured cells and tissue samples These observations reflected that multi-scale factors (including transcription and degradation among others) regulate the mRNA expression we can efficiently explore miRNA and mRNA target expression distributions which should facilitate studies of miRNA functional mechanisms (D) Heatmap showing the expression of conserved miRNAs among cell types (cell type mRNA markers are presented below) miRNAs are conserved among lineage-related cells miR-142 is expressed in multiple immune cell types; miR-200 is expressed in epithelial cells; miR-126 is expressed in endothelial cells; miR-199 is expressed in stromal cells (E) Dot plot showing combined miRNAs (miR-200a and miR-22) can distinguish alveolar cells Dot colors reflect the average expression level (scaled across cell types) and dot sizes represent the percentage of cells of each cell type that express the indicated miRNAs G) Single-cell miRNA expression comparisons between old and young lungs (F The y-axis is for the normalized miRNA expression *** for multiple-test adjusted (Bonferroni correction) p value < 0.001 tissue-resident alveolar macrophages; TRAMcc tissue-resident interstitial macrophages; Neu general capillary endothelial cells; Fibro combining miRNA and mRNA profiles will facilitate fine-grained classification of cells but this study lacked cell type resolution Our single-cell data analysis shows that miR-29 expression increases with age in multiple cell types of mouse lung supporting that miR-29 can be understood as a conserved marker for immunosenescence so miR-29 may influence the epigenetic reprogramming process in aged lungs Extracellular matrix (ECM) components are known to be dysregulated in aged tissues miR-29 is predicted to target the vascular endothelial growth factor gene (Vegfa) and vascular collagen genes all of which participate in the ECM organization These findings collectively support that increased expression of miR-29 promotes multiple aspects of aging we developed a parallel small RNA and mRNA coprofiling method and applied it to a variety of cell and tissue samples Beyond excellent performance in small RNA profiling PSCSR-seq V2 provides rich mRNA information that supports miRNA regulation analyses This attribute of the method enables investigations of miRNAs’ role in (for example) aging procession and analysis of interactions occurring between small RNAs and endogenous RNAs We generated a coexpression atlas for known cell populations in mouse lungs miRNA profiles are less powerful for cell type classification and cell cycle prediction miRNA profiles preserve the lineage relationships the integration of miRNA and mRNA profiles enables finer-resolved classifications of cells RNA expression regulation involves multiple layers of factors We used coinertia analysis to explore the expression distributions among miRNAs and mRNAs Coinertia analysis does not intend to integrate genomic profiles at the single-cell level but rather provides an interactive plot illustrating the miRNA and target mRNA expression patterns which can facilitate the selection of suitable miRNAs and their targets for the following functional studies The coinertia plot requires a knowledge of miRNA/mRNA target relationships When this information is unavailable (e.g. PSCSR-seq V2 allows correlation analysis across many cells to detect potential interactions between miRNAs and mRNAs One caution here is that PSCSR-seq V2 focuses on the transcription level which does not necessarily reflect the translation status or the final product abundance additional information such as protein abundance would be helpful for guiding functional interpretations As PSCSR-seq V2 enables single-cell miRNA and mRNA coprofiling for diverse sample types we anticipate that this method will have broad applications in clinical and biological research by providing rich information for miRNA functional studies The 3’ adapter (RA3-A2N) was obtained from Takara Biomedical Technology; The 5′ adapter (SR5T-UUG) was obtained from Sangon Biotech. Other oligonucleotides were obtained from Sangon Biotech. All oligonucleotides used in this study are described in Supplementary Table S2 A549 cells were cultured in DMEM/F-12 (11320082 HeLa and HEK293T cells were cultured in basic DMEM (C11965500BT K562 cells were cultured in basic RPMI-1640 media (C22400500BT All the cultured media were supplemented with 10% (v/v) fetal bovine serum (26140079 Gibco) and 1% penicillin–streptomycin (15140122 The cells were cultured at 37 °C in a 5% CO2 humidified incubator Fresh cells were resuspended with 1 × Dulbecco’s phosphate-buffered saline (DPBS C57BL/6 WT mice were purchased from Beijing Vital River Laboratory Animal Technology Co. and maintained under specific pathogen-free (SPF) conditions with free access to food and water under a 12-h light: dark cycle in IVC cages Mice were euthanized using carbon dioxide and lung tissues were collected and cut into small pieces (2–4 mm) These pieces were dissociated into single-cell suspensions with PythoN® Tissue Dissociation System following the manufacturer’s instructions (MD1101001 Cell suspensions were added with ACK lysis buffer (A10492-01 Gibco) to lyse the remnant red blood cells and treated with a Dead Cell Removal Kit (130-090-101 then filtered through 40-μm plastic mesh (Falcon) Cell suspensions were stained with a ReadyProbes® Cell Viability Imaging Kit (R37610 the stained cell suspensions were diluted in a mix of 1 × Second Diluent (640196 Takara) and 0.4 U Ribonuclease Inhibitor (N2515 The cell suspensions were dispensed into a SMARTer ICELL8 350v Chip (640019 containing 5184 [72 × 72] nanowells) on a MultiSample NanoDispenser (MSND All nanowells of the ICELL8 chip were imaged with a fluorescence microscope (Olympus BX43) and the images were analyzed using CellSelect software (Takara) to determine the viability and number of cells present Alive single cells were automatically selected with manual checks for the subsequent experiments The microchip was frozen in a − 80 °C fridge for at least one hour and transferred to a modified SmartChip thermocycler (Bio-Rad) at 75 °C for 5 min and chilled on ice immediately. 35 nl of 3’-ligation mix containing 0.2% Triton™ X-100 (T9284, Sigma-Aldrich), 0.04 U Ribonuclease Inhibitor, 0.07 pmol 3’ adapter (RA3-A2N, Supplementary Table S2) NEB) and 2 X T4 RNA ligase buffer was prepared and dispensed into the selected nanowells The microchip was incubated with a program of 25 °C for 6 h and 4 °C for 8–10 h 0.05 U Ribonuclease Inhibitor) was added into the microchip and transferred to the thermocycler with a program of 25 °C for 2 h and 65 °C for 20 min The small RNA RT reaction mix (1X First-strand buffer 0.78 U Superscript III reverse transcriptase [18080-085 0.06 U ribonuclease inhibitor) was dispensed into selected nanowells (35 nl of each) and incubated at 52 °C for 60 min and 70 °C for 15 min 35 nl of PCR-1 mix containing 0.22 pmol barcoded PCR-1 primers (SR5T-P1, Supplementary Table S2) and 0.01 U Phanta® HS Super-Fidelity DNA Polymerase (P502-d1 Vazyme) was dispensed into the microchip with the program “Index 2” the microchip was placed in the thermocycler with a program of 95 °C for 3 min and 72 °C for 1 min) and a final incubation at 72 °C for 5 min the microchip was inverted and centrifuged at 3000 × g for 10 min to collect and pool all contents into a single collection tube using the supplied SMARTer™ ICELL8® Collection Kit (640048 The collected PCR-1 product was purified twice using 1.8 × SPRIselect Beads (B23319 The size distribution was obtained with an Agilent High Sensitivity DNA Kit (5067–4626 Agilent Technologies) on an Agilent Bioanalyzer 2100 instrument The quantification was performed using a Qubit™ dsDNA HS Assay Kit (Q32854 Half of the PCR product was size selected for small RNA library collection using 3% agarose The other half was purified with 2% Agarose Sage Science) at 270–650 bp to collect mRNA libraries The reaction was performed with a program of 95 °C for 3 min The PCR-2 product was purified with 1.6 × SPRIselect beads The PSCSR-seq V2 library was quantified with a qPCR-based KAPA Library Quantification Kit for Illumina platforms (KK4824 The PSCSR-seq V2 library was sequenced using an Illumina NovaSeq 6000 System or NextSeq2000 instrument Supplementary Table S3 summarizes the experimental steps mapped reads with the same index tag or adjacent index tag (1 mismatch) were collapsed into UMI The UMI counts were weighted by the number of mapped locations and the UMIs were summed as the measurement of mRNA expression mRNA expression values for each cell were normalized and log-transformed implemented using the R “Seurat” package (v4.0.0) miRNA target mRNAs were predicted using the R “miRNAtap” package29; we chose the common prediction in multiple prediction algorithms (N = 3) in “miRNAtap” the miRNA/mRNA profiles were averaged across cell types/subpopulations and the highest expressed miRNAs (n = 200) and mRNAs (n = 2500) were used for the analysis The global correlation between miRNA and mRNA profiles was measured by the RV coefficient calculated as the total inertia (sum of eigenvalues of a coinertia analysis) divided by the square root of the product of the squared total inertias (sum of the eigenvalues) from the individual analysis and 76) were split into two subgroups based on the median age The human and mouse cells were grouped into six subpopulations according to conserved miRNA markers commonly expressed in human and mouse cells: miR-142 and miR-150 for lymphoid cells including T NK cells; miR-142 and miR-223 for myeloid cells including macrophages monocytes; miR-126 for endothelial cells including capillary cells capillary aerocytes; miR-199 for stromal cells including fibroblast pericytes or muscle cells; miR-200 for general epithelial cells such as cilia and miR-375 for alveolar cells including AT1 Tumor cells (with miR-135b expression) were removed The cell cycle phase was predicted using the “CellCycleScoring” function in Seurat All source codes are available within the GitHub repository (https://github.com/biocaitao/PSCSRII). Also, the website (https://biocaitao.github.io/PSCSRII) includes related datasets in the paper Specificity of microRNA target selection in translational repression Mammalian microRNAs predominantly act to decrease target mRNA levels Single-cell microRNA-mRNA co-sequencing reveals non-genetic heterogeneity and mechanisms of microRNA regulation Holo-Seq: Single-cell sequencing of holo-transcriptome Single-cell quantification of a broad RNA spectrum reveals unique noncoding patterns associated with cell types and states High-throughput total RNA sequencing in single cells using VASA-seq Small RNA transcriptome analysis using parallel single-cell small RNA sequencing Massively parallel digital transcriptional profiling of single cells Massively parallel nanowell-based single-cell gene expression profiling Procrustean co-inertia analysis for the linking of multivariate datasets A multivariate analysis approach to the integration of proteomic and gene expression data Regulation of RhoB gene expression during tumorigenesis and aging process and its potential applications in these processes ATRX promotes heterochromatin formation to protect cells from G-quadruplex DNA-mediated stress a candidate tumor suppressor gene mutated in prostate cancer A mammalian microRNA expression atlas based on small RNA library sequencing Integrated analysis of multimodal single-cell data Characterizing expression changes in noncoding RNAs during aging and heterochronic parabiosis across mouse tissues CTLA4 mRNA is downregulated by miR-155 in regulatory T cells and reduced blood CTLA4 levels are associated with poor prognosis in metastatic melanoma patients miR-29b contributes to multiple types of muscle atrophy MicroRNA-29 is an essential regulator of brain maturation through regulation of CH methylation GENCODE reference annotation for the human and mouse genomes Highly parallel genome-wide expression profiling of individual cells using nanoliter droplets Comprehensive integration of single-cell data miRNAtap: microRNA Targets-Aggregated Predictions MADE4: An R package for multivariate analysis of gene expression data Download references We thank John Hugh Snyder for constructive comments on the manuscript and the sequencing facility at NIBS for instrument and technology support Tsinghua Institute of Multidisciplinary Biomedical Research conducted the experiments with the assistance of J.T analyzed the results and wrote the manuscript text The study was reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of the National Institute of Biological Sciences, Beijing. All animal experiments were performed in accordance with the “Guide for the Care and Use of Laboratory Animals”. The study is reported in accordance with ARRIVE guidelines (https://arriveguidelines.org) filed a patent application for the method used in the work Download citation DOI: https://doi.org/10.1038/s41598-025-85612-z Metrics details Schizophrenia is a complex developmental disorder whose molecular mechanisms are not fully understood The developmental course of schizophrenia can be modeled with human induced pluripotent stem cell (hiPSC) -derived brain cells that carry patient-specific genetic risk factors for the disorder Although transcriptomic characterization of the patient-derived cells is a standard procedure microRNA (miRNA) profiling is less frequently performed To investigate the role of miRNAs in transcriptomic regulation in schizophrenia we performed miRNA sequencing for hiPSC-derived neurons from five monozygotic twin pairs discordant for schizophrenia and six controls (CTR) We compared the miRNA expression to differentially expressed genes (DEGs) reported for the same cells in our earlier work We found 21 DEmiRNAs between the affected twins (AT) and CTR with implications for the regulation of neuronal function a separate analysis of three AT with treatment-resistant schizophrenia (TRS) and CTR revealed an upregulation of four miRNAs in the UT compared to both AT and CTR The DEmiRNAs found between the UT and CTR were associated with increased cAMP/PKA signaling and synaptogenesis signaling in the UT We hypothesize that the upregulation of these processes in the UT could be linked to compensatory features against schizophrenia We identified dysregulation of pathways with relevance for schizophrenia and association to altered expression of miRNAs a hiPSC-derived neurons were differentiated from five monozygotic twin pairs discordant for schizophrenia and six controls 2019) and miRNA sequencing were conducted for one-week-old neurons The role of DEmiRNAs in transcriptomic regulation was investigated in miRNA target prediction analysis The DEmiRNA was compared to reference data sets b Volcano plot showing DEmiRNAs found between the AT and CTR (Benjamini-Hochberg adjusted p < 0.05 c DEmiRNAs and their predicted target DEGs e–h Correlation analysis between DEmiRNAs and their predicted target DEGs e Moderate but significant inverse correlation was found between miR-199a-5p and COMT expression f Strong and highly significant inverse correlation was observed between miR-199a-3p and KCTD16 expression g Moderate inverse correlation was found between miR-376b-3p and CACNA2D1 expression h Moderate inverse correlation was observed between miR-383-5p and GRIN2B expression Spearman correlation analysis was used for the statistical comparisons p-values were adjusted using the Benjamini–Hochberg procedure) that were shared between the two data sets This result provides further support for the role of these three miRNAs in schizophrenia This result supported the idea that the AT differed from the CTR more than the UT This result indicates that miR-199a/b-3p may participate in the regulation of potassium channel function in schizophrenia the miRNA target prediction analysis revealed potential interactions between the DEmiRNAs and genes related broadly to neuronal function these findings suggest that patients with TRS and non-TRS may represent different disease etiologies that stem from complex genetic factors a–c Volcano plots showing DEmiRNAs between the AT and CTR (absolute log2 fold change >1 and Benjamini–Hochberg adjusted p < 0.05) d Venn diagram showing shared DEmiRNAs between the comparisons Two DEmiRNAs were downregulated in the AT compared to both UT and CTR Four DEmiRNAs were upregulated in the UT compared to both AT and CTR Two of these DEmiRNAs were shared with the Topol et al PC2 separated the UT from AT and CTR whereas PC4 separated the AT from the CTR g DEmiRNAs that were downregulated in the AT compared to UT and CTR h DEmiRNAs that were upregulated in the UT compared to AT and CTR While none of the DEmiRNA were found among the risk miRNAs or in the CNV miRNAs four of the DEmiRNAs were shared with the Topol et al In support of our hypothesis of the compensating features all of the shared DEmiRNAs between our data and the reference data displayed inverse expression patterns This result suggests that the UT displayed characteristic miRNA expression patterns that distinguished them from both AT and CTR the differences between the UT and CTR were greater than the differences between the AT and CTR a DEmiRNA target prediction analysis comparing AT and CTR b DEmiRNA target prediction analysis comparing AT and UT c The expression of miR-1908 and its’ target molecules showed a strong and significant negative correlation d DEmiRNA target prediction analysis comparing UT and CTR e Pathway analysis for the target DEGs found in DEmiRNA target prediction analysis between UT and CTR f The expression of genes in the cAMP-mediated signaling pathway including inhibitors of cAMP/PKA signaling g miR-34c-5p and miR-23b-3p were predicted to target genes in the cAMP-mediated signaling pathway h miR-27b-3p was predicted to target BMI1 and SNAP25 miR-27b-3p expression was strongly and significantly inversely correlated with BMI1 expression and strongly inversely correlated with SNAP25 expression this result provided further support for increased cAMP signaling activity in the UT neurons miR-27b-3p was found as a potential regulator of increased synaptic function in the UT b Mean firing rate measured across eight weeks of maturation a higher mean firing rate than the AT and CTR from six weeks onward c Network burst frequency measured across eight weeks of maturation d Network burst duration measured across eight weeks of maturation and CTR neurons displayed similar p-CREB expression levels at eight weeks of maturation (scale bar = 50 μm) and CTR neurons displayed similar densities of synapsin puncta after eight weeks of maturation i The average size of the synapsin puncta was significantly elevated (p = 0.0326) in the UT compared to the CTR neurons (scale bar = 20 μm) data were collected from three independent experiments The statistical comparisons were performed with t-test or Mann–Whitney U test Normal distribution of the data was verified with Shapiro–Wilk test The colors of the data points represent results from different cell lines a trend toward higher neuronal activity was observed in the UT neurons in support of our hypothesis This difference could not be attributed to elevated cAMP singnaling activity but was accompanied by increased synapsin puncta size the differential expression of miR-199 family miRNAs may reflect impaired glucose metabolism in the affected neurons Whether similar transmission occurs during hiPSC reprogramming has not been verified epigenetic transmission of environmental trauma or the effect of medication through small RNAs could explain the differences observed between the monozygotic twins that represent the same genetic background the UT displayed broad gene expression alterations with relevance for schizophrenia and implications for increased neuronal function After investigating the expression of presynaptic puncta in the cultures we found a significant increase in the presynaptic puncta size in the UT neurons compared to the CTR neurons indicating increased strength of individual synapses non-significant increase was observed in the AT neurons this phenomenon could also be a pathological feature related to the risk of developing schizophrenia our results add to the evidence suggesting that unaffected individuals with a high genetic risk for developing schizophrenia may possess protective features against the disorder Identification of the origin and mechanisms of these features could inspire the development of new treatments for schizophrenia The hiPSCs were maintained in Essential 8 medium (E8 Gibco)) and passaged weekly with 0.5 mM EDTA The neural induction was performed by culturing hiPSCs in neural differentiation medium containing 1:1 DMEM/F12 (21331-020 Gibco) and Neurobasal medium (NBM (21103-049 supplemented with 1% B27 without vitamin A (12587001 neural progenitor cells arranged in rosettes were picked and transferred to ultra-low attachment plates The cells were cultured in neural sphere medium containing 1:1 DMEM/F12/NBM 50 μg/ml streptomycin and 25 ng/ml bFGF (100-18B The spheres were manually cut every week until 5 weeks of differentiation The cells were then plated for maturation on Polyornithine (Sigma Corning) coated plates at 50,000 cells/cm2 density The neurons were maintained for one week before harvesting The hiPSCs were infected with 2 lentiviruses: Tet-O-NGN2-PURO and FudeltaGW-rtTA (>109 IFU/ml The differentiation was started by adding 2 μg/ml Doxycycline hyclate (2431450 1:100 N2 supplement and 1:67 20% Glucose) was prepared and supplemented with 10 μM SB431542 the medium was changed to N2 medium supplemented with 1:2 of the day 1 supplement as well as 5 μg/ml puromycin (100552 MP Biomedicals) to select for infected cells the cells were fed the same media as on day 1 The final plating of the neurons was conducted on day 4 the cells were then detached with Accutase (11599686 Gibco) for 5 min and centrifuged at 300 rcf for 4 min Neurons were plated 1:1 with rat astrocytes on plates coated with 50 μg/ml Poly-l-ornithine and Matrigel using 60,000 neurons/cm2 for immunocytochemistry (ICC) and 60,000 neurons/well for microelectrode array (MEA) Neurons were cultured in Neural maturation medium (NBM 1:50 B27 without vitamin A) supplemented with 10 ng/ml BDNF (450-02 proliferating cells were eliminated from the cultures using 10 μM FUDR (4659 ½ of the medium was changed three times a week The cells were split using Trypsin (0.05%)–EDTA and the media was changed once every 2 weeks The rat astrocytes were plated with hiPSC-derived neurons 1:1 using 60,000 astrocytes/cm2 for ICC and 60,000 astrocytes/well for MEA Total RNA was extracted using a mirVana RNA extraction kit (Thermo Fisher Scientific) and the quality and quantity of the small RNA extractions were assessed using the Agilent Bioanalyser 2100 with a small RNA assay Chip and RNA Nano 6000 assay Chip (Agilent Technologies Small RNA library preparation was conducted using the Ion Total RNA-Seq kit v2 (Life Technologies) ligation of adapters containing a unique index barcode was performed (Ion Xpress™ RNA-Seq Barcode 1–16 Kit Life Technologies) to allow pooling of libraries during sequencing The libraries were constructed according to the manufacturer’s instructions the RNA samples were reverse-transcribed to cDNA using adapter-specific primers the cDNA fragments were size selected from 94 to 200 nt (the length of the small RNA insert including the 3′ and 5′ adapters) using a Magnetic Bead Purification Module (Life Technologies) followed by a library clean-up step using nucleic acid beads (Life Technologies) The quality and quantity of the libraries were verified using Agilent 2100 Bioanalyser and DNA 1000 assay kit (Agilent Technologies) The libraries were pooled equally and amplified clonally onto Ion Sphere™ Particles (ISPs) by Ion 540™ Kit-Chef and loaded in the Ion Chef™ Instrument (Life Technologies) ISPs loaded with libraries were sequenced in the Ion Torrent Ion S5™ Sequencing System using Ion 540 chips (Life Technologies) The read alignment was performed using TMAP on the Torrent Suite Server and the reads were mapped to miRBase v The mapped reads were normalized to reads per million and miRNAs with a minimum of 30 normalized read counts across all samples were used for ANOVA analysis miRNA target prediction and pathway analyses were performed using Ingenuity Pathway Analysis software (IPA; QIAGEN) DEmiRNA and DEG datasets were paired using a TargetScan algorithm that predicts high confidence and experimentally observed interactions between miRNAs and mRNAs The prediction was made using data from four databases: TarBase Ingenuity Knowledge Base and Ingenuity Expert Findings we performed expression pairing to the identified miRNA-DEG pairs and selected pairs with inverse expression patterns for further investigation The selected target DEGs were finally subjected to IPA core analysis using cutoff values of log2 fold change >1 and Benjamini-Hochberg adjusted p < 0.05 the cells were fixed with 4% paraformaldehyde for 20 min and washed twice with PBS The cells were permeabilized with 0.25% Triton X-100 in PBS for 1 h Unspecific binding sites were blocked using 5% normal goat serum (NGS) for 1 h Synaptic Systems) and phospho-CREB (rabbit The primary antibody mixture was prepared in 5% NGS and incubated overnight at +4°C on a shaker Secondary antibodies including Goat anti-chicken Alexa Fluor 568 (A11041) and Goat anti-rabbit Alexa Fluor 488 (A11008) were used The secondary antibodies were diluted 1:400 in PBS and incubated for 2 h with the cells the cells were washed 2× with PBS and 1× with DAPI (1:2000 The samples were mounted using Fluoromount-G (Thermo Fisher Scientific) For the analysis of p-CREB expression and synaptic density 2D images were taken with an EVOS M5000 fluorescence microscope The analysis was conducted with ImageJ (NIH) neurons stained with MAP2 were segmented using the default threshold option after which the p-CREB intensity in the segmented areas was measured using the Measure function the images were filtered using the Subtract background function to enhance spot-like structures The default threshold option was used to segment the synapsin spots The neurites were then segmented using the default threshold option The neurites were used as a mask to select the synapsin spots that co-localized with the neurites using the Image calculator function The neurite length was measured using the Skeletonize and Analyze particles functions and the number of synapsin spots was measured using the Analyze particles function The electrophysiological activity was recorded from neuron-astrocyte co-cultures with Maestro Edge MEA system using AxIS Navigator software and 24-well CytoView plates containing 16 electrodes (Axion Biosystems) The recordings were performed at 37 °C in a 5% CO2 atmosphere and the temperature and CO2 were allowed to stabilize for 10 min the spike threshold was set to 5× the standard deviation of the estimated noise in the AxIS Navigator software The baseline activity was then measured for 10 min The burst detection was conducted using the Neural Metric Tool (Axion Biosystems) The minimum number of spikes per burst was set to 5 and the maximum inter-spike interval within a burst was set to 100 ms The NB detection was conducted with the Envelope algorithm using a threshold factor 2 and a minimum inter-burst interval 100 ms The minimum number of electrodes in NB was set to 50% and a burst inclusion value was set to 50% The statistical analysis was conducted with GraphPad Prism 9 For the analysis of MEA data and ICC characterization paired t-test or Mann–Whitney U test was used The normal distribution of the data was verified with the Shapiro–Wilk test The error bars in the graphs represent mean and standard deviation The data supporting the results of this study are available in the supplementary material or can be requested from the corresponding author Mapping genomic loci implicates genes and synaptic biology in schizophrenia Biological insights from 108 schizophrenia-associated genetic loci Analyzing the role of MicroRNAs in schizophrenia in the context of common genetic risk variants Transcriptome analysis reveals disparate expression of inflammation-related miRNAs and their gene targets in iPSC-astrocytes from people with schizophrenia Dysregulation of miRNA-9 in a subset of schizophrenia patient-derived neural progenitor cells Sex-specific transcriptional and proteomic signatures in schizophrenia Transplantation of human embryonic stem cell-derived neural precursor cells and enriched environment after cortical stroke in rats: cell survival and functional recovery Panes, J., Wendt, A., Ramirez-Molina, O., Castro, P. & Fuentealba, J. Deciphering the role of PGC-1 in neurological disorders: From mitochondrial dysfunction to synaptic failure. Neural Regener. Res. https://doi.org/10.4103/1673-5374.317957 (2022) Monozygotic twins discordant for schizophrenia differ in maturation and synaptic transmission Association of Mitochondrial Biogenesis with Variable Penetrance of Schizophrenia Park, S. Y. & Han, J. S. Phospholipase D1 signaling: essential roles in neural stem cell differentiation. J. Mol. Neurosci. https://doi.org/10.1007/s12031-018-1042-1 (2018) Phosphodiesterase 4 inhibition enhances the dopamine D1 receptor/PKA/DARPP-32 signaling cascade in frontal cortex miR-27b shapes the presynaptic transcriptome and influences neurotransmission by silencing the polycomb group protein Bmi1 Loss-of-function variants in the schizophrenia risk gene SETD1A alter neuronal network activity in human neurons through the cAMP/PKA pathway Pharmacological rescue in patient iPSC and mouse models with a rare DISC1 mutation Astrocytes regulate neuronal network burst frequency in a species- and donor-specific manner Beveridge, N. J. & Cairns, M. J. MicroRNA dysregulation in schizophrenia. Neurobiol. Dis. 46, 263–271, https://doi.org/10.1016/j.nbd.2011.12.029 (2012) Glucose stimulates microRNA-199 expression in murine pancreatic β-cells Circulating mir-199-3p screens the onset of type 2 diabetes mellitus and the complication of coronary heart disease and predicts the occurrence of major adverse cardiovascular events MiR199a-5p inhibits hepatic insulin sensitivity via suppression of ATG14-mediated autophagy article Contribution of astrocytes to familial risk and clinical manifestation of schizophrenia Differences between germline genomes of monozygotic twins Understanding the evolutionary fate of finite populations: the dynamics of mutational effects Cecere, G. Small RNAs in epigenetic inheritance: from mechanisms to trait transmission. FEBS Lett. 595, 2953–2977, https://doi.org/10.1002/1873-3468.14210 (2021) Neurodevelopment regulators miR-137 and miR-34 family as biomarkers for early and adult onset schizophrenia miR-34b/c regulates Wnt1 and enhances mesencephalic dopaminergic neuron differentiation Genetic variants associated with anxiety and stress-related disorders: a genome-wide association study and mouse-model study GWAS meta-analysis of suicide attempt: identification of 12 genome-wide significant loci and implication of genetic risks for specific health factors Electrophysiological measures from human iPSC-derived neurons are associated with schizophrenia clinical status and predict individual cognitive performance Combining NGN2 programming with developmental patterning generates human excitatory neurons with NMDAR-mediated synaptic transmission Culturing primary neurons from rat hippocampus and cortex Schildge, S., Bohrer, C., Beck, K. & Schachtrup, C. Isolation and culture of mouse cortical astrocytes. J. Vis. Exp. https://doi.org/10.3791/50079 (2013) SRNAbench and sRNAtoolbox 2019: intuitive fast small RNA profiling and differential expression Oliveros, J. C. Venny 2.1. https://bioinfogp.cnb.csic.es/tools/venny/index.html Cytoscape: a software environment for integrated models of biomolecular interaction networks Download references This work was supported by the Academy of Finland (Grant No 334525 [to J.K.]) and the Sigrid Jusélius Foundation (to J.K.) A.I.Virtanen Institute for Molecular Sciences Division of Pharmacology and Pharmacotherapy were responsible for conceptualization; J.T. were responsible for collecting the human sample/material; J.K. was responsible for writing the original draft of the paper; N.R. were responsible for reviewing and editing the paper; N.R were responsible for formal analysis; and J.K Download citation DOI: https://doi.org/10.1038/s41537-025-00573-6 Metrics details Despite mounting evidence linking circular RNAs (circRNAs) to various diseases their specific role in liver damage triggered by obstructive sleep apnea (OSA) remains ambiguous This study investigates alterations in circRNA expression patterns in a mouse model subjected to chronic intermittent hypoxia (CIH) aiming to elucidate the pathways that lead to liver damage associated with OSA We established the CIH model and conducted circRNA microarray analysis on liver samples from both CIH and control groups The findings were substantiated via qRT-PCR a comprehensive circRNA-miRNA-mRNA (ceRNA) network was developed followed by the analysis of GO and KEGG pathways to further elucidate the underlying biological processes We identified 259 differentially expressed circRNAs comprising 86 that were upregulated and 173 that were downregulated in CIH mice The ceRNA analysis suggested that these circRNAs may modulate gene expression by sequestering miRNAs Our findings highlight potential therapeutic targets for liver pathologies associated with OSA research on the underlying mechanisms of OSA-induced liver injury remains quite limited and its molecular mechanisms are still unclear the expression profiles and mechanisms of circRNAs in liver damage associated with OSA remain unclear differentially expressed circular RNAs (DECs) were evaluated to outline their expression patterns in APOE mice with hepatic damage triggered by OSA We validated eight candidate circRNAs using qRT-PCR a circRNA-miRNA-mRNA network was established to uncover the important roles of three chosen DECs in CIH-induced liver damage the biological roles of the dysregulated circRNAs were assessed through bioinformatics analysis we aim to offer new insights into the progression of OSA-related liver injury which may aid in clinical treatment for this condition All methods are reported in accordance with ARRIVE guidelines we used male APOE mice purchased from Guangdong Yaokang Biotechnology Co. This study followed the Guidelines for Care and Use of Laboratory Animals as outlined by the Federation of European Laboratory Animal Science Associations and was approved by the Animal Care and Use Committee of 2nd Affiliated Hospital of Fujian Medical University (No The APOE mice were divided into two groups: a control group and a CIH group the mice designated for the CIH group were placed in a custom chamber fitted with oxygen sensors to assess the O2 levels A gas control system connected to the chamber managed the injection of pure nitrogen reducing the O2 concentration to 6% for 60 s the system facilitated rapid replacement of O2 The CIH cycle lasting 2 min was repeated 30 times hourly liver tissues were collected following cervical dislocation euthanasia performed by a trained professional under isoflurane anesthesia We completed the analysis of the mouse circRNA Array V2 for six samples The total RNA from all samples were measured using the NanoDrop ND-1000 Arraystar’s standard protocol was followed for sample preparation and gene chip hybridization Inc.) was applied to degrade the total RNA eliminating linear RNA and enriching CircRNAs fluorescent cRNA was generated by amplifying and transcribing the enriched circRNAs using a random primer method Arraystar Mouse circRNA Array V2 was hybridized with the labeled cRNAs which were subsequently incubated at 65 °C for 17 h we scanned the array using the Agilent Scanner G2505C The resulting array images were analyzed using Agilent Feature Extraction Software we applied the limma package in R for quantile normalization and a series of data processing heatmap and hierarchical clustering were applied to pinpoint statistically significant DECs between the two groups and visualize the unique circRNA expression patterns between the groups were analyzed through the application of the 2−ΔΔCT method we utilized Arraystar’s custom miRNA prediction software to identify the interaction targets of circRNA/miRNA we further constructed the circRNA-miRNA network with Cytoscape 3.6.1 Detailed annotation of all DECs was performed using circRNA/miRNA interaction data potential miRNAs targets were identified using a tool developed from TargetScan and miRanda The ceRNA network was established by combining the miRNAs that are commonly targeted The KEGG method identified variations in biological pathways for downstream mRNAs A threshold of < 0.05 for the p-value was determined The Student’s t-test were applied to analyze all data for comparing circRNA expression levels between the two groups All results presented in this research were derived from at least three separate experiments and are expressed as the mean ± standard deviation A significance level of < 0.05 for the p-value was established as statistically significant Histopathological changes in liver tissue (A) Liver histology of the control group mice which exhibited structural liver abnormalities mild hepatocyte edema was observed near the central vein accompanied by an increase in cytoplasmic lipid vacuoles fibrin-like eosinophilic exudates were found in some central veins and red blood cells filled both the central veins and the interlobular bile ducts (A) A clustering diagram shows how dysregulated circRNAs are distributed across various chromosomes (B) A categorization of the markedly changed circRNAs in the CIH group is provided Outcomes of the qRT-PCR validation for the circRNAs that were selected The top five anticipated targets from 8 verified circRNAs. Expected binding sites for mmu_circRNA_35781 Go analysis of changed circRNAs. (A) GO enrichment analysis for upregulated. (B) GO enrichment analysis for downregulated. (A) KEGG analysis for upregulated circRNAs (B) KEGG analysis for downregulated circRNAs we conducted a detailed exploration of circRNA expression profiles in liver impairment using a CIH-induced mouse model we pinpointed several essential circular RNAs participated in the biological mechanisms initiated by liver injury resulting from OSA This research not only expands our insight into the fundamental mechanisms of liver damage linked to OSA but also lays the groundwork for innovative clinical applications This underscores the potential for circRNAs to revolutionize the clinical management of such conditions offering a promising direction for future research and treatment development These physiological changes may not only trigger hepatic steatosis but also accelerate the progression of fibrosis This suggests that CIH has profound effects on the function of multiple organs particularly in exacerbating liver disease through oxidative stress and inflammation Understanding these mechanisms will aid in the clinical treatment and prevention of liver diseases triggered by OSA This study used circRNA microarray technology to analyze the circRNA expression patterns in CIH-induced mouse liver damage Our results revealed significant variations in circRNA expression profiles between the CIH and control groups with 173 circRNAs downregulated and 86 circRNAs upregulated We further analyzed the types and chromosomal locations of these DECs we randomly selected eight circRNAs with abnormal expression for validation via qRT-PCR confirming the significant impact of circRNAs on the onset and progression of liver damage induced by OSA This rapid advancement in circRNA research might pave the way for developing cutting-edge strategies to diagnose and treat liver injuries caused by OSA we established a ceRNA interaction network to elucidate how circRNA functions in the liver damage model induced by CIH in mice Our study revealed that three confirmed circRNAs (mmu_circRNA_35781 mmu_circRNA_35781 was significantly upregulated suggesting its potential involvement in CIH-induced liver damage by inhibiting miRNA functions Our analysis of circRNA and miRNA pointed to the likely target miRNAs of mmu_circRNA_35781 the ceRNA network identified new associations between dysregulated circular RNAs and 70 mRNAs the network provides robust evidence supporting the significant role of circRNAs in the pathogenesis of liver damage caused by OSA through the indirect modulation of specific mRNAs we believe that the NLR pathway plays a significant role in CIH-induced liver injury the activation of this pathway likely exacerbates oxidative stress and inflammation our study did not delve into the intricate mechanisms underlying the identified DECs leaving a significant gap in understanding their roles Future studies are necessary to explore the biological functions and pathways associated with these circRNAs to comprehensively elucidate their contributions in the context of liver injury Although we systematically analyzed the circRNA expression profiles in CIH-induced mouse liver damage several limitations of our study warrant attention the scope of this research is somewhat limited by the finite sample size highlighting the importance of larger samples in future work the potential molecular regulatory mechanisms and functions of circRNA in OSA-induced liver damage require further investigation the diagnostic effectiveness of circRNA levels should be analyzed in different This could enhance clinical feasibility as they might serve as diagnostic biomarkers for the progression of liver injury related to obstructive sleep apnea the exclusive use of male APOE mice in our study restricts the generalizability of the results to other biological sexes Incorporating female mice in future research would improve the reliability of the findings and enhance their relevance to a broader population one potential concern is whether APOE deficiency itself might contribute to hepatic injury thereby confounding the observed effects of CIH APOE mice were specifically chosen due to their well-established role in studying metabolic and hepatic disorders both the CIH and control groups in our study were APOE-deficient ensuring that any observed differences in liver injury were primarily attributable to CIH exposure rather than APOE deficiency itself future studies using wild-type mice or alternative models could provide additional insights into the role of circRNAs in OSA-induced liver damage our study focused on performing circRNA microarray analysis on liver tissues following model induction accompanied by a series of bioinformatics analyses and predictions including the circRNA-miRNA-mRNA ceRNA network prediction we have not yet conducted luciferase targeting assays to experimentally validate the predicted interactions our animal model differs significantly from the human OSA model and our study was conducted solely on the animal model this study evident that circRNAs exhibit a differential expression profile in a murine model of liver injury induced by OSA This suggests that circRNAs could be implicated in the pathogenesis of liver damage caused by CIH The potential therapeutic implications of modulating circRNAs to treat liver diseases associated with OSA are thus highlighted by these discoveries The comprehensive analysis of these results sheds light on the possibility of targeting circRNAs for therapeutic interventions in OSA-related liver disorders further research is warranted to elucidate the precise role and underlying mechanisms of circRNAs in liver injury induced by OSA The microarray data generated and analyzed in this study is publicly available through the GEO database under accession number GSE282153. The dataset can be accessed at https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE282153 using the access token azuragowlxctbmf Gleeson, M. & McNicholas, W. T. Bidirectional relationships of comorbidity with obstructive sleep apnoea. Eur. Respir. Rev. https://doi.org/10.1183/16000617.0256-2021 (2022) Yeghiazarians, Y. et al. Obstructive sleep apnea and cardiovascular disease: A scientific statement from the American Heart Association. Circulation 144, e56–e67. https://doi.org/10.1161/cir.0000000000000988 (2021) Redline, S., Azarbarzin, A. & Peker, Y. Obstructive sleep apnoea heterogeneity and cardiovascular disease. Nat. Rev. Cardiol. 20, 560–573. https://doi.org/10.1038/s41569-023-00846-6 (2023) Martinot, J. B., Le-Dong, N. N., Malhotra, A. & Pépin, J. L. Respiratory effort during sleep and prevalent hypertension in obstructive sleep apnoea. Eur. Respir. J. https://doi.org/10.1183/13993003.01486-2022 (2023) Liu, T. et al. Effect of obstructive sleep apnoea on coronary collateral vessel development in patients with ST-segment elevation myocardial infarction. Respirology 27, 653–660. https://doi.org/10.1111/resp.14277 (2022) Javaheri, S. & Javaheri, S. Obstructive sleep apnea in heart failure: Current knowledge and future directions. J. Clin. Med. https://doi.org/10.3390/jcm11123458 (2022) Zhang, L. et al. Obstructive sleep apnea and liver injury in severely obese patients with nonalcoholic fatty liver disease. Sleep Breath 24, 1515–1521. https://doi.org/10.1007/s11325-020-02018-z (2020) Preshy, A. & Brown, J. A bidirectional association between obstructive sleep apnea and metabolic-associated fatty liver disease. Endocrinol. Metab. Clin. N. Am. 52, 509–520. https://doi.org/10.1016/j.ecl.2023.01.006 (2023) Patop, I. L., Wüst, S. & Kadener, S. Past, present, and future of circRNAs. Embo J. 38, e100836. https://doi.org/10.15252/embj.2018100836 (2019) Kristensen, L. S. et al. The biogenesis, biology and characterization of circular RNAs. Nat. Rev. Genet. 20, 675–691. https://doi.org/10.1038/s41576-019-0158-7 (2019) Huang, X. Y. et al. Exosomal circRNA-100338 promotes hepatocellular carcinoma metastasis via enhancing invasiveness and angiogenesis. J. Exp. Clin. Cancer Res. 39, 20. https://doi.org/10.1186/s13046-020-1529-9 (2020) Hansen, T. B. et al. Natural RNA circles function as efficient microRNA sponges. Nature 495, 384–388. https://doi.org/10.1038/nature11993 (2013) Zeng, P., Cai, X., Yu, X. & Gong, L. Markers of insulin resistance associated with non-alcoholic fatty liver disease in non-diabetic population. Sci. Rep. 13, 20470. https://doi.org/10.1038/s41598-023-47269-4 (2023) Huang, G. et al. CircRNA hsa_circRNA_104348 promotes hepatocellular carcinoma progression through modulating miR-187–3p/RTKN2 axis and activating Wnt/β-catenin pathway. Cell Death Dis. 11, 1065. https://doi.org/10.1038/s41419-020-03276-1 (2020) Kanehisa, M. Toward understanding the origin and evolution of cellular organisms. Protein Sci. 28, 1947–1951. https://doi.org/10.1002/pro.3715 (2019) Kanehisa, M. & Goto, S. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 28, 27–30. https://doi.org/10.1093/nar/28.1.27 (2000) Kanehisa, M., Furumichi, M., Sato, Y., Kawashima, M. & Ishiguro-Watanabe, M. KEGG for taxonomy-based analysis of pathways and genomes. Nucleic Acids Res. 51, D587–D592. https://doi.org/10.1093/nar/gkac963 (2023) Fernandes, J. L. et al. Chronic intermittent hypoxia-induced dysmetabolism is associated with hepatic oxidative stress. Mitochondrial Dysfunct. Inflamm. Antioxid. https://doi.org/10.3390/antiox12111910 (2023) Mesarwi, O. A., Loomba, R. & Malhotra, A. Obstructive sleep apnea, hypoxia, and nonalcoholic fatty liver disease. Am. J. Respir. Crit. Care Med. 199, 830–841. https://doi.org/10.1164/rccm.201806-1109TR (2019) Yang, Q., Li, F., He, A. T. & Yang, B. B. Circular RNAs: Expression, localization, and therapeutic potentials. Mol. Ther. 29, 1683–1702. https://doi.org/10.1016/j.ymthe.2021.01.018 (2021) Nemeth, K., Bayraktar, R., Ferracin, M. & Calin, G. A. Non-coding RNAs in disease: from mechanisms to therapeutics. Nat. Rev. Genet. 25, 211–232. https://doi.org/10.1038/s41576-023-00662-1 (2024) Zhang, Y., Zhan, L., Jiang, X. & Tang, X. Comprehensive review for non-coding RNAs: From mechanisms to therapeutic applications. Biochem. Pharmacol. 224, 116218. https://doi.org/10.1016/j.bcp.2024.116218 (2024) Mei, X. & Chen, S. Y. Circular RNAs in cardiovascular diseases. Pharmacol. Ther. 232, 107991. https://doi.org/10.1016/j.pharmthera.2021.107991 (2022) Wu, D. P. et al. Circular RNAs: Emerging players in brain aging and neurodegenerative diseases. J. Pathol. 259, 1–9. https://doi.org/10.1002/path.6021 (2023) Fan, W., Pang, H., Xie, Z., Huang, G. & Zhou, Z. Circular RNAs in diabetes mellitus and its complications. Front. Endocrinol. 13, 885650. https://doi.org/10.3389/fendo.2022.885650 (2022) He, Z. & Zhu, Q. Circular RNAs: Emerging roles and new insights in human cancers. Biomed. Pharmacother. 165, 115217. https://doi.org/10.1016/j.biopha.2023.115217 (2023) Mehta, S. L., Dempsey, R. J. & Vemuganti, R. Role of circular RNAs in brain development and CNS diseases. Prog. Neurobiol. 186, 101746. https://doi.org/10.1016/j.pneurobio.2020.101746 (2020) Wang, X. et al. CircRNA hsa_circ_0110102 inhibited macrophage activation and hepatocellular carcinoma progression via miR-580-5p/PPARα/CCL2 pathway. Aging 13, 11969–11987. https://doi.org/10.18632/aging.202900 (2021) Wang, L. & Hauenstein, A. V. The NLRP3 inflammasome: Mechanism of action, role in disease and therapies. Mol. Asp. Med. 76, 100889. https://doi.org/10.1016/j.mam.2020.100889 (2020) Kong, P. et al. Inflammation and atherosclerosis: signaling pathways and therapeutic intervention. Signal Transduct. Target Ther. 7, 131. https://doi.org/10.1038/s41392-022-00955-7 (2022) Jo, E. K., Kim, J. K., Shin, D. M. & Sasakawa, C. Molecular mechanisms regulating NLRP3 inflammasome activation. Cell Mol. Immunol. 13, 148–159. https://doi.org/10.1038/cmi.2015.95 (2016) Wu, X. et al. NLRP3 deficiency protects against intermittent hypoxia-induced neuroinflammation and mitochondrial ROS by promoting the PINK1-parkin pathway of mitophagy in a murine model of sleep apnea. Front. Immunol. 12, 628168. https://doi.org/10.3389/fimmu.2021.628168 (2021) Wu, X., Chang, S. C., Jin, J., Gu, W. & Li, S. NLRP3 inflammasome mediates chronic intermittent hypoxia-induced renal injury implication of the microRNA-155/FOXO3a signaling pathway. J. Cell Physiol. 233, 9404–9415. https://doi.org/10.1002/jcp.26784 (2018) Download references This work was supported by the Joint Funds for the innovation of science and Technology Fujian Provincial Natural Science Foundation of China (Grant number: 2024J01662) Fujian Medical University Student Innovation and Entrepreneurship Training Program Funding Project (Grant Numbers: C2024051 and JC2023180) Quanzhou Science and Technology Projects (Grant number: 2022C038R) Natural Science Foundation of Fujian Province (Grant Number: 2023J01719) and Medical Innovation Project of Fujian Provincial Health Science and Technology Program (Grant Number: 2023CXA034) These authors contributed equally: Qingshi Chen Department of Endocrinology and Metabolism The Second Affiliated Hospital of Fujian Medical University This article was drafted by Huiting Lai and Yuwei Chen The conceptualization and design of the experiments were developed by Qingshi Chen and Dexin Liu and Zhuli Peng conducted the experiments and performed data analysis and validation Dexin Liu and Siying Wu analyzed the data and prepared the figures and/or tables The final manuscript was reviewed and approved by all authors Download citation DOI: https://doi.org/10.1038/s41598-025-99612-6 Metrics details a conservatively evolved single-stranded non-coding RNA exerts pivotal control over the appearance of target genes and several biological processes This study conducted a comprehensive screening of candidate microRNAs (miRNAs) associated with Lipoprotein Lipase (LPL) in the large yellow croaker (Larimichthys crocea) utilizing sophisticated bioinformatics techniques across the species’ muscular and hepatic tissues The bioinformatics analysis facilitated the compilation and examination of miRNA datasets specific to these tissues The investigation culminated in the identification of miR-84a and miR-1231-5p as key miRNAs that modulate fat hydrolysis highlighting their potential roles in lipid metabolism Subsequent in-depth analysis further implicated these miRNAs suggesting their integral involvement in the regulation of this critical enzyme Validation of these bioinformatics predictions was conducted through the construction of double luciferase reporters concealing the LPL 3′ untranslated region (3′UTR) substantiating that miR-84a and miR-1231-5p can modulate LPL expression via the LPL 3′UTR miR-891a was not concerned with this regulatory mechanism Site-directed mutagenesis experiments elucidated the specificity of the interaction sequences Quantitative PCR assays suggested that miR-84a and miR-1231-5p might influence LPL expression during the starvation phase intimating the regulatory role of miRNA in fatty acid metabolism within hepatic and muscular tissue under starvation These findings offer a nuanced understanding of LPL’s molecular functionality under stress conditions in fish emphasizing the regulatory dynamics of miRNA during metabolic stress further emphasizing their pivotal role in disease pathogenesis modulation This framework highlights the precarious function of miRNAs in regulating cellular processes that lead to various pathological conditions This evidence underscores the multifaceted role of Lipoprotein lipase in fat metabolism and its significant impact on the pathophysiology of related disorders emphasizing the complex regulatory role of miRNAs in modulating LPL expression and activity a miRNA library was constructed to identify miRNAs that target LPL and an analysis was conducted to elucidate the interaction between miRNAs and LPL in the hepatic and muscular tissue of a large yellow croaker across various periods of starvation For the purpose of elucidating and characterizing miRNAs in the large yellow croaker and the subsequent analytical processing of this dataset facilitated the identification of 1,341 known miRNAs and 108 novel miRNAs within the experimental cohort the control group was found to harbor 1,263 known miRNAs and 99 novel miRNAs Within the cohort of identified known miRNAs 608 were observed to have highly significant differential expression (P < 0.01) and 1,014 exhibited significant differential expression (P < 0.05) when comparing between the experimental and control groups This comprehensive analysis underscores the dynamic range of miRNA expression in the large yellow croaker highlighting the potential regulatory complexities in its transcriptome there were 340 miRNAs that were down-regulated and 268 that were up-regulated the novel miRNAs presented only a limited number of individuals encompassing both up-regulated and down-regulated entities This differential expression analysis delineates the impact of the experimental conditions on miRNA regulation in the large yellow croaker revealed that their P-values were below 0.05 indicating a statistically significant differential expression in comparison to the control group To assess the hypothesized regulatory roles of miR-84a a double luciferase reporter assay implemented to evaluate their regulatory efficacy The experimental design included three control groups: one transfected with an empty plasmid another with the empty vector  + miRNA mimics and a third with a recombinant plasmid harboring the LPL 3′UTR along with a negative control mimic These control groups (NTC) exhibited no significant differences in luciferase activity underscoring the baseline stability of the assay system the above result was obtaining of three miRNAs; miR-84a miR-1231-5p and miR-891a for the double luciferase assay and cell lysis after 48 h The recorded data have a mean ± SE (n = 3) and ** = P < 0.01 (NTC = control group; WT = experimental group b) Relative expression analysis miRNAs (miR-84a and miR 1231-5p) levels in different periods of starvation Samples of Larimichthys crocea were collected at various time points during starvation qPCR was then employed to assess the expression levels of LPL and the microRNAs miR-84a and miR-1231-5p U6 was utilized as a reference gene for miRNA normalization purposes The data are presented as the mean ± standard error of the mean (SEM) for a sample size of three (n = 3) Statistical significance is indicated by asterisks a comprehensive discourse on the regulatory mechanisms of miRNAs targeting the LPL 3′UTR remains scant the primary objective of our research was to delineate the miRNAs that target the LPL 3′UTR within Larimichthys crocea to advance our understanding of their regulatory interactions and implications in the context of starvation and thus suggesting a multifaceted regulatory role for miR-84a This underscores the complex network of miRNA-mediated regulatory mechanisms in lipid metabolism in vitro analyses with Larimichthys crocea miR-1231-5p was identified as a novel target of the LPL gene exhibiting a down-regulated effect on LPL expression This assertion was substantiated through a luciferase reporter assay wherein the miR-1231-5p mimic was demonstrated to attenuate the luciferase activity of a reporter vector containing the wild-type 3′ UTR of the LPL gene This reduction in luciferase activity indicates the specific interaction and regulatory effect of miR-1231-5p on the LPL gene confirming the miRNA’s role in modulating expression post-transcriptionally by binding to its 3′ UTR Our findings suggest that miR-1231-5p modulates LPL function by diminishing its expression particularly in the presence of inhibitors These findings imply that miR-891a could similarly regulate LPL necessitating further investigation to confirm its role in LPL regulation in Larimichthys crocea In vitro investigations have substantiated that both miR-84a and miR-1231-5p specifically target the 3′UTR of the LPL protein in Larimichthys crocea The results indicate that miR-84a acts as an up regulator whereas miR-1231-5p functions as a down regulator of LPL expression These observations highlight the regulatory effect of starvation on miRNA expression and its subsequent impact on LPL activity within the framework of lipid metabolism it is reasonable to hypothesize that miRNAs together with LPL during periods of nutrient deprivation play a critical role in the fatty acid metabolic processes in Larimichthys crocea Given the complex biological functions of miRNAs and LPL their interaction and collective influence on fatty acid metabolism and related diseases merit in-depth exploration 150 specimens of large yellow croaker (Larimichthys crocea) each having 60 ± 6.24 g of average body weight These specimens were captured from Xiangshan Bay and subsequently cultured in cages measuring 3 × 3 × 3 cubic meters the fish underwent a one-week acclimatization period in marine water maintained at 25 °C they were distributed into two cohorts: a control and an experimental group the fish were fed a commercial diet daily in the morning and evening while the control group continued on the regular feeding schedule the experimental group was subjected to a fasting regime for 35 days Liver and muscle tissues were systematically sampled at baseline and then weekly for five weeks from the start of the fasting period three fish were randomly selected from each group and anesthetized with Tricaine-S (MS-222) at a concentration of 50 mg L^-1 Tissue specimens were collected upon the onset of unconsciousness and stored at -80 °C for subsequent analyses The libraries for two miRNAs were constructed from the liver tissue of Larimichthys crocea following a fasting period of 35 days and under normal feeding conditions These libraries were then sent to BGI Biotech Company for miRNA transcriptome sequencing and the resultant fragments of varying lengths were separated using polyacrylamide gel electrophoresis (PAGE) RNA fragments within the range of 18 to 30 nucleotides were excise and purified The purified RNA samples were subsequently dissolved in an Elution Buffer (EB) to complete the library preparation process The integrity and concentration of the resultant libraries were evaluated using an Agilent 2100 Bioanalyzer and quantified using the ABI Step One Plus Real-Time PCR System (Applied Biosystems Subsequent high-throughput sequencing was conducted on the Illumina HiSeq 2000 platform To enhance the quality of the sequence data filters were applied to exclude repetitive sequences and non-coding RNAs that are ribosomal RNA (rRNA) The retained small RNA (sRNA) sequences were then aligned against the miRBase 21.0 database to identify and annotate the miRNA species present ensuring a complete analysis of the miRNA repertoire within the samples These analyses were aim at identifying qualified miRNAs from the miRNA transcriptome data adhering to the subsequent criteria: (1) A complementary sequence for miRNA present on LPL gene (2) The miRNAs should demonstrate a significant level of expression with a minimum threshold of 500 copies detected in the sequencing data to indicate biological relevance (3) The miRNAs under investigation must exhibit differential expression between conditions of fasting and normal feeding suggesting a functional role in response to nutritional status (4) Priority was given to miRNAs that were consistently predicted by both miRanda and TargetScan leveraging the intersection of these software tools to enhance the reliability of the predicted regulatory interactions LPL 3′UTR cloned into the psiCHECK-2 vector (Restriction site NotI and XhoI) The integrity and correctness of the resulting plasmids were confirmed through sequencing analysis This experimental design aimed to elucidate the miRNA interactions with both wild-type and mutated 3′UTR sequences of the LPL gene providing insights into the miRNAs’ regulatory mechanisms Origin Pro (version 2016) software was utilized Statistical significance was determined based on p-value thresholds of ≤ 0.01 and ≤ 0.05 thereby establishing the criterion for significant differences in the studied parameters The Larimichthys crocea specimens utilized in this research procured from Xiangshan Bay Aquatic Breeding Co. The acquisition of these fish did not necessitate any specific permissions All experimental procedures involving these animals conducted with the authorization of the Ningbo University Animal Care and Use Committee (Protocol#NBU20230067) The study adhered strictly to the ethical guidelines established by this committee ensuring compliance with the prescribed standards for animal welfare and research ethics Sequence data that support the findings of this study have been deposited in the NCBI Sequence Read Archive with the primary accession code GSE113656 Transcriptome-wide identification and characterization of the Macrobrachium rosenbergii microRNAs potentially related to immunity against non-O1 Vibrio cholerae infection Grunz, F. A. & Muller, S. Principles of miRNA–mRNA interactions: beyond sequence complementarity. Cell Mol. Life Sci. 72(16), 3127–3141. https://doi.org/10.1007/s00018-015-1922-2 (2015) MicroRNA expression and analysis of immune-related putative target genes in ISKNV-infected spleen of mandarin fish (Siniperca chuatsi) 6-gingerol protects against nutritional steatohepatitis by regulating key genes related to inflammation and lipid metabolism MicroRNA-193a and taxol combination: A new strategy for treatment of colorectal cancer Up-regulated microRNA-31 inhibits oxidative stress-induced neuronal injury through the JAK/STAT3 pathway by binding to PKD1 in mice with ischemic stroke Chu, Q., Yan, X., Liu, L. & Xu, T. The Inducible microRNA-21 negatively modulates the inflammatory response in teleost fish via targeting IRAK4. Front. Immunol. 16(10), 1623. https://doi.org/10.3389/fimmu.2019.01623 (2019) Lipoprotein lipase (LpL) on the surface of cardiomyocytes increases lipid uptake and produces a cardiomyopathy Guo, Y. et al. MiR-212–5p suppresses lipid accumulation by targeting FAS and SCD1. J. Mol. Endocrinol. JME https://doi.org/10.1530/JME-16-0179 (2017) MicroRNA-467b targets LPL gene in RAW 264.7 macrophages and attenuates lipid accumulation and proinflammatory cytokine secretion Genistein downregulates de novo lipid synthesis and impairs cell proliferation in human lung cancer cells MicroRNA-24 can control triacylglycerol synthesis in goat mammary epithelial cells by targeting the fatty acid synthase gene A novel teleost microRNA regulates autophagy and NF-κB activation during bacterial infection Mir-152 regulates 3T3-L1 preadipocyte proliferation and differentiation The effect of miR-196a-5p on proliferation and differentiation of 3T3-L1 preadipocyte MicroRNA-134 actives lipoprotein lipase-mediated lipid accumulation and inflammatory response by targeting angiopoietin-like 4 in THP-1 macrophages The draft genome of the large yellow croaker reveals well-developed innate immunity Changes in activities and mRNA expression of lipoprotein lipase and fatty acid synthetase in large yellow croaker Micro-RNA expression abnormalities of pancreatic Zhang, N. et al. Adipokines and free fatty acids regulate insulin sensitivity by increasing microRNA-21 expression in human mature adipocytes. Mol. Med. Rep. 16(2), 2254–2258. https://doi.org/10.3892/mmr.2017.6769 (2017) miRNAs associated with immune response in teleost fish Developmental & Comparative Immunology: S0145305X17301106 (2017) Genes involved in fatty acid metabolism: molecular characterization and hypothalamic mRNA response to energy status and neuropeptide Y treatment in the orange-spotted grouper Epinephelus coioides Decreased miR122 in hepatocellular carcinoma leads to chemoresistance with increased arginine Identification and evaluation of suitable reference genes for normalization of microRNA expression in Helicoverpa armigera (Lepidoptera: Noctuidae) using quantitative real-time PCR Involvement of microRNAs in the regulation of muscle wasting during catabolic conditions Genetic polymorphisms of LPL and HL and their association with the performance of Chinese sturgeons fed a formulated diet miR-29b targets LPL and TDG genes and regulates apoptosis and triglyceride production in MECs Andreassen, R. et al. Identification of differentially expressed Atlantic salmon miRNAs responding to salmonid alphavirus (SAV) infection. BMC Genomics 18(1), 349. https://doi.org/10.1186/s12864-017-3741-3 (2017) Thompson-Peer, K., Bai, J., Hu, Z. & Kaplan, J. M. HBL-1 patterns synaptic remodeling in C. elegans. Neuron. 73(3), 453–465. https://doi.org/10.1016/j.neuron.2011.11.025 (2012) MicroRNAs as biomarkers for liver disease and hepatocellular carcinoma Chen, T. et al. MicroRNA-29a regulates pro-inflammatory cytokine secretion and scavenger receptor expression by targeting LPL in ox LDL-stimulated dendritic cells. Febs Lett. 585(4), 657–663. https://doi.org/10.1016/j.febslet.2011.01.027 (2011) Xu, T., Chu, Q., Cui, J. & Zhao, X. The inducible microRNA-203 in fish represses the inflammatory responses to Gram-negative? Bacteria by targeting IL-1 receptor-associated kinase. J. Biol. Chem. 293(4), 1386–1396. https://doi.org/10.1074/jbc.RA117.000158 (2017) MicroRNA-216a inhibits NF-κB-mediated inflammatory cytokine production in teleost fish by modulating p65 Yan, L. K., Li, W., Yao, J. F. & Mao, Z. J. Effect of miR-1231 on proliferation, apoptosis and invasion of colon cancer stem cells. Chin. J. Tissue Eng. Res. https://doi.org/10.3969/j.issn.2095-4344.2016.45.009 (2016) Human microRNA has-miR-1231 suppresses hepatitis B virus replication by targeting core mRNA The Caenorhabditis elegans SOMI-1 zinc finger protein and SWI/SNF promote regulation of development by the mir-84 microRNA Potential regulation by miRNAs on glucose metabolism in liver of common carp (Cyprinus carpio) at different temperatures MicroRNA alternations in the testes related to the sterility of triploid fish miRanda application: Human MicroRNA targets Agarwal, V., Bell, G. W., Nam, J. & Bartel, P. Predicting effective microRNA target sites in mammalian mRNAs. eLife 12(4), e05005. https://doi.org/10.7554/eLife.05005 (2015) Physiological response and miRNA-mRNA interaction analysis in the head kidney of rainbow trout exposed to acute heat stress Epigenetic silencing of MicroRNA miR-107 regulates cyclin-dependent kinase 6 expression in pancreatic cancer Analysis of microRNA (miRNA) expression profiles reveals 11 key biomarkers associated with non-small cell lung cancer Download references The financial support for the research discussed in this paper was provided by the Breeding-Special Fund of Zhejiang Province as denoted by the grant number 2016C02055-7 the research received funding from the Agricultural Major Project of Ningbo Municipality identified by the grant number 2015C110005 This financial backing played a crucial role in facilitating the research activities and achieving the objectives outlined in the study All authors have read and agreed to the published version of the manuscript Download citation DOI: https://doi.org/10.1038/s41598-024-82988-2 Sign up for the Nature Briefing: Translational Research newsletter — top stories in biotechnology Metrics details Adult glioblastoma (GBM) is a highly aggressive primary brain tumor accounting for nearly half of all malignant brain tumors with a median survival rate of only 8 months Treatment for GBM is largely ineffective due to the highly invasive nature and complex tumor composition of this malignancy non-coding RNAs that regulate gene expression by binding to messenger RNAs (mRNA) While specific miRNA have been associated with GBM their precise roles in tumor development and progression remain unclear the analysis of miRNA expression data from 743 adult GBM cases and 59 normal brain samples identified 94 downregulated miRNA and 115 upregulated miRNA Many of these miRNA were previously linked to GBM pathology while we also identified novel miRNA that may act as potential regulators in GBM By integrating miRNA predictions with gene expression data we were able to associate downregulated miRNA with tumor microenvironment factors including extracellular matrix remodeling and signaling pathways involved in tumor initiation while upregulated miRNA were found to be associated with essential neuronal processes This analysis highlights the significance of miRNA in GBM and serves as a foundation for further investigation there is a critical need to gain a deeper understanding of GBM biology before effective treatment strategies can be realized we integrated additional datasets to create the largest-to-date collection of miRNA expression data from adult primary GBM patients provides the most comprehensive analysis of miRNA in GBM to date with potential for further investigation as more data become available Publicly available miRNA expression datasets were identified using the search terms ‘microRNA’ and ‘glioblastoma’ on NCBI GEO and NCI databases between May 2023 and January 2024 All identified datasets were manually screened and filtered based on the following criteria: each dataset required a minimum of 3 brain tumor samples and 3 non-cancerous brain tissue controls This study focuses on adult primary IDH-wildtype GBM These five (GSE158284) and sixteen (GSE25631) sample outliers were removed from subsequent analyses Quality control measures in the remaining datasets did not reveal any samples of poor quality the integrated differential expression analysis was repeated nine times with each iteration excluding data from one specific dataset Changes in significantly dysregulated hits were evaluated in comparison to the original list of hits We performed platform-specific individual dataset processing These results were integrated using MetaVolcanoR and metapro packages as previously described The list of dysregulated protein-coding genes was used for target prediction analysis Protein-coding genes were randomly bootstrap sampled without replacement over 1000 iterations using the python programming language The number of genes sampled corresponded to the number of upregulated and downregulated protein-coding genes A bidirectional miRNA-target prediction was performed for each set of randomized gene lists and the corresponding dysregulated miRNA list as described above using the mirDIP python API The bootstrapped-based prediction analysis calculated the number of interactions between dysregulated miRNA and randomly sampled genes Confidence intervals (CI) were calculated for each bootstrap sampled distribution to determine if the actual observed number of interactions identified was unique compared to the distribution of the number of random interactions Pathways were categorized using the Reactome pathway browser tool Using gene lists associated with each pathway dot plots were created to identify the predicted targets of miRNA implicated in ECM remodeling Schematic overview of the miRNA analysis pipeline PCA and volcano plots identify differences in miRNA expression between GBM and controls in nine datasets Each panel highlights data from one dataset: GSE158284 (a) Left side of each panel shows PCA clustering based on miRNA expression data with GBM brain samples in light blue and non-cancerous brain samples in light red volcano plots illustrate differentially expressed miRNA Total number of significantly dysregulated hits in GBM (q-value < 0.05 log2 fold change > 1) is noted for each dataset Significantly upregulated miRNA are highlighted in dark red while downregulated miRNA are in dark blue Identification of miRNA and protein-coding genes widely dysregulated in GBM Volcano plot illustrating dysregulated miRNA (a) and protein-coding genes (b) in GBM across all 9 and 3 datasets log2 fold change > 1) is noted for plot Significantly upregulated genes are highlighted in red (a) and orange (b) while downregulated genes are in blue (a) and purple (b) 83–99% of the significantly dysregulated hits remained consistent across all leave-one-out analyses indicating that no single dataset unduly skewed the results Because the observed number of interactions exceeded the 95% confidence interval of the random distribution this analysis demonstrates that the identified miRNA-target interactions are non-random the presence of these experimentally validated interactions strengthens our findings Pathways linked with downregulated miRNA hits showcase their involvement in ECM remodeling (a) Network map of pathway enrichment analysis from upregulated genes targeted by downregulated miRNA (b) Dot plot revealing targets of candidate downregulated miRNA associated with ECM remodeling pathways (c) Dot plot revealing targets of candidate downregulated miRNA associated with growth-stimulating and immune-related signaling pathways our findings highlight a set of downregulated miRNA predicted to regulate upregulated mRNA encoding crucial growth and immune-related signaling molecules in GBM Pathways linked with upregulated miRNA hits highlight their involvement in core neuronal processes (a) Network map of pathway enrichment analysis from downregulated genes targeted by upregulated miRNA (b) Dot plot revealing targets of candidate upregulated miRNA associated with core neuronal pathways our analysis incorporates additional profiling data and is exclusively focused on carefully curated datasets of adult primary GBM tumors Stringent quality control measures were implemented to ensure data integrity and eliminate low-quality samples The identification of these previously characterized miRNA strengthens the confidence in our methodology and findings We also identified several downregulated miRNA with no reported link to GBM (miR-12136 miR-642a-5p) and several that have been linked to GBM (miR-874-3p but specific roles have not been investigated we identified upregulated miRNA not previously reported as dysregulated in GBM (miR-199b-5p miR-660-5p) and a subset with uncharacterized roles (miR-1825 the increased statistical power afforded by our larger sample size enabled the identification of miRNA not previously investigated in GBM opening avenues for novel discoveries and potentially revealing previously unknown regulatory mechanisms in GBM biology To investigate potential mechanisms underlying the roles of these miRNA in GBM development we next examined the targetome of all dysregulated miRNA Because miRNA target prediction algorithms often fail to account for tissue-specific differences in gene expression and miRNA-mRNA interactions we integrated miRNA prediction algorithms with differential expression analysis of protein-coding genes focusing on dysregulated miRNA and protein-coding genes with reciprocally directed expression changes downregulation of these miRNA is predicted to derepress ECM components our results highlight the importance of understanding miRNA-mediated mechanisms regulating ECM in GBM The presence of other cancer-associated cells may further contribute to the observed relative decrease in neuronal processes The data that support the findings of this study are available from the corresponding author upon request The 2021 WHO classification of tumors of the central nervous system: A summary CBTRUS statistical report: Primary brain and other central nervous system tumors diagnosed in the United States in 2015–2019 Safe surgery for glioblastoma: Recent advances and modern challenges A restricted cell population propagates glioblastoma growth after chemotherapy Glioma stem cells promote radioresistance by preferential activation of the DNA damage response Gradient of developmental and injury response transcriptional states defines functional vulnerabilities underpinning glioblastoma heterogeneity Single-cell RNA-seq reveals that glioblastoma recapitulates a normal neurodevelopmental hierarchy Tumor evolution of glioma-intrinsic gene expression subtypes associates with immunological changes in the microenvironment Single-cell RNA sequencing and spatial transcriptomics reveal cancer-associated fibroblasts in glioblastoma with protumoral effects Glioblastoma remodelling of human neural circuits decreases survival Single-cell RNA sequencing reveals evolution of immune landscape during glioblastoma progression The CNS and the brain tumor microenvironment: implications for glioblastoma immunotherapy Microglia stimulate the invasiveness of glioma cells by increasing the activity of metalloprotease-2 Functional contribution and clinical implication of cancer-associated fibroblasts in glioblastoma Most mammalian mRNAs are conserved targets of microRNAs MicroRNAs and small interfering RNAs can inhibit mRNA expression by similar mechanisms Both natural and designed micro RNAs can inhibit the expression of cognate mRNAs when expressed in human cells Integrating multi-omics analysis for enhanced diagnosis and treatment of glioblastoma: A comprehensive data-driven approach Risk Score based on microRNA expression signature is independent prognostic classifier of glioblastoma patients and differentiation programs in glioblastoma regulates the expression of FOXJ3 and RAB31 and promotes the survival of GSCs Meta-Analysis of RNA-Seq Datasets Identifies Novel Players in Glioblastoma Proteogenomic and metabolomic characterization of human glioblastoma MicroRNA-138 suppresses glioblastoma proliferation through downregulation of CD44 The putative tumor suppressor miR-524-5p directly targets Jagged-1 and Hes-1 in glioma miR-181d: A predictive glioblastoma biomarker that downregulates MGMT expression Simultaneous miRNA and mRNA transcriptome profiling of glioblastoma samples reveals a novel set of OncomiR candidates and their target genes Oligodendrocyte progenitor cells and macrophages/microglia produce glioma stem cell niches at the tumor border High-throughput microRNA profile in adult and pediatric primary glioblastomas: The role of miR-10b-5p and miR-630 in the tumor aggressiveness The somatic genomic landscape of glioblastoma Reduced expression of hsa-miR-338-3p contributes to the development of glioma cells by targeting mitochondrial 3-Oxoacyl-ACP synthase (OXSM) in glioblastoma (GBM) Synthetic miR-21 decoy circularized by tRNA splicing mechanism inhibited tumorigenesis in glioblastoma in vitro and in vivo models Ledford, H. MicroRNAs won the Nobel - will they ever be useful as medicines?. Nature https://doi.org/10.1038/d41586-024-03303-7 (2024) Lopez-Romero, P. AgiMicroRna: Processing and differential expression analysis of agilent microRNA chips. Bioconductor https://doi.org/10.18129/b9.bioc.agimicrorna (2023) A framework for oligonucleotide microarray preprocessing limma powers differential expression analyses for RNA-sequencing and microarray studies edgeR: a Bioconductor package for differential expression analysis of digital gene expression data Optimizing the noise versus bias trade-off for Illumina whole genome expression BeadChips A comparison of background correction methods for two-colour microarrays miRBaseConverter: an R/Bioconductor package for converting and retrieving miRNA name sequence and family information in different versions of miRBase arrayQualityMetrics–a bioconductor package for quality assessment of microarray data Blighe, K., Rana, S. & Lewis, M. EnhancedVolcano: Publication-ready volcano plots with enhanced colouring andlabeling. Bioconductor https://doi.org/10.18129/b9.bioc.enhancedvolcano (2022) Prada, C., Lima, D. & Nakaya, H. MetaVolcanoR: Gene expression meta-analysis visualization tool. Bioconductor https://doi.org/10.18129/b9.bioc.metavolcanor (2022) Powerful p-value combination methods to detect incomplete association Salmon provides fast and bias-aware quantification of transcript expression Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences [version 1; peer review: 2 approved] mirDIP 4.1-integrative database of human microRNA target predictions miRTarBase update 2022: an informative resource for experimentally validated miRNA-target interactions TarBase-v9.0 extends experimentally supported miRNA-gene interactions to cell-types and virally encoded miRNAs g:Profiler-interoperable web service for functional enrichment analysis and gene identifier mapping (2023 update) Enrichment map: a network-based method for gene-set enrichment visualization and interpretation Integrated molecular genetic profiling of pediatric high-grade gliomas reveals key differences with the adult disease Pediatric glioblastomas: A histopathological and molecular genetic study The role of behab/brevican in the tumor microenvironment: mediating glioma cell invasion and motility The extracellular matrix molecule tenascin-C modulates cell cycle progression and motility of adult neural stem/progenitor cells from the subependymal zone Fibrillin 2 gene knockdown inhibits invasion and migration of lung cancer cells From signalling pathways to targeted therapies: Unravelling glioblastoma’s secrets and harnessing two decades of progress A positive feed-forward loop associating EGR1 and PDGFA promotes proliferation and self-renewal in glioblastoma stem cells HBEGF promotes gliomagenesis in the context of Ink4a/Arf and Pten loss TCF12 deficiency impairs the proliferation of glioblastoma tumor cells and improves survival c-Fos over-expression promotes radioresistance and predicts poor prognosis in malignant glioma The MAP3K1/c-JUN signaling axis regulates glioblastoma stem cell invasion and tumor progression LIF regulates CXCL9 in tumor-associated macrophages and prevents CD8+ T cell tumor-infiltration impairing anti-PD1 therapy The proteomic landscape of glioblastoma recurrence reveals novel and targetable immunoregulatory drivers CCR5-mediated signaling is involved in invasion of glioblastoma cells in its microenvironment Identification and validation of SOCS1/2/3/4 as potential prognostic biomarkers and correlate with immune infiltration in glioblastoma Oncogenic effects of miR-10b in glioblastoma stem cells miR-139/PDE2A-Notch1 feedback circuit represses stemness of gliomas by inhibiting Wnt/β-catenin signaling miR‑124‑3p inhibits the viability and motility of glioblastoma multiforme by targeting RhoG Wiranowska, M. & Rojiani, M. V. Extracellular matrix microenvironment in glioma progression. In Glioma—Exploring Its Biology and Practical Relevance (ed. Ghosh, A.) (InTech, 2011). https://doi.org/10.5772/24666 The mechanical rigidity of the extracellular matrix regulates the structure Microenvironmental stiffness enhances glioma cell proliferation by stimulating epidermal growth factor receptor signaling gelatinase-B (MMP-9) and membrane type matrix metalloproteinase-1 (MT1-MMP) are involved in different aspects of the pathophysiology of malignant gliomas Suppression of membrane-type 1 matrix metalloproteinase (MMP)-mediated MMP-2 activation and tumor invasion by testican 3 and its splicing variant gene product Expression of different extracellular matrix components in human brain tumor and melanoma cells in respect to variant culture conditions Expression of extracellular matrix components in a highly infiltrative in vivo glioma model miR-218 affects the ECM composition and cell biomechanical properties of glioblastoma cells COL1A2 inhibition suppresses glioblastoma cell proliferation and invasion HIF-1α-mediated LAMC1 overexpression is an unfavorable predictor of prognosis for glioma patients: evidence from pan-cancer analysis and validation experiments Glioblastoma invasiveness and collagen secretion are enhanced by vitamin C Type V collagen alpha 1 chain promotes the malignancy of glioblastoma through PPRC1-ESM1 axis activation and extracellular matrix remodeling Glioma expansion in collagen I matrices: analyzing collagen concentration-dependent growth and motility patterns Collagen as a double-edged sword in tumor progression microRNA-7 inhibits the epidermal growth factor receptor and the Akt pathway and is down-regulated in glioblastoma Feedback circuitry between miR-218 repression and RTK activation in glioblastoma miR-218-5p inhibits the malignant progression of glioma via targeting TCF12 MicroRNAs: As critical regulators of tumor- associated macrophages M2-like tumor-associated macrophages transmit exosomal miR-27b-3p and maintain glioblastoma stem-like cell properties Evidence for selective microRNAs and their effectors as common long-term targets for the actions of mood stabilizers Glioma synapses recruit mechanisms of adaptive plasticity Electrical and synaptic integration of glioma into neural circuits Glutamatergic synaptic input to glioma cells drives brain tumour progression FDA approves fifth RNAi drug—Alnylam’s next-gen hATTR treatment Download references We would like to thank all past and present members of the Salmena Lab for their contributions is recipient of Tier II Canada Research Chair (CRC) and was supported by a Human Frontier Career Development Program (HFSP) award Funding for this research was provided in part by Temerty Faculty of Medicine and Department of Pharmacology and Toxicology University of Toronto and awards received from Canada Foundation for Innovation (CFI-33505) and in part from the Canadian Institute of Health Research (CIHR511837) is funded by a CIHR Doctoral Research Award (CIHR181364) is funded through The Data Sciences Institute Summer Undergraduate Data Science (SUDS) research opportunity and a University of Toronto Excellence Award (UTEA) These authors contributed equally: Iulia A Jonathan Tak-Sum Chow & Leonardo Salmena Developmental Biology and Cancer Research and Teaching Department conceptualized and interpreted the results All authors revised and approved the manuscript Download citation DOI: https://doi.org/10.1038/s41598-024-78337-y Sign up for the Nature Briefing: Cancer newsletter — what matters in cancer research Metrics details To estimate the correlation between miRNA-338-3p/miRNA-1250-5p/miRNA-3065-5p clusters and ischemic stroke (IS) 83 hospitalized patients diagnosed with IS (experimental group) and 50 healthy subjects (control group) were enrolled in the Affiliated Hospital of North Sichuan Medical College from July 2020 to December 2020 and miRNA-3065-5p in peripheral blood mononuclear cells (PBMCs) were measured by real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) The expressions of miRNA-1250-5p and miRNA-3065-5p were significantly higher in the experimental group compared to the control group (2.04 ± 0.22 vs respectively) No significant difference in miRNA-338-3p expression was observed between the experimental and control groups (1.87 ± 0.22 vs The expression levels of miRNA-1250-5p increased after 24 h and no more than 7 days of disease progression but decreased after 7 days compared to baseline (P < 0.05) The expression levels of miRNA-3065-5p and miRNA-338-3p in patients with a discharge National Institutes of Health Stroke Scale (NIHSS) score greater than 33 were higher than those in the group with a score of 3 or less (P < 0.05) the expression level of miRNA-3065-5p in patients with discharged mRS scores of 3 or higher was greater than in patients with discharged mRS scores of 2 or lower (P < 0.05) The miRNA-338-3p/miRNA-1250-5p/miRNA-3065-5p clusters showed a positive correlation with neutrophil percentage and a negative correlation with lymphocyte percentage (P < 0.05) and miRNA-3065-5p significantly correlated in IS (P < 0.001) miRNA-1250-5p and miRNA-3065-5p may be associated with IS defined as two or more miRNA genes closely located on chromosomes making them a focal point of research in recent years the expression levels of these microRNAs in patients with IS remain unknown We hypothesized that the miRNA-338-3p/miRNA-1250-5p/miRNA-3065-5p clusters are important transcriptional regulators affecting the prognosis of IS which could facilitate further exploration of the regulatory transcriptional mechanisms underlying ischemia-reperfusion and provide molecular evidence for new therapeutic options for IS We tested this hypothesis by investigating the expression of the miRNA-338-3p/miRNA-1250-5p/miRNA-3065-5p clusters in IS through a case-control study derived from a Chinese population The study population comprised 83 patients with IS (the experimental group and 50 healthy volunteers (the control group All patients were selected in the department of Neurology Affiliated Hospital of North Sichuan Medical College from July 2020 to December 2020 Two neurologists diagnosed them based on the 11th Clinical Revision of International Classification of diseases (ICD-11-CM) diagnostic criteria the 4th National Cerebrovascular Conference in 1995 and the 4th National Cerebrovascular Disease Academic Conference in 2018 Patients diagnosed with transient ischemic attacks severe kidney and liver function damage were excluded The volunteers were from the physical examination center of the same hospital during the same period Informed consents were obtained for all participants age and race of the control group were matched as closely as possible to the patients in the experimental group This study was approved by the Ethics Committee of the North Sichuan Medical College Ethics Committee and conformed to the guidelines of the Declaration of Helsinki was carried out for cDNA synthesis of miRNA using minute Plus miRNA first-Stran cDNA synthesis kit (TIANGEN PCR products were analyzed using agarose gel electrophoresis (1%) stained with Genegreen Nucleic Acid Dye. Gel images of miRNA and U6 were visualized. U6 was used as an internal reference. Lanes: M:Maker, (1)(2)(3) miRNA, (4)(5)(6)U6. The predicted structure of miRNA-338, miRNA-1250 and miRNA-3065. (A) miR-338(hsa-mir-338), (B) miR-1250(hsa-mir-1250). (C) miR-3065(hsa-mir-3065). miR-338, miR-1250 and miR-3065 are all locate in chr17.From miRCarta V1.1 (https://mircarta.cs.uni-saarland.de/advanced_search/) Statistical analyses were conducted using IBM SPSS 25.0 and data were plotted using Prism 7.0 (Graphpad) A double-sided significance threshold of P < 0.05 was applied Normality tests were performed using the Kolmogorov-Smirnov test data are presented as mean ± standard deviation (\(\overline {x}\) ±s)or [median (P25 Differences between the two groups were assessed using either a parametric test (Student’s t-test) or a non-parametric test (Wilcoxon rank sum test) and miRNA-3065-5p across two or more groups were compared using the Hotelling T2 test or Wilks Λ test Categorical variables are presented as percentages (%) and differences were analyzed using the Chi-square test Correlation analyses were performed using either Pearson or Spearman methods Table 2 summarizes the clinical characteristics of the experimental and control groups There were no significant differences in gender and age between the experimental and control groups (P > 0.05) and miRNA-3065-5p in PBMCs between the experimental and control groups (A) The expression level of miRNA-338-3p in the experimental group was higher than in the control group this difference was not statistically significant (B) The expression level of miRNA-1250-5p in the experimental group was higher than that in the control group and the difference between the two groups was statistically significant (C) The expression level of miRNA-3065-5p in the experimental group was also higher than in the control group with a statistically significant difference observed between the two groups *P < 0.05,**P < 0.01,***P < 0.001 and miRNA-3065-5p were analyzed between groups according to the stages of the disease The difference in miRNA-1250-5p expression between groups was statistically significant and miRNA-3065-5p were evaluated between groups based on the discharge NIHSS score The differences in miRNA-338-3p and miRNA-3065-5p expression between groups were statistically significant and miRNA-3065-5p were compared between groups according to discharge mRS scores The difference in miRNA-3065-5p expression between groups was statistically significant Table 6; Fig. 5 illustrate the correlation among miRNA-338-3p, miRNA-1250-5p, and miRNA-3065-5p in IS. The expression levels of miRNA-338-3p, miRNA-1250-5p, and miRNA-3065-5p were significantly positively correlated in IS. The correlational analysis between miRNA-338-3p (A–C) Illustrate the correlations between miRNA-338-3p and miRNA-3065-5p in the experimental group while (D–F) depict these correlations in the overall population miRNA-338-3p was positively correlated with miRNA-1250-5p (r = 0.381 miRNA-338-3p was positively correlated with miRNA-3065-5p (r = 0.422 miRNA-1250-5p was positively correlated with miRNA-3065-5p (r = 0.531 miRNA-338-3p was positively correlated with miRNA-1250-5p miRNA-338-3p was negatively correlated with miRNA-1250-5p while a positive correlation was observed in the total population (r = 0.234 (E) miRNA-338-3p positively correlated with miRNA-3065-5p in the experimental (F) miRNA-1250-5p was positively correlated with miRNA-3065-5p in the experimental group Figure 6 presents the results of the ROC analysis for miRNA-338-3p, miRNA-1250-5p, and miRNA-3065-5p in predicting IS. The AUC values are 0.553, 0.659, and 0.737, with 95% confidence intervals of 0.455–0.650, 0.562–0.756, and 0.651–0.822, respectively. The primary outcomes of miRNA-338-3p, miRNA-1250-5p, and miRNA-3065-5p levels were presented in Table 7 for each study and miRNA-3065-5p clusters in IS has not been thoroughly explored we examined the expression levels of miRNA-338-3p and miRNA-3065-5p in PBMCs from IS patients and healthy individuals Our findings indicate that the expression levels of miRNA-1250-5p and miRNA-3065-5p in the PBMCs of IS patients were significantly higher than those in the control group miRNA-1250-5p and miRNA-3065-5p may play a role in the pathophysiological processes associated with IS by regulating immune cell polarization the miRNA-338-3p/miRNA-1250-5p/miRNA-3065-5p clusters may co-transcribe and synergistically participate in the inflammatory response of IS affecting the progression and prognosis of IS and could become one of the intervention targets for IS further research is needed to understand its upstream and downstream mechanisms the miRNA-338-3p/miRNA-1250-5p/miRNA-3065-5p clusters may be involved in the pathophysiological processes of IS The miRNA-338-3p/miRNA-1250-5p/miRNA-3065-5p clusters are closely related to inflammatory markers suggesting that the miRNA-338-3p/miRNA-1250-5p/miRNA-3065-5p clusters may affect the severity and prognosis of IS by regulating inflammatory responses and other mechanisms the study was a single-center case-control study with a small sample and a single population structure which did not represent the total population and may lead to statistical bias IS is a complex disease influenced by multiple factors and dynamic changes over time and miRNAs may play different roles at different stages of the disease we did not dynamically detect the miRNA clusters expression in the same individual Circulating extracellular-vesicle-incorporated microRNAs as potential biomarkers for ischemic stroke in patients with cancer Anti-CHAC1 exosomes for nose-to-brain delivery of mir-760-3p in cerebral ischemia/reperfusion injury mice inhibiting neuron ferroptosis Mir-671-5p upregulation attenuates blood-brain barrier disruption in the ischemia stroke model via the NF-кB/MMP-9 signaling pathway Deciphering the role of microRNAs: unveiling clinical biomarkers and therapeutic avenues in atrial fibrillation and associated stroke—A systematic review A novel miR-338-3p/SLC1A5 axis reprograms retinal pigment epithelium to increases its resistance to high glucose-induced cell ferroptosis sponges miR-1250 to upregulate MTA1 to promote cell proliferation CIRC_0012535 contributes to lipopolysaccharide-induced fetal lung fibroblast apoptosis and inflammation to regulate infantile pneumonia development by modulating the mir-338-3P/IL6R signaling A microRNA panel that regulates proinflammatory cytokines as diagnostic and prognosis biomarkers in colon cancer Epigenetically silenced apoptosis-associated tyrosine kinase (AATK) facilitates a decreased expression of cyclin D1 and WEE1 phosphorylates TP53 and reduces cell proliferation in a kinase-dependent manner Regulation of miRNA 219 and miRNA clusters 338 and 17–92 in oligodendrocytes Downregulation of mir-338-3p alleviates neuronal ischemic injury by decreasing cPKCγ-Mediated autophagy through the Akt/mTOR pathway Mir-3065-3p promotes stemness and metastasis by targeting CRLF1 in colorectal cancer Ischemic stroke and transient ischemic attack in young adults: risk factors Impaired nutritional condition after stroke from the hyperacute to the chronic phase: a systematic review and meta-analysis Long-term outcomes among ischemic stroke TOAST subtypes: a 12-year cohort study in China Temporal trend of comorbidity and increasing impacts on mortality and hospital costs of first stroke in Tianjin Safety and efficacy of tirofiban in preventing neurological deterioration in acute ischemic stroke (TREND): protocol for an investigator-initiated Endovascular thrombectomy beyond 24 hours from ischemic stroke onset: a propensity score matched cohort study Prognostic significance of international normalised ratio and prothrombin time in Chinese acute ischaemic stroke patients RVD2 emerges as a serological marker in relation to severity and six-month clinical outcome following acute intracerebral hemorrhage: a prospective cohort study from a single academic institution Efficacy and safety of Ginkgolide with intravenous alteplase thrombolysis in acute ischemic stroke with large vessel occlusion: a subgroup analysis of GIANT Exosomal miR-128-3p reversed fibrinogen-mediated inhibition of oligodendrocyte progenitor cell differentiation and remyelination after cerebral ischemia MicroRNA let-7e is a potential circulating biomarker of acute stage ischemic stroke MicroRNA-338 inhibition protects against focal cerebral ischemia and preserves mitochondrial function in vitro in astrocytes and neurons via COX4I1 LncRNA CASC15 promotes cerebral ischemia/reperfusion injury via miR-338-3p/ETS1 axis in acute ischemic stroke Long non-coding RNA MALAT1 promotes acute cerebral infarction through miRNAs-mediated hs-CRP regulation in endothelial cells is an essential molecule for angiogenesis Circulating miR-338 cluster activities on osteoblast differentiation: potential diagnostic and therapeutic targets for postmenopausal osteoporosis Cascaded bio-responsive delivery of eNOS gene and ZNF580 gene to collaboratively treat hindlimb ischemia via pro-angiogenesis and anti-inflammation Zinc finger proteins in neuro-related diseases progression ZNF354C is a transcriptional repressor that inhibits endothelial angiogenic sprouting SLC gene mutations and pediatric neurological disorders: diverse clinical phenotypes in a Saudi Arabian population Blood-brain barrier solute carrier transporters and motor neuron disease The role of solute carrier transporters in efficient anticancer drug delivery and therapy In vitro validation of an in vivo phenotyping drug cocktail for major drug transporters in humans L-type amino acid transporter 1 (SLC7A5)-mediated transport of pregabalin at the rat blood-spinal cord barrier and its sensitivity to plasma branched-chain amino acids A BORC-dependent molecular pathway for vesiculation of cell corpse phagolysosomes Amino acid solute carrier transporters in inflammation and autoimmunity In Drug Metabolism and Disposition: The Biological Fate of Chemicals (2022) Download references This Project was funded by the Special Project For Science And Technology Strategic Cooperation Between City And School Nanchong City Research And Development Fund Project (22SXZRKX004) and the 2022 Sichuan Provincial Grassroots Health Development Research Center Funded Project of North Sichuan Medical College (SWFZ22-Z-03) Affiliated Hospital of North Sichuan Medical College Conceived and designed the experiments: Y.M Download citation DOI: https://doi.org/10.1038/s41598-025-86841-y Metrics details The activity of miRNA varies across different cell populations and systems as part of the mechanisms that distinguish cell types and roles in living organisms and in human health and disease miRNA regulation drives changes in the composition and levels of protein-coding RNA and of lncRNA with targets being down-regulated when miRNAs are active The term “miRNA activity" is used to refer to this transcriptional effect of miRNAs a method designed to facilitate the evaluation of miRNA activity at high resolution The method applies to single-cell transcriptomics miTEA-HiRes analysis of peripheral blood mononuclear cells comparing Multiple Sclerosis patients to control groups revealed differential activity of miR-20a-5p and others consistent with the literature on miRNA underexpression in Multiple Sclerosis We also show miR-519a-3p differential activity in specific cell populations STRS employs the same polyadenylation concept (mentioned earlier for single cell) to slices of tissue resulting in a gene expression spatial map for genes of all lengths The recent emergence of totalRNA single-cell and spatial methods enables us to initiate an exploration of miRNA to target relationships at a higher resolution current transcriptomics technology also allows for inference and insight a computational tool to infer miRNA expression in single cell data They hypothesize that measuring miRNA expression can be performed more accurately exploiting the complex direct as well as indirect regulatory links between miRNA and the expression of other mRNAs the accuracy of the results relies on finding and pre-training a model using a bulk dataset of the same cell type and condition as the inspected single-cell dataset in order to capture the relevant regulatory links This makes miRSCAPE results highly variable depending on the availability and quality of such bulk dataset all of the above mentioned tools do not address spatial RNA sequencing We use this approach for two main purposes for the first time to the best of our knowledge miRNA activity maps for scRNAseq and spatial datasets enabling the exploration of miRNA heterogeneity (variability) across different cell types or across the geography of a sample to find differentially active miRNAs between cells in different conditions and single-cell miRNA induction experiments We investigate the relationship between miRNA expression and activity as emerges from total RNA single-cell sequencing Our method and usage instructions are available at https://github.com/EfiHerbst31/miTEA-HiRes representing the level of activity of every evaluated miRNA in each of the cells or spots miTEA-HiRes combines the activity p-values for each miRNA to yield activity scores miTEA-HiRes also produces activity maps and histograms when appropriate Top row: normalization and standardization Middle row: computation of activity p-values (shown for spatial data The same process applies to single-cell data) Bottom row: computation of aggregated activity scores (for all data types); Generation of spatial activity maps for spatial data or activity maps on a UMAP layout for single-cell data; Statistical comparison between activity p-values of different cell populations for single-cell data in comparative activity mode Activity maps of two selected miRNAs per tissue are presented in the two rightmost columns Colors of activity maps represent -log10 of activity p-values Corresponding H&E slides and GE clustering Datasets presented (from top to bottom): mouse brain (2264 spots) human ovarian cancer (4674) and human cerebellum (4992) miTEA-HiRes thus takes single cell or spatial gene expression data (with or without cell annotations) as input, and outputs a list of miRNAs ranked by their potential biological interest, combining overall activity and differential activity, when relevant. miTEA-HiRes is available at Github: https://github.com/EfiHerbst31/miTEA-HiRes and specific noteworthy miRNA activity maps exemplifying miTEA-HiRes’s output the well-studied let-7b-5p and the less understood miR-6804-3p demonstrate non-overlapping patterns of activity we compared the top 10% most active spots in let-7b-5p with those of miR-6804-3p and found zero overlap (hypergeometric p-value for under-enrichment 2e−19) there was an overlap of only 8 spots (hypergeometric p-value for under-enrichment 8e−71) It is important to note that not all miRNAs exhibit high activity the fraction of miRNAs that were found to be active (-log10(p-value) > 5) in at least 20% of the spots was between 0% (in the mouse brain and human brain) and 10% (in the human breast cancer) 10,000 cells were randomly selected from the PBMCs dataset (5000 from each group of MS and control) We then conducted the analysis using two modes: the total activity mode and the comparative activity mode - with the MS cell population vs We suggest that these miRNAs might have a complex role in MS that should be further investigated The relationship between miRNA activity and expression is further explored in  the validation section Some of the highly ranked miRNAs are not well studied for their functionality, such as miR-519d-3p (Table 1) miR-519d-3p could potentially be investigated for its relation to MS We found that nine miRNAs appeared in both lists all miRNAs in the total activity list were found to be differentially active between MS and control in comparative activity mode (corrected WRS p-values  < 9e−140) We further touch on this point in the discussion We note that we could not find literature elucidating the roles of miR-519a-3p and miR-3609 in MS In all cases where activity differences were significant we observed a corresponding significant change in target expression (zero false positives) differences in target expression were significant but no significant changes in activity were captured Table 3 describes one example for comparison between different cell types: CD4+ T cells (CD4) and activated CD8+ T cells (CD8a) miR-19b-3p is significantly more active in CD4 cells compared to CD8a cells derived from PBMCs of MS patients and also (though less significantly) in CSF derived from MS patients which has a significant difference in activity levels between CD4 and CD8 cells in both control PBMCs and CSF More results can be found in Supplementary Table 3. Full results can be found at Zenodo https://doi.org/10.5281/zenodo.10720979 The other eight miRNAs in the list of top 10 miRNAs in total activity mode had no significant differential activity between migratory and static populations (comparative activity mode Further investigation is required in a dedicated study to explore this inconsistency as there could be a more complex mechanism explaining this relationship between expression and activity in this case The other microRNAs in this list have not been extensively studied in the context of cancer metastasis This finding could potentially explain the reduced activity observed in migratory cells compared to static cells Further research is required to elucidate their specific functions as well as the potential involvement of miR-8485 To allow users to easily determine whether the target lists of two miRNAs greatly overlap, we computed the Jaccard index for every pair of miRNA target lists. The resulting table is available at Zenodo https://doi.org/10.5281/zenodo.10720979 Agreement between expression and activity, per sample, reflected by the enrichment of: a active miRNAs among the most expressed miRNAs; b non-active miRNAs among the least expressed miRNAs; miTEA-HiRes activity p-values grouped by cancer tissue for: c miR-101-3p; d miR-22-3p; e miR-10b-3p. Full results are available at Zenodo https://doi.org/10.5281/zenodo.10720979 For the human dataset we found a significant enrichment of active miRNAs at the top of the list (mHG p-value  = 3.76e−05) We also found a significant enrichment of non-active miRNAs at the bottom of the list (p-value  = 0.0055) significant enrichment (<0.05) was detected on both sides as well; enrichment of active miRNAs at the top of the list (p-value  = 0.0301) and non-active miRNAs at the bottom of the list (p-value  = 0.0114) We also tested the agreement between single-cell expression and activity in a single-cell resolution, for specific miRNAs that were found to be both overall active and expressed. Supplementary Fig. 8 shows example results from this analysis we found that these technologies report very low expression values of miRNAs probably due to low miRNA capture efficiency and to both miREACT and miRSCAPE using miRNA induction experiment in single-cell data miTEA-HiRes has two optional modes: total activity mode which reports on miRNAs that are overall active which compares between populations of cells miRNAs that are generally more active in a sample (reported by the total activity mode) greatly overlap with miRNAs that are differentially active between the sample main populations (reported by the comparative activity mode) An example observation is found analyzing MS and control PBMCs and CSF cells we see a significant share of miRNAs that were found to be overall active and to also be differentially active between the MS and control populations such as the stationary and metastatic breast cancer cells distinct sets of miRNAs were reported by the different modes that is- miRNAs that were found to be highly active in all cells did not have a significant overlap with the ones that were found to be differentially active between the stationary and metastatic populations The variation of this aspect between the two datasets could potentially be attributed to the unique nature of these pathologies and the varying roles that miRNAs play in their formative and developmental processes significant differences in miRNA activity between conditions consistently reflect changes in the expression levels of their targets The ability to compare subpopulations also effectively addresses another concern When analyzing the two primary populations within the data their composition can influence the outcomes if a specific cell type is more prevalent in the first population and has higher activity of a particular miRNA comparing the populations as a whole would simply indicate that the first group is more active for this miRNA conducting comparisons among cell types within each group would provide a better understanding of the findings and also a significant enrichment of non-active miRNAs among low expression miRNAs This finding is even more remarkable given that these datasets include the expression of the 3p and 5p strands of each miRNA combined while they appear separately in the miRNA-target database thus yielding possibly different miTEA-HiRes results We also examined the relationship between expression and activity in MS by scanning the literature for what is known about the expression of miRNAs that were found to be differentially active The ten miRNAs that were found to be the most differentially active in MS PBMCs were all found to be less active in MS compared to healthy control activity and expression had a similar pattern that is: these miRNAs are known to be down-regulated or under-expressed in MS compared to healthy control Two of them are known to be over-expressed in certain stages of MS compared to healthy control indicating a more complex working mechanism that may lead to disagreement between activity and expression we could not find literature regarding their expression in MS While miRNA expression and activity are obviously related they are not unanimous due to the complexity of cell biology Our findings shed light on the interrelation of miRNA expression and activity Through the integration of miRNA expression measurement and activity inference using our approach and code package researchers can gain deeper insight into cellular level regulatory pathways leading to a better understanding of spatial and cell-level biology miTEA-HiRes provides a means to capture the signal of miRNA activity which usually goes undetected in gene expression datasets Our study demonstrated that miTEA-HiRes successfully identified numerous functional miRNAs in specific samples and sample types Most notably miTEA-HiRes provides robust quality of results while relying on the data itself without the need to collect and pre-train on large problem-specific datasets with a friendly end-to-end pip-installable Python package we provide several leads that may be further investigated miTEA-HiRes can thus help define miRNA roles in biological processes and point out miRNAs that should be further explored future work could utilize the general framework of our technique in uncovering the activity of transcription factors providing a broader and more comprehensive understanding of active biological processes The computation of activity p-values by miTEA-HiRes (including data preprocessing) is described as a pseudo-code in Supplementary Algorithm 1 miTEA-HiRes accepts as input both spatial transciptomics and single-cell RNA-sequencing raw count matrices containing gene counts per spot or cell Bulk data may be analyzed as single cell data The steps and components of the analysis are further described herein The filtered MTIs are provided within the miTEA-HiRes package for 706 mouse miRNAs and 2571 human miRNAs To capture deviations in gene expression relative to its own dynamic expression across samples, each gene’s values are transformed into z-scores (Fig. 1 s) per gene\transcript g and cell\spot s is transformed as follows: Automatic data preprocessing is available in the miTEA-HiRes package The mHG p-value is then used by miTEA-HiRes to represent the miRNA activity level for the specific combination of miRNA and cell or spot being analyzed the p-value generated by the mHG test is exactly one The nonparametric mHG test was developed by ref. 65 and is only briefly described here for completeness The test aims to evaluate the level of enrichment present at the top of a ranked binary list the given list is randomly and uniformly selected from a pool of all lists containing N entries The alternative hypothesis suggests that the 1s have a tendency to prominently appear at the top of the list and let λ be the observed binary list of length N The p-value of mHG is then computed as the fraction of permutations \(\tilde{\lambda }\) for which \(mHG(\tilde{\lambda })\le mHG(\lambda )\) when using Λ to denote all such permuted patterns as well as links to the corresponding plots The aggregated activity score for each miRNA is the fraction of spots with observed significant activity (p-value  < 1e−5) miRNAs are sorted based on their activity scores and spatial miRNA activity maps are generated as part of the output The miRNA activity score represents the level of differential activity between the two populations and is defined by the two-sided WRS p-value We recommend using the comparative activity mode to compare populations of at least 100 cells The ranking mechanism of miRNAs was designed to highlight miRNAs that are not only differentially active but also have consistently high activity p-values in at least one population At the top of the ranked list are miRNAs that demonstrate an average activity p-value that is equal to or greater than the 0.97 quantile in at least one population and have activity scores smaller than 1e−8 are miRNAs that manifest an average activity p-value that is equal to or greater than the 0.9 quantile in at least one population and have activity score smaller than 1e−8 All the remaining miRNAs are sorted based on their activity scores relevant UMAPs and histograms are produced to demonstrate the different activity patterns across the two populations including the extraction of highly variable genes computation of the neighborhood graph of cells and finally computation of UMAP coordinates Spatial transcriptomics datasets were analyzed using miTEA-HiRes without any preprocessing Both PBMC and CSF datasets were analyzed using miTEA-HiRes without any preprocessing using default parameters (sampling 10K cells) The MS dataset with cell types was analyzed without sampling to improve statistical significance when analyzing cell subsets To enhance the statistical power and leverage the similarities between breast cancer samples we merged all cell lines and patient-derived cells into two groups: 1182 static cells and 1992 migratory cells We then used the miTEA-HiRes analysis pipeline First, we used the GDC portal106 to create two cohorts- one of cases with RNAseq data and the other of cases with miRNAseq data We then used Python code to intersect these two cohorts and loaded the intersected cohort back to the GDC portal We used the portal to identify the RNAseq samples and the miRNAseq samples that followed these criteria: primary tumor We then used Python to download the relevant samples If more than one RNAseq sample \miRNAseq sample was available for the same case we chose the one with the most detected genes \miRNAs we produced one gene expression count matrix of 11,927 samples and 57,287 genes from the RNAseq samples and one miRNA expression (reads per million) count matrix of 11,927 samples and 1810 miRNAs from the miRNAseq samples we had the expression values of the precursors of the miRNA (marked with “-1","-2".. we summed the expression values of the precursors to get an assessment of the expression of the mature miRNA and removing miRNAs that were not expressed at all we had 1662 miRNAs in the miRNA expression matrix From both methods we received an activity p-values matrix as output with a prediction of the activity of each miRNA (2571 miRNAs for miTEA-HiRes 2578 miRNAs for miReact) in each of the 11,927 samples We transformed the miTEA-HiRes activity p-values matrix to -log10(p-values) (the miReact activity p-values were already -log10 transformed) Each of the miRNAs that appeared in the activity matrices of both miTEA-HiRes and miReact also appeared as one of the 1662 miRNAs in the miRNA expression matrix no strand was specified for the miRNA that appeared in the miRNA expression matrix We then merged the datasets of human primary fibroblasts and MCF7 cells into a single human dataset (633 cells) and the datasets of all stages of murine embryonic stem cells differentiation into a single mouse dataset (2167 cells) To explore the enrichment level of active miRNAs at the top of the ranked list of overexpressed miRNAs we performed the following processing pipeline To obtain the list of most expressed miRNAs we summed the raw counts for each miRNA over all the cells We retained only those miRNAs that were also available in miTEA-HiRes database with the most expressed miRNAs positioned at the top A miRNA was considered active if its activity score was less than 0.05 (average activity p-value over all cells) miTEA-HiRes’ MTI database distinguishes between miRNAs with 3p and 5p strands while the total-RNA dataset displays only one value for the two strands which represents the summed expression of them we considered a miRNA to be active if at least one of the strands was active we converted the ranked list of overexpressed miRNAs into 1’s (representing active miRNAs) and 0’s To explore the enrichment level of non-active miRNAs at the top of the ranked list of underexpressed miRNAs To obtain the list of underexpressed miRNAs we used the reverse-order of the overexpressed miRNAs list obtained previously A miRNA was considered to be non-active if its activity score was greater than 0.1 (average activity p-value over all cells) but its other strand (3p or 5p) was previously considered as active it was excluded from the non-active miRNAs list to ensure that only truly non-active miRNAs were included we converted the ranked list of underexpressed miRNAs into 1’s (representing non-active miRNA) and 0’s otherwise enrichment of active miRNAs at the top of the list of expressed miRNAs was calculated as follows: pmHG(N = 1462 Enrichment of non-active miRNAs at the bottom of the list: pmHG(N = 1462 enrichment of active miRNAs at the top of the list: pmHG(N = 492 Enrichment of non-active miRNAs at the bottom of the list: pmHG(N = 492 N refers to the number of shared miRNAs between the dataset and miTEA-HiRes database B is the number of active (non-active) miRNAs b(n*) is the number of miRNAs both highly expressed and active (lowly expressed and non-active) at the cutoff Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article regulation and an emerging reciprocal relationship Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs Widespread changes in protein synthesis induced by microRNAs Gene silencing by microRNAs: contributions of translational repression and mRNA decay MicroRNAs can generate thresholds in target gene expression MicroRNAs as therapeutic targets in cancer MicroRNAs as therapeutic targets in human cancers MicroRNAs as therapeutic targets and their potential applications in cancer therapy Novel rank-based statistical methods reveal microRNAs with differential expression in multiple cancer types miRNA-mRNA integrated analysis reveals roles for miRNAs in primary breast tumors MicroRNAs as therapeutic targets in cardiovascular disease microRNAs as therapeutic targets and biomarkers of cardiovascular disease MicroRNAs as therapeutic targets in atherosclerosis MicroRNAs: novel therapeutic targets in neurodegenerative diseases MicroRNAs as therapeutic targets for the treatment of diabetes mellitus and its complications microRNA: emerging therapeutic targets in acute ischemic diseases miRNAs as therapeutic targets in inflammatory disease MicroRNA as therapeutic targets for treatment of depression Microrna as therapeutic targets for chronic wound healing MicroRNAs: New therapeutic targets for intestinal barrier dysfunction miRNAs as therapeutic targets in ischemic heart disease MicroRNAs: promising therapeutic targets for the treatment of pulmonary arterial hypertension microRNAs as therapeutic targets for Alzheimer’s disease Single-cell RNA sequencing for the study of development Real-time quantification of microRNAs by stem–loop rt–PCR MicroRNA expression profiling of single whole embryonic stem cells 220-plex microRNA expression profile of a single cell High-throughput microfluidic single-cell rt-qPCR Two-tailed rt-qPCR: a novel method for highly accurate miRNA quantification Single cell real-time miRNAs sensing based on nanomotors Visualization and quantification of microRNA in a single cell using atomic force microscopy Lab in a tube: ultrasensitive detection of microRNAs at the single-cell level and in breast cancer patients using quadratic isothermal amplification Quadratic isothermal amplification for the detection of microRNA Ultrahigh-throughput droplet microfluidic device for single-cell miRNA detection with isothermal amplification A sensitive flow cytometric method for multi-parametric analysis of microRNA Single-cell sequencing of the small-RNA transcriptome Holo-seq: single-cell sequencing of holo-transcriptome Efficient production of on-target reads for small RNA sequencing of single cells using modified adapters Regulation of cell-type-specific transcriptomes by microRNA networks during human brain development Capture and amplification by tailing and switching (CATS) an ultrasensitive ligation-independent method for generation of DNA libraries for deep sequencing from picogram amounts of DNA and RNA Single-cell quantification of a broad rna spectrum reveals unique noncoding patterns associated with cell types and states High-throughput total rna sequencing in single cells using vasa-seq Single-cell total RNA miniaturized sequencing (storm-seq) reveals differentiation trajectories of primary human fallopian tube epithelium Spatialde: identification of spatially variable genes Spatial transcriptomics inferred from pathology whole-slide images links tumor heterogeneity to survival in breast and lung cancer Detecting significant expression patterns in single-cell and spatial transcriptomics with a flexible computational approach Spatial mapping of the total transcriptome by in situ polyadenylation Identification and consequences of miRNA–target interactions-beyond repression of gene expression miRNA target enrichment analysis reveals directly active miRNAs in health and disease Mienturnet: an interactive web tool for microRNA-target enrichment and network-based analysis 0: Uncovering microRNAs and transcription factors with crucial roles in ngs expression data enrichmir predicts functionally relevant microRNAs based on target collections miRNA activity inferred from single cell mrna expression mirscape-inferring miRNA expression from scrna-seq data mirtarbase update 2022: an informative resource for experimentally validated miRNA–target interactions Gorilla: a tool for discovery and visualization of enriched go terms in ranked gene lists Inferring microRNA regulation: A proteome perspective miRNA normalization enables joint analysis of several datasets to increase sensitivity and to reveal novel miRNAs differentially expressed in breast cancer Discovering motifs in ranked lists of DNA sequences Drimust: a web server for discovering rank imbalanced motifs using suffix trees Efficient motif search in ranked lists and applications to variable gap motifs 10x Genomics. Adult mouse brain (ffpe). https://www.10xgenomics.com/resources/datasets/adult-mouse-brain-ffpe-1-standard-1-3-0 10x Genomics. Human skin melanoma (cytassist ffpe). https://www.10xgenomics.com/resources/datasets/human-melanoma-if-stained-ffpe-2-standard 10x Genomics. Human lung squamous cell carcinoma (cytassist ffpe). https://www.10xgenomics.com/resources/datasets/human-lung-cancer-ffpe-2-standard 10x Genomics. Human cerebellum. https://www.10xgenomics.com/resources/datasets/human-cerebellum-targeted-neuroscience-panel-1-standard Visium Website. https://www.10xgenomics.com/products/spatial-gene-expression [Online; accessed 2-Sep-2022] (2022) Mir-16-5p suppresses breast cancer proliferation by targeting anln Mir-29c-3p inhibits epithelial-mesenchymal transition to inhibit the proliferation invasion and metastasis of cervical cancer cells by targeting sparc Integrated single cell analysis of blood and cerebrospinal fluid leukocytes in multiple sclerosis mir-106b-25/mir-17-92 clusters: polycistrons with oncogenic roles in hepatocellular carcinoma The mir-17/92 cluster: a comprehensive update on its genomics functions and increasingly important and numerous roles in health and disease Oncogenic potential of the mir-106-363 cluster and its implication in human t-cell leukemia Identification and functional analysis of specific MS risk miRNAs and their target genes Up-regulation of circulating mir-93-5p in patients with relapsing-remitting multiple sclerosis Genetic association and altered gene expression of mir-155 in multiple sclerosis patients and mir-19b-3p are associated with brain-derived neurotrophic factor production and clinical activity in multiple sclerosis: a pilot study The role of cd4 t cells in the pathogenesis of multiple sclerosis Single-cell RNA-sequencing of migratory breast cancer cells: discovering genes associated with cancer metastasis Oral mucosal mesenchymal stem cell-derived exosomes: A potential therapeutic target in oral premalignant lesions 1 promotes cell proliferation through axin1-dependent wnt signaling pathway and predicts a poor prognosis of triple-negative breast cancer Mirna-106b-5p in human cancers: diverse functions and promising biomarker Nr2f1-as1/mir-190a/phldb2 induces the epithelial–mesenchymal transformation process in gastric cancer by promoting phosphorylation of akt3 The mir-124-3p/neuropilin-1 axis contributes to the proliferation and metastasis of triple-negative breast cancer cells and co-activates the tgf-β pathway mir-122-5p promotes aggression and epithelial-mesenchymal transition in triple-negative breast cancer by suppressing charged multivesicular body protein 3 through mitogen-activated protein kinase signaling mir-665 expression predicts poor survival and promotes tumor metastasis by targeting nr4a3 in breast cancer The role of inflammation-associated microrna-4257 as a promoter of malignancy in colorectal cancer Exosomal microrna in plasma as a non-invasive biomarker for the recurrence of non-small cell lung cancer mir-125b-5p inhibits breast cancer cell proliferation migration and invasion by targeting kiaa1522 mir-125a-5p impairs the metastatic potential in breast cancer via ip6k1 targeting Microrna-486-5p and microRNA-486-3p: Multifaceted pleiotropic mediators in oncological and non-oncological conditions Pvt 1-derived mir-1207-5p promotes breast cancer cell growth by targeting stat 6 mir-552: an important post-transcriptional regulator that affects human cancer Long non-coding RNA foxd2-as1 promotes cell proliferation metastasis and EMT in glioma by sponging mir-506-5p miRPathDB. https://mpd.bioinf.uni-sb.de/ Broad Institute. Human msigdb collections. https://www.gsea-msigdb.org/gsea/msigdb/collections.jsp Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles Molecular signatures database (msigdb) 3.0 Toward a shared vision for cancer genomic data Linc00052/mir-101-3p axis inhibits cell proliferation and metastasis by targeting sox9 in hepatocellular carcinoma Functional analysis of mir-101-3p and rap1b involved in hepatitis b virus-related hepatocellular carcinoma pathogenesis Identification of mir-101-3p targets and functional features based on bioinformatics meta-analysis and experimental verification in hepatocellular carcinoma Small non-coding rna abundance in adrenocortical carcinoma: A footprint of a rare cancer Berberine upregulates mir-22-3p to suppress hepatocellular carcinoma cell proliferation by targeting sp1 Long noncoding RNA mir4435-2hg promotes hepatocellular carcinoma proliferation and metastasis through the mir-22-3p/ywhaz axis Key microRNAs and their targetome in adrenocortical cancer Single-cell mRNA profiling reveals the hierarchical response of mi RNA targets to mi RNA induction Sequence features of drosha and dicer cleavage sites affect the complexity of isomirs isomir-sea: an RNA-seq analysis tool for miRNAs/isomirs expression level profiling and miRNA-mRNA interaction sites evaluation mirtarbase 2020: updates to the experimentally validated microrna–target interaction database The xl-mhg test for enrichment: A technical report Go-pca: An unsupervised method to explore gene expression data using prior knowledge In Breakthroughs in statistics: Methodology and distribution Cauchy combination test: a powerful test with analytic p-value calculation under arbitrary dependency structures Scanpy. Preprocessing and clustering 3k pbmcs. https://scanpy-tutorials.readthedocs.io/en/latest/pbmc3k.html anndata: Access and store annotated data matrices Scanpy: large-scale single-cell gene expression data analysis Schafflick, D. et al. Integrated single cell analysis of blood and cerebrospinal fluid leukocytes in multiple sclerosis [data set].GEO https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE138266 ((2019)) Schafflick, D. et al. Integrated single cell analysis of blood and cerebrospinal fluid leukocytes in multiple sclerosis [data set]. Figshare https://figshare.com/articles/dataset/MS_CSF_h5ad/14356661 (2021) Chen, Y.-C. et al. Single-cell RNA-sequencing of migratory breast cancer cells: discovering genes associated with cancer metastasis [data set]. GEO https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE162726 (2020) Herbst, E., Mandel-Gutfreund, Y., Yakhini, Z. & Biran, H. Inferring single-cell and spatial microRNA activity from transcriptomics data. Zenodo https://doi.org/10.5281/zenodo.10720979 (2024) MicroRNAs mir-17 and mir-20a inhibit t cell activation genes and are under-expressed in MS whole blood MicroRNA expression changes during interferon-beta treatment in the peripheral blood of multiple sclerosis patients Lymphoproliferative disease and autoimmunity in mice with increased mir-17-92 expression in lymphocytes Targeted deletion reveals essential and overlapping functions of the mir-17 92 family of miRNA clusters mir-155 as an important regulator of multiple sclerosis pathogenesis Download references The RESCUER project has received funding from the European Union’s Horizon 2020 Research and Innovation Program under Grant agreement No We would like to thank the Yakhini group and the Mandel-Gutfreund lab for insights and discussions Amir Argoetti and Tamar Hashimshony from the Mandel-Gutfreund lab for useful interpretation and advice developed the miTEA-HiRes statistics and method applied it to various single cell and spatial datasets developed the miTEA-HiRes software tool and found literature context All authors discussed and interpreted the results Communications Biology thanks the anonymous reviewers for their contribution to the peer review of this work Primary Handling Editors: Aylin Bircan and Tobias Goris Download citation DOI: https://doi.org/10.1038/s42003-025-07454-9 Sign up for the Nature Briefing: AI and Robotics newsletter — what matters in AI and robotics research Metrics details Lung cancer is a severe challenge to the health care system with intrinsic resistance to first and second-line chemo/radiotherapies In view of the sterile environment of lung cancer several immunotherapeutic drugs including nivolumab and durvalumab are currently being used in clinics globally with the intention of releasing exhausted T-cells back against refractory tumor cells Immunotherapies have a limited response rate and may cause immune-related adverse events (irAEs) in some patients a deeper understanding of regulating immune checkpoint interactions could significantly enhance lung cancer treatments we explore the role of miRNAs in modulating immunogenic responses against tumors We discuss various aspects of how manipulating these checkpoints can bias the immune system’s response against lung cancer we examine how altering the miRNA profile can impact the activity of various immune checkpoint inhibitors focusing on the PD-1/PD-L1 pathway within the complex landscape of lung cancer We believe that a clear understanding of the host’s miRNA profile can influence the efficacy of checkpoint inhibitors and significantly contribute to existing immunotherapies for lung cancer patients we discuss ongoing clinical trials involving immunotherapeutic drugs both as standalone treatments and in combination with other therapies intending to advance the development of immunotherapy for lung cancer Immune epigenetic programming of the host limits the outcome of cancer-directed interventions miRNAs landscape drives sterile inflammatory responses in cancer patients miRNAs landscape influences the sensitivity of cancer patients to Immune checkpoint blockade therapy Adjusting microRNAs for immune checkpoint blockade therapy is particularly beneficial in resistant cancers such as non-small cell lung cancer (NSCLC) How does targeting miRNA overcome the inherent resistance of NSCLC to first and second-line chemotherapy and radiotherapy and enhance the effectiveness of these treatments How modifying the miRNA profile of patients could alleviate T-cell exhaustion in NSCLC How deeper understanding of regulating immune checkpoint interactions significantly enhance lung cancer treatments How altering the miRNA profile in NSCLC patients can increase their sensitivity to various immune checkpoint inhibitors potentially enhancing the effectiveness of combined chemo-immune therapies by modulating the immune environment and tumor behavior Significant progress has been made in the field of immunotherapy for lung cancer and Immune Checkpoint Inhibitors (ICIs) are being increasingly recognized as the favored treatment approach for individuals diagnosed with metastatic The shows the inhibition of T-cell activation and symbolizes process of T-cell activation this review article explores the significance of miRNAs and the PD-1/PD-L1 axis in the context of lung cancer the paper will elaborate on the impact of miRNA dysregulation on PD-1/PD-L1 interactions and its effect on lung cancer progression and metastasis this paper will review ongoing clinical trials that evaluate the action of immunotherapeutic drugs either as monotherapy or combined with other therapies this paper’s analysis aims to support the development of more effective immunotherapeutic drugs against lung cancer The primary focus of this paper is on the PD-1 and PD-L1 checkpoints we will also offer a brief overview of various other important immune checkpoints in the subsequent section we will discuss the structures and functions of key immune checkpoints including PD-1 and PD-L1 Linear structure of CTLA-4 protein consisting of leader peptide and three domains: extracellular ligand binding domain a transmembrane domain and a short cytoplasmic tail of 37 amino acids having two tyrosine-based motifs The YVKM motif constitutes a binding site for the lipid PI3K SHP2 and the clathrin adapter protein AP-1 and AP-2 The serine /threonine phosphatases PP2A binds to the lysine-rich motif and tyrosine 218 (A) The domain organization of LAG-3 is schematically shown in the (B) with each Ig-like domain are indicated in rectangular boxes where D1 domain represents the variable and D2- D4 shows the constant domains respectively The cytoplasmic domain has three conserved regions: a serine-phosphorylation site a KIEELE motif (Lysine Isoleucine Glutamate Leucine Glutamate) in which the function of KIEELE motif is still unclear but the current literature suggests that it is essential for LAG-3 to perform its inhibitory function It consists of four domains: an IgV-like domain of 22 amino acids mucin domain of 181 amino acids containing O and N-linked glycosylation sites followed by the cytoplasmic domain of 79 amino acids having tyrosine phosphorylation sites (C) Linear representation of the domain structure of VISTA protein encoded by VSIR gene VISTA is composed of 311 amino acids in which N-terminal domain transmembrane domain of 20 amino acids and cytoplasmic domain of 96 amino acids respectively possessing SH2 Linear representation of domain structures of BTLA protein encoded by BTLA gene BTLA is composed of 309 amino acids in which ectodomain of 151 amino acids transmembrane domain of 23 amino acids and cytoplasmic domain of 135 amino acids ITIM and ITSM motifs responsible for its inhibitory signaling (E) Linear representation of the domain structures of PD-1 protein encoded by PDCD1 gene The extracellular domain contains an N-terminal domain containing a signal sequence and IgV-like domain of about 150 amino acids the signal sequence and IgV-like domain are connected by disulfide bond (C54-C123) The extracellular domain possesses four N-acetylation sites at N49 The cytoplasmic domain of 117 amino acids having ITIM and ITSM motifs (F) Linear representation of the domain structures of PD-L1 protein encoded by CD274 gene PD-L1 is composed of 290 amino acids in which N-terminal domain an IgV-like domain followed by a linker with IgC-like domains counting for 220 amino acids The transmembrane domain of 21 amino acids and the cytoplasmic domain of 31 amino acids having QFEET it has been demonstrated that TIM-3 plays a critical role in inhibiting anti-tumor immunity by mediating T-cell exhaustion Studies have shown that T-cells expressing both TIM-3 and CD8+ T exhibit compromised Stat5 and p38 signaling pathways blocking the TIM-3 pathway has been observed to boost cancer immunity leading to greater production of IFN-γ in T-cells numerous companies are currently conducting clinical trials involving TIM-3 inhibitors due to their potential as a form of cancer treatment BTLA-HVEM interactions have been utilized as a potential target for checkpoint blockades in cancer therapy Three signal hypotheses for T-cell activation: Signal 1-TCR-signaling; Signal 2- Co-stimulatory interaction between CD28 and CD80/86; Signal 3- Cytokine signaling the success of immunotherapies depends on effective T-cell priming as strong and prolonged T-cell activity is essential for removing cancer cells and achieving good treatment results Hallmarks of T-cell exhaustion: It shows low anti-tumor properties and failure to transition to quiescence and acquire antigen-independent memory T-cell homeostatic responsiveness and many more we discuss the mechanistic role of PD-1 and PD-L1 in T-cell inhibition A snapshot of PD-1/PD-L1 signaling pathway in T-cells: When PD-1 is engaged with its ligand PD-L1 the ITIM and ITSM motifs in the cytoplasmic domain of PD-1 get phosphorylated leading to the recruitment of SHP1/2 proteins These proteins antagonize the positive signals of T-cell activation Their numerous roles in lung cancer as tumor-suppressing and prognostic biomarkers have been firmly cemented by a huge body of data from multiple studies Studies have shown that miR-4458 can modulate immune responses by regulating the expression of various genes involved in immune cell activation and differentiation miR-4458 has been found to target the expression of the gene encoding the pro-inflammatory cytokine interleukin-6 (IL-6) in dendritic cells leading to a reduction in IL-6 production and subsequent suppression of T-cell activation the authors found a lower proportion of NK-cells and CD3+ T-cells in the peripheral blood of NSCLC patients compared to healthy subjects compared to normal human embryonic lung fibroblast cells (2BS) miR-4458 was found to be downregulated in human NSCLC cell lines (~1.6 fold in H1299 ~1.9 fold in A549 and ~1.4 fold in SW900) (p < 0.01) whereas a higher expression level of STAT3 was reported in lung cancer cells (~1.6 fold in H1299 The above data suggests that miR-4458 exists as a tumor suppressor in lung cancer the miR-4458 mimic group exhibited a significant reduction in tumor volume and weight compared to the miR-4458 negative control group These data suggest that miR-4458 overexpression may inhibit NSCLC tumor growth They also found increased IFN-γ and IL-2 serum levels in the miR-4458 mimic group in stark contrast with decreasing IL-10 serum in the same group IL-10 usually inhibits the activity of immune cells whereas IL-2 increases the growth and proliferation of immune cells so increased levels of IL-2 and IFN-γ enhance anti-tumor immunity a potential negative correlation was found between miR-4458 and oncogenic STAT3 gene expression (F = −0.201 p < 0.05) in 25 pairs of NSCLC tissues compared to normal lung tissue samples It is demonstrated that STAT3 inhibits cell proliferation through a high expression level of miR-4458 Additional results indicate that miR-4458 mimics and inhibits STAT3 expression the CCK-8 assay confirms enhanced cell proliferation in A549 and LLC cells with the overexpression of STAT3 miRNA-mediated modulation of immune check points in tumor cells ultimately leading to T-cell inactivation and resulting in immune escape this study demonstrated that miR-4458 increases anti-tumor immunity in NSCLC by targeting STAT3 to downregulate PD-L1 expression the miR-4458/STAT3/PD-L1 axis presents as an attractive target to improve ICI response in NSCLC qRT-PCR results further revealed that miR-526b-3p levels decreased ~2.38 fold in PC-9 and ~2.5 fold in A549 lung cancer cell lines compared to the control cell line BEAS-2B miR-526b-3p mimics in CDDP-resistant cells reduce IC50 values in the miR-526b-3p group against the vector group ectopic expression of miR-526b-3p reduces cell survival researchers discovered that miR-526b-3p detrimentally controls the amount of STAT3 in lung cancer cells by combining the 3’ UTR of STAT3 with miR-526b-3p or miR-526b-3p mutant reduces the miR-526b-3p groups compared to the control group STAT3 expresses ~1.45 fold higher in CDDP-resistant lung cancer cell lines than CDDP-sensitive lung cancer cell lines Exogenous overexpression of STAT3 reduces miR-526b-3p regulation during cell growth it suggests that miR-526b-3p suppresses STAT3 in CDDP-resistant lung cancer Likewise, miR-526b-3p reduces the expression of PD-L1 in lung cancer cells. The predicted binding site on PD-L1 mRNA by miR-526b-3p is shown in Table 2 Given that the activation of PD-1/PD-L1 improves immune evasion in cancer by reducing CD8+ T-cells it is unclear how the introduction of miR-526b-3p affects the CD8+ T-cell population Flow cytometric analysis revealed that STAT3 prevents the promotion of CD8+ T-cells while miR-526b-3p enhances their population In concordance with the abovementioned results, STAT3 increases PD-L1 expression, which leads to chemoresistance in NSCLC. Furthermore, the suppression of miR-526b-3p increased the expression of STAT3 and PD-L1 (Fig. 6) The authors further demonstrated that in the presence of an immunotherapeutic drug Avelumab the level of PD-L1 expression decreases without significantly affecting the expression levels of STAT3 or miR-526b-3p the CD8+ T-cell counts decreased in the miR-526b-3p inhibitor-treated group These results suggest that miR-526b-3p inhibitor increased cell migration while Avelumab impedes cell motility These findings suggest that miR-526b-3p may have therapeutic potential in cancer immunotherapy by modulating immune responses and targeting critical regulators of tumor growth and immune evasion Further research is necessary to deeply comprehend the clinical uses of miR-526b-3p in immunotherapy for lung cancer to investigate the consequence of miR-34a expression on PD-L1 expression in a syngeneic mouse model of NSCLC a liposomal nanoparticle laden with miR-34a mimics qRT-PCR and western blotting results exhibited increased levels of miR-34a in tumors while concurrently downregulating tumor PD-L1 mRNA and PD-L1 protein Flow cytometry confirmed the miR-34-induced repression of PD-L1 as PD-L1 expression was significantly lower in the MRX34 group than in the control group (mean PD-L1 expression percentage of the control group (30.4% vs 42.9%)) The liposomal administration of miR-34 mimics also suppressed PD-L1 expression in NSCLC xenografts mice an in vitro study demonstrated that miR-34 mimics significantly reduced (~70%) luciferase reporter expression a multidose efficacy investigation was also carried out in the syngeneic mouse paradigm to examine the impact of MRX34 on cancer development MRX34 mimics enhance the fraction of CD8+ cells in tumors while decreases the amount of tumor-infiltrating PD-1+ T-cells and macrophages CD8+ T-cells spiked much more in MRX34 and radiation treatment (XRT) combination than in either therapy alone (44.2% Vs 26.1%) MRX34 inhibited the effects of XRT on macrophages and Tregs compared to XRT alone The TNF-α and IFN-γ also increased in combination therapy which seems much more effective These findings suggest that miR-34a regulates the evasion of tumors from the immune system through the p53 pathway by targeting PD-L1 the potential use of miR-34 in cancer therapy needs further investigation Furthermore, to better understand the relationship between PD-L1, EMT potential, and the miR-200/ZEB1 axis, their expression was studied in lung cancer cell lines. The predicted binding site on PD-L1 mRNA by miR-200b is shown in Table 2 It was found that while PD-L1 expression was elevated in quasi-epithelial cells (murine 393P and human HCC827) with persistent ZEB1 expression it was elevated in mesenchymal lung cancer cell lines (human H157 disrupt the normal ZEB1-miR-200 double-negative feedback loop and produced a mesenchymal phenotype Transforming growth factor-β increased the levels of ZEB1 and PD-L1 in both human and mouse lung cancer cells Previous studies have shown that IFN-γ increases the expression of PD-L1 in natural killer cells it was found that IFN-γ stimulation increased the expression of PD-L1 in tumor cells Mesenchymal tumor cells (344SQ and 393P ZEB1) were more sensitive to IFN-γ than epithelial tumor cells (344SQ miR-200 and 393P) These results indicate that the miR-200/ZEB1 axis controls the production of PD-L1 by tumor cells in the presence or absence of IFN-γ it was found that the miR-200 family members directly regulate PD-L1 as demonstrated by the inhibition of luciferase reporter activity when miR-200b or -200c pre-miRs were co-transfected into murine (344SQ) or human (H157 or H1299) lung cancer cells after transfection of wild-type (WT) PD-L1 3′-UTR reporter construct These results unequivocally show that in the presence or absence of IFN-γ the miR-200/ZEB1 axis controls the production of PD-L1 by tumor cells When miR-200b or −200c pre-miRs were co-transfected into murine (344SQ) or human (H157 or H1299) lung cancer cells after transfection of wild-type (WT) PD-L1 3′-UTR reporter construct luciferase reporter activity was inhibited proving that the miR-200 family members directly regulate PD-L1 IFN-γ has been the subject of much research and it is well-known that this cytokine is essential for tumor surveillance It is a potent master regulator of PD-L1 expression which was suggested to be a factor in the immune evasion of tumors highlighting that mesenchymal tumors are more susceptible to IFN-γ its inhibition significantly reduced fatigued T lymphocytes in mesenchymal tumors while having no meaningful effect on epithelial tumors the data show that the miR-200/ZEB1 axis is a downstream regulator of PD-L1 that can control the outcomes of the IFN-γ pathway it has been found that downregulation of miR-200 enhances the expression of PD-L1 on tumor cells leading to CD8+ T-cell suppression in the tumor microenvironment and promoting metastasis These studies suggest that miR-200b could be a potential therapeutic target for treating lung cancer The negative correlation between miR-200b and PD-L1 expression suggests that miR-200b could be used as a therapeutic marker for lung cancer patients the level of PD-L1 was associated with the T-stage (tumor size stage) in PD-L1-positive LUAD patients the patients at T3 stage had higher PD-L1 expression compared to patients at the T1 stage (p < 0.01) PD-L1 levels decreased following PD-L1 inhibitor therapy Further to assess the expression of exosomal miR-16-5p in LUAD patients it was observed that miR-16-5p expresses ~2.94 fold significantly lower than those in healthy controls (p < 0.01) When compared to patients with tumor sizes at the T2 with T1 the T2 stage patients displayed higher PD-L1 expression After treating PD-L1-positive LUAD patients with PD-L1 inhibitors for 15 weeks the expression of miR-16-5p derived from serum exosomes significantly increased (p < 0.05) following 15 weeks of PD-L1 inhibitor treatment variations in exosomal miR-16-5p expression were shown to have a negative relationship with PD-L1 protein levels in tissues (p < 0.05) (r2 = 0.2077) LUAD patients with low serum exosomal miR-16-5p levels had more significant therapeutic effects and overall survival than those with higher levels compared to BEAS-2B (control) cell culture medium the exosomal miR-16-5p levels in A549 (~2.27 fold) /PC9 (~2.5 fold) /HCC827 (~2.38-fold) cell culture media were downregulated (p < 0.05 or p < 0.01) Furthermore, to assess the effect of miR-16-5p in HCC827/PC9 cells and by transfecting miR-16-5p mimic, the results revealed that miR-16-5p was found to be ~2.2-fold higher in exosomes in the cell culture medium (p < 0.01) (Fig. 6) Transfection of HCC827 cells with a pcDNA-PD-L1 vector resulted in PD-L1 overexpression (p < 0.01) which led to a reduction in exosomal miR-16-5p in the HCC827 cell culture medium (p < 0.05) The findings revealed that overexpression of exosomal miR-16-5p in cell culture medium decreased the role of PD-L1 overexpression (p < 0.05) which was associated with increased tumor volume and weight compared to the NC vector group The results showed that the pcDNA-PD-L1 group had higher levels of PD-L1 protein than the NC vector group we can conclude that miR-320a has the potential to serve as a diagnostic biomarker for lung cancer as its reduced expression correlates with PD-L1 overexpression in both the early and advanced stages of the disease Although molecular mechanisms are still unclear exposure of T-cells to anti-PD-1 treatment increased exosomal miRNA-4315 levels According to the miRGen.v3 program’s predictive study the expression of five FoxO1-regulated miRNAs (miR-101-5p These five miRNAs are expressed in T-cells Surprisingly exosomes obtained from T-cells exposed to PD-1 contained ten times more miR-4315 than exosomes derived from T-cells exposed to the IgG control Considering the previous evidence demonstrating that exosomal miR-4315 restricts apoptosis it is speculated that miRNA-4315 can target a Bim A mimic of miR-4315 reduced luciferase activity coupled to the 3′UTR/Bim plasmid and downregulated both protein and mRNA levels of Bim in cells Anti-miR-4315 remarkably prevented Exo/PD-1 from further reducing the expression of Bim in A172 cells and was co-immunoprecipitated with 3′UTR/Bim Similar studies have been conducted on the lung cancer cell line A549 Exo/PD-1 attenuated the cell death driven on by each treatment and as was discovered with the A172 glioma cell line these effects were blocked by an anti-miR-4315 the downregulation of Bim expression and the reduction of PARP and Caspase-3 cleavage were associated with cell death inhibition The study revealed that exomiR-4315 derived from T-cells exposed to PD-1 inhibited Bim expression Resistance to chemotherapy was enhanced as a result of the downregulation of apoptosis produced by the integration of miR-4315 into cancer cell lines the effectiveness of exo miR-4315 as a biomarker was investigated It was discovered that in patients with lung cancer undergoing anti-PD-1 therapy the changes in exomiR-4315 expression over time are correlated with a serum biomarker associated with resistance to apoptosis In four lung cancer patients receiving PD-1 treatment exomiR-4315 levels and serum cytochrome c levels were measured to determine the therapeutic relevance Pearson’s correlation analysis showed that serum cytochrome c concentrations and longitudinal exomiR-4315 expression were associated significantly in each patient recruited these findings indicate that in lung cancer patients receiving PD-1 exomiR-4315 expression was shown to be inversely linked with a serum biomarker for apoptosis resistance These results suggest that increasing miR-181a expression in lung cancer may boost anti-tumor responses and prevent T-cell exhaustion thereby highlighting miR-181a as a potential target of miRNA mimic therapy in lung cancer the utilization of immune checkpoint inhibitors (ICIs) specifically anti-PD-1/PD-L1 immunotherapy has demonstrated encouraging outcomes in the clinical setting These therapies have been successful in promoting tumor regression and inhibiting metastasis we briefly discuss the mechanisms of action of each of these ICIs and their performance in recent clinical trials involving lung cancer patients those treated with chemotherapy alone had a lower median event-free survival of 20.8 months (95% CI 14.0 to 26.7) (hazard ratio for disease progression nivolumab plus chemotherapy outperformed chemotherapy alone in event-free survival and pathological complete response across all patient subgroups including PD-L1 expression level and type of platinum therapy (CDDP or carboplatin) combining neoadjuvant nivolumab with chemotherapy significantly improved pathological complete response and event-free survival in patients with resectable NSCLC compared to chemotherapy alone The verified ORR for cohort 2 (PD-L1 TPS 1–49%) was 20.0% (95% CI 5.7–43.7%); 4 of the 20 patients had partial responses (PRs) and four patients experienced disease progression Disease control rates (DCR) for cohorts 1 and 2 were 87.5% (95% CI Niraparib and pembrolizumab exhibited clinical activity in patients with advanced or metastatic NSCLC in which 56.3% of patients responded to the combination therapy examined the effects of combining avelumab with pepinemab The results indicated that the combination treatment exhibited a higher response rate compared to single-agent avelumab particularly in the PD-L1 negative/low group while four displayed clinical improvement after 1 year the combination of pepinemab and avelumab was well-tolerated and proved to be effective in treating immunotherapy-resistant and PD-L1-negative/low NSCLC tumors and significant advancements have recently been achieved to deepen our understanding of how the host immune system influences tumor growth and treatment response These developments have led to the discovery of novel immunological checkpoint inhibitors that have been approved for use in clinics One of the most successful cancer drug discoveries in recent years is the development of immune checkpoint inhibitors the FDA approved the first immune checkpoint inhibitor (ipilimumab which marked a significant advancement in the field of immunotherapy as well as greatly enhancing the survival of NSCLC patients ICIs have emerged as a fundamental therapeutic approach for various types of cancers which include inhibitory receptors or immunological checkpoints play a vital role in maintaining self-tolerance and minimizing tissue damage caused by the immune system’s response to cancer By inhibiting molecules such as PD-1 and PD-L1 immune checkpoint inhibitors can reactivate cytotoxic T-cells co-stimulatory factors like CD28 enhance signaling when T-cell receptors detect antigens alongside the major histocompatibility complex (MHC) Recent studies have revealed that immune-inhibitory checkpoints like PD-1/PD-L1 and CTLA-4 play a significant role in the balance and evasion stages of cancer immune evasion they also suppress the anti-tumor response when they bind to ligands on antigen-presenting cells (CTLA-4 binding to CD80/CD86) or tumor cells (PD-1 binding to PD-L1) Targeting and blocking these immune-inhibitory interactions using monoclonal antibodies (mAbs) have paved the way for a new generation of immunotherapy-based cancer treatments Innovative therapeutic methods including PD-1/PD-L1 inhibitors with other ICIs and DNA repair targeted medications are being tested in clinical trials It is now predicted that cancer vaccines and cell-based chimeric antigen receptor T-cells (CAR T-cells) and combination immunotherapies are the future of lung cancer treatment This review article primarily focused on how PD-1/PD-L1 immunotherapy can be used to treat lung cancer in association with miRNAs The rationale behind this paper was to explore more about immunotherapeutic in lung cancer and how non-coding RNAs like miRNA can help in combination with ICIs lung cancer treatment we found that there are a lot of research gaps in this field of oncology as it is also a new and emerging concept in the field of tumorigenesis The main limitation of this study was that the research unveiled in this context is very narrow that needs to be divulged soon And the reason behind the narrow study can be the less patient data because usually patients are not willing to share their information with the researchers so it is also problematic in the examination and treatment of patients different types of tumors at different sites may have different levels of PD-L1 expression Another impediment was that there were a lot of research gaps in the papers none of the papers clearly defined the exact mechanism of how miRNAs interact with PD-1/PD-L1 protein and how they are interacting with each other to cure lung cancer it was noticed that the latest research paper on this topic lacked the aforementioned facts The particular sites or domains of miRNA and PD-1/PD-L1 interaction are not distinctly defined there are certain events that are related to immunotherapy treatment called as irAEs (immune-related adverse events) like colitis These may lead to some other diseases that may even worsen the condition the mechanistic studies on the action of drugs on the miRNA/PD-1/PD-L1 axis need to be unversed there is a dire need to generate new therapeutic biomarkers that can provide relief to cancer patients in spite of harming the individual incongruously How long have i got?” in stage IV NSCLC patients with at least 3 months up to 10 years survival and short-term survival prediction is not good enough to answer this question Extensive-stage small-cell lung cancer: first-line and second-line treatment options Innovative approaches for cancer treatment: current perspectives and new challenges Immune checkpoint inhibitors for lung cancer treatment: a review Immune checkpoint signaling and cancer immunotherapy Next generation of immune checkpoint therapy in cancer: new developments and challenges PD-1/PD-L1 checkpoint inhibitors in tumor immunotherapy A decade of immune-checkpoint inhibitors in cancer therapy MicroRNAs aid the assessment of programmed death ligand 1 expression in patients with non-small cell lung cancer A guide to cancer immunotherapy: from T-cell basic science to clinical practice MiR-140 expression regulates cell proliferation and targets PD-L1 in NSCLC Resistance mechanisms of Anti-PD1/PDL1 therapy in solid tumors Immune-related adverse events and anti-tumor efficacy of immune checkpoint inhibitors microRNA-20b-5p overexpression combing Pembrolizumab potentiates cancer cells to radiation therapy via repressing programmed death-ligand 1 miRNA as a modulator of immunotherapy and immune response in melanoma Oncogenic microRNA-411 promotes lung carcinogenesis by directly targeting suppressor genes SPRY4 and TXNIP The role of cancer-derived microRNAs in cancer immune escape Immunomodulatory MicroRNAs in cancer: targeting immune checkpoints and the tumor microenvironment Circulating miR-320a acts as a tumor suppressor and prognostic factor in non-small cell lung cancer Circulating microRNA-590-5p functions as a liquid biopsy marker in non-small cell lung cancer Combination of CTLA-4 and PD-1 blockers for treatment of cancer Regulation of CTLA-4 expression during T-cell activation CTLA-4 control over Foxp3+ regulatory T-cell function CTLA-4-mediated inhibition in regulation of T-cell responses: mechanisms and manipulation in tumor immunotherapy CTLA-4 and PD-1 receptors inhibit T-cell activation by distinct mechanisms CTLA-4: new insights into its biological function and use in tumor immunotherapy CTLA-4 in regulatory T-cells for cancer immunotherapy an essential immune-checkpoint for T-cell activation Gene of the month: lymphocyte-activation gene 3 (LAG-3) LAG-3: from molecular functions to clinical applications a novel lymphocyte activation gene closely related to CD4 Novel immune checkpoint targets: moving beyond PD-1 and CTLA-4 CD3/TCR complex-associated lymphocyte activation gene-3 molecules inhibit CD3/TCR signaling The promising immune checkpoint LAG-3 in cancer immunotherapy: from basic research to clinical application Preclinical characterization of relatlimab The promising immune checkpoint LAG-3: from tumor microenvironment to cancer immunotherapy TIM-3 as a target for cancer immunotherapy and mechanisms of action a promising target for cancer immunotherapy TIM3 comes of age as an inhibitory receptor and TIGIT: co-inhibitory receptors with specialized functions in immune regulation PAG-associated FynT regulates calcium signaling and promotes anergy in T lymphocytes Tim-3 finds its place in the cancer immunotherapy landscape Structural basis of VSIG3: the ligand for VISTA VISTA expression and patient selection for immune-based anticancer therapy The role of V-domain Ig suppressor of T-cell activation (VISTA) in cancer therapy: lessons learned and the road ahead VISTA: a mediator of quiescence and a promising target in cancer immunotherapy Structure and functional binding epitope of V-domain Ig suppressor of T-cell activation VISTA expression by microglia decreases during inflammation and is differentially regulated in CNS diseases VISTA: an immune regulatory protein checking tumor and immune cells in cancer immunotherapy Roles of BTLA in immunity and immune disorders BTLA expression in stage I-III non-small-cell lung cancer and its correlation with PD-1/PD-L1 and clinical outcomes BTLA-HVEM couple in health and diseases: insights for immunotherapy in lung cancer Balancing co-stimulation and inhibition with BTLA and HVEM Regulatory T-cell expression of herpesvirus entry mediator suppresses the function of B and T lymphocyte attenuator-positive effector T-cells BTLA/HVEM signaling: milestones in research and role in chronic hepatitis B virus infection Clinical significance of tumor-infiltrating immune cells focusing on BTLA and Cbl-b in patients with gallbladder cancer Distinct expression and inhibitory function of B and T lymphocyte attenuator on human T-cells PD-1 and PD-L1 in cancer immunotherapy: clinical implications and future considerations Alternative splice variants of the human PD-1 gene PD-1/PD-L1 pathway: current researches in cancer The role of PD-1 and PD-L1 in T-cell immune suppression in patients with hematological malignancies The diverse functions of the PD1 inhibitory pathway Structural biology of the immune checkpoint receptor PD-1 and its ligands PD-L1/PD-L2 refractory squamous non-small-cell lung cancer (CheckMate 063): a phase 2 The PD-1 pathway in tolerance and autoimmunity PD-1 and cancer: molecular mechanisms and polymorphisms The extrinsic and intrinsic roles of PD-L1 and its receptor PD-1: implications for immunotherapy treatment Regulation of PD-L1: a novel role of pro-survival signalling in cancer.Ann Oncol PD-1 and PD-L1 checkpoint signaling inhibition for cancer immunotherapy: mechanism The intracellular signalosome of PD-L1 in cancer cells Immunotherapy in non-small cell lung cancer: update and new insights PD-1/PD-L1 pathway: basic biology and role in cancer immunotherapy IFN-gamma from lymphocytes induces PD-L1 expression and promotes progression of ovarian cancer Inducible but not constitutive expression of PD-L1 in human melanoma cells is dependent on activation of NF-kappaB Glycosylation and stabilization of programmed death ligand-1 suppresses T-cell activity Cytotoxic CD8(+) T-cells in cancer and cancer immunotherapy Helpless priming sends CD8(+) T-cells on the road to exhaustion Signal 3 cytokines as modulators of primary immune responses during infections: the interplay of type I IFN and IL-12 in CD8 T-cell responses Cancer immune escape: the role of antigen presentation machinery CD8(+) cytotoxic T lymphocytes in cancer immunotherapy: a review Clinical implications of T-cell exhaustion for cancer immunotherapy Exhausted CD8+T-cells in the tumor immune microenvironment: new pathways to therapy CD4 T-cell exhaustion: does it exist and what are its roles in cancer Greenberg PD.Tolerance and exhaustion: defining mechanisms of T cell dysfunction.Trends Immunol T-cell exhaustion in immune-mediated inflammatory diseases: new implications for immunotherapy BET bromodomain inhibition rescues PD-1-mediated T-cell exhaustion in acute myeloid leukemia Mechanisms of T-cell exhaustion in pancreatic cancer T-cell exhaustion in the tumor microenvironment PD1/PD-L1 immune checkpoint as a potential target for preventing brain tumor progression and profound transcriptomic changes characterize cancer-dependent exhaustion of persistently activated CD4(+) T-cells Exosomal PD-L1: new insights into tumor immune escape mechanisms and therapeutic strategies IFN-γ-mediated inhibition of lung cancer correlates with PD-L1 expression and is regulated by PI3K-AKT signaling MAPK pathway activity plays a key role in PD-L1 expression of lung adenocarcinoma cells Immunomodulatory role for MicroRNAs: Regulation of PD-1/PD-L1 and CTLA-4 immune checkpoints expression The role of miRNA in tumor immune escape and miRNA-based therapeutic strategies Role of miRNAs in immune responses and immunotherapy in cancer miR-4458 directly targets IGF1R to inhibiT-cell proliferation and promote apoptosis in hemangioma miR-4458 regulates cell proliferation and apoptosis through targeting SOCS1 in triple-negative breast cancer miR-4458 inhibits the epithelial-mesenchymal transition of hepatocellular carcinoma cells by suppressing the TGF-beta signaling pathway via targeting TGFBR1 Prognostic and predictive value of a microRNA signature in stage II colon cancer: a microRNA expression analysis Large-scale circulating microRNA profiling for the liquid biopsy of prostate cancer Integrated extracellular microRNA profiling for ovarian cancer screening Molecular analysis of high-grade serous ovarian carcinoma with and without associated serous tubal intra-epithelial carcinoma Colorectal adenoma and carcinoma specific miRNA profiles in biopsy and their expression in plasma specimens Role of microRNA-4458 in patients with non-small-cell lung cancer MiR-4458 inhibits breast cancer cell growth MicroRNA-4458 regulates PD-L1 expression to enhance anti-tumor immunity in NSCLC via targeting STAT3 miR-526b-3p functions as a tumor suppressor in colon cancer by regulating HIF-1alpha The LMCD1-AS1/miR-526b-3p/OSBPL5 axis promotes cell proliferation migration and invasion in non-small cell lung cancer miR-526b-3p serves as a prognostic factor and regulates the proliferation and migration of glioma through targeting WEE1 miR-526b-3p inhibits lung cancer cisplatin-resistance and metastasis by inhibiting STAT3-promoted PD-L1 NEAT1/miR-200b-3p/SMAD2 axis promotes progression of melanoma miR-200b induces cell cycle arrest and represses cell growth in esophageal squamous cell carcinoma Upregulation of miR-200b inhibits hepatocellular carcinoma cell proliferation and migration by targeting HMGB3 protein Exosome-mediated miR-200b promotes colorectal cancer proliferation upon TGF-beta1 exposure MicroRNA profiles of prostate carcinoma detected by multiplatform microRNA screening MicroRNA expression profiles classify human cancers Metastasis is regulated via microRNA-200/ZEB1 axis control of TumorTumor cell PD-L1 expression and intratumoral immunosuppression A review on the role of mir-16-5p in the carcinogenesis MiR-16-5p suppresses breast cancer proliferation by targeting ANLN miR-16-5p regulates aerobic glycolysis and tumorigenesis of NSCLC cells via LDH-A/lactate/NF-kappaB signaling Serum exosomal miR-16-5p functions as a tumor inhibitor and a new biomarker for PD-L1 inhibitor-dependent immunotherapy in lung adenocarcinoma by regulating PD-L1 expression Curcumin inhibits ovarian cancer progression by regulating circ-PLEKHM3/miR-320a/SMG1 axis MiR-320a down-regulation mediates bladder carcinoma invasion by targeting ITGB3 miR-320a functions as a suppressor for gliomas by targeting SND1 and beta-catenin miR-320a promotes p53-dependent apoptosis of prostate cancer cells by negatively regulating TP73-AS1 invitro Exploring the mechanism of miR320a in regulating PDL1 upon lung cancer pathogenesis Anti-PD1 therapy induces lymphocyte-derived exosomal miRNA-4315 release inhibiting Bim-mediated apoptosis of tumor cells and glycolysis of breast cancer through NDRG2-mediated activation of PTEN/AKT pathway MiR-181a promotes cell proliferation and migration through targeting KLF15 in papillary thyroid cancer miR-181a-5p is downregulated and inhibits proliferation and the cell cycle in prostate cancer MicroRNA-181a-5p prevents the progression of esophageal squamous cell carcinoma in vivo and in vitro via the MEK1-mediated ERK-MMP signaling pathway Increased PD-L1 expression in acquired cisplatin-resistant lung cancer cells via Mir-181a Checkpoint-modulating immunotherapies in tumor treatment: targets Molecular interactions of antibody drugs targeting PD-1 and immune correlates of anti-PD-1 antibody in cancer Investigating the role of the N-terminal loop of PD-1 in binding process between PD-1 and nivolumab via molecular dynamics simulation An unexpected N-terminal loop in PD-1 dominates binding by nivolumab Overall survival and long-term safety of nivolumab (anti-programmed death 1 antibody ONO-4538) in patients with previously treated advanced non-small-cell lung cancer Neoadjuvant nivolumab plus chemotherapy in resectable lung cancer Nivolumab monotherapy and nivolumab plus ipilimumab in recurrent small cell lung cancer: results from the CheckMate 032 randomized cohort Current clinical progress of PD-1/PD-L1 immunotherapy and potential combination treatment in non-small cell lung cancer Structural basis for blocking PD-1-mediated immune suppression by therapeutic antibody pembrolizumab JASPER: phase 2 trial of first-line niraparib plus pembrolizumab in patients with advanced non-small cell lung cancer Pembrolizumab plus pemetrexed and platinum in nonsquamous non-small-cell lung cancer: 5-year outcomes from the phase 3 KEYNOTE-189 study Study protocol of KeyPemls-004: a phase 2 study of pembrolizumab in combination with plinabulin and docetaxel in previously treated patients with metastatic non-small cell lung cancer and progressive disease (PD) after immunotherapy (PD-1/PD-L1 inhibitor) alone or in combination with platinum-doublet chemotherapy MPDL3280A (anti-PD-L1) treatment leads to clinical activity in metastatic bladder cancer indication and modality of use in advanced or metastatic urinary bladder carcinoma] Atezolizumab for first-line treatment of PD-L1-selected patients with NSCLC Phase II study of atezolizumab with bevacizumab for non-squamous non-small cell lung cancer with high PD-L1 expression (@Be Study) Durvalumab: a review in extensive-stage SCLC Durvalumab with chemoradiotherapy for limited-stage small-cell lung cancer NEPTUNE China cohort: first-line durvalumab plus tremelimumab in Chinese patients with metastatic non-small-cell lung cancer Mocetinostat in combination with durvalumab for patients with advanced NSCLC: results from a phase I/II study A WIN Consortium phase I study exploring avelumab and axitinib in advanced non-small cell lung cancer Anti-tumor activity of cetuximab plus avelumab in non-small cell lung cancer patients involves innate immunity activation: findings from the CAVE-Lung trial Download references supported in the form of Junior Research Fellowship (J.R.F.) (UGC) ref (191620043900) under the NFSC scheme to Vivek Uttam We thank the National University of Singapore for supporting funding for KCHY APK was supported by NUHS Seed Fund (NUHSRO/2023/039/RO5 + 6/Seed-Mar/04) Non-Coding RNA and Cancer Biology Laboratory drafted first version and revisions; RK—literature review drafted first version and revisions; KCHY—literature review drafted first version and revisions; CYHK—literature review drafted first version and revisions; JL—collated additional literature wrote revision manuscript; RKS—literature review drafted first version and revisions; SM—literature review drafted first version and revisions; AM—literature review edited first and revision manuscripts; AJ —conceptualized the research topic Download citation DOI: https://doi.org/10.1038/s41420-024-02182-1 Metrics details When using the reverse-transcription quantitative polymerase chain reaction (RT-qPCR) technique for quantitative assessment of microRNA (miRNA) expression normalizing data using a stable endogenous gene is essential; however no universally adequate reference gene exists the most adequate endogenous normalizer for the expression assessment of plasma miRNAs in patients with coronavirus disease 2019 (COVID-19) Two massive sequencing procedures were performed (a) to identify differentially expressed miRNAs between patients with COVID-19 and healthy volunteers (n = 12) and (b) to identify differentially expressed miRNAs between patients with severe COVID-19 and those with mild COVID-19 (n = 8) The endogenous normalizer candidates were selected according to the following criteria: (1) the miRNA must have a fold regulation = 1; (2) the miRNA must have a p-value > 0.990; and (3) the miRNAs that were discovered the longest ago should be selected and hsa-miR-205-3p) met all criteria and were selected for validation by RT-qPCR in a cohort of 125 patients only hsa-miR-205-3p was eligible endogenous normalizers in the context of COVID-19 because their expression was stable between the compared groups Although data normalization directly influences the accuracy of results no standardized protocol exists for this procedure no specific normalized miRNAs have been identified in patients with COVID-19 considering that there are no concrete conclusions regarding which miRNA should be used as a normalizer for miRNA expression assessment in COVID-19 and considering the severity and importance of the disease further research is required to elucidate this issue we aimed to determine the most appropriate endogenous normalizer for assessing plasma miRNA expression in patients with COVID-19 The criterion adopted for dividing the participants included in the study was the presence or absence of SARS-CoV-2 virus infection as confirmed by a reference RT-qPCR test conducted using plasma collected on the same day as the test Two large-scale sequencing procedures were performed 12 participants were involved and subdivided into two groups: (1) Case group (n = 8 participants with a positive RT-PCR test for SARS-CoV-2); (2) Control group (n = 4 with a negative RT-PCR test for SARS-CoV-2) the sequencing was performed to identify differentially expressed miRNAs between patients with COVID-19 and controls (healthy volunteers) Participants were divided as follows: (1) Case group (n = 8 participants who tested positive for SARS-CoV-2 in the reference test RT-PCR); (2) Control group (n = 4 participants with a negative RT-PCR result for SARS-CoV-2) the sequencing was performed to identify differentially expressed miRNAs between patients with severe/critical COVID-19 and those with mild COVID-19 Participants were divided as follows: (1) non-severe group (n = 4 participants with mild/moderate COVID-19); (2) severe/critical group (n = 4 participants with severe/critical COVID-19) The participants’ clinical characteristics are shown in Table 1 fold change = miRNA expression of severe or critical group/miRNA expression of mild or moderate group and hsa-miR-205-3p) selected by next-generation sequencing were confirmed by RT-qPCR in a larger cohort of participants (n = 125 including all those involved in the sequencing) Although hsa-miR-194-3p was detected in all samples during sequencing Different experiments were conducted to determine whether amplification could be confirmed the use of this miRNA as an endogenous control was ruled out For the remaining three miRNAs (hsa-miR-34a-3p, hsa-miR-17-3p, and hsa-miR-105-3p), Tables 4 and 5 show their expression levels according to RT-qPCR When comparing the expression levels between the case (n = 85) and control groups (n = 40) hsa-miR-17-3p was not suitable as an endogenous normalizer as it exhibited significant differences in expression (p < 0.05) Similar expression levels of hsa-miR-34a-3p and hsa-miR-205-3p were observed in the two groups (p = 0.3990 and p = 0.0805 when comparing the expression levels between the group of patients with mild COVID-19 (n = 45) and critical COVID-19 (n = 39) a significant difference was observed (p < 0.05) for hsa-miR-34a-3p none of the selected miRNAs met the prerequisites for use as endogenous normalizers for different disease severities The endogenous reference gene must be stably expressed in both groups (Case and Control when discussing the first sequencing; Mild COVID-19 and Critical COVID-19 when discussing the second sequencing) a statistical analysis was performed to evaluate this premise; as all candidate miRNAs showed significant differences when comparing expression between patients with severe/critical COVID-19 and those with mild COVID-19 (p < 0.05) the analysis was made only for the results comparing miRNA expression between COVID-19 patients and controls Stability of candidate miRNAs for normalization chosen by the RT-qPCR results comparing differentially expressed miRNAs between patients with COVID-19 and controls (healthy volunteers), determined by different algorithms (RefFinder, http://blooge.cn/RefFinder/) higher values indicate lower the stability of the miRNA To ensure the success of miRNA expression assessment using the gold standard method RT-qPCR the most appropriate normalizer is expected to be utilized a gene must remain stable and exhibit constant expression across different contexts and individuals testing the stability of potential normalizers prior to experimentation is necessary we aimed to determine the best plasma miRNA normalizer for patients with COVID-19 Combining the RNA sequencing results and the criteria established previously in this study (namely and the longest previously discovered miRNAs) yielded four candidates for validation as possible endogenous normalizers: hsa-miRNA-34a-3p RT-qPCR was conducted with a larger cohort of participants analyzing the selected miRNAs as potential endogenous normalizers care was taken to ensure that differences in individual profiles did not interfere with the study of miRNA expression hsa-miR-194-3p was not an appropriate endogenous normalizer for use in the experiments as neither amplification nor detection was observed using the gold standard method The results indicate that hsa-miR-17-3p is the most stable miRNA this miRNA exhibited different values when comparing the two groups involved in the analyses and hsa-miR-34a-3p was more stable than hsa-miR-205-3p and none of the patients in our cohort had such conditions hsa-miR-205-3p is the most suitable normalizer for comparing plasma miRNAs from patients with COVID-19 with those from healthy volunteers when comparing distinct COVID-19 severities there was no indication that it would be the best endogenous normalizer leaving it as a subject to be addressed in future research This study had two significant limitations to avoid potential bias in the interpretation of the results the control and case groups should differ only with reference to COVID-19 for a better study design While precautions were taken to match the groups in terms of age and sex the same was not possible regarding ethnicity and comorbidities such as diabetes and systemic arterial hypertension the number of participants in the validation cohort should have been larger some issues must be addressed to establish hsa-miR-205-3 as an endogenous normalizer there is currently no ideal normalization strategy for applications in studies assessing miRNA expression using the gold standard RT-qPCR method an appropriate endogenous normalizer should possess characteristics such as stability under different conditions and equivalent expression across all individuals this study aimed to determine the best endogenous normalizer for assessing plasma miRNA expression in patients diagnosed with COVID-19 the miRNA that most closely approximates the ideal conditions for use as an endogenous normalizer when comparing plasma miRNAs from patients with COVID-19 versus healthy volunteers is hsa-miR-205-3p Future research is expected to define the most suitable normalizer for different COVID-19 severities Considering the significance of the topic presented by COVID-19 in recent years and ongoing research we believe that this work will pave the way for further research and advancements in science and technology within the context of the disease This study was conducted in accordance with the Declaration of Helsinki and approved by the Ethics Committee of the Universidade Estadual de Campinas (protocol code: 31049320.7.1001.5404 Informed consent was obtained from all participants or their legal guardians The participants were subdivided into two groups according to their SARS-CoV-2 results in the reference RT-PCR test the “case group,” the inclusion criteria consisted of individuals aged between 18 and 80 years These participants were hospitalized at the Hospital Estadual de Sumaré Dr the Hospital de Clínicas of University of Campinas (HC-UNICAMP) the Centro de Saúde da Comunidade (CECOM UNICAMP) In the “control group,” participants were included according to the following criteria: individuals between 18 and 80 years old and members of the UNICAMP community with a negative RT-PCR result for SARS-CoV-2 in addition to having negative test results had no contact with SARS-CoV-2 infected people did not participate in frontline COVID virus control efforts and were monitored for 15 days after sample collection to ensure that they did not exhibit COVID-19-related symptoms individuals with common symptoms of COVID-19 but without shortness of breath patients with evidence of lower respiratory disease or imaging and with oxygen saturation (SpO2) ≥ 94% in room air; severe individuals with SpO2 < 94% in room air a ratio of arterial partial pressure of oxygen to fraction of inspired oxygen (PaO2/FiO2) < 300 mm Hg or lung infiltrates > 50%; and critical individuals who presented respiratory failure The participants were characterized by age Data were collected from patient records (case group) and questionnaires (control group) and healthy controls were matched for sex and age Peripheral venous blood samples were collected from all participants in EDTA tubes all samples were collected during hospitalization within 10 days of symptom onset Plasma samples were separated from the whole blood by centrifugation at 2500 rpm and stored in a -80 °C biobank freezer until the experiments were conducted Three criteria were employed to select candidate normalizer miRNAs from RNA-Seq data: (1) miRNA must have a fold-change value equal to 1; (2) miRNA must have a p-value > 0.990; and (3) considering the first two criteria the third criterion was to select the miRNAs that were discovered the earliest (i.e. those with the smallest number in their nomenclature) the most adequate normalizer miRNA was the one with no difference in expression between the evaluated groups (p > 0.05) miRNA extraction was performed using 200 µL of each plasma sample with the miRNeasy Serum/Plasma Kit (Qiagen The samples were once again kept in a -80 °C freezer after the experiment was completed To ensure an accurate analysis of miRNA expression using the RT-qPCR technique 15 fmol of the synthetic miRNA cel-miR-39 was added This exogenous miRNA (spike-in) served as a quality control for the entire technical process If the sample threshold cycle (Ct) was outside two standard deviations from the mean Ct of the exogenous control This was exclusively the case with the miRNA samples used for RT-qPCR validation; the samples extracted for sequencing did not contain cel-miR-39 cDNA was synthesized using the TaqMan™ Advanced miRNA cDNA Synthesis kit (Applied Biosystems USA) following the manufacturer’s instructions The sequencing cohort comprised 12 participants (n = 12) along with the QIAseq® miRNA Library Kit (Qiagen Quality control of the samples was also performed by analyzing 1 and 2 µL of each miRNA sequencing library using an Agilent Bioanalyzer and a Qubit fluorometer according to the manufacturer’s specifications Library preparations were sequenced using an Illumina HiSeq 2500 platform which were sent to the Life Sciences Core Facility (LaCTAD) at UNICAMP for sequencing RT-qPCR was used to validate the results obtained by sequencing as it is considered the gold standard for assessing miRNA expression The validation cohort comprised 125 participants (n = 125) including the 12 participants from the sequencing cohort The RT-qPCR was performed at the Clinical Pharmacy Laboratory (CliPhar) RT-qPCR was performed on a Rotor-Gene Q (Qiagen Germany) using TaqMan™ Advanced miRNA Assays (Applied Biosystems USA) for the selected miRNAs as possible normalizers The total reaction volume was reduced to 10 µL consisting of 5 µL of TaqMan® Fast Advanced Master Mix (2×) (Applied Biosystems 0.5 µL of TaqMan® Advanced miRNA Assay (20×) (Applied Biosystems The reactions were performed in duplicates Raw data were evaluated using Rotor-Gene Q Series Software 2.1.0.9 (Qiagen samples with cel-miR-39 expression above two standard deviations were excluded from the analysis which encompasses four different normalization tools commonly utilized: BestKeeper each employing distinct algorithms to assess gene expression stability comparing the stability values ​​of other endogenous controls; the lower the stability value the more appropriate is the endogenous control For the clinical and demographic data analyses and dispersion (standard deviation) were presented Data normality was assessed using the Shapiro–Wilk test miRNA expression was compared between the COVID-positive and COVID-negative groups using the Mann–Whitney U test A p-value < 0.05 was considered statistically significant for all analyses All statistical analyses were performed using the GraphPad Prism v.9.1.0 software for Windows (GraphPad Software The stability of endogenous control miRNAs was assessed using the online in silico prediction tool RefFinder (http://blooge.cn/RefFinder/)7,8 which comprises four normalization methods: BestKeeper it employs distinct algorithms concurrently based on different statistical endpoints and assigns a value to each gene to determine the most consistently expressed gene The datasets generated and/or analyzed during the current study are available from the Research Data Repository of the Universidade Estadual de Campinas, https://doi.org/10.25824/redu/WWUNT1 Ministério da Saúde do Brasil. Coronavírus, Ministério da Saúde. Ministério da Saúde https://www.gov.br/saude/pt-br/assuntos/coronavirus (2022) World Health Organization. Coronavirus (COVID-19) Cases -Dashboard https://data.who.int/dashboards/covid19/cases?n=c (2023) Identification of novel genes coding for small expressed RNAs Data normalization of urine miRNA profiling from Head and Neck Cancer patients treated with cisplatin COVID-19 Treatment Guidelines Panel. Coronavirus Disease 2019 (COVID-19) treatment guidelines. Natl. Institutes Health https://www.covid19treatmentguidelines.nih.gov/ RefFinder: A web-based tool for comprehensively analyzing and identifying reference genes A miRNA analysis tool for deep sequencing of plant small RNAs Normalization of microRNA expression levels in quantitative RT-PCR assays: Identification of suitable reference RNA targets in normal and cancerous human solid tissues MicroRNA profiling in plasma or serum using quantitative RT-PCR Identification of valid endogenous control genes for determining gene expression in human glioma Identification of suitable endogenous control genes for microRNA gene expression analysis in human breast cancer Addressing the unsolved challenges in microRNA-based biomarker development: Suitable endogenous reference microRNAs for SARS-CoV-2 infection severity Identification of suitable endogenous normalizers for qRT- PCR analysis of plasma microRNA expression in essential hypertension Considerations and suggestions for the Reliable analysis of miRNA in plasma using qRT-PCR MiR-34a-3p alters proliferation and apoptosis of meningioma cells in vitro and is directly targeting SMAD4 MiR-34a-3p suppresses pulmonary vascular proliferation in acute pulmonary embolism rat by targeting DUSP1 Mone, P. et al. Functional role of miR-34a in diabetes and frailty. Front. Aging vol. 3 Preprint at (https://doi.org/10.3389/fragi.2022.949924 2022) MiR-205-3p suppresses bladder cancer progression via GLO1 mediated P38/ERK activation Mir-205-3p promotes lung cancer progression by targeting APBB2 Mir-205-3p promotes proliferation and reduces apoptosis of breast cancer MCF-7 cells and is associated with poor prognosis of breast cancer patients Advantages of restoring mir-205-3p expression for better prognosis of gastric cancer via prevention of epithelial-mesenchymal transition Determination of stable housekeeping genes differentially regulated target genes and sample integrity: BestKeeper - Excel-based tool using pair-wise correlations Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization applied to bladder and colon cancer data sets Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR Download references This research was funded by the São Paulo Research Foundation (FAPESP) CRSCR is a recipient of a doctoral scholarship from Coordenação de Aperfeiçoamento de Pessoal de Nível Superior—Brazil (CAPES) JTS is a recipient of a scientific initiation scholarship from FAPESP CMN is a recipient of a scientific initiation scholarship from FAPESP The content of this article results from the Pharmaceutical Security Nucleus Project the result of a partnership between the Ministry of Justice and Public Security of Brazil through the Fund for the Defense of Diffuse Rights The content does not necessarily reflect the official position of the Ministry or the Fund on the subject under consideration Institutional Review Board Statement: The study was conducted in accordance with the Declaration of Helsinki and approved by the Ethics Committee of the Universidade Estadual de Campinas (protocol code: 31049320.7.1001.5404 Julia Tiemi Siguemoto and Carolini Motta Neri contributed equally to this work Carla Regina da Silva Correa da Ronda & Patricia Moriel Wagner José Fávaro & Eder de Carvalho Pincinato and P.M.; Data analysis and interpretation and E.d.C.P.; Critical revision of the manuscript All authors have read and agreed to the final version of the manuscript Written informed consent has been obtained from the patient(s) to publish this paper The authors declare no conflict of interest The funders had no role in the design of the study; in the collection or interpretation of data; in the writing of the manuscript; or in the decision to publish the results Download citation DOI: https://doi.org/10.1038/s41598-024-75740-3 Metrics details This study aimed to evaluate the diagnostic value of miR-193b-5p and miR-511-5p in sepsis and septic shock from the perspective of immune regulation serum exosomal miRNA sequencing was conducted on patients with sepsis (n = 6) miR-193b-5p and miR-511-5p were identified as immune-related miRNAs differentiating sepsis from septic shock quantitative real-time polymerase chain reaction (qRT-PCR) was performed to validate the identified miRNAs in a cohort of 90 participants and 30 general surgery patients serving as controls The results indicated that miR-193b-5p expression level was significantly reduced in septic patients and septic shock patients compared with healthy controls Both miR-193b-5p and miR-511-5p exhibited diagnostic potential distinguishing sepsis from the control group with area under the curve values of 0.797 and 0.795 miR-193b-5p expression level was inversely correlated with C-reactive protein level (r = -0.40 A positive correlation was identified between miR-193b-5p and lymphocyte count (r = 0.26 serum miR-193b-5p demonstrated potential as a diagnostic biomarker for sepsis and was associated with inflammation and immune regulation in sepsis fail to diagnose sepsis with sufficient speed and accuracy further investigation into the pathogenesis of sepsis and the identification of highly specific and sensitive biomarkers are necessary to establish a robust theoretical basis for clinical diagnosis and treatment dynamic syndrome caused by imbalance in the inflammatory network a single indicator or a small set of indicators is insufficient to comprehensively reflect the dysregulation of immune and inflammatory responses in sepsis The present study therefore utilized high-throughput sequencing technology to obtain all miRNAs in serum exosomes from patients with sepsis and septic shock and potential biomarkers were screened and verified for the early sepsis diagnosis from the perspective of immune function Analysis of differentially expressed microRNAs and prediction of target genes (a) The heatmap of upregulated and downregulated DEMs among sepsis (b) The volcano plot of upregulated and downregulated DEMs between sepsis and septic shock (c) The volcano plot of upregulated and downregulated DEMs between sepsis and healthy controls (d) The volcano plot of upregulated and downregulated DEMs between septic shock and healthy controls The red dot indicates the upregulated DEMs and the green dot indicates the downregulated DEMs (e) The Venn diagram of upregulated and downregulated target genes between sepsis and septic shock (f) The Venn diagram of upregulated and downregulated target genes between sepsis and healthy controls (g) The Venn diagram of upregulated and downregulated target genes between septic shock and healthy controls Analysis of target genes in KEGG pathways (a) KEGG pathway analysis results for downregulated target genes between sepsis and septic shock (b) KEGG pathway analysis results for upregulated target genes between sepsis and healthy controls (c) KEGG pathway analysis results for upregulated target genes between septic shock and healthy controls The x-axis represents the proportion of genes enriched in each pathway relative to the total number of genes in the group along with the number of genes in each pathway The circle size corresponds to the number of genes involved and the color scale represents -log10(Q value) KEGG: Kyoto Encyclopedia of Genes and Genomes the PPI network of down-regulated target genes between sepsis and septic shock consisted of 12 nodes and 22 edges the PPI network of upregulated target genes between septic patients and HCs included 13 nodes and 34 edges the PPI network of upregulated target genes between septic shock patients and HCs comprised 22 nodes and 67 edges Results of PPI network analysis of target genes related to immune and DEMs-mRNAs networks (a) The downregulated hub genes between sepsis and septic shock (b) The upregulated hub genes between sepsis and healthy controls (c) The upregulated hub genes between septic shock and healthy controls (d) The networks for downregulated DEMs and target genes between sepsis and septic shock (e) The networks for upregulated DEMs and target genes between sepsis and healthy controls (f) The upregulated DEMs and target genes between septic shock and healthy controls The verification of the diagnosis value of miR-193b-5p and miR-511-5p in sepsis and septic shock groups (c) ROC curves illustrating the sensitivity and specificity of plasma miR-511-5p and miR-193b-5p (d) ROC curves depicting the sensitivity and specificity of plasma miR-511-5p and miR-193b-5p (e) Correlation between miRNAs and immunity and inflammatory indicators hs-CRP: High-sensitivity C-reactive protein the impact of immune-related biomarkers in sepsis is unclear The purpose of our study was to identify and verified diagnostic biomarkers of sepsis from the perspective of immune function regulation small RNA sequencing technology was employed to identify DEMs among septic patients concentrating on miRNA profiles derived from serum exosomes Target genes of the identified DEMs were predicted using public databases and pathway enrichment analysis was conducted to identify immune-related pathways By filtering the target genes enriched in immune-related pathways DEMs-mRNAs interaction networks were constructed enabling the selection of miRNAs associated with immune function as potential biomarkers for the early diagnosis of sepsis and septic shock Further validation was carried out using quantitative real-time polymerase chain reaction (qRT-PCR) which confirmed that miR-193b-5p plays a role in sepsis by modulating the immune response public databases were employed to predict target genes associated with the identified DEMs The KEGG pathway analysis of upregulated target genes in sepsis and septic shock groups revealed significant enrichment in multiple immune pathways and functions the KEGG pathway analysis of upregulated target genes in the septic shock group demonstrated significant enrichment in the leukocyte transendothelial migration pathway (hsa04670) and the T cell receptor (TCR) signaling pathway (hsa04660) These findings indicate that dysregulation of innate and adaptive immune responses plays a critical role in the pathogenesis and progression of sepsis To accurately identify the occurrence of septic shock in patients with sepsis key genes enriched in immune pathways were screened and a DEMs-mRNAs regulatory network was constructed to identify critical miRNAs miRNAs with the most connections to these genes were the primary target miRNAs and we screened out miR-193b-5p and miR-511-5p as the target miRNAs while PIK3CA and CD8A were linked to miR-511-5p this study found that miR-193b-5p level was reduced in patients with sepsis and septic shock compared with HCs suggesting that miR-193b-5p expression level may vary between systems affected by sepsis no significant difference in miR-511-5p expression level was identified between patients with sepsis or septic shock and HCs miR-511-5p expression level had no correlation with immune-related indicators suggesting limited utility for diagnosing sepsis through serum analysis have demonstrated that downregulation of the TCR pathway in sepsis datasets is associated with poor prognosis upregulation of the TCR signaling pathway was found in the septic shock group compared with the sepsis group potentially reflecting early immune overactivation during septic shock This early activation of adaptive immune pathways may amplify the hyper-inflammatory response driving the transition from sepsis to septic shock signifying immunosuppression and increased susceptibility to secondary infections This biphasic immune response highlights the complex regulation of immunity in sepsis and its progression to septic shock This study utilized bioinformatics technology to identify sepsis biomarkers from the perspective of immune function regulation We identified that miR-193b-5p may influence the development of sepsis by regulating immune-related pathways and validated this finding using qRT-PCR technology in a new patient cohort thereby enhancing the reliability of the results we explored the potential role of miR-193b-5p in sepsis progression providing a theoretical basis for the accurate diagnosis and targeted treatment of sepsis The small sample size used for microRNA sequencing and qRT-PCR validation might affect the generalizability of the results Future studies should verify the identified DEMs at the cellular and animal levels and incorporate larger sample sizes this study only assessed the expression levels of miR-193b-5p and miR-511-5p at the time of patient inclusion without dynamically monitoring their expression throughout disease progression This limitation highlights the need for further research to better elucidate the clinical significance of these immune function-related miRNAs in sepsis the findings indicate that serum miR-193b-5p can serve as a diagnostic marker for sepsis miR-193b-5p is associated with inflammation and immune regulation highlighting its potential role in sepsis pathophysiology Serum samples were collected from six patients with sepsis and six patients with septic shock who were admitted to the ICU of the General Hospital of Ningxia Medical University (Yinchuan China) between August 2020 and August 2021 three healthy volunteers were recruited as controls miRNA sequencing was performed on these samples and bioinformatics techniques were applied to identify miRNAs of interest A prospective observational study was subsequently conducted from January 1 and general surgery patients (control group) who were admitted to the ICU of the same hospital Blood samples were obtained within 24 h of ICU admission for qRT-PCR to validate the key miRNAs identified through sequencing All study participants were adults (≥ 18 years old) Exclusion criteria included a history of oncological disease or long-term use of chemotherapeutic agents There were no significant differences in baseline clinical characteristics or SOFA scores among the three groups (P > 0.05) the septic shock group exhibited significantly higher Acute Physiology and Chronic Health Evaluation II (APACHE II) scores and maximum body temperatures within the first 24 h after ICU admission compared with the sepsis and control groups (P < 0.05) the sepsis group exhibited a higher maximum body temperature during the same period compared with the control group (P < 0.05) Participants’ general and clinical characteristics are presented in Supplementary Tables S3 and S4 This study was performed in line with the principles of the Declaration of Helsinki Approval was granted by the Ethics Committee of General Hospital of Ningxia Medical University China (Ethics Approval Number: 2020 − 722) All patients’ legal representatives and healthy volunteers have been informed and provided written informed consent forms in accordance with the Declaration of Helsinki Venous blood samples (20 mL) were collected and left at room temperature for 30 min before being placed at 4 °C for 3–4 h The samples were centrifuged at 4000 × g for 20 min at 4 °C and the supernatant was carefully extracted This supernatant was centrifuged again at 1000 × g for 10 min at 4 °C The resulting serum was transferred to RNase-free lyophilization tubes and stored at -80 °C Exosome extraction was performed at 37 °C using ultracentrifugation The top 10 upregulated and downregulated DEMs were selected for each comparison Pathways associated with immune function were selected for further analysis. Genes enriched in these pathways were subjected to PPI network analysis using the STRING database (Version 11.5; https://cn.string-db.org/) The confidence score threshold was set at 0.40 Visualization of the PPI network was performed using Cytoscape software (Version 3.9.0 Hub genes were identified using the Maximal Clique Centrality (MCC) algorithm in the CytoHubba plugin The top five genes in each analysis were designated as hub genes The DEMs-mRNAs network was constructed using the DEMs identified and their target genes enriched in immune-relevant pathways This network was visualized using Cytoscape software (Version 3.9.0) to facilitate the identification of key DEMs a prospective study was conducted involving 90 participants: 30 patients with septic shock Venous blood samples (1 mL) were collected into sterilized enzyme-free centrifuge tubes containing 5 mL RNA SolidTM reagent The samples were stored at -30 °C until RNA extraction The expression levels of miR-193b-5p and miR-511-5p were quantified using qRT-PCR with 2× SYBR Green qPCR Master Mix (None ROX) (Servicebio Technology Co. The relative expression levels were calculated using the 2−ΔΔCt method Data were analyzed utilizing SPSS 26.0 software (IBM Hospitalization data for all participants were recorded using EpiData 3.0 software Continuous variables following a normal distribution were reported as mean ± standard deviation (SD) and analyzed using Student’s t-test Continuous variables with a skewed distribution were presented as median (interquartile range IQR) and analyzed using the Mann-Whitney U test Differences among multiple groups were assessed through one-way analysis of variance (ANOVA) or the Kruskal-Wallis H-test ROC curve analysis was performed using MedCalc 19.7.2 software to assess the diagnostic accuracy of miR-193b-5p and miR-511-5p for sepsis and septic shock Spearman correlation analysis was used to examine the relationships between miR-193b-5p and inflammation or immunity-related indicators A significance level of α = 0.05 was applied and P < 0.05 was considered statistically significant All data supporting the findings of this study are available within the paper and its Supplementary Information The Third International Consensus definitions for Sepsis and septic shock (Sepsis-3) and national sepsis incidence and mortality 1990–2017: analysis for the global burden of Disease Study Executive Summary: surviving Sepsis Campaign: International guidelines for the management of Sepsis and Septic Shock 2021 Sepsis-induced immunosuppression: from cellular dysfunctions to immunotherapy inflammatory markers as well as prognosis in sepsis patients Modes of action and diagnostic value of miRNAs in sepsis MiRNAs: dynamic regulators of immune cell functions in inflammation and cancer MicroRNA therapeutics: towards a new era for the management of cancer and other diseases MicroRNA fingerprints identify miR-150 as a plasma prognostic marker in patients with sepsis Accuracy of circulating microRNAs in diagnosis of sepsis: a systematic review and meta-analysis The correlations between the serum expression of miR-206 and the severity and prognosis of sepsis Circulating miR-147b as a diagnostic marker for patients with bacterial sepsis and septic shock Overexpression of miR-150-5p Alleviates Apoptosis in Sepsis-Induced Myocardial Depression Mesenchymal stromal (stem) cell therapy modulates miR-193b-5p expression to attenuate sepsis-induced acute lung injury Oleuropein protects against lipopolysaccharide-induced sepsis and alleviates inflammatory responses in mice T cell receptor (TCR) signaling in health and disease Immune gene expression networks in sepsis: a network biology approach Ultrafast and memory-efficient alignment of short DNA sequences to the human genome Predicting effective microRNA target sites in mammalian mRNAs The biochemical basis of microRNA targeting efficacy miRWalk: an online resource for prediction of microRNA binding sites miRDB: an online database for prediction of functional microRNA targets Prediction of functional microRNA targets by integrative modeling of microRNA binding and target expression data Comparative toxicogenomics database (CTD): update 2021 Metascape provides a biologist-oriented resource for the analysis of systems-level datasets KEGG: kyoto encyclopedia of genes and genomes Toward understanding the origin and evolution of cellular organisms Download references This work was supported by the Key Research and Development Program of Ningxia (2021BEG03064) This work was supported by Ningxia Natural Science Foundation Project (2022A1782) Xuzhou Maternity and Child Health Care Hospital Affiliated to Xuzhou Medical University General Hospital of Ningxia Medical University People’s Hospital of Ningxia Hui Autonomous Region Ningxia key Laboratory of Craniocerebral Diseases Department of Pulmonary and Critical Care Medicine Department of Key Laboratory of Ningxia Stem Cell and Regenerative Medicine enrolled patients and collected the data; C All the authors approved the final version of the article to be submitted All authors commented on previous versions of the manuscript and all authors read and approved the final manuscript † Can Li and Xinxing Sun contributed equally to this study Download citation DOI: https://doi.org/10.1038/s41598-025-89946-6 Metrics details This study aims to investigate the differential miRNA expression profile between the visceral white adipose tissue and the skeletal muscle of people with obesity undergoing bariatric surgery Skeletal muscle and visceral adipose tissue samples of 10 controls and 38 people with obesity (50% also with type 2 diabetes) undergoing bariatric surgery were collected miRNA expression profiles were analyzed using Next-Generation Sequencing and subsequently validated using RT-PCR Approximately 69% of miRNAs showed similar expression in both tissues 55 miRNAs were preferentially expressed in visceral adipose tissue and 53 in skeletal muscle miR-122b-5p was uniquely identified in skeletal muscle while miR-1-3p and miR-206 were upregulated in skeletal muscle miR-224-5p and miR-335-3p exhibited upregulation in visceral adipose tissue distinctions related to the presence of type 2 diabetes were observed solely in the expression of miR-1-3p and miR-206 in visceral adipose tissue This is the first study unveiling distinct miRNA expression profiles in paired samples of visceral adipose tissue and skeletal muscle in humans The identification of obesity-specific miRNAs in these tissues opens up promising avenues for research into potential biomarkers for obesity diagnosis and treatment although the relationship between obesity and the development of type 2 diabetes is widely accepted it is still unclear why some people with obesity develop diabetes and others do not Regarding the important role of visceral adipose tissue and skeletal muscle in the development and progression of various metabolic diseases this study aims to investigate the differential miRNA expression profile between the visceral white adipose tissue and the skeletal muscle of people with severe obesity undergoing bariatric surgery We believe that studying the miRNA profile of these two tissues opens a door to explain the metabolic duality of obesity which in some cases favors the development of other pathologies such as diabetes while in others acts as a protective factor the participation of all patients undergoing bariatric surgery at the Central University Hospital of Asturias (HUCA) was requested A total of 38 volunteers with obesity aged between 29 and 62 years were included in the study 10 volunteers without obesity or type 2 diabetes who underwent abdominal surgery for other reasons (mainly eventrations) Volunteers were then subdivided into a discovery cohort (N = 6) and a validation cohort (N = 48) which also include patients from the discovery cohort All subjects were recruited at the General Surgery Service and the Endocrinology and Nutrition Service of the HUCA Informed consent was obtained from all volunteers and the study protocol was approved by the HUCA ethical committee (Project identification code: CEImPA:2020.419; acceptation date: 21st October 2020) which is consistent with the principles of the Declaration of Helsinki Fresh visceral adipose tissue and skeletal muscle were obtained simultaneously during the surgery procedure under sterile conditions and immediately transported to the laboratory visceral adipose tissue is obtained from the greater omentum while muscle biopsies are collected from the transversus abdominis or external oblique in the left subcostal region in the midclavicular line A laminar flux cabin was used for tissue manipulation to avoid contamination and blood vessels were cleaned out by using tweezers and scissors a routine blood biochemical analysis was performed a few days before surgery Muscular and visceral adipose tissue samples were analyzed by NGS for small-RNA total expression quality control and next-generation sequencing procedures were accomplished by Arraystar INC (Rockville total RNA of each sample was extracted from 50–100 mg of tissue by using TRIzol (Invitrogen) reagent total RNA was used to prepare the miRNA sequencing library RNA extraction was performed with NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs Ribo-Zero Magnetic Gold Kit (Human/Mouse/Rat) (Epicentre USA) and NEB Multiplex Small RNA Library Prep Set for Illumina according to the manufacturer’s instructions which include the following steps: (1) 3’-adapter ligation; (2) 5’-adapter ligation; (3) cDNA synthesis; (4) PCR amplification; (5) size selection of 135–155 base pairs (bp) PCR amplified fragments (corresponding to 15–35 nucleotides (nt) small RNAs) Libraries were quantified with Agilent 2100 Bioanalyzer the DNA fragments in well mixed libraries were denatured with 0.1 M NaOH to generate single-stranded DNA molecules amplified in situ and finally sequenced for 51 cycles on Illumina NextSeq 500 (Illumina USA) according to the manufacturer’s instructions The small RNA that are obtained through miRDeep2 are mainly the mature sequences which are eventually produced by more than one precursor throughout the genome all mature miRNAs with the same names were taken from different precursors and averaged for each (rounded up) differential expression analysis used the quasi-likelihood negative binomial generalized log-linear model (GLM) functions Statistical significance for differentially expressed miRNA was defined as p values < 0.05 only differentially expressed miRNAs with logCPM greater than 5 were considered for subsequent validation Gene expression data are expressed as target miRNA expression relative to the corresponding housekeeping mean gene expression (ΔCT = CT miRNA – CT value of the housekeeping gene) The relative expression of each miRNA was reported as 2−ΔCT statistical analysis was performed with JASP software (0.14.1) The Shapiro–Wilk test was conducted to assess sample normality and then non-parametric Paired Willcoxon test or Kruskal–Wallis test followed by Dunn Post Hoc test were performed and Bonferroni correction stated Spearman test was used to evaluate correlations between variables corrected by FDR was considered significant Anthropometric and clinical profile of patients included in both the discovery and the validation cohort are present in Table 1 significant differences were observed in age LDL cholesterol and triglycerides among the three groups BMI was significantly increased in both groups of people with obesity versus the control group and both glucose and HbA1c between the group of people with diabetes and the two non-diabetic groups LDL cholesterol levels were found significantly reduced in the group of people with obesity and diabetes compared to controls while triglycerides are significantly higher in the group of patients with both obesity and diabetes compared with the group of people with obesity but not diabetes Spearman correlation was performed to explore any potential relationships between miRNA expression in both tissues, and different biochemical variables including the lipidic profile (HDL Cholesterol, LDL Cholesterol, Total Cholesterol and Triglycerides) and the glucose profile (HbA1c and blood glucose) (Table S4) We could observe greater number of miRNAs related with the lipidic profile in the adipose tissue compared with the skeletal muscle although more miRNAs from the skeletal muscle were influenced by blood glucose the same number of miRNAs in both tissues were affected by the HbA1c percentage only the relationship between hsa-miR-374a-3p with HDL and hsa-miR-331-5p with total cholesterol were found to be common in both tissues with the latter correlation exhibiting opposite directions we decided to correct our significance cut point to 0.0001 based on the number of miRNAs included in the analysis (0.05/345 miRNAs) significancy was only conserved between visceral adipose tissue hsa-miR-941 expression and LDL cholesterol and highlighting the “Wnt signaling pathway” (hsa04910; p = 6.10 × 10−9; 113 target genes) the “insulin signaling pathway” (hsa04310; p = 3.33 × 10−6; 102 target genes) and “TGF-beta signaling pathway” (hsa04350; p = 8.92 × 10−6; 66 target genes) Among all the differentially expressed miRNAs in the discovery cohort five miRNAs were selected for their validation in an extensive cohort: hsa-miR-206 hsa-miR-122b-5p and hsa-miR-1-3p which were found upregulated in the skeletal muscle and hsa-miR-224-5p and hsa-miR-335-3p which were found upregulated in the visceral adipose tissue miRNA expression was quantified by real time PCR with Taqman probes A hsa-miR-1-3p; B hsa-miR-206; C hsa-miR-122b-5p; D hsa-miR-335-3p; E hsa-miR-224-5p Mann–Whitney test was applied for tissue comparison We also compared miRNA expression between tissues observing a positive correlation of visceral adipose tissue hsa-miR-224-5p expression with skeletal muscle hsa-miR-122b-5p significance disappears when we correct the p value by the number of miRNAs analyzed In addition to the aforementioned correlations we have also observed a negative correlation between visceral adipose tissue hsa-miR-335-3p expression with HDL cholesterol levels A–E Skeletal muscle F–I visceral adipose tissue [red: OB_T2D—people with obesity and type 2 diabetes; green: OB_noT2D—people with obesity and without type 2 diabetes; blue: noOB_noT2D—people without obesity and without type 2 diabetes] Wilcoxon test with Bonferroni correction was applied for tissue comparison ***p < 0.001; **p < 0.01; *p < 0.05; ^p < 0.06 and given the ability of miRNAs to be secreted into the bloodstream by different tissues and transported throughout the body by microvesicles and exosomes our goal was to investigate the expression profile of miRNAs in these two tissues not only to determine the differences between the two but also to be able to analyze the different expression profile of miRNAs in those people with obesity who develop type 2 diabetes and those who maintain normal blood glucose levels despite obesity we simultaneously examined paired visceral adipose tissue and skeletal muscle miRNA profile from six people with obesity both tissues showed a specific miRNA expression profile only 108 miRNAs (31% of miRNAs) showed significant differences among groups which means that 69% of the identified miRNAs are similarly expressed in both tissues and the differential miRNA profile between visceral adipose tissue and skeletal muscle in human obesity is poorly explored highlighting the role of miRNAs in the prognosis of people with obesity undergoing bariatric surgery not only achieving the desired weight loss but also resolving associated comorbidities we describe the miRNA expression profile in both visceral adipose tissue and skeletal muscle of the same patients with severe obesity with the aim of analyzing the differences and similarities between these two tissues different obesity phenotypes have been defined in recent years leading to the term “metabolically healthy obesity” to define those people with obesity with non-pathological metabolic we believe that miRNAs may play a fundamental role in the identification and classification of patients with different metabolic profiles although more studies are needed in this area One of the main limitations of this study is the small sample size of the discovery cohort although this serves as a pilot study and more extensive research should be conducted we suggest that further study of these miRNAs and their corresponding target genes could improve our understanding of the metabolic complexities of obesity further exploration could include the establishment of a new discovery cohort explicitly designed to study miRNA profiles in people with obesity and with type 2 diabetes This initiative would provide a more complete picture of the factors that influence the onset of type 2 diabetes in people with severe obesity Another important limitation we found is the lack of a real control group because although patients who underwent minor surgeries (mainly eventrations) were selected any surgery can cause inflammation and affect the final result of the study the strict criteria for this control group results in a smaller cohort size but the large metabolic differences in this group make the sample size valid The NGS data generated in this study have been deposited in the ArrayExpress database under accession code E-MTAB-13008 WHO. Obesity and overweight. 2017. http://www.who.int/mediacentre/factsheets/fs311/en/ Obesity pathogenesis: an Endocrine Society scientific statement Impact of obesity and metabolic syndrome on immunity Antithrombotic therapy and body mass: an expert position paper of the ESC Working Group on Thrombosis Adipose tissue inflammation and metabolic dysfunction in obesity Targeting adipose tissue in the treatment of obesity-associated diabetes Kurylowicz A. microRNAs in human adipose tissue physiology and dysfunction. Cells. 2021;10. https://doi.org/10.3390/CELLS10123342 Mitochondrial dynamics in skeletal muscle insulin resistance and type 2 diabetes Dilworth L, Facey A, Omoruyi F. Diabetes mellitus and its metabolic complications: the role of adipose tissues. Int J Mol Sci. 2021;22. https://doi.org/10.3390/ijms22147644 Butz H, Kinga N, Racz K, Patocs A. Circulating miRNAs as biomarkers for endocrine disorders. J Endocrinol Invest. 2016. https://doi.org/10.1007/s40618-015-0316-5 Babraham Bioinformatics. FastQC a quality control tool for high throughput sequence data. 2020. https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ Cutadapt removes adapter sequences from high-throughput sequencing reads miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades miRBase: from microRNA sequences to function Controlling the false discovery rate: a practical and powerful approach to multiple testing The sva package for removing batch effects and other unwanted variation in high-throughput experiments miRNet. https://www.mirnet.ca/miRNet/home.xhtml miR-24-3p and body mass index as type 2 diabetes risk factors in Spanish women 15 years after gestational diabetes mellitus diagnosis MicroRNA expression profiles in the subcutaneous adipose tissues of morbidly obese Chinese women Lancet Diabetes & Endocrinology Commission on the definition and diagnosis of clinical obesity Relevance of body composition in phenotyping the obesities The molecular mechanisms of obesity paradox Schetz M, De Jong A, Deane AM, Druml W, Hemelaar P, Pelosi P, et al. Obesity in the critically ill: a narrative review. Intensive Care Med. 2019. https://doi.org/10.1007/s00134-019-05594-1 Li K, Zhang Y, Zhang Y, Xi Q, Wang S-b, Li W, et al. Comparative analysis of microRNA expression profiles between skeletal muscle- and adipose-derived exosomes in pig. 2021. https://doi.org/10.3389/fgene.2021.631230 Cardiovascular risk factors and differential transcriptomic profile of the subcutaneous and visceral adipose tissue and their resident stem cells Different expression of micro-RNA in the subcutaneous and visceral adipose tissue of obese subjects Differential expression profile of miRNAs in porcine muscle and adipose tissue during development Differential expression profile of microRNA in yak skeletal muscle and adipose tissue during development Safa A, Bahroudi Z, Shoorei H, Majidpoor J, Abak A, Taheri M, et al. miR-1: a comprehensive review of its role in normal development and diverse disorders. Biomed Pharmacother. 2020;132. https://doi.org/10.1016/J.BIOPHA.2020.110903 Morales-Sánchez P, Lambert C, Ares-Blanco J, Suárez-Gutiérrez L, Villa-Fernández E, Garcia AV, et al. Circulating miRNA expression in long-standing type 1 diabetes mellitus. Sci Rep. 2023;13. https://doi.org/10.1038/S41598-023-35836-8 a key modulator of skeletal muscle development and disease biomarkers and therapeutic targets in liver diseases Elevated circulating microRNA-122 is associated with obesity and insulin resistance in young adults Levels of circulating miR-122 are associated with weight loss and metabolic syndrome Gharanei S, Shabir K, Brown JE, Weickert MO, Barber TM, Kyrou I, et al. Regulatory microRNAs in brown, brite and white adipose tissue. Cells. 2020;9. https://doi.org/10.3390/CELLS9112489 MiR-224 impairs adipocyte early differentiation and regulates fatty acid metabolism is involved in adipose tissue inflammation Differential expression of microRNAs in adipose tissue after long-term high-fat diet-induced obesity in mice The up-regulation of microRNA-335 is associated with lipid metabolism in liver and white adipose tissue of genetically obese mice Mechanisms linking obesity to insulin resistance and type 2 diabetes From the triumvirate to the ominous octet: a new paradigm for the treatment of type 2 diabetes mellitus Arderiu G, Mendieta G, Gallinat A, Lambert C, Díez-Caballero A, Ballesta C, et al. Type 2 diabetes in obesity: a systems biology study on serum and adipose tissue proteomic profiles. Int J Mol Sci. 2023;24. https://doi.org/10.3390/IJMS24010827 The value of miRNAs in the prognosis of obese patients receiving bariatric surgery Bariatric surgery alters microRNA content of circulating exosomes in patients with obesity Langi G, Szczerbinski L, Kretowski A. Meta-analysis of differential miRNA expression after bariatric surgery. J Clin Med. 2019;8. https://doi.org/10.3390/JCM8081220 He X, Kuang G, Wu Y, Ou C. Emerging roles of exosomal miRNAs in diabetes mellitus. Clin Transl Med. 2021;11. https://doi.org/10.1002/CTM2.468 Roux-en-Y-Bariatric surgery reduces markers of metabolic syndrome in morbidly obese patients miRNA signatures of insulin resistance in obesity Exploring microRNAs as predictive biomarkers for type 2 diabetes mellitus remission after sleeve gastrectomy: a pilot study Intramuscular injection of miR-1 reduces insulin resistance in obese mice Expression and clinical significance of miR-1 and miR-133 in pre-diabetes Download references This study has been funded by Instituto de Salud Carlos III (ISCIII) through the project PI19/01162 to ED and co-funded by the European Union A non-conditional grant from Menarini laboratory group was also received CL is recipient from a Sara Borrell grant from ISCIII (CD23/00037) PMS is recipient from a pre-doctoral grant from the Spanish Association Against Cancer (AECC) (PRDAS18003FERN) We thank Fundación Caja Rural and Sociedad Asturiana de Diabetes Nutrición y Obesidad for their continuous support These authors contributed equally: Carmen Lambert These authors jointly supervised this work: María Moreno Gijón Health Research Institute of the Principality of Asturias (ISPA) Centre for Biomedical Network Research on Rare Diseases (CIBERER) Edelmiro Menéndez-Torre & Elías Delgado Department of Diabetes Endocrinology and Nutrition (UDEN) Institut d’Investigació Biomèdica de Girona (IDIBGI) Jèssica Latorre & José Manuel Fernandez-Real Centre for Biomedical Network Research on Obesity and Nutrition Physiopathology (CIBEROBN) José Manuel Fernandez-Real and Elías Delgado Conduction/Data collection: Carmen Lambert Raquel Rodríguez Uría and Sandra Sanz Navarro Lourdes María Sanz Álvarez and Edelmiro Menéndez-Torre Download citation DOI: https://doi.org/10.1038/s41366-024-01683-4 Metrics details MicroRNAs are regulators of gene expression and their dysregulation can lead to various diseases MicroRNA-135 (MiR-135) exhibits brain-specific expression and performs various functions such as neuronal morphology Dysfunction of miR-135 has been reported in brain tumors and neurodegenerative and neurodevelopmental disorders Several reports show downregulation of miR-135 in glioblastoma indicating its tumor suppressor role in the pathogenesis of brain tumors by performing in silico analysis of molecular targets of miR-135 we reveal the significant pathways and processes modulated by miR-135 and signaling pathways of miRNAs in general with a focus on miR-135 in different neurological diseases including brain tumors and potential of glioblastoma organoids in recapitulating disease initiation and progression We highlight the promising therapeutic potential of miRNAs as antitumor agents for aggressive human brain tumors including glioblastoma MicroRNAs play significant regulatory roles in brain tumors and neurological diseases Brain-specific miR-135 regulates several signaling pathways such as Hippo and Insulin pathways in brain tumors and neurological diseases A comparative evaluation of different methods for generating glioblastoma organoids display significant therapeutic potential for treating brain disorders How is miR-135 regulated at the epigenetic and post-transcriptional levels in cancer What is the role of alternative splicing and cell-type-specific transcription factors in modulating the expression of miR-135 in different cancers Does modulating miR-135 expression have therapeutic and diagnostic applications in brain tumors and neurological disorders MiRNAs-mediated regulation of various pathways in these brain diseases is of paramount significance with respect to therapeutic development which has shown extensive dysregulation in cancer (A) Schematic representing the method of in silico analysis: A list of predicted targets of miR-135 was prepared using the TargetScan7.2 program (43) To find evolutionary conserved functions of miR-135 we found 280 conserved predicted targets from 8 species (Human We used these 280 conserved target genes in Enrichr and DAVID database analysis to reveal enriched pathways modulated by miR-135 (B-C) Bar diagram representation of enriched biological pathwaysusing predicted targets of miR-135 by DAVID and Enrichr database analysis miR-135 targets several genes in the Hippo signaling pathway indicating stringent regulation of the pathway by miR-135 The miR-135 suppresses cell proliferation and stem cell phenotype expression while the miRNA promotes apoptosis and migration MiR-135 suppresses the stemness property and tumorigenesis The schematic representation of prominentmiRNAs dysregulated in respective neurological diseases Since the genetic cause of ASD is not yet well understood it seems unlikely that these miRNAs alone are responsible for causing ASD Such modifications have already entered clinical trials a mimic of miR-34a conjugated with liposomes has entered Phase-I clinical trials for the treatment of primary and metastatic liver cancer (NCT01829971) miR-135 has emerged as a therapeutic target that can be further explored in clinical trials for the development of novel drugs for the treatment of neurological diseases This review elucidates the role of miRNAs in brain tumorigenesis with a special emphasis on the brain-specific miRNA-135 MiR-135 plays a major role in brain tumorigenesis and neurological diseases MiR-135 can act as both an oncogene and a tumor suppressor though its low expression in major brain tumors such as glioblastoma and medulloblastoma suggests its tumor-suppressor ability The tissue-specific context may influence the altered expression of miR-135 in different cancers MiR-135 downregulates several targets involved in signaling pathways and tumor recurrence in glioblastoma and medulloblastoma The miR-135-mediated regulation of several targets highlights the complexity of the associated signaling pathways MiR-135 is reported to be downregulated in AD and ALS but upregulated in PD and HD while increasing the vulnerability to autism These findings suggest distinctive modes of regulation of this miRNA potentially involving RNA-binding proteins MiR-135 not only acts as a diagnostic marker for several neurodegenerative diseases but also serves as a target for various drugs Our enrichment analysis using the targets of miR-135 suggests that this miRNA participates in several signaling pathways such as the cGMP-PKG pathway and thyroid hormone signaling providing new insights into the mechanistic action of miR-135 Although the enriched signaling pathways have not yet been thoroughly assessed in neurological diseases this warrants further investigation for the therapeutic development of miR-135-based modalities The widespread role and involvement of miR-135 in various brain-associated diseases and its interaction with other signaling pathways highlight its significant clinical relevance for the development of therapeutic strategies aimed at ameliorating brain tumors and neurological diseases All data generated or analyzed during this study are included in this published article The role of MicroRNAs in biological processes Risk factors for childhood and adult primary brain tumors Neurodevelopmental and neurobehavioral disorders N6-methyladenosine marks primary microRNAs for processing Processing of primary microRNAs by the microprocessor complex TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing ATP-dependent human RISC assembly pathways Regulatory mechanism of MicroRNA expression in cancer Oncogenic role of microRNA-532-5p in human colorectal cancer via targeting of the 5’UTR of RUNX3 MicroRNA miR-324-3p induces promoter-mediated expression of RelA gene A search for conserved sequences in coding regions reveals that the let-7 microRNA targets Dicer within its coding sequence Human argonaute 2 has diverse reaction pathways on target RNAs AU-rich-element-mediated upregulation of translation by FXR1 and argonaute 2 Regulatory mechanisms of miR-145 expression and the importance of its function in cancer metastasis The MITF/mir-579-3p regulatory axis dictates BRAF-mutated melanoma cell fate in response to MAPK inhibitors Characterization of a p53/miR-34a/CSF1R/STAT3 feedback loop in colorectal cancer Role of Sirtuin1-p53 regulatory axis in aging motility and invasion of gastric cancer cells miR-30c impedes glioblastoma cell proliferation and migration by targeting SOX9 FOXP1 and hsa-miR-181a-5p as prognostic markers in acute myeloid leukemia patients treated with intensive induction chemotherapy and autologous stem cell transplantation Epigenetic silencing of miR-200b is associated with cisplatin resistance in bladder cancer NF90 modulates processing of a subset of human pri-miRNAs Exosomal circSTRBP from cancer cells facilitates gastric cancer progression via regulating miR-1294/miR-593-3p/E2F2 axis A review on the importance of miRNA-135 in human diseases miR-135a regulates synaptic transmission and anxiety-like behavior in amygdala miR-135a-5p mediates memory and synaptic impairments via the Rock2/Adducin1 signaling pathway in a mouse model of Alzheimer’s disease CircRNA RSF1 regulated ox-LDL induced vascular endothelial cells proliferation apoptosis and inflammation through modulating miR-135b-5p/HDAC1 axis in atherosclerosis Abnormal expression of miR-135b-5p in bone tissue of patients with osteoporosis and its role and mechanism in osteoporosis progression miR-135a alleviates silica-induced pulmonary fibrosis by targeting NF-κB/inflammatory signaling pathway Tumor-suppressive miRNA-135a inhibits breast cancer cell proliferation by targeting ELK1 and ELK3 oncogenes Effects of microRNA-135a on the epithelial-mesenchymal transition migration and invasion of bladder cancer cells by targeting GSK3β through the Wnt/β-catenin signaling pathway MiR-135b is a direct PAX6 target and specifies human neuroectoderm by inhibiting TGF-β/BMP signaling DAVID: a web server for functional enrichment analysis and functional annotation of gene lists (2021 update) miR-135a suppresses granulosa cell growth by targeting Tgfbr1 and Ccnd2 during folliculogenesis in mice Identification of miR-135b as a novel regulator of TGFβ pathway in gastric cancer Correction: miR-135b promotes cancer progression by targeting transforming growth factor beta receptor II (TGFBR2) in colorectal cancer Mir-135a enhances cellular proliferation through post-transcriptionally regulating PHLPP2 and FOXO1 in human bladder cancer MiR-135 post-transcriptionally regulates FOXO1 expression and promotes cell proliferation in human malignant melanoma cells Roles of thyroid hormone-associated microRNAs Affecting oxidative stress in human hepatocellular carcinoma Biological roles of microRNAs in the control of insulin secretion and action miR-135a targets IRS2 and regulates insulin signaling and glucose uptake in the diabetic gastrocnemius skeletal muscle MiR-135a-5p inhibits vascular smooth muscle cells proliferation and migration by inactivating FOXO1 and JAK2 signaling pathway MiR-135b-5p and MiR-499a-3p promote cell proliferation and migration in atherosclerosis by directly targeting MEF2C MicroRNA-135b promotes lung cancer metastasis by regulating multiple targets in the Hippo pathway and LZTS1 Immunotherapy for glioma: current management and future application The 2021 WHO classification of tumors of the central nervous system: a summary cIMPACT-NOW update 3: recommended diagnostic criteria for “Diffuse astrocytic glioma Glioblastoma multiforme: the latest diagnostics and treatment techniques A patient-derived glioblastoma organoid model and Biobank recapitulates inter- and intra-tumoral heterogeneity and imaging: what the radiologists need to know Intertumoral heterogeneity within medulloblastoma subgroups Cerebellum development and medulloblastoma Subtypes of medulloblastoma have distinct developmental origins Posterior fossa tumors in children: developmental anatomy and diagnostic imaging Patient-derived tumour xenografts as models for oncology drug development Mouse models of glioblastoma for the evaluation of novel therapeutic strategies Genetically engineered cerebral organoids model brain tumor formation Opportunities and challenges of glioma organoids Brain microRNAs and insights into biological functions and therapeutic potential of brain enriched miRNA-128 miR-30 overexpression promotes glioma stem cells by regulating Jak/STAT3 signaling pathway miRNA signature in glioblastoma: potential biomarkers and therapeutic targets miR-124 suppresses glioblastoma growth and potentiates chemosensitivity by inhibiting AURKA miR-3189-targeted GLUT3 repression by HDAC2 knockdown inhibits glioblastoma tumorigenesis through regulating glucose metabolism and proliferation MicroRNA-128 inhibits glioma cells proliferation by targeting transcription factor E2F3a Pro-neural miR-128 is a glioma tumor suppressor that targets mitogenic kinases Tumor-derived exosomes deliver the tumor suppressor miR-3591-3p to induce M2 macrophage polarization and promote glioma progression miR-135b suppresses tumorigenesis in glioblastoma stem-like cells impairing proliferation Antitumor effect of a new nano-vector with miRNA-135a on malignant glioma An integrated bioinformatics study of a novel niclosamide derivative a potential GSK3β/β-catenin/STAT3/CD44 suppressor with anti-glioblastoma properties miR-135a-5p functions as a glioma proliferation suppressor by targeting tumor necrosis factor receptor-associated factor 5 and predicts patients’ prognosis Long noncoding RNA GACAT3 promotes glioma progression by sponging miR-135a Identification of key microRNAs regulating ELOVL6 and glioblastoma tumorigenesis The roles of miRNAs in medulloblastoma: a systematic review Silencing of the miR-17~92 cluster family inhibits medulloblastoma progression The miR-17/92 polycistron is up-regulated in sonic hedgehog-driven medulloblastomas and induced by N-myc in sonic hedgehog-treated cerebellar neural precursors Epigenetic silencing of miRNA-9 is associated with HES1 oncogenic activity and poor prognosis of medulloblastoma miR-124 is frequently down-regulated in medulloblastoma and is a negative regulator of SLC16A1 MicroRNA-182 promotes leptomeningeal spread of non-sonic hedgehog-medulloblastoma MicroRNA 128a increases intracellular ROS level by targeting Bmi-1 and inhibits medulloblastoma cancer cell growth by promoting senescence Exosomal miR-101-3p and miR-423-5p inhibit medulloblastoma tumorigenesis through targeting FOXP4 and EZH2 Long noncoding RNA HOTAIR promotes medulloblastoma growth migration and invasion by sponging miR-1/miR-206 and targeting YY1 Prognostic value of miR-137 in children with medulloblastoma and its regulatory effect on tumor progression Downregulation of miR-326 and its host gene β-arrestin1 induces pro-survival activity of E2F1 and promotes medulloblastoma growth MiR-1253 exerts tumor-suppressive effects in medulloblastoma via inhibition of CDK6 and CD276 (B7-H3) Distinctive microRNA signature of medulloblastomas associated with the WNT signaling pathway Extracellular vesicle-associated miR-135b and -135a regulate stemness in Group 4 medulloblastoma cells by targeting angiomotin-like 2 miR-135a inhibits cancer stem cell-driven medulloblastoma development by directly repressing Arhgef6 expression Identification of microRNA signature in different pediatric brain tumors Transcriptomic analysis in pediatric spinal ependymoma reveals distinct molecular signatures microRNA network analysis identifies miR-29 cluster as key regulator of LAMA2 in ependymoma Aberrantly expressed microRNAs and their implications in childhood central nervous system tumors Identification of microRNAs as potential prognostic markers in ependymoma MicroRNA expression in pediatric intracranial ependymomas and their potential value for tumor grading Prognostic relevance of miR-124-3p and its target TP53INP1 in pediatric ependymoma mRNA and miRNA expression analyses of the MYC/E2F/miR-17-92 network in the most common pediatric brain tumors Investigation of miRNA and mRNA co-expression network in ependymoma Insights into the pathophysiology of Alzheimer’s disease and potential therapeutic targets: a current perspective Zeliger HI Alzheimer’s disease. In: Oxidative stress [Internet]. Elsevier; 2023 [cited 2024 May 11]. pp. 291–7. Available from: https://linkinghub.elsevier.com/retrieve/pii/B9780323918909000209 In silico analysis of green tea polyphenols as inhibitors of AChE and BChE enzymes in Alzheimer’s disease treatment Role of miRNAs in Alzheimer’s disease and possible fields of application Up-regulated pro-inflammatory MicroRNAs (miRNAs) in Alzheimer’s disease (AD) and age-related macular degeneration (AMD) MicroRNA profiling of CSF reveals potential biomarkers to detect Alzheimer’s disease potential biomarkers for Alzheimer׳s disease regulate β secretase and amyloid precursor protein and -384 were potential Alzheimer’s disease biomarkers The influence of age and gender on motor and non-motor features of early Parkinson’s disease: initial findings from the Oxford Parkinson Disease Center (OPDC) discovery cohort Basal ganglia circuits changes in Parkinson’s disease patients Role and dysregulation of miRNA in patients with Parkinson’s disease Dysregulated miRNAs as biomarkers and therapeutical targets in neurodegenerative diseases Long non-coding RNA MALAT1 regulates cell proliferation and apoptosis via miR-135b-5p/GPNMB axis in Parkinson’s disease cell model Involvement of microRNA-135a-5p in the protective effects of hydrogen sulfide against Parkinson’s disease miR-135b plays a neuroprotective role by targeting GSK3β in MPP+-intoxicated SH-SY5Y cells MicroRNA alterations in iPSC-derived dopaminergic neurons from Parkinson disease patients Brotman RG, Moreno-Escobar MC, Joseph J, Pawar G. Amyotrophic lateral sclerosis. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2024 [cited 2024 May 11]. Available from: http://www.ncbi.nlm.nih.gov/books/NBK556151/ Studies of genetic and proteomic risk factors of amyotrophic lateral sclerosis inspire biomarker development and gene therapy Amyotrophic lateral sclerosis: a clinical review Serum microRNAs in sporadic amyotrophic lateral sclerosis Micro-RNAs in ALS muscle: differences in gender Huntington’s disease: from molecular pathogenesis to clinical treatment Huntington disease: advances in the understanding of its mechanisms Somatic and gonadal mosaicism of the Huntington disease gene CAG repeat in brain and sperm Altered microRNA regulation in Huntington’s disease models The regulatory roles of microRNAs toward pathogenesis and treatments in Huntington’s disease MicroRNAs in CSF as prodromal biomarkers for Huntington disease in the PREDICT-HD study Altered microRNA expression in animal models of Huntington’s disease and potential therapeutic strategies A microRNA-based gene dysregulation pathway in Huntington’s disease The bifunctional microRNA miR-9/miR-9* regulates REST and CoREST and is downregulated in Huntington’s disease miRNAs as biomarkers of autism spectrum disorder: a systematic review and meta-analysis Interplay between maternal Slc6a4 mutation and prenatal stress: a possible mechanism for autistic behavior development Maternal immune activation alters brain microRNA expression in mouse offspring Noncoding RNAs: key molecules in understanding and treating pain Singh P, Singh M. MicroRNAs: the tiny robust players unraveling the multifaceted channels of pain. In: pain: causes, concerns and consequences [Internet]. BENTHAM SCIENCE PUBLISHERS; 2016 [cited 2024 May 11]. pp. 126–60. Available from: http://www.eurekaselect.com/node/146917 Improved targeting of miRNA with antisense oligonucleotides Tumor suppressor MicroRNAs in clinical and preclinical trials for neurological disorders MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Noncoding RNA therapeutics—challenges and potential solutions miR-Synth: a computational resource for the design of multi-site multi-target synthetic miRNAs Emerging roles of microRNAs in chronic pain Melatonin may suppress lung adenocarcinoma progression via regulation of the circular noncoding RNA hsa_circ_0017109/miR-135b-3p/TOX3 axis Morin inhibited lung cancer cells viability and migration by suppressing miR-135b and inducing its target CCNG2 Desflurane protects against liver ischemia/reperfusion injury via regulating miR-135b-5p MicroRNA 135 is essential for chronic stress resiliency miR-135a-5p inhibitor protects glial cells against apoptosis via targeting SIRT1 in epilepsy A novel 3D human glioblastoma cell culture system for modeling drug and radiation responses Glioblastoma and cerebral organoids: development and analysis of an in vitro model for glioblastoma migration Patient-derived glioblastoma organoids reflect tumor heterogeneity and treatment sensitivity Generation of glioblastoma patient-derived organoids and mouse brain orthotopic xenografts for drug screening Histological analysis of invasive glioblastoma organoids embedded in a 3D collagen matrix Biobanked glioblastoma patient-derived organoids as a precision medicine model to study inhibition of invasion Establishment of patient-derived organoid models of lower-grade glioma Modeling patient-derived glioblastoma with cerebral organoids Glioblastoma model using human cerebral organoids Modeling glioblastoma invasion using human brain organoids and single-cell transcriptomics Patient-derived organoids and orthotopic xenografts of primary and recurrent gliomas represent relevant patient avatars for precision oncology A human co-culture cell model incorporating microglia supports glioblastoma growth and migration Patient-derived organoids recapitulate glioma-intrinsic immune program and progenitor populations of glioblastoma NPI-0052 and γ-radiation induce a synergistic apoptotic effect in medulloblastoma Modeling medulloblastoma in vivo and with human cerebellar organoids Medulloblastoma and high-grade glioma organoids for drug screening MiR-7-5p is frequently downregulated in glioblastoma microvasculature and inhibits vascular endothelial cell proliferation by targeting RAF1 MicroRNA-7 regulates glioblastoma cell invasion via targeting focal adhesion kinase expression miR‑34a derived from mesenchymal stem cells stimulates senescence in glioma cells by inducing DNA damage MicroRNA-34a: a novel tumor suppressor in p53-mutant glioma cell line U251 MicroRNA miR-93 promotes tumor growth and angiogenesis by targeting integrin-β8 Inhibition of tumor progression and M2 microglial polarization by extracellular vesicle-mediated microRNA-124 in a 3D microfluidic glioblastoma microenvironment Downregulation of Pdcd4 by mir-21 facilitates glioblastoma proliferation in vivo MicroRNA-21 promotes glioblastoma tumorigenesis by down-regulating insulin-like growth factor-binding protein-3 (IGFBP3) Downregulation of Spry2 by miR-21 triggers malignancy in human gliomas MicroRNA-21 targets tumor suppressor genes ANP32A and SMARCA4 MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators Human glioma growth is controlled by microRNA-10b The myc-miR-17–92 axis blunts TGF{beta} signaling and production of multiple TGF{beta}-dependent antiangiogenic factors Prognostic and microRNA profile analysis for CD44 positive expression pediatric posterior fossa ependymoma MicroRNAs in Alzheimer’s disease: potential diagnostic markers and therapeutic targets MicroRNA dysregulation in parkinson’s disease: a narrative review miR-196a ameliorates phenotypes of Huntington disease in cell Correlating serum micrornas and clinical parameters in amyotrophic lateral sclerosis Disruption of skeletal muscle mitochondrial network genes and miRNAs in amyotrophic lateral sclerosis A miRNA signature in leukocytes from sporadic amyotrophic lateral sclerosis Differential expression of several miRNAs and the host genes AATK and DNM2 in leukocytes of sporadic ALS patients Disrupted microRNA expression caused by Mecp2 loss in a mouse model of Rett syndrome Download references Funding from the Science and Engineering Research Board (SB/SRS/2020-21/45/LS; WEA/2021-22/000007) These authors contributed equally: Sarika V Amity Institute of Molecular Medicine and Stem Cell Research The survey of the literature and the inferences were made by SVK The bioinformatics analysis was carried out by SVK The manuscript was drafted and finalized by SVK All authors have read and approved the final manuscript This declaration is “not applicable” since this manuscript is a review Download citation DOI: https://doi.org/10.1038/s41420-024-02283-x Metrics details The methyltransferase complex (MTC) deposits N6-adenosine (m6A) onto RNA whereas the microprocessor produces microRNA Whether and how these two distinct complexes cross-regulate each other has been poorly studied Here we report that the MTC subunit B tends to form insoluble condensates with poor activity with its level monitored by the 20S proteasome the microprocessor component SERRATE (SE) forms liquid-like condensates which in turn promote the solubility and stability of the MTC subunit B the hypomorphic lines expressing SE variants defective in MTC interaction or liquid-like phase behaviour MTC can recruit the microprocessor to the MIRNA loci prompting co-transcriptional cleavage of primary miRNA substrates primary miRNA substrates carrying m6A modifications at their single-stranded basal regions are enriched by m6A readers which retain the microprocessor in the nucleoplasm for continuing processing This reveals an unappreciated mechanism of phase separation in RNA modification and processing through MTC and microprocessor coordination Prices may be subject to local taxes which are calculated during checkout Biomolecular condensates at the nexus of cellular stress Phase transitions in the assembly of multivalent signalling proteins Mechanistic dissection of increased enzymatic rate in a phase-separated compartment Imaging dynamic and selective low-complexity domain interactions that control gene transcription Nucleated transcriptional condensates amplify gene expression Phase separation of SERRATE drives dicing body assembly and promotes miRNA processing in Arabidopsis Liquid phase condensation in cell physiology and disease Biomolecular condensates: organizers of cellular biochemistry A solid-state conceptualization of information transfer from gene to message to protein The contribution of the 20S proteasome to proteostasis How intrinsically disordered proteins order plant gene silencing Emerging roles for phase separation in plants Jozwiak, M., Bielewicz, D., Szweykowska-Kulinska, Z., Jarmolowski, A. & Bajczyk, M. SERRATE: a key factor in coordinated RNA processing in plants. Trends Plant Sci. https://doi.org/10.1016/j.tplants.2023.03.009 (2023) DEAD-box helicases modulate dicing body formation in Arabidopsis Intrinsically disordered proteins SAID1/2 condensate on SERRATE for dual inhibition of miRNA biogenesis in Arabidopsis Degradation of SERRATE via ubiquitin-independent 20S proteasome to survey RNA metabolism PRP4KA phosphorylates SERRATE for degradation via 20S proteasome to fine-tune miRNA production in Arabidopsis Dynamic assembly of the mRNA m6A methyltransferase complex is regulated by METTL3 phase separation A photoregulatory mechanism of the circadian clock in Arabidopsis m(6)A enhances the phase separation potential of mRNA Multivalent m(6)A motifs promote phase separation of YTHDF proteins mRNA adenosine methylase (MTA) deposits m(6)A on pri-miRNAs to modulate miRNA biogenesis in Arabidopsis thaliana HNRNPA2B1 is a mediator of m(6)A-dependent nuclear RNA processing events Hidden codes in mRNA: control of gene expression by m(6)A A comprehensive online database for exploring approximately 20,000 public Arabidopsis RNA-seq libraries Occurrence and functions of m(6)A and other covalent modifications in plant mRNA IUPred3: prediction of protein disorder enhanced with unambiguous experimental annotation and visualization of evolutionary conservation Highly accurate protein structure prediction with AlphaFold Evans, R. et al. Protein complex prediction with AlphaFold-Multimer. Preprint at bioRxivhttps://doi.org/10.1101/2021.10.04.463034 (2022) Structural basis of N(6)-adenosine methylation by the METTL3–METTL14 complex Liquid-to-solid phase transition of oskar ribonucleoprotein granules is essential for their function in Drosophila embryonic development Heat-shock chaperone HSPB1 regulates cytoplasmic TDP-43 phase separation and liquid-to-gel transition Mammalian oocytes store mRNAs in a mitochondria-associated membraneless compartment Anaphase-promoting complex/cyclosome regulates RdDM activity by degrading DMS3 in Arabidopsis Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq Arabidopsis RNA processing factor SERRATE regulates the transcription of intronless genes SWI2/SNF2 ATPase CHR2 remodels pri-miRNAs via SERRATE to impede miRNA production R-loops at microRNA encoding loci promote co-transcriptional processing of pri-miRNAs in plants SERRATE interacts with the nuclear exosome targeting (NEXT) complex to degrade primary miRNA precursors in Arabidopsis The YTH domain protein ECT2 is an m(6)A reader required for normal trichome branching in Arabidopsis The m(6)A reader ECT2 controls trichome morphology by affecting mRNA stability in Arabidopsis Principles of mRNA targeting via the Arabidopsis m(6)A-binding protein ECT2 Cellular handling of protein aggregates by disaggregation machines Cellular strategies for controlling protein aggregation mTOR regulates phase separation of PGL granules to modulate their autophagic degradation RNA recruitment switches the fate of protein condensates from autophagic degradation to accumulation A METTL3–METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method Post-transcriptional splicing of nascent RNA contributes to widespread intron retention in plants A comprehensive map of intron branchpoints and lariat RNAs in plants KETCH1 imports HYL1 to nucleus for miRNA biogenesis in Arabidopsis Identification and quantification of small RNAs Arabidopsis SERRATE coordinates histone methyltransferases ATXR5/6 and RNA processing factor RDR6 to regulate transposon expression In vitro reconstitution assays of Arabidopsis 20S proteasome Bidirectional processing of pri-miRNAs with branched terminal loops by Arabidopsis Dicer-like1 METTL16 exerts an m(6)A-independent function to facilitate translation and tumorigenesis Cryo-EM structures of human m(6)A writer complexes Download references This work was supported by grants from the National Institutes of Health (NIH GM127414) and National Science Foundation (NSF the NSF of Guangdong Province (2020B1515020007) 32170593) and the Guangdong Provincial Pearl River Talent Plan (2019QN01N108) to Z.Z. NSF (MCB 2139857) and the Welch Foundation (A-2177-20230405) to X.Z Guangdong Provincial Key Laboratory of Biotechnology for Plant Development School of Biological Sciences and Center for Plant Science Innovation conceived the project and designed the experiments independently discovered the project of SE–MTB interaction generated genetic materials and plasmids and participated in confocal microscope analysis generated MTA and MTB antibodies and validated partial results created lines of Flag-tagged conjugated MTA and MTB overexpression transgenic plants and native promoter-driven GFP-tagged MTB provided intellectual and experimental support thoroughly edited the paper and all authors contributed to the proofreading Nature Cell Biology thanks Jungnam Cho, Monika Chodasiewicz, and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Peer reviewer reports are available Pan RNA-seq network analysis showed synchronous expression association of microprocessor components and m6A writers over all samples (a) Spearman (or Pearson) correlation analysis was conducted to assess the expression relationship using over 1,000 RNA-seq data from various wild-type plant tissues The house keeping gene ACTIN1 (AT2G37620) serves as a control Each point in (a) represents expression levels of two indicated genes shown in log10(FPKM) in individual RNA-seq datasets Source data The sequence alignment of the artificial miRNAs (in red) with their target sequences (in blue) Be noted: two independent artificial-miRNA lines for MTB and FIP37 were generated and validated One elite line for each was used for further studies RT-qPCR assays showed that the amount of MTA MTB and FIP37 transcripts was largely reduced in knockdown lines of mta (b) one-way ANOVA analysis with Dunnett’s multiple comparisons test p values for relative expression of MTA at the se-2 p values for relative expression of MTB at the se-2 and mtb vs Col-0 are 0.98 and 0.0013 p values for relative expression of FIP37 at the se-2 and fip37 vs Col-0 are 0.99 and 0.0010 Western blots showed the reduced MTA (e) and MTB (f) proteins in their amiR-KD lines Endogenous proteins were detected by indicated antibodies and fip37 displayed developmental defects in seedlings The photos were taken of 10-day-old seedlings Y2H screening showed that neither DCL1 nor HYL1 directly interact with m6A writers LCI assays in Nicotiana Benthamiana demonstrated that both MTB and FIP37 can mediate the interaction between MTA and SE Co-IP assays validated the interaction between SE and MTC in plants Proteins were extracted from transgenic plants of p35S::Flag-MTA (j) and p35S::Flag-4xMyc-FIP37 (l) transgenic plants Lysates were then supplied with or without 50 μg/mL of RNase A prior to IP with an anti-FLAG antibody SE was detected via a specific anti-SE antibody BiFC assays validated the interactions between SE and MTC in Arabidopsis mesophyll protoplast At least three independent experiments were performed (e ten transgenic plants exhibited were photographed (g) ten independent colonies (h) and ten independent protoplasts for each interaction were tested (m) HPLC-MS quantification of m6A/A levels of commercial m6A (+) and m6A (–) spike-ins the purified poly(A) + RNA was mixed with internal controls containing m6A modified (red) and unmodified (yellow) spike-ins The resulting fragments were immunoprecipitated using a specific anti-m6A antibody Parallel IPs using an anti-GFP antibody were performed as negative controls The IP-ed RNAs were then processed for library construction and high-throughput sequencing enabling the identification and quantification of m6A modifications at a transcriptome-wide level Autography images of input and m6A RNA enriched by indicated antibodies in (b) One tenth of the input and all of immunoprecipitated RNA were de-phosphorylated and then labelled with P32-ATP before resolvement in 8% urea gels The motif sequences for m6A modifications in the context Computational simulation via IUPred3 (a – c) and AlphaFold2 (d – f) showed disorder regions of animal (a a window size of 30 consecutive residues was used The predicted disordered and ordered regions are presented in red and blue The left y-axis represents the tendency score while the x-axis represents positions of amino acids including a human-MTC mimicking structure of MTA-MTB (g) and an IDR-coupled folding model of SE-MTB (h) Both models were predicted via the multimer module of AlphaFold2 The different entities are color-coded as indicated the N-terminal IDR of MTB wrapped around the C-terminal IDR of SE to create a pivotal interaction interface which served as the nexus of the MTB-SE assembly which was further stabilized by the N-terminal IDR of SE clasping MTB the MTase domain of MTB and the zinc finger domain of SE maintained a functionally active conformation like that of MTC or the monomer Sequence alignment of C-terminal of SE and its homologs across different species showed that R718 is conserved through plants Predicted seven donors of hydrogen bonds in the SE-MTB interaction were highlighted in dashed boxes Coomassie Brilliant Blue (CBB) staining of purified recombinant proteins for in vitro assays in SDS–PAGE gels In vitro droplet formation of 3 μM purified mCherry-SE Recombinant MTB protein formed aggregates when dialyzed from high salt solution (800 mM) into a low salt (150 mM) solution In vitro assays with 3 μM MTA-CFP indicated that the presence of the crowder 5% Ficoll resulted in insoluble condensates resistant to 10% 1,6-HD In vitro condensate formation assays indicated that the removal of the fluorescent tag had no impact on the phase behavior of either MTA or MTB Confocal images shows no co-condensates formed by LCDFUS and MTB in vitro Confocal images showed co-condensation of MTA-CFP and YFP-MTB with or without 5% Ficoll Rendered 3D shapes of SE-MTB co-condensates Confocal images revealed that transiently expressed MTA-CFP and mCherry-SE in Arabidopsis mesophyll cells from Col-0 display liquid-like co-condensates rendered 3D modeling reveals that co-condensates exhibit a spherical shape fusion of co-condensates is presented with time-lapse live imaging FRAP assays and the recovery curve showed that MTC displays liquid-like phase behavior Confocal microscopic images showed the fluorescence of transiently expressed proteins in Arabidopsis mesophyll protoplast prepared from se-1 formed liquid-like co-condensates with MTA and MTB in protoplasts 2.5% 1,6-HD treatment was adopted 10 min prior before imaging which disrupted liquid-like condensates plant SE depleting N-terminal IDR; LCDFUS- SE∆IDR1 is a chimera protein of human FUS’s LCD and SE∆IDR1; FUSLCD At least three independent experiments were performed (a – h) at least eight independent protoplasts were tested (i – n) Two biological replicates of immunoblots with ten-day-old seedling detected a decreased ratio of soluble (supernatant) MTB in se-2 vs Col-0 where the amount was arbitrarily assigned a value of 1 Overexpression of MTA in Col-0 and se-1 could promote flowering time whereas overexpression of MTB could only do this in Col-0 MTB-interaction compromised or IDR-depleted SE variants could not complement the developmental defects of se-1 in which all potential hydrogen donors in C-terminal were mutated except R718; SE-R718A which has compromised interaction with MTB; SE∆IDR1 failed to form spherical co-condensates; LCDFUS-SE∆IDR1 a chimera protein of human FUS’s LCD fused with SE∆IDR1 exhibits a pattern analogous to wild-type SE at least 10 independent colonies and protoplasts for each interaction were tested (d at least ten transgenic plants showed similar phenotype (g small RNA RT-qPCR analysis of indicated miRNAs U6 and UBQ10 served as internal controls for normalization of miRNAs in (d) and pri-miRNAs in (f) p values for relative expression of miR156 at the sRNA-seq of mta; pABI3::MTA vs Col-0 are 0.15 p values for relative expression of miR158 p values for relative expression of genes at mta vs Col-0 are 0.0010 p values for relative expression of pri-miRNAs at mta vs Col-0 are 0.0017 MTA does not impact the transcription of MIR167a locus Both histochemical staining analysis (g) and RT-qPCR of GUS activity (h) showed comparable transcriptional levels of MIR167a in mta vs Col-0 RT-PCR analysis showed that the patterns of pri-miRNA alternative splicing are comparable in Col-0 and mta RNA-seq analysis showed that the transcript levels of microprocessor components are not decreased in mta vs Col-0 P values for relative expression of miRNA pathway genes at mta vs Col-0 are 0.018 The experiments were replicated three times and representative results are shown (i and j) ANOVA with Dunnett’s multiple comparison test two-way ANOVA with Tukey’s multiple comparison test p values for relative enrichment of A vs B Illustration and sequence of m6A (+) pri-miR166A used in the processing assay Bioinformatic analysis of multi-omics data (pan-transcriptome MeRIP-seq and sRNA-seq) and statistical analysis of protein degradation assays Lists of methylated pr-miRNAs and used oligos in this study Source numerical data and statistical source data a society or other partner) holds exclusive rights to this article under a publishing agreement with the author(s) or other rightsholder(s); author self-archiving of the accepted manuscript version of this article is solely governed by the terms of such publishing agreement and applicable law Download citation DOI: https://doi.org/10.1038/s41556-024-01530-8 Metrics details The ambiguity of etiology makes temporomandibular joint osteoarthritis (TMJOA) “difficult-to-treat” Emerging evidence underscores the therapeutic promise of exosomes in osteoarthritis management challenges such as low yields and insignificant efficacy of current exosome therapies necessitate significant advances Addressing lower strontium (Sr) levels in arthritic synovial microenvironment we studied the effect of Sr element on exosomes and miRNA selectively loading in synovial mesenchymal stem cells (SMSCs) we developed an optimized system that boosts the yield of SMSC-derived exosomes (SMSC-EXOs) and improves their miRNA profiles with an elevated proportion of beneficial miRNAs while reducing harmful ones by pretreating SMSCs with Sr Sr-pretreated SMSC-derived exosomes (Sr-SMSC-EXOs) demonstrated superior therapeutic efficacy by mitigating chondrocyte ferroptosis and reducing osteoclast-mediated joint pain in TMJOA Our results illustrate Alix’s crucial role in Sr-triggered miRNA loading identifying miR-143-3p as a key anti-TMJOA exosomal component this system is specifically oriented towards synovium-derived stem cells site-specific miRNA selectively loading in SMSC-EXOs proposes a promising therapeutic enhancement strategy for TMJOA optimizing the miRNA compositions within synovial mesenchymal stem cell-derived exosomes (SMSC-EXOs) could open new avenues to enhance their therapeutic efficacy the effect of Sr on driving miRNA sorting in SMSCs for OA or TMJOA remains unclearly we explore the utilization of the trace element strontium (Sr) to refine miRNA profiles within synovial mesenchymal stem cell-derived exosomes We propose that Sr interaction with the Alix protein plays a pivotal role in selectively enriching therapeutic miRNA profiles Our investigation reveals Alix’s role in Sr-triggered miRNA loading with miR-143-3p as a key exosomal component for anti-TMJOA effects thereby providing an insight into the site-specific miRNA selectively loading and offering a promising strategy for TMJOA therapy Strontium augmentation elevates the yield of SMSC-EXOs and improves miRNA profiles for effective osteoarthritis intervention a Schematic diagram of untreated SMSC-EXOs and Sr-SMSC-EXOs isolation process c number of particles were assessed by nanoparticle tracking analysis e Heatmap analysis of the top 50 significantly expressed miRNAs in the SMSC-EXOs and Sr-SMSC-EXOs g Volcano plot of the miRNAs in the SMSC-EXOs and Sr-SMSC-EXOs h Functional analysis of differentially expressed miRNAs between the SMSC-EXOs and Sr-SMSC-EXOs based on existing studies i The relationship between miRNAs with known function in arthritis and DE miRNAs j Quantitative RT-PCR analysis of the miRNA in the SMSC-EXOs and Sr-SMSC-EXOs The above data suggest that treatment with Sr not only significantly elevated the yield of SMSC-EXOs but also optimized the miRNA profile within these exosomes for effective OA intervention selectively increasing the level of therapeutic miRNAs while reducing the presence of potentially deleterious miRNAs Superior therapeutic performance of Sr-enhanced SMSC-EXOs in ameliorating TMJOA symptoms in rats OARSI scoring system showing the degradation in condylar cartilage and 3D reconstruction of the condyles and the ratio of bone volume to tissue volume (BV/TV) in subchondral bone Scale bar for Safranin-O/Fast green staining b Quantitative RT-PCR analysis of condylar chondrocytes 48 h after indicated treatment c Western blot analyses of the GPX4 and SLC7A11 in condylar chondrocytes 48 h after indicated treatment d Lipid peroxidation was determined using the BODIPY 716 581/591 C11 reagent in condylar chondrocytes 48 h after indicated treatment e Relative MDA measurement in condylar chondrocytes 48 h after indicated treatment f Immunofluorescence staining for MMP13 and GPX4 in condylar cartilage at 6 weeks g Measurement of the pain threshold value in TMJ region by Von Frey monofilaments testing ***P < 0.001; compared to TMJOA+SMSCs-EXOs group h Immunofluorescence staining for CGRP and TRAP staining in subchondral bone at 6 weeks These data imply that ferroptosis inhibition might be involved in the mechanism by which Sr-SMSC-EXOs achieve enhanced therapeutic efficacy for cartilage repair The above data indicate that Sr-SMSC-EXOs exhibit superior pain relief compared to SMSC-EXOs Necessity of Alix upregulation for Sr-triggered miRNA loading and exosome secretion a Quantitative RT-PCR and b western blot analyses of exosome formation related genes in SMSCs 48 h after indicated treatment c Size distribution and number of particles were assessed by nanoparticle tracking analysis f Heatmap analysis of screened miRNAs in the SMSC-EXOs and Sr-SMSC-EXOs g Functional analysis of screened in miRNAs between the SMSC-EXOs and Sr-SMSC-EXOs based on existing studies h The relationship between functionally known miRNAs and screened miRNAs i Quantitative RT-PCR analyses of the miRNA in the SMSC-EXOs j Quantitative RT-PCR analyses of the miRNA in the SMSC-EXOs and SiAlix-SMSC-EXOs k GO and KEGG pathway analyses of the target genes of screened miRNAs These data indicate that Sr exposure might drive SMSCs to load more beneficial and less harmful miRNA into EXOs which is at least partially explained by the Alix dependent miRNA loading These results suggest that Sr/Alix controlled miRNAs might be involved in chondrocytes ferroptosis the inflammatory microenvironment and subchondral bone remodeling Alix suppression negates Sr’s therapeutic efficacy in SMSC-EXOs for TMJOA management and immunofluorescence staining for GPX4 in condylar cartilage and 3D reconstruction of the condyles and BV/TV of subchondral bone post indicated treatment Scale bar for Safranin-O/Fast green staining and immunofluorescence staining b Lipid peroxidation was determined using the BODIPY 716 581/591 C11 reagent in condylar chondrocytes 48 h after indicated treatment c Relative MDA measurement in condylar chondrocytes 48 h after indicated treatment d Western blot analyses of the GPX4 and SLC7A11 in condylar chondrocytes 48 h after indicated treatment e Measurement of the pain threshold value in TMJ region by Von Frey monofilaments testing ***P < 0.001; compared to TMJOA+Sr-SMSC-EXOs group f Immunofluorescence staining for CGRP in subchondral bone g TRAP staining analyses in subchondral bone These data demonstrate the critical role of Alix in the enhanced pain relief offered by Sr-SMSC-EXOs Central role of miR-143-3p in Sr-SMSC-EXOs in enhancing TMJOA alleviation a Circular heatmap analysis of miR-143-3p expression abundance in the SMSC-EXOs b Schematic model of the time course for establishment of unilateral anterior crossbite (UAC) model of TMJOA mice with indicated treatment and pain test time and 3D reconstruction of the condyles and BV/TV in subchondral bone post indicated treatment d Relative MDA measurement in condylar chondrocytes 48 h after indicated treatment e Western blot analyses of the GPX4 and SLC7A11 in condylar chondrocytes 48 h after indicated treatment f Measurement of the pain threshold value in TMJ region by Von Frey monofilaments testing g Immunofluorescence staining for CGRP and TRAP staining in subchondral bone MiR-143-3p targets Mfsd8 to reduce the ferroptosis susceptibility of chondrocytes in TMJOA attenuating and 3D reconstruction of the condyles and BV/TV in subchondral bone b Measurement of the pain threshold value in TMJ region by Von Frey monofilaments testing c Immunofluorescence staining for CGRP and TRAP staining in subchondral bone d The structure of miR-143-3p and the miR-143-3p sequence and the predicted miR-143-3p target site in the 3′-UTR of Mfsd8 (upper) Schematic of the luciferase reporter plasmids with the WT or MUT Mfsd8 3′-UTRs (lower) f Relative luciferase activity in HEK293T cells transfected with the indicated luciferase reporter plasmids along with miR-143-3p mimics or inhibitors g Immunofluorescence staining for Mfsd8 in condylar cartilage k western blot analyses of the Mfsd8 in condylar chondrocytes 48 h after indicated treatment m Relative MDA measurement in condylar chondrocytes 48 h after indicated treatment n Western blot analyses of the GPX4 in condylar chondrocytes 48 h after indicated treatment These results demonstrate that miR-143-3p targets Mfsd8 in an inhibitory manner These data indicate that miR-143-3p reduced the susceptibility of chondrocytes to ferroptosis by targeting the Mfsd8 3′-UTR undergo Alix-mediated exosomal miRNA loading upon Sr exposure a Quantitative RT-PCR and western blot analyses of the Alix in MSCs 48 h after indicated treatment b Number of particles was assessed by nanoparticle tracking analysis c Quantitative RT-PCR analyses of the miR-143-3p in the SMSC-EXOs OARSI scoring system in condylar cartilage ***P < 0.001; compared to TMJOA + SMSC-EXOs group f Immunofluorescence staining for CGRP and TRAP staining in subchondral bone g Venn diagram of the differently expressed mRNAs between BMSCs and Sr-BMSCs h GO and KEGG pathway analyses of the target genes of the differently expressed mRNAs between SMSCs and Sr-SMSCs These data suggest that the effects of Sr on regulating exosome biogenesis vary with the source of the MSCs and confirm the importance of the synovium niche-derived MSCs in the strategy to increase Alix using Sr to enhance the effectiveness of MSC-EXOs in TMJOA The above data further reveal the unique alterations of transcriptome profiles in SMSCs and BMSCs after Sr exposure Schematic diagram shows a potential strategy utilizing a niche cell-guided work pattern to optimize the miRNA compositions in therapeutic SMSC-EXOs and boost the yield of the EXOs the abundance of miR-146a and miR-26a-5p decreased and miR-140-3p increased in Sr-SMSCs-EXOs novel-1(data not shown) and miR-143-3p as beneficial miRNA components for arthritis alleviation in vivo Sr not only boosted the secretion of SMSC-EXOs optimized the miRNA compositions in EXOs to include more beneficial and less harmful miRNAs partially via Alix These results confirmed the role of Sr in controlling exosomal miRNA loading and partially revealed the Alix-mediated mechanism in arthritis our data also revealed that synovium niche-derived MSCs undergo Alix-mediated exosomal miRNA sorting upon Sr exposure Transcriptome analysis showed that the DE genes of SMSCs upon Sr exposure were involved in EXOs biogenesis and chondrocyte metabolism but those of BMSCs upon Sr exposure were not The entirely different manners in which miR-143-3p responded to Sr in the present study might be attributed to the different source and type of the MSCs used The above data thus provide a hint concerning the ‘niche cell-guided’ work pattern of Sr in controlling exosomal miRNA loading There is still more work to be done to fully reveal the mechanism by which niche cells may guide the role of Sr in regulating exosome biogenesis whether miR-143-3p acts as upstream of Mfsd8 is not clear We showed that Mfsd8 was obviously upregulated in TMJOA damaged cartilage and this upregulation was reversed after AgomiR-143-3p treatment Knockdown of Mfsd8 significantly reversed the enhancement of ferroptosis by miR-143-3p inhibitors dual-luciferase reporter assay observed that miR-143-3p mimics retarded the activity of the WT reporter but not that of the mutant (MUT) reporter confirming that Mfsd8 is the direct target of miR-143-3p with a role in suppressing chondrocyte ferroptosis and ameliorating TMJOA this is the first study to report the biological significance of miR-143-3p in ameliorating TMJOA by directly targeting Mfsd8 to inhibit chondrocyte ferroptosis It suggests that miR-143-3p could be a novel target for attenuating TMJOA There are several recognized limitations to our study miRNAs are only one type of EXO cargo among many To have a more comprehensive understanding of the influence of Sr exposure on SMSC-EXOs more sequencing techniques and rigorous verification will be required to analyze different kinds of exosomal cargo so that the alteration of EXOs can be explained more deeply we have demonstrated that SMSC-EXOs and Sr-SMSC-EXOs alleviate cartilage injury by inhibiting chondrocyte ferroptosis and we observed that these EXOs inhibited abnormal remodeling of subchondral bone we have not yet fully revealed the specific mechanism by which SMSC-EXOs and Sr-SMSC-EXOs affect subchondral bone or whether there is crosstalk between cartilage and subchondral bone in this process This will be the subject of future investigations there is a great unmet medical need for a disease-modifying biological reagent to combat OA Although we have indicated the feasibility of using SMSCs EXOs to treat TMJOA this is just the first step toward the translation of our research into clinical use Future experiments should test the efficacy of SMSC-EXOs and Sr-SMSC-EXOs in TMJOA using large-animal models Further investigation of appropriate EXO dosage and administration will promote the clinical application of EXOs our results demonstrate that treatment of SMSCs with Sr not only significantly enhanced the yield of SMSC-derived exosomes but also optimized the miRNA profile within these exosomes Functional assays indicated that Sr-SMSC-EXOs were more effective in attenuating chondrocyte ferroptosis and osteoclast-mediated joint pain our data suggest a mechanistic underpinning for these effects highlighting the involvement of the Alix protein in Sr-induced miRNA loading These findings establish a direct correlation between Sr treatment site-specific SMSCs and therapeutic efficacy in the context of TMJOA weighing an average of 200 g) and C57BL/6 mice (8 weeks old weighing an average of 20 g) were purchased from Dossy Experimental Animal Limited Company (Chengdu All the animals were bred and maintained under specific-pathogen-free (SPF) conditions in a 12-/12-h light/dark cycle Animals were anaesthetized with pentobarbital sodium (100 mg/kg A previously established unilateral anterior crossbite (UAC) model was used to induce TMJOA China) were respectively bonded to the left maxillary and mandibular incisor the instrument was checked every other day and re-bonded in a timely manner if it was displaced Soft food was provided for the first three days after the operation and a standard diet was resumed from the fourth day Animals were sacrificed according to the schematic diagram after different interventions for analyses All procedures were approved by the Ethics Committee of the West China School of Stomatology Sichuan University under document number WCHSIRB-D-2021-472 These modified miRNA agomir/antagomir exhibit high affinity to cell membranes and demonstrate increased stability and efficacy in vivo experiments To assess the effect of miR-143-3p antagomir on TMJOA animals were randomly allocated to four groups: negative control (NC) and TMJOA+Sr-SMSC-EXOs+miR-143-3p antagomir and TMJOA+Sr-SMSC-EXOs groups were administered a miR-143-3p antagomir negative control To assess the effect of miR-143-3p agomir on TMJOA animals were randomly allocated to three groups: NC Animals in the NC group and TMJOA group were applied with a miR-143-3p agomir negative control For experiments assessing the effect of SMSC-EXOs animals were randomly allocated to six groups: Sham Exosomes (10 μL EXOs suspension for every mouse articular cavity) or an equal volume of PBS were injected into the TMJ articular cavity Synovial mesenchymal stem cells (SMSCs) were isolated from synovial tissue of 6-week-old SD rats The cells were routinely cultured in high glucose DMEM medium (Gibco USA) supplemented with 10% fetal bovine serum (FBS; BioInd Israel) and 1% penicillin-streptomycin (Gibco USA) at 37 °C in a humidified incubator with 5% CO2 and 95% humidity single cell suspensions of primary cells were cloned using the limiting dilution method SMSCs from the same passage (passages 3-6) were used in each experiment cells were analyzed for the expression of cell surface markers by flow cytometric analysis For determining the multipotential differentiation capabilities of SMSCs cells were cultured in osteogenesis-inducing medium and chondrogenesis-inducing medium for 21 days They were then fixed and stained with ALP for osteocytes and Toluidine blue and Safranin-O for pellet culture chondrocytes SMSCs were cultured in high-glucose DMEM containing 10% exosome-free FBS (Gibco USA) or in high-glucose DMEM containing 10% exosome-free FBS and 100 nmol/L trontium chloride in an equal volume of PBS for 48 h to collect conditioned medium (CM) and purified from CM as previously described Exosomes were resuspended with 100 μL PBS and stored in a -80°C freezer until use The morphology of exosomes was observed under TEM (HITACHI H-7000FA The particle size distribution of exosomes was analyzed by NTA (Malvern Western blot was used to identify the protein expression levels fixed with 4% paraformaldehyde solution for 24 h and stored in 70% ethanol at 4 °C before further processing TMJs were decalcified using 0.5 mol/L EDTA for 2 months and sectioned to 5-μm thickness used for staining According to the manufacturers’ recommendations the sections were stained with Safranin-O/Fast green (Solarbio The morphology of the articular cartilage was observed using a microscope and the severity of the TMJOA-like phenotype was evaluated using the OARSI scoring system frozen sections or fixed chondrocytes were incubated at 4 °C overnight with primary antibodies against MMP13 (Abcam The secondary antibodies were used donkey anti-mouse Alexa Fluor 488/555/647 and donkey anti-rabbit Alexa Fluor 488/555/647 (Thermo Fisher Scientific) The nuclei were counterstained with DAPI (Sigma-Aldrich the images of the samples were observed through a Nikon A1 confocal microscope Sections were blinded and scored by two experienced researchers and the average scores were used in statistical analyses The Von Frey monofilaments testing (Stoelting 58011) is often used to measure pain experienced by animals The tip of a hard plastic filament was used to stimulate the test area of the animal and the animal’s reaction was observed to judge whether it evidenced a painful response to the stimulus The animals were kept calm before the pain threshold detection The midpoint of the line between the corner of the eye and the ear was used as the test area (‘temporomandibular zone’) The intensity of the stimulus (g) was recorded when the animal was observed to undergo a change from a calm state to a mouth-rubbing or grasping response Starting from the minimal filament intensity of the minimum filaments the test was repeated for three times at an interval of 30 seconds The average value was taken as the pain threshold of the temporomandibular zone Micro-CT scanning of TMJs was performed on μCT 80 system (filter Al 0.2 mm Switzerland) with a resolution of 10 μm to detect the changes in the subchondral bone Three-dimensional images were reconstructed by SCANCO Visualizer for morphological assessment Bone density was analyzed by SCANCO Evaluation including the ratio of bone volume to tissue volume (BV/TV) TMJ condylar cartilage was dissected from 2-week-old SD rats and then digested with 2.5 mg/mL collagenase type II (Gibco) for 2 h and 0.5 mg/mL collagenase type II overnight at 37 °C The primary condylar chondrocytes were resuspended and cultured in low glucose DMEM medium (Gibco) containing 10% FBS and 1% penicillin-streptomycin at 37 °C in a humidified incubator with 5% CO2 and 95% humidity we only use first-passage chondrocytes were used for experiments employing the in vitro chondrocyte model of OA Primary condylar chondrocytes were incubated with recombinant IL-1β (10 ng/mL mimics NC (50 nmol/L) or inhibitors NC (50 nmol/L) SMSCs were plated in 96-well plates at 3 500 cells per well in 100 μL of culture medium supplemented with 10 μL of CCK-8 reagent (MCE) and incubated at 37 °C for 2.5 h following indicated treatments The absorbance was measured at 450 nm using a microplate reader (Synergy H1; BioTek) SMSCs labeled with the EDU working fluid for 2.5 h The images were acquired with fluorescence microscopy the malonaldehyde (MDA) level and glutathione (GSH) level of primary condylar chondrocytes were determined with a Lipid Peroxidation MDA Kit (Beyotime S0131) and GSH and GSSG Assay Kit (Beyotime S0053) according to the manufacturers’ protocols primary condylar chondrocytes were incubated with 5 µmol/L of BODIPY581/591 C11 (Invitrogen trypsinized and filtered into single cell suspensions Flow cytometry analysis (Becton Dickinson) was performed using the FITC filter for oxidized BODIPY-C11 (emission: 510 nm) and PE-TexasRed filter for reduced BODIPY-C11 (emission: 590 nm) About 20 000 cells were analyzed for each sample FlowJo v10 (BD Bioscience) was used for data analysis primary condylar chondrocytes were stained with DCFH-DA (Beyotime S0033) to measure ROS and assayed by fluorescence microscopy (Ts2R/FL; Nikon) Fixed chondrocytes were stained with 0.1 µg/mL Nile Red (MCE and the nuclei were counterstained using DAPI (Sigma) Images were captured with a Nikon A1 confocal microscope and analyzed with ImageJ software Primary condylar chondrocytes or exosomes lysates were extracted using RIPA lysis buffer (Beyotime The protein concentration of the samples was detected using a BCA protein assay kit (Beyotime The samples were heated at 100 °C for 5 min in sample buffer and transferred to PVDF membranes (Bio-Rad) The membranes were blotted with 5% BSA and incubated with primary antibody at 4 °C overnight The membranes were washed in TBST solution and incubated with the secondary antibodies The antibody-antigen complexes were visualized with Immobilon reagents (Millipore The following primary antibodies were applied: GPX4 (Abcam siRNAs specific to Alix were designed with the coding sequences of Alix shown in Tab. S5 SMSCs were seeded into 6-wells plates and transfected with siRNA (100 nmol/L using Lipofectamine 3000 (Invitrogen) Non-silencing siRNA was used as a negative control Small-RNA sequencing and miRNA data analysis of the SMSC-EXOs and Si-Sr-SMSC-EXOs groups were conducted by Novogene (Beijing Small-RNA sequencing was performed in triplicate using three independent sets of RNA preparations DESeq analysis was used to identify differentially expressed miRNAs with a threshold of fold change ≥1.5 and P < 0.05 mRNA sequencing and mRNA data analysis of the BMSCs and Sr-SMSCs groups were conducted by Novogene (Beijing mRNA sequencing was performed in triplicate using three independent sets of RNA preparations DESeq analysis was used to identify differentially expressed mRNAs with a threshold of fold change ≥1.5 and P < 0.05 The consistency rate was defined as sequencing screened miRNAs with the same trend of change as reported in literature/sequencing screened miRNAs with known functions in literature The inconsistency rate was defined as sequencing screened miRNAs with the opposite trend of change as reported in literature/ sequencing screened miRNAs with known functions in literature The cells were harvested at 48 h after transfection and luciferase activities of different samples were measured using a dual-luciferase reporter assay (Promega The results were shown with relative luciferase activity (Firefly Luc/Renilla Luc) Bone marrow mesenchymal stem cells (BMSCs) were isolated from bone marrow tissue of 2-week-old mice The cells were routinely cultured in α-MEM medium (Gibco) supplemented with 10% fetal bovine serum (FBS; BioInd Israel) and 1% penicillin-streptomycin at 37 °C in a humidified incubator with 5% CO2 and 95% humidity single cell suspensions of primary cells were cloned with the limiting dilution method as previously described BMSCs from the same passage (passages 3-6) were used in each experiment BMSCs were cultured in high-glucose DMEM containing 10% exosome-free FBS (Gibco USA) or in α-MEM medium containing 10% exosome-free FBS and 100 nmol/L strontium chloride or equal volume of PBS for 48 h to collect conditioned medium (CM) Exosomes were resuspended with 100 μL PBS and stored in -80 °C freezer until use Data are presented as the mean ± standard error of at least three independent experiments Significance of differences between two treatment groups was evaluated using Student’s t test A Paired t test was used to determine the significance between the baseline and an endpoint within a group For multiple comparisons of continuous measures between groups when the variables were distributed normally one-way analysis of variance (ANOVA) was performed and Tukey’s post hoc test was applied to determine the statistical significance between groups When the variables were not distributed normally All statistical analyses were conducted using GraphPad Prism 8 P < 0.05 was considered statistically significant The data used and/or analyzed during the current study are contained within the manuscript Other data are available from the corresponding author on reasonable request Cell-free osteoarthritis treatment with sustained-release of chondrocyte-targeting exosomes from umbilical cord-derived mesenchymal stem cells to rejuvenate aging chondrocytes Small extracellular vesicles derived from human adipose-derived mesenchymal stromal cells cultured in a new chemically-defined contaminate-free media exhibit enhanced biological and therapeutic effects on human chondrocytes in vitro and in a mouse osteoarthritis model Exosomes from osteoarthritic fibroblast-like synoviocytes promote cartilage ferroptosis and damage via delivering microRNA-19b-3p to target SLC7A11 in osteoarthritis Exosome-mediated delivery of kartogenin for chondrogenesis of synovial fluid-derived mesenchymal stem cells and cartilage regeneration You, D. G. et al. Metabolically engineered stem cell-derived exosomes to regulate macrophage heterogeneity in rheumatoid arthritis. Sci. Adv. 7 https://doi.org/10.1126/sciadv.abe0083 (2021) MSC exosomes alleviate temporomandibular joint osteoarthritis by attenuating inflammation and restoring matrix homeostasis Divergent chondro/osteogenic transduction laws of fibrocartilage stem cell drive temporomandibular joint osteoarthritis in growing mice Exosomes derived from miR-140-5p-overexpressing human synovial mesenchymal stem cells enhance cartilage tissue regeneration and prevent osteoarthritis of the knee in a rat model Comparison of exosomes secreted by induced pluripotent stem cell-derived mesenchymal stem cells and synovial membrane-derived mesenchymal stem cells for the treatment of osteoarthritis MiR-671 ameliorates the progression of osteoarthritis in vitro and in vivo Decreased miR-214-3p activates NF-κB pathway and aggravates osteoarthritis progression The exosome-like vesicles from osteoarthritic chondrocyte enhanced mature IL-1β production of macrophages and aggravated synovitis in osteoarthritis Bone marrow stromal cells stimulated by strontium-substituted calcium silicate ceramics: release of exosomal miR-146a regulates osteogenesis and angiogenesis Reactive oxygen species-responsive dendritic cell-derived exosomes for rheumatoid arthritis Exosomes rewire the cartilage microenvironment in osteoarthritis: from intercellular communication to therapeutic strategies Chondrocyte-targeted microRNA delivery by engineered exosomes toward a cell-free osteoarthritis therapy Qin, H. et al. Silencing miR-146a-5p protects against injury-induced osteoarthritis in mice. Biomolecules 13 https://doi.org/10.3390/biom13010123 (2023) Notch signalling drives synovial fibroblast identity and arthritis pathology Distinct fibroblast subsets drive inflammation and damage in arthritis Song, J. E. et al. Role of synovial exosomes in osteoclast differentiation in inflammatory arthritis. Cells 10 https://doi.org/10.3390/cells10010120 (2021) Exosomes from IL-1β stimulated synovial fibroblasts induce osteoarthritic changes in articular chondrocytes Micro/nano-textured hierarchical titanium topography promotes exosome biogenesis and secretion to improve osseointegration Bioglass enhances the production of exosomes and improves their capability of promoting vascularization Exosomes secreted by macrophages upon copper ion stimulation can promote angiogenesis Resveratrol-selenium nanoparticles alleviate neuroinflammation and neurotoxicity in a rat model of Alzheimer’s disease by regulating Sirt1/miRNA-134/GSK3β expression The potential role of zinc oxide nanoparticles in microRNAs dysregulation in STZ-induced type 2 diabetes in rats Tarale, P. et al. Manganese exposure: Linking down-regulation of miRNA-7 and miRNA-433 with α-synuclein overexpression and risk of idiopathic Parkinson’s disease. Toxicol. In Vitro 46 https://doi.org/10.1016/j.tiv.2017.10.003 (2018) Trace metal composition of synovial fluid and blood serum of patients with rheumatoid arthritis Efficacy and safety of strontium ranelate in the treatment of knee osteoarthritis: results of a double-blind Strontium ranelate promotes chondrogenesis through inhibition of the Wnt/β-catenin pathway Clinically meaningful effect of strontium ranelate on symptoms in knee osteoarthritis: a responder analysis The effects of strontium ranelate on the risk of vertebral fracture in women with postmenopausal osteoporosis Spontaneous immunomodulation and regulation of angiogenesis and osteogenesis by Sr/Cu-borosilicate glass (BSG) bone cement to repair critical bone defects Strontium ranelate-laden near-infrared photothermal-inspired methylcellulose hydrogel for arthritis treatment Construction of Wogonin nanoparticle-containing strontium-doped nanoporous structure on titanium surface to promote osteoporosis fracture repair CLIC and membrane wound repair pathways enable pandemic norovirus entry and infection Alix is required for activity-dependent bulk endocytosis at brain synapses ALIX Regulates Tumor-Mediated Immunosuppression by Controlling EGFR Activity and PD-L1 Presentation ALIX increases protein content and protective function of iPSC-derived exosomes A pathogenic picornavirus acquires an envelope by hijacking cellular membranes The ESCRT machinery is recruited by the viral BFRF1 protein to the nucleus-associated membrane for the maturation of Epstein-Barr Virus Identification of microRNA‑363‑3p as an essential regulator of chondrocyte apoptosis in osteoarthritis by targeting NRF1 through the p53‑signaling pathway CircSPI1_005 ameliorates osteoarthritis by sponging miR-370-3p to regulate the expression of MAP3K9 D-mannose alleviates osteoarthritis progression by inhibiting chondrocyte ferroptosis in a HIF-2α-dependent manner Subchondral bone osteoclasts induce sensory innervation and osteoarthritis pain ALIX- and ESCRT-III-dependent sorting of tetraspanins to exosomes Syntenin-ALIX exosome biogenesis and budding into multivesicular bodies are controlled by ARF6 and PLD2 LAMP2A regulates the loading of proteins into exosomes Tumor-suppressive circRHOBTB3 is excreted out of cells via exosome to sustain colorectal cancer cell fitness HRS phosphorylation drives immunosuppressive exosome secretion and restricts CD8+ T-cell infiltration into tumors Mechanical strain determines the site-specific localization of inflammation and tissue damage in arthritis Cancer: a mirrored room between tumor bulk and tumor microenvironment Associations of exposure to multiple trace elements with the risk of goiter: A case-control study Strontium as a substitute for calcium in the process of transmitter release at the neuromuscular junction Mg2+ -mediated autophagy-dependent polarization of macrophages mediates the osteogenesis of bone marrow stromal stem cells by interfering with macrophage-derived exosomes containing miR-381 Lithium-containing biomaterials stimulate bone marrow stromal cell-derived exosomal miR-130a secretion to promote angiogenesis Dysregulation of both miR-140-3p and miR-140-5p in synovial fluid correlate with osteoarthritis severity Multi-pathway protective effects of microRNAs on human chondrocytes in an in vitro model of osteoarthritis Huang, Z. et al. MiR-26a-5p enhances cells proliferation, invasion, and apoptosis resistance of fibroblast-like synoviocytes in rheumatoid arthritis by regulating PTEN/PI3K/AKT pathway. Biosci. Rep. 39 https://doi.org/10.1042/BSR20182192 (2019) Utility of Select Plasma MicroRNA for Disease and Cardiovascular Risk Assessment in Patients with Rheumatoid Arthritis KRAS-MEK Signaling Controls Ago2 Sorting into Exosomes Liu, X.-M., Ma, L. & Schekman, R. Selective sorting of microRNAs into exosomes by phase-separated YBX1 condensates. Elife 10 https://doi.org/10.7554/eLife.71982 (2021) Syntenin-1 is a new component of tetraspanin-enriched microdomains: mechanisms and consequences of the interaction of syntenin-1 with CD63 Mutant p53 Drives Cancer Metastasis via RCP-Mediated Hsp90α Secretion UNC93B1 recruits syntenin-1 to dampen TLR7 signalling and prevent autoimmunity Heparanase activates the syndecan-syntenin-ALIX exosome pathway MicroRNA‑143‑3p contributes to the regulation of pain responses in collagen‑induced arthritis Balaskas, P. et al. MicroRNA Signatures in Cartilage Ageing and Osteoarthritis. Biomedicines 11 https://doi.org/10.3390/biomedicines11041189 (2023) miR-143-3p regulates cell proliferation and apoptosis by targeting IGF1R and IGFBP5 and regulating the Ras/p38 MAPK signaling pathway in rheumatoid arthritis Aberrant upregulation of the glycolytic enzyme PFKFB3 in CLN7 neuronal ceroid lipofuscinosis Glycerol kinase 5 confers gefitinib resistance through SREBP1/SCD1 signaling pathway Download references This research was supported by National Natural Science Foundation of China (Nos Sichuan Science and Technology Program (No.24ZDYF0099) and Research and Develop Program West China Hospital of Stomatology Sichuan University (RD-03-202101) to J.W Bridget Samuels for critical reading of the manuscript Qiang Guo from State Key Laboratory of Oral Diseases We thank Guang Yang and Yang Yang from experimental animal center of West China Hospital Sichuan University for technical support with animal breeding Jie Zhang from Histology and Imaging platform Sichuan University for technical support with microscopy State Key Laboratory of Oral Diseases & National Clinical Research Center for Oral Diseases & Department of Orthodontics Laboratory of Aging Research and Department of Geriatrics National Clinical Research Center for Geriatrics Fujian Key Laboratory of Oral Diseases & Fujian Provincial Engineering Research Center of Oral Biomaterial & Stomatological Key Lab of Fujian College and University Qinlanhui Zhang: Writing-review & editing Download citation DOI: https://doi.org/10.1038/s41368-024-00329-5 Metrics details MicroRNAs (miRNAs) play dual roles in acute lymphoblastic leukemia (ALL) as both tumor suppressors and oncogenes and miRNA expression profiles can be used for patient risk stratification Precise assessment of miRNA levels is crucial for understanding their role and function in gene regulation Quantitative real-time polymerase chain reaction (qPCR) is a reliable and cost-effective method for analyzing miRNA expression assuming that appropriate normalization to stable references is performed to ensure valid data we evaluated the stability of six commonly used miRNA references (5sRNA and miR-532-5p) across nine B-cell precursor (BCP) ALL cell lines 22 patient-derived xenograft (PDX) BCP ALL samples from different organ compartments of leukemia bearing mice and peripheral blood mononuclear cells (PBMCs) from six healthy donors We used four different algorithms (Normfinder and BestKeeper) to assess the most stably expressed reference across all samples we validated our data in an additional set of 13 PDX ALL samples and six healthy controls identifying miR-103a-3p and miR-532-5p as the most stable references for miRNA normalization in BCP ALL studies we demonstrated the critical importance of using a stable reference to accurately interpret miRNA data the choice of solid references is pivotal to allow data comparisons of studies analyzing the biology of ALL compartmentalization or searching for new therapeutical targets Patient sample characteristics of the identification cohort Spleen-derived ALL cells were subjected to multiplex ligation-dependent probe amplification characterizing the samples for frequently detected genetic alterations in ALL ALL: acute lymphoblastic leukemia; PDX: patient-derived xenograft; TTL: time to leukemia Strategy for selecting miRNA references Exclusion criteria included review articles studies on non-human samples or on pathogenic/non-BCP-ALL related diseases studies focusing on gender-associated miRNAs or tissue not affected by ALL manifestation studies published in languages other than English and studies in which no data concerning the use of miRNA references were included BCP ALL: B-cell precursor acute lymphoblastic leukemia; #number: reference in the corresponding article Expression of miRNA references in PDX ALL specimens and ALL cell lines of the identification cohort and 5sRNA were analyzed in previous-defined PDX ALL samples derived from spleen (n = 22) Kruskal–Wallis test was applied to test whether the median CT values of miRNA references vary amongst the ALL sample groups PDX: patient-derived xenograft; ALL: acute lymphoblastic leukemia; BM: bone marrow; CNS: central nervous system Stability of miRNA references in PDX ALL samples and ALL cell lines of the identification cohort Expression stability within the cohort samples was analyzed applying the Normfinder (A and B; A: samples clustered in 1 group; B: samples sorted in 4 groups according to spleen- For A-E: decreasing values indicate increasing stability F: ∆CT calculations based on CT[reference 1] – CT[reference 2]; mean CT values with min to max whiskers are shown PDX: patient-derived xenograft; ALL: acute lymphoblastic leukemia RefFinder on PDX ALL samples and ALL cell lines of the identification cohort Mean of ranking according to the Normfinder and ∆CT method applying the RefFinder algorithm Decreasing values indicate increasing stability Expression and stability of miRNA references in healthy controls of the identification cohort. (A) Expression of miRNA references are depicted as CT values. Expression stability within healthy controls was analyzed by applying the Normfinder (B), BestKeeper (C), ∆CT (D and E), or geNorm algorithm (F). For A-D and F, decreasing values indicate increasing stability. E: ∆CT calculations based on CT[reference 1] – CT[reference 2]; mean CT values with min to max whiskers are shown. RefFinder on healthy controls of the identification cohort (C) Stability values according to the Normfinder algorithm applying grouping (HCs and PDX) to the combined cohort BCP ALL: B-cell precursor acute lymphoblastic leukemia; PDX: patient-derived xenograft; HC: healthy control To validate miR-532-5p and miR-103a-3p as reliable references in BCP ALL studies we additionally analyzed 13 PDX ALL samples with viability exceeding 25% based on FSC/SSC and over 60% positivity for human CD19 and 7 CNS-derived ALL samples for validation (Supplementary Fig RefFinder on PDX ALL samples of the validation cohort RefFinder on healthy controls of the validation cohort Applying the RefFinder algorithm to the combined PDX ALL samples and HC specimens of the validation cohort identified miR-103a-3p as most stably expressed (Supplementary Fig some miRNA references are characterized by increased score variations in ALL samples compared to HCs (Supplementary Fig assessing intrinsic sample type differences by applying grouping to the Normfinder algorithm (ALL samples and HCs) still identified miR-103a-3p as the most stable reference in the combined cohort (Supplementary Fig Influence of miRNA reference on analyzed miR-181a-5p expression in BM PDX ALL specimens The expression of miR-181a-5p in PDX BM specimens as compared to HCs of the identification cohort was analyzed by normalizing the miRNA expression to miR-532-5p (A) Analysis of STD of miR-181a-5p expression dependent on miRNA reference used for data normalization in the identification cohort (E) MiRNA-181a-5p expression in relation to miR-103a-3p (F) and RNU6 (I) was assessed in BM-derived ALL cells compared to HCs of the validation cohort STD of miR-181a-5p expression in association with used reference in the validation cohort (J) BM: bone marrow; PDX: patient-derived xenograft; ALL: acute lymphoblastic leukemia; STD: standard deviation help identify the most stable references for accurate normalization After establishing the xenograft mouse model together with cells from nine individual BCP ALL cell lines (NALM-6 and HAL-01) and PBMCs derived from six human healthy donors were subjected to miRNA isolation and cDNA synthesis The expression levels of six standards (5sRNA and miR-532-5p) in all samples were analyzed by qPCR identifying miR-103a-3p and miR-532-5p as the most reliable references to be used in accurate qPCR normalization in miRNAs studies in BCP ALL xenografts NOD/SCID/huALL: non-obese diabetic/severe combined immunodeficiency/human acute lymphoblastic leukemia; BM: bone marrow; CNS: central nervous system; PBMC: peripheral blood mononuclear cell thus highlighting the importance of evaluating the expression stability of miRNA references before being used in miRNA studies Varying expression levels of frequently used miRNA references also differ between healthy and diseased tissues Although SNORD44 was identified as stably expressed in PBMCs derived from HCs in both the identification and validation cohort the stability of miR-103a-3p and miR-532-5p remained high when analyzed in combination with ALL specimens we recognize the potential bias due to the disproportionate sample sizes as the smaller HC cohort may be overshadowed by the larger ALL cohort potentially leading to an overrepresentation of stability scores from ALL specimens the increased ranking of miR-103a-3p was only observed in the identification cohort as reflected in Normfinder grouping results where RNU6 was identified as the most stable reference when intra-group variation was considered miR-103a-3p remained stable even upon Normfinder grouping which is further supported by the low variation in ranking scores in PDX ALL samples across both cohorts we also identified varying expression levels of frequently used miRNA references pointing to a diverse expression in ALL specimens of different organ compartments when applying grouping to the Normfinder algorithm to both the identification and validation cohort the stability of miR-103a-3p (in both cohorts) and miR-532-5p (in the identification cohort) was maintained high substantiating the reliability of using these miRNAs for data normalization in miRNA studies on ALL specimens GeNorm further strengthens these findings in both cohorts confirming miR-103a-3p in combination with miR-532-5p as most stable references in ALL specimens geNorm uses pairwise comparisons to assess gene stability across all samples identifying reference genes with minimal variation even across different experimental conditions or biological variability making this algorithm a robust method for selecting stable reference genes in heterogeneous cohorts miRNA expression data obtained from xenografts is likely applicable to patient samples The inability to analyze miRNA stability in a subtype-specific manner is a significant limitation as it prevents the identification of potential reference miRNAs that could be more suitable for specific ALL subtypes we provide the first study analyzing the stability of a variety of miRNA references in ALL cell lines and PDX specimens derived from different organ compartments and identifying miR-103a-3p and miR-532-5p as the most stably expressed reference miRNAs in BCP ALL models Since patient-derived material from different organ compartments is exceedingly rare and difficult to obtain our work with PDX ALL samples provides essential groundwork for future studies focusing on miRNAs as diagnostic or prognostic markers Given the significant differences in miRNA reference expression stability between ALL specimens and HCs and expressional variations between cohorts we suggest evaluating the stability of standards within the sample cohort to avoid introducing bias due to varying reference levels and HAL-01 were obtained from the German Collection of Microorganisms and Cell Cultures GmbH (DSMZ Cell lines were regularly tested for Mycoplasm contamination (MycoAlert® Mycoplasma Detection Kit Switzerland) and were authenticated by short-tandem repeat profiling (GenePrint® 10 System Cells were cultured in RPMI-1640 supplemented with 20% fetal calf serum and 1% penicillin/streptomycin (Thermo Fisher Scientific Leukemia loads in the different organ compartments were analyzed by flowcytometric stainings of cells using APC anti-human CD19 and PE anti-mouse CD45 antibodies (BD Biosciences and viability of cells was analyzed according to forward and side scatter (FSC/SSC) criteria using the BD® LSR II Flow Cytometer (BD Biosciences To analyze the expression of miRNA references and miR-181a-5p in peripheral blood mononuclear cells (PBMCs) of HCs we obtained buffy coats from anonymous blood healthy donors from the Institute of Clinical Transfusion Medicine and Immunogenetics Ulm Donors provided written informed consent to the blood being used for research purposes according to local regulations (Ethikkommission der Universtät Ulm) Total RNA was extracted using the Quick-RNA Miniprep Kit (Zymo Research and concentration was determined at 260 nm using the NanoDrop 2000 (ThermoFisher Scientific Reverse transcription of miRNAs was performed on 20 ng RNA using the miRCURY LNA RT Kit (Qiagen Germany) following the manufacturer’s instructions Expression levels of miRNAs were assessed by qPCR with the miRCURY LNA SYBR Green PCR Kit and the miRCURY LNA miRNA PCR Assay (Qiagen Netherlands) using primers for RNU6 (YP00203907) All data not provided in the manuscript and the supplementary information are available from the authors upon request Bartel, D. P. Metazoan MicroRNAs. Cell 173, 20–51. https://doi.org/10.1016/j.cell.2018.03.006 (2018) Kozomara, A. & Griffiths-Jones, S. miRBase: annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res. 42, D68-73. https://doi.org/10.1093/nar/gkt1181 (2014) Szczepanek, J. Role of microRNA dysregulation in childhood acute leukemias: Diagnostics, monitoring and therapeutics: A comprehensive review. World J. Clin. Oncol. 11, 348–369. https://doi.org/10.5306/wjco.v11.i6.348 (2020) Hunger, S. P. et al. Improved survival for children and adolescents with acute lymphoblastic leukemia between 1990 and 2005: a report from the children’s oncology group. J. Clin. Oncol. 30, 1663–1669. https://doi.org/10.1200/JCO.2011.37.8018 (2012) Salvaris, R. & Fedele, P. L. Targeted therapy in acute lymphoblastic leukaemia. J. Pers. Med. https://doi.org/10.3390/jpm11080715 (2021) Nguyen, K. et al. Factors influencing survival after relapse from acute lymphoblastic leukemia: a Children’s Oncology Group study. Leukemia 22, 2142–2150. https://doi.org/10.1038/leu.2008.251 (2008) Grobbelaar, C. & Ford, A. M. The role of MicroRNA in paediatric acute lymphoblastic leukaemia: Challenges for diagnosis and therapy. J. Oncol. 2019, 8941471. https://doi.org/10.1155/2019/8941471 (2019) Kubota, H. et al. RNA-seq-based miRNA signature as an independent predictor of relapse in pediatric B-cell acute lymphoblastic leukemia. Blood Adv. 8, 1258–1271. https://doi.org/10.1182/bloodadvances.2023011583 (2024) Boldrin, E. et al. MicroRNA-497/195 is tumor suppressive and cooperates with CDKN2A/B in pediatric acute lymphoblastic leukemia. Blood 138, 1953–1965. https://doi.org/10.1182/blood.2020007591 (2021) Scherr, M. et al. Differential expression of miR-17~92 identifies BCL2 as a therapeutic target in BCR-ABL-positive B-lineage acute lymphoblastic leukemia. Leukemia 28, 554–565. https://doi.org/10.1038/leu.2013.361 (2014) Git, A. et al. Systematic comparison of microarray profiling, real-time PCR, and next-generation sequencing technologies for measuring differential microRNA expression. RNA 16, 991–1006. https://doi.org/10.1261/rna.1947110 (2010) Sato, F., Tsuchiya, S., Terasawa, K. & Tsujimoto, G. Intra-platform repeatability and inter-platform comparability of microRNA microarray technology. PLoS One 4, e5540. https://doi.org/10.1371/journal.pone.0005540 (2009) Bustin, S. A. et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 55, 611–622. https://doi.org/10.1373/clinchem.2008.112797 (2009) Kyriakidis, I., Kyriakidis, K. & Tsezou, A. MicroRNAs and the diagnosis of childhood acute lymphoblastic leukemia: Systematic review, meta-analysis and re-analysis with novel small RNA-Seq tools. Cancers (Basel) https://doi.org/10.3390/cancers14163976 (2022) Meyer, L. H. & Debatin, K. M. Diversity of human leukemia xenograft mouse models: implications for disease biology. Cancer Res. 71, 7141–7144. https://doi.org/10.1158/0008-5472.CAN-11-1732 (2011) Meyer, L. H. et al. Early relapse in ALL is identified by time to leukemia in NOD/SCID mice and is characterized by a gene signature involving survival pathways. Cancer Cell 19, 206–217. https://doi.org/10.1016/j.ccr.2010.11.014 (2011) Munch, V. et al. Central nervous system involvement in acute lymphoblastic leukemia is mediated by vascular endothelial growth factor. Blood 130, 643–654. https://doi.org/10.1182/blood-2017-03-769315 (2017) Richter-Pechanska, P. et al. PDX models recapitulate the genetic and epigenetic landscape of pediatric T-cell leukemia. EMBO Mol. Med. https://doi.org/10.15252/emmm.201809443 (2018) Rokita, J. L. et al. Genomic profiling of childhood tumor patient-derived xenograft models to enable rational clinical trial design. Cell Rep. 29, 1675-1689 e1679. https://doi.org/10.1016/j.celrep.2019.09.071 (2019) Uzozie, A. C. et al. PDX models reflect the proteome landscape of pediatric acute lymphoblastic leukemia but divert in select pathways. J. Exp. Clin. Cancer Res. 40, 96. https://doi.org/10.1186/s13046-021-01835-8 (2021) Akbari Moqadam, F. et al. MicroRNA signature in BCR-ABL1-like and BCR-ABL1-positive childhood acute lymphoblastic leukemia: Similarities and dissimilarities. Leuk. Lymphoma 55, 1942–1945. https://doi.org/10.3109/10428194.2013.858813 (2014) Avigad, S. et al. miR expression profiling at diagnosis predicts relapse in pediatric precursor B-cell acute lymphoblastic leukemia. Genes Chromosomes Cancer 55, 328–339. https://doi.org/10.1002/gcc.22334 (2016) Egyed, B. et al. MicroRNA-181a as novel liquid biopsy marker of central nervous system involvement in pediatric acute lymphoblastic leukemia. J. Transl. Med. 18, 250. https://doi.org/10.1186/s12967-020-02415-8 (2020) Schotte, D. et al. Identification of new microRNA genes and aberrant microRNA profiles in childhood acute lymphoblastic leukemia. Leukemia 23, 313–322. https://doi.org/10.1038/leu.2008.286 (2009) Schotte, D. et al. MicroRNA characterize genetic diversity and drug resistance in pediatric acute lymphoblastic leukemia. Haematologica 96, 703–711. https://doi.org/10.3324/haematol.2010.026138 (2011) Vandesompele, J. et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. https://doi.org/10.1186/gb-2002-3-7-research0034 (2002) Silver, N., Best, S., Jiang, J. & Thein, S. L. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol. Biol. 7, 33. https://doi.org/10.1186/1471-2199-7-33 (2006) Liang, Y., Ridzon, D., Wong, L. & Chen, C. Characterization of microRNA expression profiles in normal human tissues. BMC Genomics 8, 166. https://doi.org/10.1186/1471-2164-8-166 (2007) Schwarzenbach, H., da Silva, A. M., Calin, G. & Pantel, K. Data normalization strategies for MicroRNA quantification. Clin. Chem. 61, 1333–1342. https://doi.org/10.1373/clinchem.2015.239459 (2015) Marabita, F. et al. Normalization of circulating microRNA expression data obtained by quantitative real-time RT-PCR. Brief. Bioinform. 17, 204–212. https://doi.org/10.1093/bib/bbv056 (2016) Peltier, H. J. & Latham, G. J. Normalization of microRNA expression levels in quantitative RT-PCR assays: identification of suitable reference RNA targets in normal and cancerous human solid tissues. RNA 14, 844–852. https://doi.org/10.1261/rna.939908 (2008) Mendiola-Soto, D. K. et al. MiRNAs in hematopoiesis and acute lymphoblastic leukemia. Int. J. Mol. Sci. https://doi.org/10.3390/ijms24065436 (2023) Altmeyer, L., Baumer, K. & Hall, D. Differentiation of five forensically relevant body fluids using a small set of microRNA markers. Electrophoresis https://doi.org/10.1002/elps.202400089 (2024) Endogenous controls for real-time quantitation of miRNA using TaqMan® MicroRNA assays Fang, Z. H. et al. miR-150 exerts antileukemia activity in vitro and in vivo through regulating genes in multiple pathways. Cell Death Dis. 7, e2371. https://doi.org/10.1038/cddis.2016.256 (2016) Liu, J. et al. Berberine promotes XIAP-mediated cells apoptosis by upregulation of miR-24-3p in acute lymphoblastic leukemia. Aging (Albany NY) 12, 3298–3311. https://doi.org/10.18632/aging.102813 (2020) Nishioka, C. et al. Downregulation of miR-217 correlates with resistance of Ph(+) leukemia cells to ABL tyrosine kinase inhibitors. Cancer Sci. 105, 297–307. https://doi.org/10.1111/cas.12339 (2014) Sun, X. et al. microRNA-155-5p initiates childhood acute lymphoblastic leukemia by regulating the IRF4/CDK6/CBL axis. Lab. Invest. 102, 411–421. https://doi.org/10.1038/s41374-021-00638-x (2022) Wang, W. et al. LncRNA CRNDE promotes the progression of B-cell precursor acute lymphoblastic leukemia by targeting the miR-345-5p/CREB axis. Mol. Cells 43, 718–727. https://doi.org/10.14348/molcells.2020.0065 (2020) Spagnuolo, M. et al. Transcriptional activation of the miR-17-92 cluster is involved in the growth-promoting effects of MYB in human Ph-positive leukemia cells. Haematologica 104, 82–92. https://doi.org/10.3324/haematol.2018.191213 (2019) Figueredo Dde, S., Gitai, D. L. & Andrade, T. G. Daily variations in the expression of miR-16 and miR-181a in human leukocytes. Blood Cells Mol. Dis. 54, 364–368. https://doi.org/10.1016/j.bcmd.2015.01.004 (2015) Liu, Y. et al. A systematic analysis of miRNA markers and classification algorithms for forensic body fluid identification. Brief Bioinform https://doi.org/10.1093/bib/bbaa324 (2021) Teruel-Montoya, R. et al. MicroRNA expression differences in human hematopoietic cell lineages enable regulated transgene expression. PLoS One 9, e102259. https://doi.org/10.1371/journal.pone.0102259 (2014) Wei, S. et al. Screening and evaluation of endogenous reference genes for miRNA expression analysis in forensic body fluid samples. Forensic Sci. Int. Genet 63, 102827. https://doi.org/10.1016/j.fsigen.2023.102827 (2023) Zhao, C. et al. The lncRNA MALAT1 participates in regulating coronary slow flow endothelial dysfunction through the miR-181b-5p-MEF2A-ET-1 axis. Vascul. Pharmacol. 138, 106841. https://doi.org/10.1016/j.vph.2021.106841 (2021) Fujimoto, S. et al. Optimal small-molecular reference RNA for RT-qPCR-based body fluid identification. Forensic Sci. Int. Genet. 37, 135–142. https://doi.org/10.1016/j.fsigen.2018.08.010 (2018) Bollati, V. et al. Microvesicle-associated microRNA expression is altered upon particulate matter exposure in healthy workers and in A549 cells. J. Appl. Toxicol. 35, 59–67. https://doi.org/10.1002/jat.2987 (2015) Khalyfa, A. et al. Effect on intermittent hypoxia on plasma exosomal micro RNA signature and endothelial function in healthy adults. Sleep 39, 2077–2090. https://doi.org/10.5665/sleep.6302 (2016) Veryaskina, Y. A. et al. Selection of reference genes for quantitative analysis of microRNA expression in three different types of cancer. PLoS One 17, e0254304. https://doi.org/10.1371/journal.pone.0254304 (2022) Xie, F., Xiao, P., Chen, D., Xu, L. & Zhang, B. miRDeepFinder: a miRNA analysis tool for deep sequencing of plant small RNAs. Plant Mol. Biol. https://doi.org/10.1007/s11103-012-9885-2 (2012) Donati, S., Ciuffi, S. & Brandi, M. L. Human circulating miRNAs real-time qRT-PCR-based analysis: An overview of endogenous reference genes used for data normalization. Int. J. Mol. Sci. https://doi.org/10.3390/ijms20184353 (2019) mir-16-5p as a suitable reference gene for normalization of quantitative real time PCR in acute lymphoblastic leukemia Shahid, S., Shahid, W., Shaheen, J., Akhtar, M. W. & Sadaf, S. Circulating miR-146a expression as a non-invasive predictive biomarker for acute lymphoblastic leukemia. Sci. Rep. 11, 22783. https://doi.org/10.1038/s41598-021-02257-4 (2021) Xue, Y. et al. A genetic variant in miR-100 is a protective factor of childhood acute lymphoblastic leukemia. Cancer Med. 8, 2553–2560. https://doi.org/10.1002/cam4.2082 (2019) Luna-Aguirre, C. M. et al. Circulating microRNA expression profile in B-cell acute lymphoblastic leukemia. Cancer Biomark. 15, 299–310. https://doi.org/10.3233/CBM-150465 (2015) Rzepiel, A. et al. Circulating microRNAs as minimal residual disease biomarkers in childhood acute lymphoblastic leukemia. J. Transl. Med. 17, 372. https://doi.org/10.1186/s12967-019-2114-x (2019) Kaddar, T. et al. Prognostic value of miR-16 expression in childhood acute lymphoblastic leukemia relationships to normal and malignant lymphocyte proliferation. Leuk. Res. 33, 1217–1223. https://doi.org/10.1016/j.leukres.2008.12.015 (2009) Lou, G. et al. Differential distribution of U6 (RNU6-1) expression in human carcinoma tissues demonstrates the requirement for caution in the internal control gene selection for microRNA quantification. Int. J. Mol. Med. 36, 1400–1408. https://doi.org/10.3892/ijmm.2015.2338 (2015) Allantaz, F. et al. Expression profiling of human immune cell subsets identifies miRNA-mRNA regulatory relationships correlated with cell type specific expression. PLoS One 7, e29979. https://doi.org/10.1371/journal.pone.0029979 (2012) Almeida, R. S. et al. MicroRNA expression profiles discriminate childhood T- from B-acute lymphoblastic leukemia. Hematol. Oncol. 37, 103–112. https://doi.org/10.1002/hon.2567 (2019) Fulci, V. et al. Characterization of B- and T-lineage acute lymphoblastic leukemia by integrated analysis of MicroRNA and mRNA expression profiles. Genes Chromosomes Cancer 48, 1069–1082. https://doi.org/10.1002/gcc.20709 (2009) Nair, R. A. et al. MicroRNA signatures in blood or bone marrow distinguish subtypes of pediatric acute lymphoblastic leukemia. Transl. Oncol. 13, 100800. https://doi.org/10.1016/j.tranon.2020.100800 (2020) Mase, M. et al. Selection of reference genes is critical for miRNA expression analysis in human cardiac tissue. A focus on atrial fibrillation. Sci. Rep. 7, 41127. https://doi.org/10.1038/srep41127 (2017) Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408. https://doi.org/10.1006/meth.2001.1262 (2001) Download references We thank Sevil Essig and Ulrike Formentini for excellent technical assistance Open Access funding enabled and organized by Projekt DEAL received funding from the “Bausteinprogramm” of Medical Faculty was funded by the International Graduate School in Molecular Medicine was funded by Kind-Philipp-Stiftung for pediatric oncological research Teresa Mack and Tommaso Gianferri have contributed equally to the work Meyer and Vera Muench have contributed equally to the work Department of Pediatrics and Adolescent Medicine International Graduate School in Molecular Medicine designed and conceptualized research and wrote the manuscript; and all authors read and approved the manuscript Download citation DOI: https://doi.org/10.1038/s41598-024-77733-8 Metrics details Micro RNAs (miRNAs) play a crucial role as regulators of various biological processes and have been implicated in the pathogenesis of mental disorders such as schizophrenia and bipolar disorders we investigate the expression patterns of miRNAs in the PsyCourse Study (n = 1786) contrasting three broad diagnostic groups: Psychotic (Schizophrenia-spectrum disorders) miRNA transcriptome-wide association study (TWAS) we identified multiple miRNAs unique to Psychotic and Affective groups as well as shared by both we performed integrative analysis to identify the target genes of the dysregulated miRNAs and elucidate their potential roles in psychosis Our findings reveal significant alterations of multiple miRNAs such as miR-584-3p and miR-99b-5p across the studied diagnostic groups highlighting their role as molecular correlates the miRNA TWAS analysis discovered previously known and novel genetically dysregulated miRNAs confirming the relevance in the etiology of the diagnostic groups novel factors and putative molecular mechanisms underlying these groups were uncovered through the integration of miRNA-target gene interactions This comprehensive investigation provides valuable insights into the molecular underpinnings of severe mental disorders shedding light on the complex regulatory networks involving miRNAs Diagnostic and statistical manual of mental disorders: DSM-5 D.C.: American Psychiatric Publishing; 2013 The misdiagnosis of bipolar disorder as a psychotic disorder: some of its causes and their influence on therapy Diagnostic conversion from unipolar depression to bipolar disorder or schizoaffective disorder: a nationwide prospective 15-year register study on 43 495 inpatients a 50-year assessment of diagnostic stability based on a national case registry A comparison of selected risk factors for unipolar depressive disorder and schizophrenia from a danish population-based cohort Genetic relationships between schizophrenia Cross-Disorder Group of the Psychiatric Genomics Consortium Identification of risk loci with shared effects on five major psychiatric disorders: a genome-wide analysis The genetics of psychotic bipolar disorder Twin studies for the investigation of the relationships between genetic factors and brain abnormalities in bipolar disorder Schizophrenia as a complex trait: evidence from a meta-analysis of twin studies Genome-wide association study of more than 40,000 bipolar disorder cases provides new insights into the underlying biology The Schizophrenia Working Group of the Psychiatric Genomics Consortium, Ripke S, Walters JT, O’Donovan MC. Mapping genomic loci prioritises genes and implicates synaptic biology in schizophrenia. Genetic Genomic Med. 2020. https://doi.org/10.1101/2020.09.12.20192922 The immune system and psychiatric disease: a basic science perspective First episode psychosis and schizophrenia are systemic neuro-immune disorders triggered by a biotic stimulus in individuals with reduced immune regulation and neuroprotection MicroRNAs and pro-inflammatory cytokines as candidate biomarkers for recent-onset psychosis Inflammatory proteins and miRNA-144-5p in patients with depression or stress- and adjustment disorders after psychological treatment Schizophrenia is associated with an increase in cortical microRNA biogenesis regulates the expression of genes functioning in neuronal glutamatergic synapses Baseline levels of miR-223-3p correlate with the effectiveness of electroconvulsive therapy in patients with major depression MiRNA differences related to treatment-resistant schizophrenia Kaurani L, Islam MR, Heilbronner U, Krüger DM, Zhou J, Methi A, et al. Regulation of Zbp1 by miR-99b-5p in microglia controls the development of schizophrenia-like symptoms in mice. EMBO J. 2024. https://doi.org/10.1038/s44318-024-00067-8 Integrative approaches for large-scale transcriptome-wide association studies The genotype-tissue expression (GTEx) project PolymiRTS Database 3.0: linking polymorphisms in microRNAs and their target sites with human diseases and biological pathways Association study of MiRSNPs with schizophrenia A longitudinal approach to biological psychiatric research: The PsyCourse study miRTrace reveals the organismal origins of microRNA sequencing data Chaumette T, Cinotti R, Mollé A, Solomon P, Castain L, Fourgeux C, et al. Monocyte signature associated with herpes simplex virus reactivation and neurological recovery after brain injury. Am J Respir Crit Care Med. 2022. https://doi.org/10.1164/rccm.202110-2324OC CommonMind consortium provides transcriptomic and epigenomic data for schizophrenia and bipolar disorder cell specific microRNA catalogue of human peripheral blood Massively parallel sequencing of microRNA in bloodstains and evaluation of environmental influences on miRNA candidates using realtime polymerase chain reaction Age-associated microRNA expression in human peripheral blood is associated with all-cause mortality and age-related traits Screening of schizophrenia associated miRNAs and the regulation of miR-320a-3p on integrin β1 Schizophrenia risk mediated by microRNA target genes overlapped by genome-wide rare copy number variation in 22q11.2 deletion syndrome The global assessment scale: a procedure for measuring overall severity of psychiatric disturbance Imprinted DLK1-DIO3 region of 14q32 defines a schizophrenia-associated miRNA signature in peripheral blood mononuclear cells HMDD v3.0: a database for experimentally supported human microRNA–disease associations miR2Disease: a manually curated database for microRNA deregulation in human disease Research progress of miRNA in different depression model samples MicroRNA and posttranscriptional dysregulation in psychiatry Systematic review and bioinformatic analysis of microRNA expression in autism spectrum disorder identifies pathways associated with cancer Assessing the impact of copy number variants on miRNA genes in autism by monte carlo simulation Insights on the functional impact of microRNAs present in autism-associated copy number variants MicroRNA-seq data analysis pipeline to identify blood biomarkers for Alzheimer’s disease from public data MicroRNA alterations in induced pluripotent stem cell-derived neurons from bipolar disorder patients: pathways involved in neuronal differentiation miR-936 is increased in schizophrenia and inhibits neural development and AMPA receptor-mediated synaptic transmission MicroRNA profiling of neurons generated using induced pluripotent stem cells derived from patients with schizophrenia and schizoaffective disorder Understanding pharmaco-epigenomic response of antipsychotic drugs using genome-wide microRNA expression profile in liver cell line Multilayer feedforward networks are universal approximators Weighted kappa: nominal scale agreement provision for scaled disagreement or partial credit A coefficient of agreement for nominal scales Altered expression of microRNA-223 in the plasma of patients with first-episode schizophrenia and its possible relation to neuronal migration-related genes Failure of neuronal homeostasis results in common neuropsychiatric phenotypes Role of astrocytes in major neuropsychiatric disorders Structural abnormality in schizophrenia versus bipolar disorder: a whole brain cortical thickness Molecular mechanisms of bipolar disorder: progress made and future challenges Impaired endoplasmic reticulum stress response in bipolar disorder: cellular evidence of illness progression DST studies in psychotic depression: a meta-analysis Cortisol and the dexamethasone suppression test as a biomarker for melancholic depression: a narrative review a new candidate gene for schizophrenia involved in myelination QKI-7 regulates expression of interferon-related genes in human astrocyte glioma cells Download references This work was endorsed by German Center for Mental Health (DZPG; to PF and TGS Urs Heilbronner was supported by European Union’s Horizon 2020 Research and Innovation Programme (PSY-PGx grant agreement No 945151) and the Deutsche Forschungsgemeinschaft (DFG FS was supported by the GoBIO project miRassay from the BMBF The Genotype-Tissue Expression Project was supported by the Common Fund of the Office of the Director of the National Institutes of Health and Vogl Thomas are part of the PsyCourse core team and Zimmermann Jörg represent the clinical centers involved in the recruitment and samples collection of the PsyCourse study We would like to express our profond gratitude to all study participants without whom this work would not have been possible Present address: Department of Psychiatry and Psychotherapy These authors contributed equally: Pierre Solomon These authors jointly supervised this work: André Fischer Center for Research in Transplantation and Translational Immunology Department for Systems Medicine and Epigenetics German Center for Neurodegenerative Diseases (DZNE) Institute of Psychiatric Phenomics and Genomics (IPPG) University Hospital of Psychiatry and Psychotherapy Ahvaz Jundishapur University of Medical Sciences School of Medicine & University Hospital Bonn Department of Psychiatry and Psychotherapy Faculty of Medicine and University Hospital Bonn Florey Institute of Neuroscience and Mental Health European Medical School Oldenburg-Groningen University Medical Center Hamburg-Eppendorf Division of Psychiatry and Psychotherapeutic Medicine Research Unit for Bipolar Affective Disorder Department of Psychosomatic Medicine and Psychotherapy German Center for Neurodegenerative Disease (DZNE) Research Group for Genome Dynamics in Brain Diseases German Center for Neurodegenerative Diseases Anna-Lena Schütz & Farahnaz Sananbenesi Department of Psychiatry and Behavioral Sciences Johns Hopkins University School of Medicine Cluster of Excellence “Multiscale Bioimaging: from Molecular Machines to Networks of Excitable Cells” (MBExC) and JZ contributed to acquisition and/or processing and/or managing of data (phenotype data and/or biological data) LK and UH coordinated the RNA isolation and small-RNA-seq of the entire PsyCourse samples with the help of SB and ALS DMK and TP contributed to the sequencing design and performed QC analysis FS (Farahnaz Sananbenesi) and AF planned the sequencing experiments AS supervised JBG and contributed to manuscript editing SP carried out the quality control of the genotyping and imputation PS performed bioinformatics analysis including alignment JP oversaw the bioinformatics analysis and validation experiments and JBG wrote the article with contribution from SB All authors contributed to revising and approving the final version of the manuscript Two co-authors provide the following financial interest and personal relationships which may be considered as potential competing interests: JW that organized the PsyCourse recruitment at the Göttingen university medical center receives consulting fees from Immungenetics Roche; received payment for lectures from Beeijing Yibai Science and Technology Ltd. Lilly and holds patents PCT/EP 2011 001724 and PCT/EP 2015 052945 PF has been EPA president in 2022 and is a co-editor of the German (DGPPN) schizophrenia treatment guidelines and a co-author of the WFSBP schizophrenia treatment guidelines; he is on the advisory boards and receives speaker fees from Janssen The official period of data collection was from January 2012 through December 2019 The study protocol was approved by the respective ethics committee for each study center and was carried out following the rules of the Declaration of Helsinki All study participants provided written informed consent Download citation DOI: https://doi.org/10.1038/s41380-025-03018-9 Metrics details are rapidly emerging as important regulators in cell homeostasis as well as potential players in cellular degeneration The latter has led to interest in them as both biomarkers and as potential therapeutics are central nervous system cells of great interest yet their study is largely restricted to animals due to the difficulty in obtaining healthy human RGC Using a CRISPR/Cas9-based reporter embryonic stem cell line human RGC were generated and their miRNA profile characterized using NanoString miRNA assays We identified a variety of retinal specific miRNA upregulated in ESC-derived RGC with half of the most abundant miRNA also detectable in purified rat RGC Several miRNA were however identified to be unique to RGC from human The findings show which miRNA are abundant in RGC and the limited congruence with animal derived RGC These data could be used to understand miRNA’s role in RGC function as well as potential biomarkers or therapies in retinal diseases involving RGC degeneration Retinal ganglion cells (RGCs) are the projection neurons of the retina connecting the eye to the rest of the brain RGCs represent a significant research interest for several reasons with processing beginning in the retina and is itself a subject of intense scientific research a leading cause of irreversible blindness is the loss of RGCs and includes traumatic optic neuropathy and glaucoma RGC research allows a deeper understanding of the mechanisms of RGC death as well as the potential neuroprotective effects of candidate treatments RGCs are also arguably the most easily accessible central nervous system (CNS) neurons and understanding the intrinsic mechanisms behind axon regenerative failure could not only benefit victims of sight loss but also provide therapeutic strategies for those paralysed from spinal cord injury Here we demonstrate the substantial miRNA changes associated with human RGC differentiation All reagents were purchased from ThermoFisher unless otherwise specified five small molecules including Forskolin (#72114; StemCell Technologies) Dorsomorphin (#72102; StemCell Technologies) Inducer of definitive endoderm 2 (IDE2) (#72524; StemCell Technologies) and DAPT (D5942; Sigma) were added to hECS cultures Generated RGCs were purified from hESCs using mouse CD90.2 (Thy1.2) MicroBeads as per the manufacturer’s instructions (#130-121-278; Miltenyi Biotec cells were detached using accutase solution (# A6964; Sigma) and the cell pellet resuspended in 390 µl of 0.5% BSA solution RGCs were magnetically labelled with addition of 50 µl CD90.2 MicroBeads incubated for 15 min at RT and mixed gently every 5 min A 5 ml solution of 0.5% BSA was added to the mixture followed by centrifuging at 130 g for 5 min The cell pellet was resuspended in 400 µl 0.5% BSA by gentle pipetting Positive selection of CD90.2+ was performed by magnetic separation using MS columns (#130-042-201; Miltenyi Biotec) in the magnetic field of OctoMACS™ separator (#130-042-109; Miltenyi Biotec) The magnetic labelled RGC was collected using a plunger and addition of lysis buffer and then vortex at full speed for 30 s Total RNA was isolated using the Qiagen® miRNeasy® advanced micro kit (# 217684; Qiagen Germany) as per the manufacturer’s instructions The quality of RNA was assessed using an Agilent 2100 Bioanalyser (Agilent Technologies USA) and all samples had an RNA Integrity Number (RIN) value of 9.70–10 100 ng of input total RNA was profiled on a NanoString nCounter MAX platform using the Human v3 miRNA CodeSet kit (#150629; NanoSring USA) to directly measure miRNA expression levels unique oligonucleotide tags were annealed and then ligated with the miRNAs of interest through a target specific bridge oligo followed by hybridization of the specific target of interest to the Reporter CodeSet samples were hybridized on a Veriti™ Thermal Cycler (Applied Biosystems USA) for 20 h before being processed using the nCounter Prep Station followed by the nCounter Digital Analyser Data normalization was performed using nSolver Analysis Software v4.0 whereby data was normalized to housekeeping genes (B2M Since the assay has a minimum detection threshold for weakly expressed miRNA it was necessary to filter the normalized abundance values when comparisons between two groups are made miRNA with abundance values of below 25 (in both groups) were removed This applies to both the abundance measurements as well as the subsequent fold change heatmaps (whereby fold changes are presented as log2 fold change) Heatmaps further filtered out any average fold change that was not > 2 or < − 2 Confirmatory RT-qPCR was performed using TaqMan™ RT-qPCR reagents comparing ESC to RGC at 6 h (n = 3) RT for miRNA analysis in each sample extract was undertaken using the TaqMan™ high-capacity cDNA reverse transcription kit (4368813) Each reaction was prepared as a master mix containing 1.5 μL 10 × RT mix 1 μL Multiscribe™ reverse transcriptase and 4.25 μL molecular biology grade water in each sample 10 μL of this master mix was added to 0.1 mL microcentrifuge strips Following mixing and collection by centrifugation thermocycling was carried out at 4 °C for 5 min followed by 85 °C for 5 min and finally maintained at 4 °C Each cDNA sample was then diluted with 30 μL water to a final volume of 45 μL Each qCPR reaction contained 10 μL TaqMan™ master mix II (no UNG) Finally these samples were analysed in 96 well fast plates (4346907) using a Quantstudio 7 Flex qPCR System Having compared the Ct value of miRs to the references data was normalised to hsa-miR-93-5p as the least variable sequence and the data reported as relative expression using the 2^-ΔΔCt method While in culture, the CRISPR/Cas9 H7/H9 ESC remained relatively stable with few miRNA changes. A total of 83 miRNA were found to be expressed in ESC (above the noise threshold), 10 of which demonstrated at least a twofold change between two separate cultures (Fig. 1). Of these 10, miR-106a, -92a, and -424 were found to be statistically significant. miRNA abundance and fold change heat map profiles of human embryonic stem cells (ESCs) in culture (A,B) Histograms display the average (mean ± SEM; n = 3) abundance of miRNA in H7/H9 ESCs as determined by Nano String miRNA assay sorted in descending order (note Y axis change in panel B) RNA was isolated from ESCs cultured for 48 (blue) and 6 (red) hours to determine miRNA drift RNA abundances below 25 are excluded due to sensitivity limits of the assay (C,D) Heatmaps display the log2 fold change of miRNA from ESC 48 h in culture compared to those 6 h in culture (n = 3) miRNA were selected from panel A/B that have an average <  −2 (C) or > 2 (D) fold change ESC culture and differentiation images. (A) ESC plated in matrigel coated plate with a density of 5 × 10^5, the density for when differentiation began, imaged using brightfield microscopy (scale bar: 100 µm). (B) ESC-induced RGC fixed with 4% PFA, counterstained with DAPI, and imaged using confocal microscopy, showing BRN3B-tdTomato (RGC phenotypic marker; red; scale bar: 50 µm). Confirmatory RT-qPCR analysis of 2 miRNAs of differing expression changes (A) Ct values of all 4 miRs analysed and 2 comparators miR-204-5p and miR-302b-3p (B) Relative expression of miR-204-5p in ESC vs (C) Relative expression of miR-302b-3p in ESC vs Ingenuity pathway analysis of all miRNAs identified in this study relating these miRNA to their likely function miRNA abundance and fold change heat map profiles of human retinal ganglion cells (RGCs) in culture (A,B) Histograms display the average (mean ± SEM; n = 3) abundance of miRNA in ESC-derived RGCs as determined by Nano String miRNA assay RNA was isolated from RGCs cultured for 48 (blue) and 6 (red) hours to determine miRNA drift (C,D) Heatmaps display the log2 fold change of miRNA from RGCs 48 h in culture compared to those 6 h in culture (n = 3) The present study identified the miRNA expressed in human H7/H9 ESC as well as their changes when they are differentiated into RGC using well established techniques We looked at both abundance and log2 fold changes to understand the miRNA profile of these cells and thus build on this literature with a profile of human RGC yet served as useful positive control of both the stemness of our cells and is also found to be abundant in the present study It would be of great use to further explore the subtype profile of these RGC to determine if they belong to a distinct class of RGC or make up several expected subtypes the present study identifies the miRNA profile of both ESC and ESC-derived RGC ESC-derived RGCs appear to express a variety of miRNA identified to be important in retinal development and function Several of these miRNA have also been identified in purified rat RGC six miRNA appeared to be unique to the human RGC Further understanding of the biology of human RGC can be achieved by taking into consideration their unique miRNA signature additional raw IPA data is available on request from corresponding author Retinal Ganglion Cells: Methods and Protocols Vol Osborne, A., Sanderson, J. & Martin, K. R. Neuroprotective effects of human mesenchymal stem cells (hMSC) and platelet derived growth factor (PDGF) on human retinal ganglion cells (RGCs). Stem Cells https://doi.org/10.1002/stem.2722 (2017) Sluch, V. M. et al. Differentiation of human ESCs to retinal ganglion cells using a CRISPR engineered reporter cell line. Sci. Rep. 5, 16595. https://doi.org/10.1038/srep16595 (2015) Sluch, V. M. et al. Enhanced stem cell differentiation and immunopurification of genome engineered human retinal ganglion cells. Stem Cells Transl. Med. 6, 1972–1986. https://doi.org/10.1002/sctm.17-0059 (2017) Mead, B., Chamling, X., Zack, D. J., Ahmed, Z. & Tomarev, S. TNFα-mediated priming of mesenchymal stem cells enhances their neuroprotective effect on retinal ganglion cells. Invest. Ophthalmol. Vis. Sci. 61, 6–6. https://doi.org/10.1167/iovs.61.2.6 (2020) Subramani, M., Van Hook, M. J., Qiu, F. & Ahmad, I. Human retinal ganglion cells respond to evolutionarily conserved chemotropic cues for intra retinal guidance and regeneration. Stem Cells 41, 1022–1036. https://doi.org/10.1093/stmcls/sxad061 (2023) Zhang, K. Y. et al. Role of the internal limiting membrane in structural engraftment and topographic spacing of transplanted human stem cell-derived retinal ganglion cells. Stem Cell Rep. 16, 149–167. https://doi.org/10.1016/j.stemcr.2020.12.001 (2021) Leung, A. K. & Sharp, P. A. MicroRNA functions in stress responses. Mol. Cell 40, 205–215. https://doi.org/10.1016/j.molcel.2010.09.027 (2010) Emde, A. & Hornstein, E. miRNAs at the interface of cellular stress and disease. EMBO J. 33, 1428–1437. https://doi.org/10.15252/embj.201488142 (2014) Chong, M. M. et al. Canonical and alternate functions of the microRNA biogenesis machinery. Genes Dev. 24, 1951–1960. https://doi.org/10.1101/gad.1953310 (2010) The role of miRNA in retinal ganglion cell health and disease mirna changes in retinal ganglion cells after optic nerve crush and glaucomatous damage Esmaeili, M. & Mead, B. Differentiation of human embryonic/induced-pluripotent stem cells to retinal ganglion cells. Methods Mol. Biol. 2708, 41–48. https://doi.org/10.1007/978-1-0716-3409-7_5 (2023) Normalization of real-time quantitative RT-PCR data: a model based variance estimation approach to identify genes suited for normalization - applied to bladder- and colon-cancer data-sets Li, X., Sun, M., Cheng, A. & Zheng, G. LncRNA GAS5 regulates migration and epithelial-to-mesenchymal transition in lens epithelial cells via the miR-204-3p/TGFBR1 axis. Lab. Invest. 102(4), 452–460. https://doi.org/10.1038/s41374-021-00713-3 (2022) Jiang, B. et al. MiR-204-5p may regulate oxidative stress in myopia. Sci. Rep. 14 (1), 9770. https://doi.org/10.1038/s41598-024-60688-1 (2024) Shiels, A. TRPM3_miR-204: a complex locus for eye development and disease. Hum. Genom. 14(1), 7. https://doi.org/10.1186/s40246-020-00258-4 (2020) Kim, J. et al. MicroRNA-302 induces proliferation and inhibits oxidant-induced cell death in human adipose tissue-derived mesenchymal stem cells. Cell Death Dis. 5, e1385. https://doi.org/10.1038/cddis.2014.344 (2014) Feng, K. M., Tsung, T. H., Chen, Y. H. & Lu, D. W. The role of retinal ganglion cell structure and function in glaucoma. Cells 12 (24), 2797. https://doi.org/10.3390/cells12242797 (2023) Lipchina, I. et al. Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 25 (20), 2173–2186. https://doi.org/10.1101/gad.17221311 (2011) Zuzic, M., Rojo Arias, J. E., Wohl, S. G. & Busskamp, V. Retinal miRNA functions in health and disease. Genes (Basel) 10 (5), 377. https://doi.org/10.3390/genes10050377 (2019) Direct multiplexed measurement of gene expression with color-coded probe pairs Huang, Q. & Ma, Q. MicroRNA-106a inhibits cell proliferation and induces apoptosis in colorectal cancer cells. Oncol. Lett. 15, 8941–8944. https://doi.org/10.3892/ol.2018.8516 (2018) Han, L. et al. MicroRNA-106a regulates autophagy-related cell death and EMT by targeting TP53INP1 in lung cancer with bone metastasis. Cell Death Dis. 12, 1037. https://doi.org/10.1038/s41419-021-04324-0 (2021) Alcantara, K. M. M. & Garcia, R. L. MicroRNA-92a promotes cell proliferation, migration and survival by directly targeting the tumor suppressor gene NF2 in colorectal and lung cancer cells. Oncol. Rep. 41, 2103–2116. https://doi.org/10.3892/or.2019.7020 (2019) and invasion of clear cell renal cell carcinoma and attenuates expression of O-GlcNAc-transferase Chen, E. Y. Y., Chen, J. S. & Ying, S. Y. The microRNA and the perspectives of miR-302. Heliyon 5, e01167. https://doi.org/10.1016/j.heliyon.2019.e01167 (2019) Suh, M.-R. et al. Human embryonic stem cells express a unique set of microRNAs. Dev. Biol. 270, 488–498. https://doi.org/10.1016/j.ydbio.2004.02.019 (2004) Bereimipour, A., Satarian, L. & Taleahmad, S. Investigation of key signaling pathways associating miR-204 and common retinopathies. BioMed. Res. Int. 2021, 5568113. https://doi.org/10.1155/2021/5568113 (2021) Conte, I. et al. MiR-204 is responsible for inherited retinal dystrophy associated with ocular coloboma. Proc. Natl. Acad. Sci. 112, E3236–E3245. https://doi.org/10.1073/pnas.1401464112 (2015) Shahriari, F. et al. MicroRNA profiling reveals important functions of miR-125b and let-7a during human retinal pigment epithelial cell differentiation. Exp. Eye Res. 190, 107883. https://doi.org/10.1016/j.exer.2019.107883 (2020) Saxena, K., Rutar, M. V., Provis, J. M. & Natoli, R. C. Identification of miRNAs in a model of retinal degenerations. Invest. Ophthalmol. Vis. Sci. 56, 1820–1829. https://doi.org/10.1167/iovs.14-15449 (2015) Drewry, M. D. et al. Differentially expressed microRNAs in the aqueous humor of patients with exfoliation glaucoma or primary open-angle glaucoma. Hum. Mol. Genet. 27, 1263–1275. https://doi.org/10.1093/hmg/ddy040 (2018) Zhuang, P. et al. Combined microRNA and mRNA detection in mammalian retinas by in situ hybridization chain reaction. Sci. Rep. 10, 351. https://doi.org/10.1038/s41598-019-57194-0 (2020) MicroRNAs of the mammalian eye display distinct and overlapping tissue specificity Carrella, S. et al. miR-181a/b control the assembly of visual circuitry by regulating retinal axon specification and growth. Dev. Neurobiol. 75, 1252–1267. https://doi.org/10.1002/dneu.22282 (2015) ElShelmani, H. et al. The role of deregulated microRNAs in age-related macular degeneration pathology. Transl. Vis. Sci. Technol. 10, 12. https://doi.org/10.1167/tvst.10.2.12 (2021) Zhang, Y. et al. Suppression of microRNA-125a-5p upregulates the TAZ-EGFR signaling pathway and promotes retinoblastoma proliferation. Cell. Signal. 28, 850–860. https://doi.org/10.1016/j.cellsig.2016.04.002 (2016) Zhang, H. et al. Regulation of retinal amacrine cell generation by miR-216b and Foxn3. Development https://doi.org/10.1242/dev.199484 (2022) Olena, A. F., Rao, M. B., Thatcher, E. J., Wu, S. Y. & Patton, J. G. miR-216a regulates snx5, a novel notch signaling pathway component, during zebrafish retinal development. Dev. Biol. 400, 72–81. https://doi.org/10.1016/j.ydbio.2015.01.016 (2015) Liu, Y. et al. microRNA-216a protects against human retinal microvascular endothelial cell injury in diabetic retinopathy by suppressing the NOS2/JAK/STAT axis. Exp. Mol. Pathol. 115, 104445. https://doi.org/10.1016/j.yexmp.2020.104445 (2020) Yang, Y. et al. MicroRNA-15b targets VEGF and inhibits angiogenesis in proliferative diabetic retinopathy. J. Clin. Endocrinol. Metab. 105, 3404–3415. https://doi.org/10.1210/clinem/dgaa538 (2020) Fairchild, C. L. A. et al. Let-7 regulates cell cycle dynamics in the developing cerebralcortex and retina. Sci. Rep. 9, 15336. https://doi.org/10.1038/s41598-019-51703-x (2019) Xia, X. & Ahmad, I. let-7 microRNA regulates neurogliogenesis in the mammalian retina through Hmga2. Dev. Biol. 410, 70–85. https://doi.org/10.1016/j.ydbio.2015.12.010 (2016) Arora, A., McKay, G. J. & Simpson, D. A. C. Prediction and verification of miRNA expression in human and rat retinas. Invest. Ophthalmol. Vis. Sci. 48, 3962–3967. https://doi.org/10.1167/iovs.06-1221 (2007) Sanes, J. R. & Masland, R. H. The types of retinal ganglion cells: current status and implications for neuronal classification. Annu Rev Neurosci. 8 (38), 221–246. https://doi.org/10.1146/annurev-neuro-071714-034120 (2015) Langer, K. B. et al. Retinal ganglion cell diversity and subtype specification from human pluripotent stem cells. Stem Cell Rep. 10 (4), 1282–1293. https://doi.org/10.1016/j.stemcr.2018.02.010 (2018) Kim, U. S., Mahroo, O. A., Mollon, J. D. & Yu-Wai-Man, P. Retinal ganglion cells-diversity of cell types and clinical relevance. Front. Neurol. 12, 661938. https://doi.org/10.3389/fneur.2021.661938 (2021) Download references This work was funded by Fight for Sight UK We would also like to thank Prof Donald Zack for providing the CRISPR-modified H7/H9 ESC line Dr Amanda Redfern from Central Biotechnology Services for providing the facility and guide to use nCounter Dr Alex Gibbs from Wales Cancer Research Centre who is funded by the Cancer Research Strategy (CReSt) for Wales for bioinformatic guidance Systems Immunity University Research Institute M.E. performed experiments for Figs. 1–7 including differentiation of ESC into RGC NanoString miRNA expression assay and microscopy help with analysis and writing the most of manuscript helped with RT-qPCR experimentation and analysis Download citation DOI: https://doi.org/10.1038/s41598-024-83381-9 Metrics details Programmable RNA editing is harnessed for modifying mRNA miRNA also regulates numerous biological activities but current RNA editors have yet to be exploited for miRNA manipulation we present a customizable editor REPRESS (RNA Editing of Pri-miRNA for Efficient Suppression of miRNA) and characterize critical parameters The optimized REPRESS is distinct from other mRNA editing tools in design rationale hence enabling editing of pri-miRNAs that are not editable by other RNA editing systems We edit various pri-miRNAs in different cells including adipose-derived stem cells (ASCs) hence attenuating mature miRNA levels without disturbing host gene expression We further develop an improved REPRESS (iREPRESS) that enhances and prolongs pri-miR-21 editing for at least 10 days with minimal perturbation of transcriptome and miRNAome promotes in vitro cartilage formation and augments calvarial bone regeneration in rats thus implicating its potentials for engineering miRNA and applications such as stem cell reprogramming and tissue regeneration pre-miRNA is exported out of the nucleus and undergoes further maturation to form the mature miRNA These limitations entail the development of an alternative method for miRNA regulation Most of these tools edit mRNA by designing the guide RNA or oligonucleotide complementary to mRNA except a single mismatch (usually a cytosine) opposite to the adenine intended for deamination They are harnessed to reverse pathogenic mutations on mRNA and restore native protein expression in cells and disease models these methods are neither used to edit pri-miRNA nor have they been exploited for tissue regeneration Because pri-miRNA processing is critical for miRNA biogenesis and current programmable RNA editing systems have yet to be harnessed to edit pri-miRNA this study aims to create a programmable system for RNA Editing of PRi-miRNA for Efficient SuppreSsion of miRNA (REPRESS) The optimized REPRESS enables editing of various pri-miRNAs and attenuates their mature miRNAs levels in different cells including adipose-derived stem cells (ASCs) We further generate the improved REPRESS (iREPRESS) that prolongs and enhances pri-miRNA editing with minimal perturbation of transcriptome and microRNAome iREPRESS editing of pri-miR-21 reprograms ASCs differentiation ameliorates in vitro cartilage formation and in vivo bone regeneration thus paving an avenue for miRNA regulation stem cell engineering and regenerative medicine A- > I editing efficiencies were calculated by EditR Statistical analyses were carried out with one-way (F N) or two-way (P) ANOVA followed by Tukey multiple comparison test Data represent means ± SD of three independent culture experiments Source data are provided as a Source data file The 16-aa flexible XTEN linker (B-REPRESS 5) further improved A76 conversion efficiency to ≈12% the 5-aa rigid linker (EAAAK) barely converted A76 D-REPRESS 5 that exploited XTEN linker to fuse dRfxCas13d with ADAR2DD conferred the highest A76 editing efficiency (≈15%) we abbreviated D-REPRESS 5 as REPRESS for ensuing characterization These data underscored the crRNA-dependent specificity of REPRESS A dREPRESS expression cassette harboring the fusion of dRfxCas13d and deactivated ADAR2DD with E488Q and E396A mutations Plasmids encoding optimized REPRESS or dREPRESS were co-delivered with crRNA expressing plasmids into cells with a ratio of 1:3 (w:w) miRNAs were collected at 1 day for TaqMan assay using primers specific to mature miRNAs Statistical analyses were carried out with one-way ANOVA followed by Tukey multiple comparison test Data represent means±SD of three independent culture experiments D Transcriptome-wide analysis of ASCs co-transduced with iREPRESS using cr21 (C) or non-targeting (NT) crRNA (D) RNA-seq data are presented as log2(fold change) vs F Global miRNA analysis of ASCs co-transduced with iREPRESS using cr21 (E) or NT crRNA (F) Statistical significance was determined by two-sided Wald test followed by correction using Storey’s method to generate q values Change with FALSE q value was cut off and volcano plot is presented in ‒log10(p value) vs Red and blue dots (C–F) represent significantly upregulated and downregulated genes in sequencing data H Transcriptome-wide A-to-I off-target analysis of ASCs co-transduced with iREPRESS using cr21 (G) or NT crRNA (H) J miRNAome A-to-I off-target analysis of ASCs co-transduced with iREPRESS using cr21 (I) or NT crRNA (J) Total RNA or miRNA was harvested after 3 days for RNA or small-RNA seq experiments Statistical analyses were carried out with two-way ANOVA (A B) followed by Tukey multiple comparison test These data confirmed that iREPRESS prolonged pri-miRNA editing with minimal perturbation of transcriptome and miRNAome we next exploited iREPRESS to knockdown miR-21 and reprogram ASCs differentiation Experiments and experimental groups are identical to those shown in Fig. 3 B Relative expression of adipogenic marker genes C/ebpα (A) and Ppar-γ (B) D Relative expression of chondrogenic marker genes Acan (C) and Col2a1 (D) Alcian Blue and Alizarin Red staining (n = 3) H–J Spectrophotometric analysis for oil droplet formation (adipogenesis Statistical analyses were carried out with one-way (H–J) and two-way ANOVA (A–D) followed by Tukey multiple comparison test Quantitative data represent means±SD of three independent culture experiments A Gross appearance of engineered cartilages (C) Alcian Blue and (D) Col II staining (n = 3) Black arrow heads represent the positive stains F Semiquantitative analysis of GAG and Col II ASCs were mock- (Mock group) or iREPRESS-transduced (iREPRESS group) in 15-cm dishes the cells were seeded into porous gelatin scaffolds (diameter = 6 mm; thickness = 1 mm; 5 × 106 cells/scaffold; n = 3 for each group) The ASCs/gelatin constructs continued to be cultured in chondroinductive medium and assayed at 7 or 14 dpt Statistical analyses were carried out with two-way ANOVA followed by Tukey multiple comparison test The constructs were implanted into the critical-sized (diameter = 6 mm) calvarial defects of SD rats Bone regeneration was evaluated by μCT imaging Percentage values were calculated by normalization to the bone area (28 mm2) volume (28 mm3) and density (4600 HU) of the original defects Quantitative data are represented as means±SD REPRESS is also distinct from other RNA editing tools in that REPRESS is designed to translocate to the nucleus where pri-miRNA is located whereas other systems are introduced into the cytoplasm to edit mRNA which may be ascribed to the distinctive ability of REPRESS to engage ADAR2DD with adjacent pre-miRNA hairpin whereas other RNA editing systems guide ADAR2DD to the immediate spacer:target duplex rather than the pre-miRNA hairpin These data underscore the stringent requirement for REPRESS design and indicate the superiority of REPRESS for pri-miRNA editing hence enabling its use in stem cell engineering and tissue regeneration These data collectively implicate the potentials of iREPRESS for broad applications which may mitigate the editing efficacy of iREPRESS in humans This obstacle may be circumvented by replacing dRfxCad13d with other dCas13 protein (e.g Animal experiments were performed in compliance with the Guide for the Care and Use of Laboratory Animals (National Council of Science and Technology Taiwan) and were approved by the Institutional Animal Care and Use Committee of National Tsing Hua University Full-length FL hADAR2 E488Q was cloned from pmGFP-ADAR2 (Addgene # 117929) dREPRESS plasmid was constructed by replacing ADAR2DD E488Q in pD-REPRESS 5 with deactivated ADAR2DD E488Q E396A via inverse PCR and self-ligation respectively) were constructed by annealing chemically synthesized oligonucleotides and subcloning into EcoRI/BbsI-digested psgRNAa pXR004 carrying the original BbsI cloning sites was used as a non-targeting (NT) crRNA HEK293FT (Invitrogen) and A549 cells were maintained in DMEM high glucose (Gibco) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS) (Gibco) Cells were passaged at ≈80% confluency and seeded to 12-well plates (1 × 105 cells/well) 4 sets of plasmids were co-transfected into cells using Lipofectamine 3000 (Invitrogen) with a DNA:lipid ratio of 1:1.5: (i) REPRESS (300 ng) and crRNA (600 ng) plasmids; (ii) pC0039 (300 ng) and crRNA (600 ng) plasmids for REPAIR; (iii) 500 ng of U6-driven arRNA plasmid for LEAPER; or (iv) pmGFP-ADAR2 (250 ng) and U6-driven gRNA plasmid (750 ng) for RESTORE ASCs were isolated from SD rats (Biolasco, Taiwan) as described59 The cells were cultured in complete αMEM (Gibco) containing 10% FBS 1% PS and 4 ng/mL basic fibroblast growth factor (bFGF) ASCs at passage 2 to 5 were used for subsequent experiments ASCs were resuspended in Opti-MEM (Gibco) and mixed with 3 µg of REPRESS and 6 µg of crRNA plasmids for REPRESS; 3 µg of pC0039 and 6 µg of crRNA plasmid for REPAIR; 5 µg of U6-driven arRNA plasmid for LEAPER; or 2.5 µg of pmGFP-ADAR2 and 7.5 µg of U6-driven gRNA plasmids for RESTORE The plasmids were electroporated into cells in a 2-mm gap cuvette with NEPA21 Electroporator (NEPAGENE) at 2 pulses of 275 V/2.5 ms with an interval of 50 ms for poring phase and 5 pulses of 20 V/50 ms with an interval of 50 ms cells were seeded to 12-well plates (5 × 104 cells/well) and cultured overnight at 37 °C under 5% CO2 The cells were washed and incubated with BV suspended in surrounding medium (complete culture medium without sodium bicarbonate) at optimal multiplicity of infection (MOI) and mixed on a rocking plate (10 rpm the cells were cultured in fresh medium containing 3 mM sodium butyrate the sodium butyrate-containing medium was removed and the cells continued to be cultured in fresh or induction medium for subsequent analysis Transduced ASC cells were differentiated in adipogenic chondrogenic or osteogenic induction medium Half of the media was removed and replaced by fresh induction media until analysis time Differentiated cells were fixed in 4% buffered formaldehyde (Macron) for 15 min at room temperature and stained with Oil Red O The dyes in the stained cells were extracted with isopropanol or cetylpyridinium chloride and read at 492 or 550 nm on the plate reader (SpectraMax M2 ASCs cells were seeded to 96-well plates (2.5 × 103 cells/well) prior to transduction Mock or transduced cells were cultured in fresh medium and replenished every 2 days cells were washed with PBS and incubated in fresh medium with 0.5 mg/mL MTT (Sigma) at 37 °C for 3 h cells were incubated with 100 µL solution of 4 µM HCl and 0.1% Triton X-100 in isopropyl alcohol at room temperature for 15 min on a rocking plate The adsorption was read on SpectraMax M2 at 560 nm cells were stained with BrdU for proliferation assay (Cell BioLabs) the stained cells were fixed and subsequently stained with anti-BrdU antibody followed by HRP-conjugated secondary antibody staining The cells were allowed to react with substrate The reaction was stopped before reading at 450 nm on SpectraMax M2 and unique joined sequences were counted by in-house Perl script EdgeR was used to perform differentially expressed gene (DEG) analysis The sequencing depth was ≈20 million reads per sample DEG was deemed significant using the following thresholds: p value < 0.0001 and absolute log2(Fold-Change) value >= 1 significant edits in the Mock groups were removed and considered as SNPs Edits in experiment groups were deemed significant after Fisher’s exact test with a p value < 0.05 and occurring at least in 2 out of 3 replicates SNPs were removed from the significant edits manually at UCSC Genome Browser ASCs were mock or co-transduced in a 15-cm dish as described previously thickness 1 mm) were cut from Spongostan sheets (Ethicon MS0003) with a biopsy puncher (Integra Miltex) ASCs cells were collected and seeded to gelatin discs (5 × 106 cells/disc) The resultant ASCs/gelatin constructs were incubated at 37 °C 5% CO2 for 4 h prior to culturing in chondroinduction medium the constructs were collected for calvarial defect implantation the constructs were fixed in 4% buffered formaldehyde (Macron) overnight at room temperature before embedding in paraffin and sliced into 3-µm thick sections The sections were cleaned in xylene and hydrated through a series of descending alcohol the hydrated sections were stained with H&E and Alcian Blue/Nuclear Fast Red antigen retrieval of the sections were carried out with 0.05% trypsin EDTA (Gibco) at 37 °C for 20 min followed by blocking in PBS containing 5% bovine serum albumin and 0.1% Tween 20 for 1 h before incubating with rabbit anti-collagen type II (Abcam The sections were then incubated with HRP-conjugated goat anti-rabbit (Abcam 1:500) secondary antibody at room temperature for 1 h and developed with SIGMAFAST™ 3,3′-Diaminobenzidine (Sigma) Sections were photographed on Eclipse TS100-F (Nikon) Positively stained areas of the images were processed by Fiji for semi-quantification Mock (Mock group) and transduced (iREPRESS) ASCs/gelatin constructs cultured in chondroinduction medium were harvested at 7 or 14 dpt for implantation 6-week-old female SD rats were injected intramuscularly with Zoletil® 50 (25 mg/kg body weight Virbac Animal Health) and 2% Rompun® (0.15 mL/kg body weight followed by cefazolin injection (160 mg/kg body weight) The calvaria were exposed by a 2-cm midline incision and the removal of the periosteal layers A 6-mm defect was created by punching through the exposed calvarium with a biopsy puncher (Integra Miltex) gradually with occasional saline buffer supplement to minimize damage to the neighboring bone tissue and underlying dura mater The bone flaps were gently discarded and replaced with the ASCs/scaffold constructs followed by suturing with 4-0 absorbable stitch (PolySorb Post-operative procedure was performed with an administration of topical neomycin/bacitracin and intramuscular injection of ketoprofen (5 mg/kg) µCT imaging was performed on a nanoScan SPECT/CT (Mediso) at Chang Gung Memorial Hospital to assess bone regeneration of the animals at 4 (W4) 8 (W8) and 12 (W12) weeks post-implantation 3D and hot-and-cold projections of the calvarial bones were rendered by InterViewTM FUSION (Mediso) and PMOD (PMOD Technologies) DICOM files from scanning were further processed by PMOD to generate bone area In vitro data and images are representative of at least three independent culture experiments All quantitative data are expressed as mean±standard deviation (SD) The sample size of animal studies was not predetermined and experiments were not randomized Statistical analyses were carried out with one-way or two-way ANOVA followed by Tukey multiple comparison test A p value less than 0.05 was considered significant Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article All data supporting the results of this study are available within the paper and Supplementary Information. High-throughput sequencing data are available from the NCBI Sequence Read Archive database PRJNA1153716. Source data are provided with this paper All the code used in the study for processing DNA and RNA seq data calculating A- > I editing are derived from the original articles referenced in the Methods section Mechanisms of post-transcriptional regulation by microRNAs: are the answers in sight Structural basis for pri-miRNA recognition by Drosha Functional atlas of primary miRNA maturation by the microprocessor Modulation of microRNA processing and expression through RNA editing by ADAR deaminases Anti-miRNA oligonucleotides: a comprehensive guide for design Baculovirus-mediated miRNA regulation to suppress hepatocellular carcinoma tumorigenicity and metastasis a novel genomic tool to knock down microRNA in vitro and in vivo Inhibition of microRNA function by antimiR oligonucleotides Using artificial microRNA sponges to achieve microRNA loss-of-function in cancer cells Repair of double-strand breaks induced by CRISPR-Cas9 leads to large deletions and complex rearrangements Programmable RNA editing by recruiting endogenous ADAR using engineered RNAs Precise RNA editing by recruiting endogenous ADARs with antisense oligonucleotides Engineered circular ADAR-recruiting RNAs increase the efficiency and fidelity of RNA editing in vitro and in vivo Endogenous ADAR-mediated RNA editing in non-human primates using stereopure chemically modified oligonucleotides a specific yet highly efficient programmable A > I RNA base editor Programmable C-to-U RNA editing using the human APOBEC3A deaminase Programmable RNA base editing with a single gRNA-free enzyme A cytosine deaminase for programmable single-base RNA editing Programmable RNA-guided RNA effector proteins built from human parts Efficient and precise editing of endogenous transcripts with SNAP-tagged ADARs Identification and expression analysis of miRNAs during batch culture of HEK-293 cells miR-140-3p aggregates osteoporosis by targeting PTEN and activating PTEN/PI3K/AKT signaling pathway Regulation of ADAM10 by miR-140-5p and potential relevance for Alzheimer’s disease and angiogenesis by targeting SuFu and Fus-1 expression and miR-143 enhance adipogenic differentiation from porcine bone marrow-derived mesenchymal stem cells Baculovirus-mediated miR-214 knockdown shifts osteoporotic ASCs differentiation and improves osteoporotic bone defects repair Redirection of silencing targets by adenosine-to-inosine editing of miRNAs Design of small molecule-responsive microRNAs based on structural requirements for Drosha processing Emerging roles of DROSHA beyond primary microRNA processing A novel source for miR-21 expression through the alternative polyadenylation of VMP1 gene transcripts Functions and regulation of RNA editing by ADAR deaminases Efficient gene delivery into cell lines and stem cells using baculovirus Enhanced and prolonged baculovirus-mediated expression by incorporating recombinase system and in cis elements: a comparative study Regenerating cartilages by engineered ASCs: Prolonged TGF-β3/BMP-6 expression improved articular cartilage formation and restored zonal structure Bi-directional gene activation and repression promote ASC differentiation and enhance bone healing in osteoporotic rats MicroRNA-21 controls the development of osteoarthritis by targeting GDF-5 in chondrocytes The use of ASCs engineered to express BMP2 or TGF-β3 within scaffold constructs to promote calvarial bone repair CRISPR activation of long non-coding RNA DANCR promotes bone regeneration Transcriptome engineering with RNA-targeting type VI-D CRISPR effectors An RNA-targeting CRISPR–Cas13d system alleviates disease-related phenotypes in Huntington’s disease models In vivo RNA editing of point mutations via RNA-guided adenosine deaminases Abundant off-target edits from site-directed RNA editing can be reduced by nuclear localization of the editing enzyme RNA editing: expanding the potential of RNA therapeutics MicroRNA: trends in clinical trials of cancer diagnosis and therapy strategies Noncoding RNA therapeutics-challenges and potential solutions Huang, S. et al. Advances in microRNA therapy for heart failure: Clinical trials, preclinical studies, and controversies. Cardiovasc. Drugs Ther. https://doi.org/10.1007/s10557-023-07492-7 (2023) Cytosine and adenine base editing of the brain heart and skeletal muscle of mice via adeno-associated viruses A strategy for Cas13 miniaturization based on the structure and AlphaFold Programmable RNA editing with compact CRISPR-Cas13 systems from uncultivated microbes Pre-existing adaptive immunity to the RNA-editing enzyme Cas13d in humans Massively parallel Cas13 screens reveal principles for guide RNA design Enhanced critical-size calvarial bone healing by ASCs engineered with Cre/loxP-based hybrid baculovirus EditR: A method to quantify base editing from Sanger sequencing Trimmomatic: a flexible trimmer for Illumina sequence data PEAR: a fast and accurate Illumina Paired-End reAd mergeR fastp: an ultra-fast all-in-one FASTQ preprocessor featureCounts: an efficient general purpose program for assigning sequence reads to genomic features RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome Investigating RNA editing in deep transcriptome datasets with REDItools and REDIportal Statistical significance for genomewide studies Systematic identification of edited microRNAs in the human brain Using Perl for statistics: Data processing and statistical computing Download references The authors thank the Laboratory Animal Center Taiwan for the molecular imaging and technical support The authors also acknowledge the financial support from the National Science and Technology Council (NSTC 112-2223-E-007-002 (Y.C.H.) Chang Gung Memorial Hospital (CMRPG3M0782 (Y.C.H.) CMRPG3M0781 (Y.C.H.)) and National Health Research Institutes (NHRI-EX112-11014BI (Y.C.H.) These authors contributed equally: Vu Anh Truong Frontier Research Center on Fundamental and Applied Sciences of Matters designed and performed experiments and wrote the paper Nature Communications thanks the anonymous reviewers for their contribution to the peer review of this work Download citation DOI: https://doi.org/10.1038/s41467-024-52707-6 Metrics details Pancreatic cancer is often diagnosed at advanced stages and early-stage diagnosis of pancreatic cancer is difficult because of nonspecific symptoms and lack of available biomarkers We performed comprehensive serum miRNA sequencing of 212 pancreatic cancer patient samples from 14 hospitals and 213 non-cancerous healthy control samples We randomly classified the pancreatic cancer and control samples into two cohorts: a training cohort (N = 185) and a validation cohort (N = 240) We created ensemble models that combined automated machine learning with 100 highly expressed miRNAs and their combination with CA19-9 and validated the performance of the models in the independent validation cohort The diagnostic model with the combination of the 100 highly expressed miRNAs and CA19-9 could discriminate pancreatic cancer from non-cancer healthy control with high accuracy (area under the curve (AUC) We validated high diagnostic accuracy in an independent asymptomatic early-stage (stage 0-I) pancreatic cancer cohort (AUC:0.97; sensitivity We demonstrate that the 100 highly expressed miRNAs and their combination with CA19-9 could be biomarkers for the specific and early detection of pancreatic cancer it is important to detect pancreatic cancer in asymptomatic populations to improve the prognosis no blood biomarkers have been used to identify patients with pancreatic cancer at an early stage and less invasive diagnostic tools for early-stage pancreatic cancer are urgently required its performance has not been validated in patients with asymptomatic early-stage (stage 0-I) pancreatic cancer to assess the ability of miRNA profiles and CA19-9 levels to distinguish subjects with pancreatic cancer at each stage from subjects without pancreatic cancer including 213 pancreatic cancer samples collected from 14 centers and 212 non-cancer healthy control samples collected from three centers We comprehensively analyzed all miRNA profiles by next-generation sequencing (NGS) using an automated machine learning (AutoML) method to create discrimination models using highly expressed 100 miRNAs and CA19-9 The models were validated in an independent cohort study Our data showed that the 100 highly expressed miRNAs and a combination of those with CA19-9 could be biomarkers for the specific and early detection of pancreatic cancer and even for asymptomatic early-stage pancreatic cancer patients Serum samples were obtained from pancreatic cancer patients (n = 212) who were admitted or referred to Kyoto University Hospital (KUHP) (n = 56) Kindai University Hospital (KDUH) (n = 67) Kyoto Prefectural University of Medicine (KPUM) (n = 25) Hyogo Prefectural Amagasaki General Medical Center (AGMC) (n = 5) Japanese Red Cross Osaka Hospital (JRCOS) (n = 11) Japanese Red Cross Otsu Hospital (JRCOT) (n = 12) Japanese Red Cross Takatsuki Hospital (JRCT) (n = 3) Japanese Red Cross Wakayama Medical Center (JRCW) (n = 13) Kobe City Nishi-Kobe Medical Center (KNMC) (n = 2) all of which are secondary or tertiary care hospitals between 2020 and 2023 and stored at −80 °C The inclusion criteria were age over 20 years histologically confirmed pancreatic cancer in a surgically resected specimen or a computed tomography (CT) scan showing a solid mass in the pancreas or dilatation of pancreatic duct in patients not undergoing surgery with histology or cytology from the pancreas that confirmed the diagnosis of adenocarcinoma The clinical stage of pancreatic cancer was determined using a CT scan according to the UICC 7th criteria Patients with pancreatic cancer were randomly divided into a training cohort and a validation cohort under the following restrictions: 30 cases in stage 0-I and IV were assigned to the validation cohort and the remaining 92 pancreatic cancer cases were assigned to the training cohort A total of 213 serum samples from healthy individuals without cancer were collected from three independent cohorts The three cohorts included volunteers aged over 40 years who were recruited from the OCROM clinic (OCROMC) (n = 71) Osaka Pharmacology Clinical Research Hospital (OPHACH) (n = 71) The inclusion criterion for healthy control participants was no history of malignant tumors according to self-reported medical history at the time of blood sampling and one year later Healthy control participants were randomly divided into training and validation cohorts under the following restrictions: 120 cases were assigned to the validation cohort and the remaining 93 healthy control participants were assigned to the training cohort Blood samples were collected into serum-separating tubes the serum was separated by centrifugation and aliquoted into cryotubes These sera were frozen at −80 °C until miRNA extraction The time interval between blood sampling and serum freezing at −80 °C was observed strictly within the same day and serum samples that showed hemolysis were excluded RNA samples containing miRNA were extracted from the serum using the Maxwell® RSC miRNA Plasma and Serum kit (Promega 331535) was spiked into each serum sample to monitor RNA extraction Concentrations of miRNAs were quantified using Qubit™ microRNA Assay Kits (Invitrogen These miRNA samples were stored at −80 °C until NGS library preparation Sequencing outputs were mapped to miRBase v21 using the QIAseq miRNA Primary Analysis Pipeline For the development of classification models, miRNAs were excluded if they did not meet the following criteria: a read count of 50 or more in all the samples. The ComBat-normalized and log2-transformed values of the remaining 100 miRNAs were used to construct discrimination models. These miRNAs are listed in Supplementary Table 2 The average value of the eight prediction score outputs from each algorithm was used as the final miRNA+CA19-9-index For miRNA quantification using the Ion GeneStudio S5 Prime system (Thermo Fisher Scientific miRNA libraries were prepared using the QIAseq miRNA Library Kit and the QIAseq miRNA 48 Index TF (96) (Qiagen The pooled libraries were loaded into the Ion 540 Chip (Thermo Fisher Scientific A27766) with the Ion Chef system (Thermo Fisher Scientific 4484177) and sequenced with the Ion GeneStudio S5 Prime system The sequenced reads were processed as for NextSeq 550 miRNA reads were normalized by reference-batch ComBat in the R (version 4.2.3) “sva” package Pancreatic cancer discrimination models using data from the Ion GeneStudio S5 system were constructed using the same 100 miRNAs used in the models built on NextSeq 550 data The same eight algorithms as the NextSeq 550-based models were used and the average of these prediction scores was used as the final index hierarchical unsupervised clustering analysis with heatmaps and AUC calculations were conducted using the statistical analysis software R (version 4.2.3) and UMAP analyses were conducted by prcomp (RRID:SCR_014676) and umap in the R “stats,” “Rtsne,” and “umap” packages 95% confidence ellipses were drawn by stat_ellipse in the R “ggplot2” package Heatmap and dendrograms were drawn by Heatmap in the R “ComplexHeatmap” package Student’s t-test for continuous variables and Pearson’s χ2 test for categorical variables were used to analyze patient characteristics of the training cohort and validation cohort To evaluate model performance of sensitivity and specificity 95% CIs were calculated using the bootstrap method by the R “pROC” package To evaluate the influence of patient backgrounds of age and focal pancreatic parenchymal atrophy (FPPA) on constructed models p-values of the Kolmogorov–Smirnov test were calculated by ks.test in the R “stats” package To evaluate the correlation between miRNA index and CA19-9 level Spearman’s correlation coefficient was calculated by cor.test in the R “stats” packages To evaluate AUC values of ROC curves with early-stage or asymptomatic pancreatic cancers of constructed models p-values were calculated by roc.test in the R “pROC” package To evaluate sensitivities of early-stage or asymptomatic pancreatic cancers of constructed models p-values of the McNemar test were calculated by mcnemar.test in the R “stats” package including 213 pancreatic cancer patients from 14 hospitals and 212 healthy controls without cancer from three clinics were randomly divided into the training and validation cohorts a Heatmap representing hierarchical unsupervised clustering analysis of the miRNA sequencing of healthy controls (blue) and pancreatic cancer patients (orange) b Principal component analysis (PCA) of the miRNA sequencing of healthy controls (blue) and pancreatic cancer patients (orange) a Schematic procedure of the index calculation in miRNA model and miRNA+CA19-9 model b ROC curve for the performance of serum CA19-9 alone (red) and miRNA+CA19-9 model (blue) in the validation cohort and miRNA+CA19-9 model of healthy participants and pancreatic cancer patients in each stage (0 g Confusion matrices of miRNA model and miRNA+CA19-9 model at 98% specificity in each stage of the validation cohort The color gradient indicated the rate of each metric i Box plots of CEA and DUPAN-2 of healthy participants and pancreatic cancer patients in each stage (0 In the independent validation cohort, the AUC was 0.88 (95% confidence interval (CI), 0.84–0.93) for serum CA19-9, 0.94 (95% CI, 0.91–0.97) for the miRNA model, and 0.99 (95% CI, 0.98–1.00) for the miRNA+CA19-9 model when patients with pancreatic cancer were tested against healthy participants (Table 2) b ROC curves for the performance of serum CA19-9 alone (red) and miRNA+CA19-9 model (blue) in discriminating patients with pancreatic cancer in stage 0-I (a) and stage 0-II (b) from healthy controls c ROC curves for the performance of serum CA19-9 alone (red) and miRNA+CA19-9 model (blue) in discriminating asymptomatic patients with pancreatic cancer in stage 0-I in the validation cohort d–l Asymptomatic patients with pancreatic cancer in stage I: case 1 (d–g) and case 2 (h–l) d MRI revealed main pancreatic duct dilatation (arrow) 3.0 cm (e) MRI revealed a low-signal area in the main pancreatic duct on T2-weighted images (arrow) 3.0 cm (f) Contrast-enhanced CT revealed a slightly enhanced tumor in the main pancreatic duct (arrow) 0.50 cm (h) MRI revealed main pancreatic duct dilatation (arrow) 3.0 cm (i) Contrast-enhanced CT revealed main pancreatic dilatation (arrow) 3.0 cm (j) A tumor could not be detected in PET-CT (arrow) and eosin staining of the surgical specimen revealed pancreatic cancer in stage IA The inset shows invasive pancreatic cancer The AUC of the miRNA+CA19-9 model was significantly higher than that of CA19-9 in patients with pancreatic cancer in stage 0-I (Fig. 4a) and stage 0-II (Fig. 4b) in the validation cohort (P < 0.05) The sensitivities of the miRNA and miRNA+CA19-9 models at 98% specificity were significantly higher than that of CA19-9 in patients with pancreatic cancer in stage 0-I tested against healthy participants in the validation cohort (P < 0.05) These results indicated that the 100 highly expressed miRNAs and CA19-9 in blood serum successfully discriminated healthy controls from patients with pancreatic cancer not only in the advanced stage but also in the early stage (stage 0-I) with high sensitivity and specificity These results indicate that the 100 highly expressed miRNAs and their combination with CA19-9 could be used as biomarkers for screening asymptomatic patients with pancreatic cancer in stage 0-I we present representative cases in which the miRNA and miRNA+CA19-9 models could discriminate asymptomatic patients with early-stage pancreatic cancer from healthy controls and the miRNA+CA19-9 index of 0.66 indicated negative Pancreatic juice cytology revealed adenocarcinoma and the patient was diagnosed with pancreatic cancer at clinical stage I The patient underwent surgery and was pathologically diagnosed with stage IB pancreatic cancer Sensitive and specific biomarkers for identifying patients with early-stage pancreatic cancer are urgently required we comprehensively analyzed serum miRNA profiles using NGS of all serum samples from patients with pancreatic cancer and healthy controls in a large sample set (N = 425) collected from 17 centers including 46 patients with pancreatic cancer in stage 0-I The discrimination models generated using the training cohort were validated using an independent validation cohort (N = 240) High diagnostic accuracy (AUC:0.98) was validated even in an independent early-stage (stage 0-I) pancreatic cancer cohort (N = 30) which included 21 patients with asymptomatic pancreatic cancer Using an ensemble model that combines machine learning algorithms our model has good discriminative ability and high robustness we validated our pancreatic cancer prediction models the miRNA model and the miRNA+CA19-9 model with an independent validation cohort to differentiate patients with pancreatic cancer from healthy controls the high performance of our discrimination models was validated in 21 asymptomatic patients with pancreatic cancer in stage 0-I These results suggest that the 100 highly expressed miRNAs and their combination with CA19-9 could be biomarkers for detecting asymptomatic patients with pancreatic cancer in stage 0-I Most of the 100 miRNAs used in our discrimination models were dismissed in previous studies This is possibly because previous studies focused only on miRNAs that were differentially expressed between patients with pancreatic cancer and controls and constructed discrimination models using them We extracted highly and robustly expressed miRNAs and used them for model construction regardless of differences in expression levels combining a large number of miRNAs through machine learning improves the discrimination ability of pancreatic cancer A possible disadvantage of machine learning is that the time cost of creating models is high; however by comprehensively analyzing all miRNA profiles and using AutoML the 100 highly expressed miRNAs and a combination of those with CA19-9 could discriminate patients with pancreatic cancer High diagnostic accuracy (AUC:0.98) was validated in an independent early-stage (stage 0-I) pancreatic cancer cohort Our data demonstrate that the 100 highly expressed miRNAs and their combination with CA19-9 could be used as biomarkers for the specific and early detection of pancreatic cancer We plan to prospectively study the utility of these discriminatory models for high-risk populations of pancreatic cancer The main data supporting the results of this study are available in this paper and in the Supplementary Information The raw and analyzed datasets generated during the study are available for research purposes from the corresponding authors upon reasonable request They also contain personal and patient data and are available for research purposes pending the completion of adequate paperwork Projecting cancer incidence and deaths to 2030: the unexpected burden of thyroid Egawa S, Toma H, Ohigashi H, Okusaka T, Nakao A, Hatori T et al. Japan Pancreatic Cancer Registry; 30th Year Anniversary Japan Pancreas Society. 2012 www.pancreasjournal.com Recent trends in the incidence and survival of stage 1A pancreatic cancer: a surveillance Multicenter study of early pancreatic cancer in Japan Screening for pancreatic cancer: US preventive services task force reaffirmation recommendation statement Is screening for pancreatic cancer in high-risk individuals one step closer or a fool’s errand Management of patients with increased risk for familial pancreatic cancer: updated recommendations from the International Cancer of the Pancreas Screening (CAPS) Consortium European evidence-based guidelines on pancreatic cystic neoplasms Timeline of development of pancreatic cancer and implications for successful early detection in high-risk individuals Ashida R, Tanaka S, Yamanaka H, Okagaki S, Nakao K, Fukuda J et al. The role of transabdominal ultrasound in the diagnosis of early stage pancreatic cancer: review and single-center experience. Diagnostics. 2019;9. https://doi.org/10.3390/diagnostics9010002 MicroRNAs: novel regulators in the hallmarks of human cancer Circulating microRNA in body fluid: a new potential biomarker for cancer diagnosis and prognosis Versatile roles of extracellular vesicles in cancer Urine microRNAs as potential noninvasive biomarkers in urologic cancers Serum exosomal mirna-1226 as potential biomarker of pancreatic ductal adenocarcinoma Kim MW, Koh H, Kim JY, Lee S, Lee H, Kim Y, et al. Tumor-specific miRNA signatures in combination with ca19−9 for liquid biopsy-based detection of PDAC. Int J Mol Sci. 2021. https://doi.org/10.3390/ijms222413621 Guo S, Qin H, Liu K, Wang H, Bai S, Liu S et al. Blood small extracellular vesicles derived miRNAs to differentiate pancreatic ductal adenocarcinoma from chronic pancreatitis. Clin Transl Med. 2021;11. https://doi.org/10.1002/ctm2.520 A microRNA signature in circulating exosomes is superior to exosomal glypican-1 levels for diagnosing pancreatic cancer Circulating exosomal microRNAs as novel potential detection biomarkers in pancreatic cancer Goto T, Fujiya M, Konishi H, Sasajima J, Fujibayashi S, Hayashi A, et al. An elevated expression of serum exosomal microRNA-191, − 21, −451a of pancreatic neoplasm is considered to be efficient diagnostic marker. BMC Cancer. 2018;18. https://doi.org/10.1186/s12885-018-4006-5 Khan IA, Rashid S, Singh N, Rashid S, Singh V, Gunjan D, et al. Panel of serum miRNAs as potential non-invasive biomarkers for pancreatic ductal adenocarcinoma. Sci Rep. 2021;11. https://doi.org/10.1038/s41598-021-82266-5 A pilot study to develop a diagnostic test for pancreatic ductal adenocarcinoma based on differential expression of select miRNA in plasma and bile Combination of plasma microRNAs with serum CA19-9 for early detection of pancreatic cancer Matsuzaki J, Kato K, Oono K, Tsuchiya N, Sudo K, Shimomura A, et al. Prediction of tissue-of-origin of early stage cancers using serum miRNomes. JNCI Cancer Spectr. 2023;7. https://doi.org/10.1093/jncics/pkac080 MicroRNA biomarkers in whole blood for detection of pancreatic cancer An exosome-based transcriptomic signature for noninvasive early detection of patients with pancreatic ductal adenocarcinoma: a multicenter cohort study Multiple cancer type classification by small RNA expression profiles with plasma samples from multiple facilities Tsuzuki S, Fujitsuka N, Horiuchi K, Ijichi S, Gu Y, Fujitomo Y, et al. Factors associated with sufficient knowledge of antibiotics and antimicrobial resistance in the Japanese general population. Sci Rep. 2020;10. https://doi.org/10.1038/s41598-020-60444-1 Predicting inpatient length of stay after brain tumor surgery: developing machine learning ensembles to improve predictive performance Regularization and variable selection via the elastic net Deng L, Pan J, Xu X, Yang W, Liu C, Liu H. PDRLGB: Precise DNA-binding residue prediction using a light gradient boosting machine. BMC Bioinform. 2018;19. https://doi.org/10.1186/s12859-018-2527-1 Chen K, Li R, Dou Y, Liang Z, Lv Q. Ranking support vector machine with kernel approximation. Comput Intell Neurosci. 2017;2017. https://doi.org/10.1155/2017/4629534 Marée R, Geurts P, Wehenkel L. Random subwindows and extremely randomized trees for image classification in cell biology. BMC Cell Biol. 2007;8. https://doi.org/10.1186/1471-2121-8-S1-S2 Zagoruyko S, Komodakis N. Wide Residual Networks. 2016 http://arxiv.org/abs/1605.07146 Li W, Liu H, Yang P, Xie W. Supporting regularized logistic regression privately and efficiently. PLoS ONE. 2016;11. https://doi.org/10.1371/journal.pone.0156479 Machine learning and deep learning methods that use omics data for metastasis prediction Chen T, Guestrin C. XGBoost: A Scalable Tree Boosting System. 2016. https://doi.org/10.1145/2939672.2939785 random forests: Statistical arbitrage on the S&P 500 A comparative study between frequency ratio model and gradient boosted decision trees with greedy dimensionality reduction in groundwater potential assessment Bloomston M, Frankel WL, Petrocca F, Volinia S, Alder H, Hagan JP, et al. MicroRNA expression patterns to differentiate pancreatic adenocarcinoma from normal pancreas and chronic pancreatitis. https://jamanetwork.com/ Small RNA-sequencing for analysis of circulating miRNAs Comprehensive assessment of multiple biases in small RNA sequencing reveals significant differences in the performance of widely used methods Evaluation of quantitative miRNA expression platforms in the microRNA quality control (miRQC) study Download references The authors thank all the members of the Fukuda laboratory for their technical assistance and helpful discussions and supported in part by Grants-in-Aid from the JSPS KAKENHI (19H03639 the Japan Agency for Medical Research and Development the Moonshot Research and Development Program (JPMJMS2022-1 the Fusion Oriented Research for disruptive Science and Technology (FOREST Department of Gastroenterology and Hepatology Kyoto University Graduate School of Medicine Japanese Red Cross Wakayama Medical Center Hyogo Prefectural Amagasaki General Medical Center AF and YI received research support from ARKRAY The other authors declare no competing interests This study conformed to the provisions of the Declaration of Helsinki All individuals provided written informed consent for the use of their serum samples and clinical information This study was reviewed and approved by the Research Ethics Committee of KUHP (R2692) Download citation DOI: https://doi.org/10.1038/s41416-024-02794-5 Metrics details Potatoes are a critical staple crop worldwide yet their yield is significantly constrained by salt stress Understanding and enhancing salt tolerance in potatoes is crucial for ensuring food security This study evaluated the salt tolerance of 17 diverse potato varieties using principal component analysis Comprehensive evaluation based on morphological and biochemical indicators divided the varieties into three categories and Z1076-1 as having strong salt tolerance Regression equations established stem thickness and catalase activity as rapid identification markers for salt tolerance in tetraploid potatoes Transcriptome analysis of the highly tolerant variety Z1076-1 identified 68 differentially expressed miRNAs (DE miRNAs) qRT-PCR validation for eight randomly selected DE miRNAs confirmed consistent expression trends with transcriptome data Predicted target genes of these miRNAs are involved in calcium channel signaling Our findings provide valuable insights for the identification and screening of salt-tolerant potato germplasms The findings also lay the foundation for studying molecular mechanisms of salt tolerance and advancing genetic breeding efforts to cultivate more resilient potato varieties exploring the response of crops to salt stress and improving their tolerance to saline-alkali soil is of great significance for enhancing the utilization of saline alkali land and promoting global soil environment improvement Although multiple studies have been conducted on the evaluation methods of potato salt tolerance both domestically and internationally there is still a lack of unified understanding and standards which hinders the in-depth development of potato salt tolerance research combining methods such as membership function analysis and principal component analysis with multiple indicators to comprehensively evaluate potato salt tolerance will have important theoretical and practical significance laying the foundation for further exploration of the molecular mechanism of potatoes salt tolerance research on the involvement of miRNAs in response to salt stress in potatoes is not extensive enough and still need be further in-depth exploration multiple statistical analysis methods were used to comprehensively evaluate the salt tolerance of 17 tetraploid potato germplasm resources using four morphological indicators (plant height fresh weight and stem thick) and five physiological and biochemical indicators (MDA The indicators that can accurately evaluate potato salt tolerance were screened and a mathematical evaluation model for potato salt tolerance under in vitro conditions was established the selected salt tolerant varieties were treated in MS medium containing NaCl (80 mm/L) for 0 h and the samples were collected to construct 12 small RNA sequencing libraries Differentially expressed miRNAs in potatoes under salt stress were screened and the functions of their target genes were also analyzed This study aims to provide germplasm resources for salt tolerant breeding of potatoes and lay a foundation for studying the molecular mechanisms of potato salt stress tolerance Phenotype of five potato materials under different salt concentrations (A) Coefficient variation of salt tolerance indexes of the five studied potato varieties (B) The effective growth rates of five materials After 21 d of treatment with 80 mM NaCl, the morphological and physiological indices of the 17 potato samples were measured and the statistical analysis was performed (Table S1 and S2) the coefficient variation of traits ranged from 25.96 to 111.33% whereas the coefficient variation of the indices under CK ranged from 21.37 to 91.82% and FW under the salt stress treatment were all lower indicating that salt stress inhibited the growth of potato plants and roots salt stress promoted thick stem growth to a certain extent and SOD contents were all higher than those in the CK indicating that salt stress had an important effect on stem growth Correlation analysis of potato materials under salt stress According to the standard of eigenvalues greater than 1 and the principal component loading matrix, PCA simplified the nine morphological, physiological, and biochemical indices into four independent comprehensive indices (Table 2) with a cumulative contribution rate of 78.36% Based on the analysis of the eigenvalue loads the four largest principal components were FW These four new independent comprehensive indices represent the information determined by the nine original indices The S values of the nine indexes were calculated according to the formula and these S values were used to comprehensively evaluate the salt tolerance of each potato material The order of tolerance was Z1264-1 > Z700-1 > Z943-1 > Z1266-1 > Z510-1 > Z1076-1 > Z456-2 > Z494 > Z1219-1 > Z1268-1 > Z1074-1 > Z1045 > Z850-1 > Z1184-1 > Z965 > Z1277-1 > Z440-1 Cluster dendrogram of S values for comprehensive evaluation of salt tolerance indicators of 17 potato plantlets To facilitate the comprehensive evaluation of salt tolerance in other potato varieties a multiple linear regression model was established using stepwise regression analysis The S-value of the comprehensive evaluation of morphological and physiological indicators was used as the dependent variable and the relative value of each indicator was used as the independent variable The regression equation of salt tolerance-related indicators was obtained as S = 0.641 X1−0.861X2 + 0.346X3 Coefficients of determination for the equation were R2 = 0.960 and F = 0.029 and it was easiest to use this regression equation to evaluate potato salt tolerance the proportion of clean readings in all samples exceeded 95.7% The Bowtie package was used to locate the length of the screened sRNA onto the reference sequence and the matching rate of all samples exceeded 66% Eight DE miRNAs were randomly selected to validate their expression using quantitative RT-PCR (Fig. 5C). The qRT-PCR expression profiles of these miRNAs were consistent with the RNA-Seq results, confirming the effectiveness of the RNA-Seq data. Differential expression pattern of miRNAs in four kinds of tissue-cultured seedlings after salt treatment (A) The number of DE miRNAs in all comparison groups (B) Hierarchical clustering heatmap of DE miRNAs with red representing high expression miRNAs and blue representing low expression miRNAs (C) qRT-PCR analysis of DE miRNAs selected by transcriptome data The standard deviation is represented by the error bars Some target genes of the DE miRNAs encoded proteins related to calcium channel signaling pathways Some target genes may be related to osmotic regulation activity in potatoes there are some target genes that encode proteins related to hormone signaling pathways ABSCISIC ACID-INSENSITIVE 5-like proteins (ABI5) 1-aminocyclopropane-1-carboxylate synthase (ACS) 1-aminocyclopropane-1-carboxylate oxidase (ACO) Pyridoxine/pyridoxamine 5’-phosphate oxidase (PPOX) Some target genes encode antioxidant system enzymes such as superoxide dismutase (SOS) Peroxidase (POD) and Glutathione S-transferase (GST) were possibly related to the clearance activity of reactive oxygen species (ROS) Several target genes encode key enzymes influencing the phenylpropane metabolism pathway such as phenylalanine ammonia-lyase (PAL) and 4-coumarate-CoA ligase (4CL) There are also some proteins related to cell wall synthesis such as expansin and the receptor-like kinase FERONIA several target genes were annotated as members of various transcription factor families Gene Ontology(GO) enrichment analysis showed that the target genes of DE-miRNAs should be classified into 20 biological processes (BPs) and six cellular component (CCs) terms after 3 h of stress treatment “membrane,” “intrinsic component of membrane,” and “integral component of membrane” in the CCs were the three terms with the highest number of enriched genes (Figure the most abundant BPs were single-organism cellular processes and “signal transduction.” The most relevant MFs were “protein binding,” “purine nucleotide binding” and “ribonucleotide binding.” In the CC group the targets were enriched in terms of the membrane part “membrane part,” “membrane” and “integral component of membrane” (Figure the main enriched GO terms were “single-organism cellular process,” “cellular process” and “transport” in BPs; “membrane part,” “membrane” and “protein complex” in CCs; with “ADP binding,” “adenyl ribonucleotide binding,” and “adenyl nucleotide binding” in MFs (Figure all target genes of the DE miRNAs were subjected to pathway significance enrichment analysis the enrichment pathway of targets gene mainly included “zeatin biosynthesis,” “nitrogen metabolism,” “porphyrin and chlorophyll metabolism,” “peroxisome,” and so on (Figure the “metabolic pathways,” “splicesome,” and “RNA degradation” pathways contain the most target genes (Figure the main enriched pathways were “zeatin biosynthesis,” “terpenoid backbone biosynthesis,” “RNA degradation,” “metabolic pathways,” and “ABC transporters” (Figure this study identified the salt tolerance of stem segments of potato variety tissue culture seedlings using this methodology The four morphological indicators selected in this study (PH ST and FW) can accurately evaluate potato salt tolerance under in vitro conditions but the field salt tolerance of the selected germplasms still needs further research the antioxidant enzymes POD and SOD and the content of Pro showed an upward trend which is consistent with previously reported results and biochemical indices in 17 potato varieties and conducted a comprehensive evaluation of the salt tolerance of each potato variety using the membership function method The results showed that the comprehensive salt tolerance coefficient S value was closely related to the membership function value which considered the weight of each trait index and that different trait indices made different contributions to salt resistance it was more accurate and objective to use the comprehensive salt tolerance coefficient S value to evaluate salt resistance comprehensively The research results provide germplasm resources reference for potato salt tolerance breeding and provide reference basis for accurate in vitro evaluation of potato salt tolerance laying the foundation for further exploration of potato salt tolerance mechanism Our results will provide a basis for further exploration of the molecular mechanism of miRNA regulation of potato salt tolerance in the future several target genes encode expansin and the receptor-like protein kinase FERONIA indicating that miRNAs may be involved in the synthesis of potato cell wall and membrane in response to salt stress these miRNAs and their target genes may play important roles in the response of potatoes to salt stress providing new insights into the molecular mechanisms of potato response to salt stress the results of this study showed that the morphological and physiological indexes of potato under salt stress would be affected Due to the limitation of experimental materials and indexes the established regression equation of salt tolerance may not involve all potato varieties Combined with transcriptome analysis of salt-tolerant varieties we can provide some theoretical references for salt-tolerant miRNAs Further studies are needed to truly understand the mechanism of salt tolerance in potato Plantlets of the potato variety Z1076-1 used in the miRNA-Seq experiment were grown in a glass bottle with a diameter of 10 cm and a height of 40 cm The stem segments with axillary buds were cultured in vitro on a base MS medium for 20 d under 16 h light/8 h dark photoperiod conditions at 25℃ and then transferred to MS medium containing 80 mM NaCl for salt stress treatment The tissue cultured seedlings were collected at 0 immediately frozen in liquid nitrogen and stored at −80℃ for further experimentation Three biological replicates were used for each time point The experiments were conducted in a potato tissue culture room at the Institute of Biophysics completely randomized design was used to detect the effects of different salt stress concentrations on the potato growth phenotypes NaCl was added to the MS solid medium to induce salt stress Fresh potato plantlets grown for three weeks were divided into 1 cm-long stem segments and inserted into an MS solid medium at different salt concentrations Each sterile glass bottle containing at least five fresh stem segments was used as a replicate and three replicates were performed The culture conditions were temperature (25 ± 2) ℃ The coefficient of variation (CV) for each parameter was subsequently calculated were determined using appropriate kits (Beijing Solarbio Science & Technology Co. Samples weighing 0.1 g were stored in a 1.5 ml centrifuge tube at −80 °C in a refrigerator The salt tolerance of the potato varieties was determined by calculating the membership function value (MFV) of all tested traits The weights of the comprehensive indices were calculated through principal component analysis (PCA) The comprehensive salt tolerance coefficient was calculated using the following equation:  Where F(Xj) is the jth comprehensive index value aij represents the factor load corresponding to the characteristic value of each single index and Xij denotes the standardized processing value of each index U (Xj) constitutes the membership function value of the jth indicator Xj represents the jth salt tolerance coefficient Xmin denotes the minimum value of the jth indicator salt tolerance coefficient and Xmax is the maximum value of the jth indicator salt tolerance coefficient Wj represents the weight of the jth indicator among all indicators and Pj is the contribution rate of the jth indicator Microsoft Excel 2019 was used to analyze and organize the data and the above equations were used to calculate the comprehensive salt tolerance coefficient and cluster analysis were performed using the SPSS statistical software (Ver RNA samples were extracted using the TRIzol reagent RNA degradation and contamination were monitored using 1% agarose gel electrophoresis The RNA purity was assessed using a the NanoPhotometer® spectrophotometer (IMPLEN RNA integrity was assessed using an RNA Nano 6000 Assay Kit on an Agilent Bioanalyzer 2100 system (Agilent Technologies The small RNA libraries were prepared from a total of 2 µg total RNA isolated from each sample using NEBNext® Multiplex Small RNA Library Prep Set for Illumina® (NEB USA.) in accordance with manufacturer’s instructions purified RNA was mixed with the NEB 3’ SR Adapter then the SR RT Primer hybridized to the excess of 3’ SR Adapter (that remained free after the 3’ ligation reaction) and transformed the single-stranded DNA adapter into a double-stranded DNA molecule A 5’ ends adapter was ligated to 5’ ends of miRNAs First-strand cDNA was synthesized using M-MuLV Reverse Transcriptase (RNase H) PCR amplification was performed using LongAmp Taq 2X Master Mix The PCR products were purified on an 8% polyacrylamide gel (100V DNA fragments corresponding to 140–160 bp (the length of small RNA plus the 3’ and 5’ adapters) were recovered and dissolved in 8 µL of elution buffer library quality was assessed using an Agilent Bioanalyzer 2100 system with DNA high-sensitivity chips This approach allowed for one mismatched base A differential expression analysis between the two groups was performed using the DESeq R package (version 1.24.0) P-values were adjusted using the Benjamini-Hochberg method A corrected P-value of < 0.05 was set as the threshold for screening differentially expressed genes A GO enrichment analysis was used to identify candidate target genes of the differentially expressed miRNAs A GOseq-based Wallenius non-central hypergeometric distribution was implemented to perform the GO enrichment analysis The KOBAS software was used to test the statistical enrichment of target gene candidates in the KEGG pathways this study evaluated the salt tolerance of 17 diverse potato varieties based on morphological and biochemical indicators and identified Z1264-1 Transcriptome analysis was performed on Z1076-1 We screened 68 differentially expressed miRNAs and eight related miRNAs were verified using RT-qPCR This study provides a strong reference for identifying and screening salt-tolerant potato germplasms All data generated or analyzed during this study are included in this article (and its additional files) The raw sequence data reported in this paper have been deposited in the Genome Sequence Archive in National Genomics Data Center China National Center for Bioinformation / Beijing Institute of Genomics Chinese Academy of Sciences (GSA: CRA019254) that are publicly accessible at https://ngdc.cncb.ac.cn/gsa/browse/CRA019254 Zhao, C., Zhang, H., Song, C., Zhu, J. K. & Shabala, S. Mechanisms of plant responses and adaptation to soil salinity. Innovation 1 (1), 100017. https://doi.org/10.1016/j.xinn.2020.100017 (2020) Munns, R. & Tester, M. Mechanisms of salinity tolerance. Annu. Rev. Plant. Biol. 59, 651–681. https://doi.org/10.1146/annurev.arplant.59.032607.092911 (2008) Shabala, L. et al. Cell-type-specific H+-ATPase activity in root tissues enables k+ retention and mediates acclimation of barley (Hordeum vulgare) to salinity stress. Plant. Physiol. 172 (4), 2445–2458. https://doi.org/10.1104/pp.16.01347 (2016) Zaheer, K. (ed Akhtar, M. H.) Potato production, usage, and nutrition-A review. Crit. Rev. Food Sci. Nutr. 56 5 711–772 https://doi.org/10.1080/10408398.2012.724479 (2016) Gebrechristos, H. Y. & Chen, W. Utilization of potato peel as eco-friendly products: a review. Food Sci. Nutr. 6 (6), 1352–1356. https://doi.org/10.1002/fsn3.691 (2018) Kang, Y. et al. Furrow-ridge mulching managements affect the yield, tuber quality and storage of continuous cropping potatoes. Plant. Soil. Environ. 66 (11), 576–583. https://doi.org/10.17221/316/2020-PSE (2020) Akrimi, R. et al. Electromagnetic water enhanced metabolism and agrophysiological responses of potato (Solanum tuberosum L.) under saline conditions. J. Agron. Crop Sci. 207 (1), 44–58. https://doi.org/10.1111/jac.12449 (2021) Katerji, N., Van Hoorn, J. W., Hamdy, A. & Mastrorilli, M. Salinity effect on crop development and yield, analysis of salt tolerance according to several classification methods. Agric. Water Manag. 62 (1), 37–66. https://doi.org/10.1016/S0378-3774(03)00005-2 (2003) Sanwal, S. K. et al. Salinity stress tolerance in potato cultivars: evidence from physiological and biochemical traits. Plants 11 (14), 1842. https://doi.org/10.3390/plants11141842 (2022) Li, Q. et al. Transcriptome analysis uncovers the gene expression profile of salt-stressed potato (Solanum tuberosum L). Sci. Rep. 10, 5411. https://doi.org/10.1038/s41598-020-62057-0 (2020) Tang, Y. et al. Salt tolerance evaluation and mini-core collection development in Miscanthus sacchariflorus and M. Lutarioriparius. Front. Plant. Sci. 15, 1364826. https://doi.org/10.3389/fpls.2024.1364826 (2024) Li, Q. et al. Physiology and gene expression analysis of potato (Solanum tuberosum L.) in salt stress. Plants 11, 1565. https://doi.org/10.3390/plants11121565 (2022) Ahmed, H. A. A. et al. Variability in salinity stress tolerance of potato (Solanum tuberosum L.) varieties using in vitro screening. Cienc. Agrotec. 44, e004220. https://doi.org/10.1590/1413-7054202044004220 (2020) Iwakawa, H. & Tomari, Y. The functions of microRNAs: mRNA decay and translational repression. Trends Cell. Biol. 25 (11), 651–665. https://doi.org/10.1016/j.tcb.2015.07.011 (2015) Chorostecki, U. et al. Evolutionary footprints reveal insights into plant microRNA biogenesis. Plant. Cell. 29 (6), 1248–1261. https://doi.org/10.1105/tpc.17.00272 (2017) Deng, F. et al. Molecular evolution and functional modification of plant miRNAs with CRISPR. Trends Plant Sci. 27 (9), 890–907. https://doi.org/10.1016/j.tplants.2022.01.009 (2022) Zhang, B. H. MicroRNA: a new target for improving plant tolerance to abiotic stress. J. Exp. Bot. 66 (7), 1749–1761. https://doi.org/10.1093/jxb/erv013 (2015) Yang, W. et al. Overexpressing osa-miR171c decreases salt stress tolerance in rice. J. Plant. Biol. 60, 485–492. https://doi.org/10.1007/s12374-017-0093-0 (2017) Islam, W., Tauqeer, A., Waheed, A. & Zeng, F. MicroRNA mediated plant responses to nutrient stress. Int. J. Mol. Sci. 23(5), 2562. https://doi.org/10.3390/ijms23052562 (2022) Zhao, G., Yu, H., Liu, M., Lu, Y. & Ouyang, B. Identification of salt-stress responsive microRNAs from Solanum lycopersicum and Solanum pimpinellifolium. Plant. Growth Regul. 83, 129–140. https://doi.org/10.1007/s10725-017-0289-9 (2017) Discovery of microRNA-target modules of African rice (Oryza glaberrima) under salinity stress https://doi.org/10.1038%2Fs41598-017-18206-z (2018) Ai, B. et al. Overexpression of miR1861h increases tolerance to salt stress in rice (Oryzasativa L.). Genet. Resour. Crop Evol. 68(1), 87–92. https://doi.org/10.1007/s10722-020-01045-9 (2021) Sharma, A. et al. Identification of microRNAs and their expression in leaf tissues of guava (Psidium guajava L.) under salinity stress. Agronomy 10(12), 1920. https://doi.org/10.3390/agronomy10121920 (2020) Kang, Y. et al. Integration of mRNA and miRNA analysis reveals the molecular mechanism of potato (Solanum tuberosum L.) response to alkali stress. Int. J. Biol. Macromol. 182, 938–949. https://doi.org/10.1016/j.ijbiomac.2021.04.094 (2021) Šimko, I. Effects of Kinetin, paclobutrazol and their interactions on the microtuberization of potato stem segments cultured in vitro in the light. Plant. Growth Regul. 12, 23–27. https://doi.org/10.1007/BF00144578 (1993) Latif, A. et al. Novel halotolerant rhizobacterial strains mitigated the salt stress in-vitro and in-vivo and improved the growth of tomato plants. Sci. Hort. 319, 112115. https://doi.org/10.1016/j.scienta.2023.112115 (2023) Luo, Y., Wang, K., Zhu, L., Zhang, N. & Si, H. StMAPKK5 positively regulates response to drought and salt stress in potato. Int. J. Mol. Sci. 25(7), 3662. https://doi.org/10.3390/ijms25073662 (2024) Colin, L. et al. The cell biology of primary cell walls during salt stress. Plant. cell. 35(1), 201–217. https://doi.org/10.1093/plcell/koac292 (2023) Zaman, M. S., Ali, G. M., Muhammad, A., Farooq, K. & Hussain, I. Vitro screening of salt tolerance in potato (Solanum tuberosum L.) varieties. Sarhad J. Agric. 31(2), 106–113. https://doi.org/10.13140/RG.2.2.20287.87200 (2015) Hanin, M., Ebel, C., Ngom, M., Laplaze, L. & Masmoudi, K. New insights on plant salt tolerance mechanisms and their potential use for breeding. Front. Plant. Sci. 7(1787). https://doi.org/10.3389/fpls.2016.01787 (2016) Boughalleb, F., Abdellaoui, R., Mahmoudi, M. & Bakhshandeh, E. Changes in phenolic profile, soluble sugar, proline, and antioxidant enzyme activities of Polygonum equisetiforme in response to salinity. Turk. J. Bot. 44(1), 25–35. https://doi.org/10.3906/bot-1908-2 (2020) Mehta, D. & Vyas, S. Comparative bio-accumulation of osmoprotectants in saline stress tolerating plants: a review. Plant. Stress. 9, 100177. https://doi.org/10.1016/j.stress.2023.100177 (2023) Wang, H. et al. Variability in morpho-biochemical, photosynthetic pigmentation, enzymatic and quality attributes of potato for salinity stress tolerance. Plant. Physiol. Bioch. 203, 108036. https://doi.org/10.1016/j.plaphy.2023.108036 (2023) Sharma, M. et al. Inroads into saline-alkaline stress response in plants: unravelling morphological, physiological, biochemical, and molecular mechanisms. Planta 259(6). https://doi.org/10.1007/s00425-024-04368-4 (2024) Zhang, M. et al. Evaluation of salt tolerance of oat cultivars and the mechanism of adaptation to salinity. J. Plant Physiol. 273, 153708. https://doi.org/10.1016/j.jplph.2022.153708 (2022) Abbas, A. et al. Genome-wide analysis of Invertase Gene Family, and expression profiling under Abiotic stress conditions in Potato. Biology 11(4), 539. https://doi.org/10.3390/biology11040539 (2022) Chen, Z. et al. An optimized protocol for comprehensive evaluations of salt tolerance in crop germplasm accessions: a case study of tomato (Solanum lycopersicum L). Agronomy 14(4), 842. https://doi.org/10.3390/agronomy14040842 (2024) Zhang, S. et al. Multivariate analysis compares and evaluates heat tolerance of potato germplasm. Plants 13(1), 142. https://doi.org/10.3390/plants13010142 (2024) Wang, K. et al. Heterogeneous expression of Osa-MIR156bc increases abiotic stress resistance and forage quality of alfalfa. Crop J. 9(5), 1135–1144. https://doi.org/10.1016/j.cj.2020.11.009 (2021) Xing, L. et al. miR169q and NUCLEAR FACTOR YA8 enhance salt tolerance by activating PEROXIDASE1 expression in response to ROS. Plant. Physiol. 188(1), 608–623. https://doi.org/10.1093/plphys/kiab498 (2022) Chu, Y. et al. The mir390-GhCEPR2 module confers salt tolerance in cotton and Arabidopsis. Ind. Crops Prod. 190, 115865. https://doi.org/10.1016/j.indcrop.2022.115865 (2022) Denver, J. B. & Ullah, H. miR393s regulate salt stress response pathway in Arabidopsis thaliana through scaffold protein RACK1A mediated ABA signaling pathways. Plant. Signal. Behav. 14(6), 1600394. https://doi.org/10.1080/15592324.2019.1600394 (2019) Liu, X. et al. Transgenic Chrysanthemum indicum overexpressing cin-miR396a exhibits altered plant development and reduced salt and drought tolerance. Plant. Physiol. Biochem. 168, 17–26. https://doi.org/10.1016/j.plaphy.2021.09.035 (2021) Nguyen, D. Q., Brown, C. W., Pegler, J. L., Eamens, A. L. & Grof, C. P. L. Molecular manipulation of microRNA397 abundance influences the development and salt stress response of Arabidopsis thaliana. Int. J. Mol. Sci. 21(21), 7879. https://doi.org/10.3390/ijms21217879 (2020) Qin, R. et al. MicroRNA408 negatively regulates salt tolerance by affecting secondary cell wall development in maize. Plant. Physiol. 192(2), 1569–1583. https://doi.org/10.1093/plphys/kiad135 (2023) Zhou, H. et al. Insights into plant salt stress signaling and tolerance. J. Genet. Genomics. 51(1), 16–34. https://doi.org/10.1016/j.jgg.2023.08.007 (2024) Yang, Y. et al. Calcineurin B-like proteins CBL4 and CBL10 mediate two independent salt tolerance pathways in Arabidopsis. Int. J. Mol. Sci. 20(10), 2421. https://doi.org/10.3390/ijms20102421 (2019) Ren, H. et al. Calcium signaling-mediated transcriptional reprogramming during abiotic stress response in plants. Theor. Appl. Genet. 136(10), 210. https://doi.org/10.1007/s00122-023-04455-2 (2023) Yu, Z. et al. How plant hormones mediate salt stress responses. Trends Plant. Sci. 25(11), 1117–1130. https://doi.org/10.1016/j.tplants.2020.06.008 (2020) Yang, C. et al. ABI5-FLZ13 module transcriptionally represses growth-related genes to delay seed germination in response to ABA. Plant. Commun. 4(6), 100636. https://doi.org/10.1016/j.xplc.2023.100636 (2023) Zhang, H. et al. Emerging crosstalk between two signaling pathways coordinates K+ and Na+ homeostasis in the halophyte Hordeum Brevisubulatum. J. Exp. Bot. 71(14), 4345–4358. https://doi.org/10.1093/jxb/eraa191 (2020) Li, J. et al. Comparative transcriptome analysis reveals K+ transporter gene contributing to salt tolerance in eggplant. BMC Plant. Biol. 19, 67. https://doi.org/10.1186/s12870-019-1663-8 (2019) Hasanuzzaman, M. et al. Regulation of reactive oxygen species and antioxidant defense in plants under salinity. Int. J. Mol. Sci. 22(17), 9326. https://doi.org/10.3390/ijms22179326 (2021) Yan, J., Li, J., Zhang, H., Liu, Y. & Zhang, A. ZmWRKY104 positively regulates salt tolerance by modulating ZmSOD4 expression in maize. Crop J. 10(2), 555–564. https://doi.org/10.1016/j.cj.2021.05.010 (2022) Cao, B., Li, N. & Xu, K. Crosstalk of phenylpropanoid biosynthesis with hormone signaling in Chinese cabbage is key to counteracting salt stress. Environ. Exp. Bot. 179, 104209. https://doi.org/10.1016/j.envexpbot.2020.104209 (2020) Zhang, J. et al. Regulation of SmEXPA13 expression by SmMYB1R1-L enhances salt tolerance in Salix matsudana Koidz. Int. J. Biol. Macromol. 270(Pt 1). https://doi.org/10.1016/j.ijbiomac.2024.132292 (2024) Xie, Y. et al. Apple receptor-like kinase FERONIA regulates salt tolerance and ABA sensitivity in Malus domestica. J. Plant. Physiol. 270, 153616. https://doi.org/10.1016/j.jplph.2022.153616 (2022) Wang, Z. et al. One year and multipoint comparative test of ‘Xisen 6’. J. Agric. 11(6), 13–18. https://doi.org/10.11923/j.issn.2095-4050.cjas20191200312 (2021) Gelmesa, D. et al. Vitro screening of potato genotypes for osmotic stress tolerance. Open. Agric. 2, 308–316. https://doi.org/10.1515/opag-2017-003 (2017) Howlader, O. & Hoque, M. A. Growth analysis and yield performance of four potato (Solanum tuberosum L.) varieties. Bangladesh J. Agril Res. 43(2), 267–280. https://doi.org/10.3329/bjar.v43i2.37330 (2018) Langmead, B., Trapnell, C., Pop, M. & Salzberg, S. L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 10(3). https://doi.org/10.1186/gb-2009-10-3-r25 (2009) Hardigan, M. A. et al. Genome reduction uncovers a large dispensable genome and adaptive role for copy number variation in asexually propagated Solanum tuberosum. Plant. Cell. 28(2), 388–405. https://doi.org/10.1105/tpc.15.00538 (2016) Friedländer, M. R., Mackowiak, S. D., Li, N., Chen, W. & Rajewsky, N. miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Nucleic Acids Res. 40(1), 37–52. https://doi.org/10.1093/nar/gkr688 (2012) Wen, M., Shen, Y., Shi, S. & Tang, T. miREvo: an integrative microRNA evolutionary analysis platform for next-generation sequencing experiments. BMC Bioinform. 13, 140. https://doi.org/10.1186/1471-2105-13-140 (2012) Zhou, L. et al. Integrated profiling of microRNAs and mRNAs: microRNAs located on Xq27.3 associate with clear cell renal cell carcinoma. PLoS One. 5(12). https://doi.org/10.1371/journal.pone.0015224 (2010) Fahlgren, N. et al. High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes. PLoS One. 2(2), e219. https://doi.org/10.1371/journal.pone.0000219 (2007) Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C(T)) method. Methods 25(4), 402–408. https://doi.org/10.1006/meth.2001.1262 (2001) Download references This work was supported by funding from the following projects: Key R&D Program of Shandong Province of China (grant number 2022LZGC017) National Natural Science Foundation of China (grant number 32201714 and 32301777) Natural Science Foundation of Shandong of China (ZR2023QC102) Talent Introduction Project of Dezhou University of China (grant number 2021xjrc303 and Project of Shandong Province Higher Educational Science and Technology Program (grant number 2023KJ270) Shandong Provincial Key Laboratory of Biophysics National Engineering Research Center for Potato revised the article and helped in funding acquisition All authors reviewed and edited the manuscript Download citation DOI: https://doi.org/10.1038/s41598-025-86276-5 Molecular Diagnostics Graphical abstract present Metrics details Non-small cell lung cancer (NSCLC) is characterised by its aggressiveness and poor prognosis Early detection and accurate prediction of therapeutic responses remain critical for improving patient outcomes we investigated the potential of circulating microRNA (miRNA) as non-invasive biomarkers in patients with NSCLC We quantified miRNA expression in plasma from 122 participants (78 NSCLC; 44 healthy controls) Bioinformatic tools were employed to identify miRNA panels for accurate NSCLC diagnosis Validation was performed using an independent publicly available dataset of more than 4000 NSCLC patients we correlated miRNA expression with clinicopathological information to identify independent prognostic miRNAs and those predictive of anti-PD-1 treatment response We identified miRNA panels for lung adenocarcinoma (LUAD) and squamous cell carcinoma (LUSC) diagnosis The LUAD panel consists of seven circulating miRNAs (miR-9-3p while the LUSC panel comprises nine miRNAs (miR-130b-3p and miR-205 (LUSC) serve as independent prognostic markers for survival exhibit predictive potential in anti-PD-1-treated LUAD patients Circulating miRNA signatures demonstrate diagnostic and prognostic value for NSCLC and may guide treatment decisions in clinical practice we hypothesised that miRNAs overexpressed in various NSCLC subtypes (LUAD or LUSC) tissue would also be elevated in the blood circulation of patients This pattern of elevated miRNA expression in the circulation could serve as a non-invasive diagnostic biomarker to identify NSCLC and distinguish between its subtypes We aimed to investigate circulating miRNA as biomarkers in various clinical applications of NSCLC management and treatment We investigated whether NSCLC-specific circulating miRNA I) are elevated in the plasma of NSCLC patients compared to healthy individuals and could serve as a lung cancer non-invasive screening tool II) could determine the prognosis of NSCLC patients III) could be utilised as predictive markers for survival under ICI treatment and IV) could assist in monitoring treatment response We compared the circulating miRNA expression in the plasma of patients with LUAD and LUSC to healthy individuals Our results were cross-validated using a publicly available independent dataset of nearly 4000 NSCLC patients aiming to refine the use of miRNAs in NSCLC screening and improve patient survival our findings advance the application of miRNAs as non-invasive biomarkers in NSCLC management and treatment personalisation The study included individuals >18 years of age with untreated irrespective of the disease stage or healthy individuals who served as controls Participants provided informed consent to give blood for the study Patients with previous treatment for lung cancer and patients with known secondary malignancies were excluded Other types of non-cancerous diseases were not excluded The Ethics Committee of the Canton of Bern Switzerland approved the use of human specimens in this study (Project ID: 2018-01756) Blood samples were collected at Inselspital Blood samples were collected in standard 7.5 mL EDTA tubes Plasma was then extracted by centrifugation (20 °C and stored at −80 °C at the Liquid Biobank Bern Differentially expressed miRNAs were determined according to the false discovery rate (FDR) < 0.05 Unsupervised clustering was performed on miRNAs with logFC >2 (4-fold induction or reduction) We used Qiagen’s miRNeasy Serum/Plasma Advanced Kit (Qiagen No./ID: 217204) to extract miRNAs from a 0.5 mL plasma sample which included a spin down at 1000 rpm for 3 min and RNA extraction from the supernatant The miRNA was extracted in a volume of 10 μL and used for reverse transcription The Sp4/Sp5 spike-in mix was added at the beginning of the extraction as internal control Sp4 was used as an extraction control and during the normalisation step (Qiagen The miRNA extraction sample (10 μL) was used for the reverse transcription transcribed with the miRCURY LNA RT kit (Qiagen Sp6 and Cel-miR-39-3p (Cel39) were added as an RT positive control during the RT process according to the manufacturer’s instructions and recommendation (Qiagen Plasma-derived miRNA expression was measured using miRCURY LNA SYBR Green PCR kits (Qiagen MiRCURY LNA miRNA primers were used (Qiagen QPCR was conducted in 384-well plates with 10 μL end volume 1:10 diluted cDNA using the Viia7 Real-Time PCR system (Applied Biosystems) ΔCt values were calculated using the Sp4 values (Ct(target)-Ct(Sp4)) (Qiagen Normalisation and statistical differences between LUSC and LUAD plasma and healthy donor samples were assessed using RStudio v4.2.1 (2022-06-23) Haemolysis contamination was defined as ΔCt (miR-23a-3p-miR-451a) > 7 as recommended by the miRCURY LNA miRNA Focus PCR Panels kit (Qiagen The concentration of Carcinoembryonic antigen (CEA) protein was measured using the RayBio® Human CEA ELISA Kit (Cat No./ID: ELH-CEA) with an initial 50 µL plasma according to the kit protocol This study aimed to identify differentially expressed circulating miRNA expression in LUAD and LUSC subtypes of NSCLC and assess their potential as biomarkers for distinguishing between the subtypes of NSCLC and healthy donors we selected the miRNAs that were pathologically upregulated in the cancer tissues of LUAD and LUSC patients compared to the normal adjacent tissues from The Cancer Genome Atlas (TCGA) data bank we evaluated the expression of those selected candidate miRNAs in the plasma of LUAD and LUSC cancer patients and healthy individuals serving as controls We prospectively collected NSCLC and healthy plasma samples between 07-Dec-2018 and 29-Aug-2022 and the median follow-up time for survival in the entire NSCLC cohort was 43.2 months We assessed the time to progression (progression-free survival Collected clinicopathologic co-variables included: Disease stage according to the 8th edition of TNM classification treatment response according to RECIST 1.1 criteria All procedures performed in this study involving human participants were in accordance with the ethical standards of the institutional and/or cantonal ethics committee with the Helsinki Declaration and with the Swiss Federal Human Research Act (HRA) The CombiROC algorithm selects the miRNAs with the highest area under the curve (AUC) in a receiver operating characteristic (ROC) curve and displays their test sensitivity (SE) and specificity (SP) values and statistical tests used in every experiment can be found in the corresponding figure legend All p-values were considered significant when p < 0.05 We clustered the data for heatmaps according to Euclidean’s method based on the average linkage and generated heatmaps according to the standard normal distribution a Flow chart for the NSCLC circulating miRNA study b Heatmap and boxplot showing the differentially expressed (DE) miRNAs in malignant lung cancer and matched normal tissue Rows represent miRNA IDs; columns represent TCGA sample IDs A log2FC > 2 (4-fold induction or reduction) with a p-value of <0.05 was used as a threshold and considered significant 42 miRNAs are differentially expressed (27 upregulated 61 miRNAs are differentially expressed (40 upregulated The baseline characteristics of enrolled patients are summarised in Supplementary Table 1 Our study population includes patients with early and late-stage NSCLC The median age of the patients did not differ significantly; however the LUSC cohort had a higher number of men and a higher smoking rate than the LUAD cohort reflecting the strong association of male smokers with the incidence of LUSC These results indicate that the different NSCLC subtypes have distinct miRNA expression signatures implying that different miRNA panels need to be investigated for NSCLC biomarker studies We then selected the DE miRNAs from LUAD and LUSC to investigate their presence in the bloodstream a Heatmap and boxplot indicate DE miRNA expression (n = 28) b Correlation plot of DE miRNA expression levels Similar variables are placed adjacently using correlation-based variable ordering Darker colours and larger circles indicate stronger correlations while red represents a negative correlation c Heatmap and boxplot show DE miRNA expression (n = 28) in the validation cohort Data is displayed as means ± SD; statistical evaluation using Student’s t-test and significant are miRNAs with p < 0.05 d Heatmap of DE miRNA expression in early disease stage (n = 13) e Heatmap of DE miRNA expression in late disease stage (n = 19) f Venn diagram depicting overlapped DE miRNA (n = 6) between early-stage vs as well as stage-specific miRNAs in the early-stage (n = 7) and late-stage (n = 13) g ROC analysis reveals the best combination panel of DE miRNAs with the highest sensitivity (SE) and specificity (SP) as well as the best area under the curve (AUC) for the LUSC cohort h Violin plot shows the probability density of the two compared sample groups (LUSC vs i Pie chart shows the percentages of false predictions (false positives j Table displays the best miRNA combination panel according to the highest AUC and optimal cut-off in both LUSC and validation cohorts as determined by the CombiRoc analysis the validation cohort included an additional blood sample analysis after surgical removal of the lung cancer and in nearly all samples a significant drop in the miRNA expression was observed This suggests that the circulating miRNAs originate from the tumour miRNA expression levels in LUAD were highly independent of tumour stage Only hsa-miR-210-3p and hsa-miR-301a-5p were identified as early-stage biomarkers and hsa-miR-147b-3p as late-stage biomarkers we observed a higher variety between early and late-stage-specific miRNA as only six miRNA species appeared in both stages hsa-miR-210-3p and hsa-miR-301a-5p appeared as early-stage-specific miRNAs in both LUAD and LUSC cohorts and hsa-miR-9-5p was found to be a late-stage biomarker in both cohorts underscoring the critical role of utilising miRNA panels to maximise the specificity for NSCLC diagnosis a Kaplan–Meier plots of overall survival (OS) for the LUAD cohort showing significant prognostic miRNAs based on DE miRNA expression (n = 3 The cut-off for high or low miRNA expression was assessed by the X-tile programme b Multivariate Cox regressional hazard analysis for prognostic miRNAs (n = 3) in LUAD cohort with clinical variables such as stage c Kaplan–Meier plots of OS for the LUSC cohort representing significant prognostic miRNAs according to DE miRNA expression (n = 7 d Multivariate Cox regressional hazard analysis for prognostic miRNAs (n = 2) in the LUSC cohort with clinical variables such as stage To summarise, our results indicate that hsa-miR-135b-5p, hsa-miR-196a-5p, and hsa-miR-31-5p for LUAD, as well as both strands of hsa-miR-205, are promising prognostic biomarkers that should be further validated in other independent cohorts prospectively. The insignificant miRNAs for both LUAD and LUSC are shown in Supplementary Fig. 6 We investigated whether circulating miRNA could predict survival under immunotherapy with an anti-PD1 immune-checkpoint inhibitor (ICI) We performed a Kaplan–Meier survival analysis on 12 LUAD patients who received ICI alone (ICI mono; n = 5) or ICI plus chemotherapy (ICI + Chemo; n = 7) as first-line treatment for advanced-stage disease Due to the low number of LUSC patients that received ICI treatment (n = 4) We chose PFS after the start of ICI treatment as the endpoint to eliminate possible bias by second-line therapies a PD-L1 tissue staining (positive >1% b Tissue PD-L1 expression-based Kaplan–Meier-estimated progression-free survival (PFS) in NSCLC patients (n = 12) c Kaplan–Meier-estimated PFS in NSCLC patients treated with ICI mono (n = 5) d Kaplan–Meier-estimated PFS based on DE miRNAs (n = 10) in NSCLC patients treated with ICI e The alluvial plot illustrates the patient cohorts undergoing ICI therapy These groups are split into two categories: PD-L1 negative or positive quantified as exceeding the median expression levels showed as a red colour while ‘L’ represents a low expression of miRNA Those “miRNA-shedders” have a lower survival rate under ICI treatment than patients with lower expression levels a Clinical profiles of patients treated with various therapies (n = 10) (CR: Complete Response b Changes in DE miRNA expression alteration between pre-treatment and post-treatment samples c Heatmap of 17 differentially expressed miRNAs in five LUAD patients d Heatmap of 28 differentially expressed miRNAs in five LUSC patients we demonstrate that circulating miRNA can be a source of novel biomarkers for the diagnosis and treatment management of NSCLC we combined different data sources to identify the most robust and relevant biomarkers: starting with publicly available TCGA data on miRNA expression in tumour tissue we focused on a limited number of miRNA candidates to minimise non-tumour-related influences on the composition of the circulating miRNA pool We then investigated these miRNA candidates in a prospective cohort of NSCLC patients and healthy individuals at our Cancer Centre and our findings were validated in an independent previously published big study cohort of more than 4000 lung cancer patients as well as the lower number of candidate miRNAs for testing may provide advantages in terms of cost-effectiveness and rapid qPCR analysis Such an approach is easily adaptable to clinical applications we have a high certainty that the investigated miRNA originates from the tumour which may lead to improved diagnostic specificity This approach also opens the possibility of developing a therapy-guiding diagnostic tool for future miRNA-based treatment approaches gives us confidence that our diagnostic panels are reliable and reproducible To implement such a diagnostic test for NSCLC screening in clinical practice Strategies include low-threshold testing endorsed by family doctors or pneumologists Integrating the blood test into national cancer screening programmes could further enhance acceptance among patients and primary care providers the absolute benefit of adjuvant therapy remains limited A more targeted selection of patients who can truly benefit from adjuvant therapy remains desirable Our prognostic markers may help identify patients who are at high or low risk of relapse The applicability of circulating miRNA in the selection of adjuvant therapies must be tested in an independent study the impact of these miRNAs on the tumour microenvironment and immune cells was beyond the scope of the present study such as prostate-specific antigen (PSA) in prostate cancer there are no widely established biomarkers in the clinic for monitoring treatment response in NSCLC Radiographic exams (computed tomography) are commonly used to determine treatment response under therapy or remission status following curative treatment Those radiologic examinations must be repeated at longer intervals to provide information on response They are resource-intensive and expose patients to radiation could provide a rapid assessment of treatment response or remission status and support clinical treatment decisions we found that serial measurement of the candidate miRNAs correlates with tumour response according to radiological criteria in the vast majority of cases This finding suggests that measuring circulating miRNA with cost-effective laboratory methods for universal adoption allows monitoring treatment responses in NSCLC in a non-invasive manner our study offers several advantages over existing analyses: (I) Targeted miRNA candidate selection: Our innovative approach which involves selecting specific miRNA candidates from tissue analysis (II) Simple analysis method: Our straightforward analysis method by qPCR requires minimal effort to implement in clinical practice (III) Validation: We validated our diagnostic miRNA panels in completely independent data sets (IV) Integration of clinical parameters: we provide a comprehensive analysis of circulating miRNAs spanning different levels such as diagnosis Our study has a few limitations: Normalising circulating miRNA against endogenous genes is known to be challenging we used uniform plasma volumes and normalised against RNA spike-ins we did not investigate whether the miRNA circulates freely or in extracellular vesicles particularly in survival prediction during ICI treatment These findings should be validated thoroughly in a larger study cohort In summary, the findings support that circulating miRNAs have enormous potential as biomarkers in the management of NSCLC patients, from diagnosis to treatment and monitoring (Supplementary Tables 2 and Table 3) Our study highlights the substantial clinical potential of circulating miRNA profiling as a robust and non-invasive tool for managing NSCLC We provide validated circulating miRNA profiles specifically tailored for NSCLC diagnosis demonstrating high sensitivity and specificity we present evidence supporting individual miRNAs as both independent prognostic biomarkers and predictors of response to immune-checkpoint inhibitors All human transcriptomic data compiled for this study was taken from the Gene Expression Omnibus (GEO) (https://www.ncbi.nlm.nih.gov/geo/) database with accession number GSE137140 Global Cancer Statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries The 2015 World Health Organization Classification of Lung Tumors: impact of genetic clinical and radiologic advances since the 2004 classification European cancer mortality predictions for the year 2023 with focus on lung cancer Epigenetics in non-small cell lung cancer: from basics to therapeutics P1.19 Lung cancer screening initiative and identification of novel blood biomarkers for early detection of lung cancer Screening for lung cancer: US preventive services task force recommendation statement Osimertinib in untreated EGFR-mutated advanced non-small-cell lung cancer Pembrolizumab plus chemotherapy in metastatic non-small-cell lung cancer Five-year outcomes with pembrolizumab versus chemotherapy for metastatic non-small-cell lung cancer with PD-L1 tumor proportion score ≥ 50 STK11 and KEAP1 mutations as prognostic biomarkers in an observational real-world lung adenocarcinoma cohort Is Evolutionary Conservation a Useful Predictor for Cancer Long Noncoding RNAs miRNA deregulation in cancer cells and the tumor microenvironment Circulating miRNAs as sensitive and specific biomarkers for the diagnosis and monitoring of human diseases: promises and challenges TCGAbiolinks: an R/Bioconductor package for integrative analysis of TCGA data Lu G. Sample size formulas for estimating areas under the receiver operating characteristic curves with precision and assurance. Electronic Thesis and Dissertation Repository 8045 ir.lib.uwo.ca/etd/8045/ [Internet] CombiROC: an interactive web tool for selecting accurate marker combinations of omics data Usefulness of circulating microRNAs miR-146a and miR-16-5p as prognostic biomarkers in community-acquired pneumonia A miRNA-based diagnostic model predicts resectable lung cancer in humans with high accuracy X-Tile: a new bio-informatics tool for biomarker assessment and outcome-based cut-point optimization Carcinoembryonic antigen (CEA) as tumor marker in lung cancer IL-33-ST2 signaling promotes stemness in subtypes of myeloid leukemia cells through the Wnt and Notch pathways CD8(+) T cells expand stem and progenitor cells in favorable but not adverse risk acute myeloid leukemia IL-9 secreted by leukemia stem cells induces Th1-skewed CD4+ T-cells Is PD-L1 a consistent biomarker for anti-PD-1 therapy The model of balstilimab in a virally-driven tumor Evaluating the use of circulating microRNA profiles for lung cancer detection in symptomatic patients Integrated analysis of circulating cell free nucleic acids for cancer genotyping and immune phenotyping of tumor microenvironment STAT3/miR-135b/NF-kappaB axis confers aggressiveness and unfavorable prognosis in non-small-cell lung cancer Diagnostic assay based on hsa-miR-205 expression distinguishes squamous from nonsquamous non-small-cell lung carcinoma MiR-205-5p promotes lung cancer progression and is valuable for the diagnosis of lung cancer miRNA-seq tissue diagnostic signature: a novel model for NSCLC subtyping Prognostic role of circulating miRNAs in early-stage non-small cell lung cancer Adjuvant atezolizumab after adjuvant chemotherapy in resected stage IB-IIIA non-small-cell lung cancer (IMpower010): a randomised Cancer exosome-derived miR-9 and miR-181a promote the development of early-stage MDSCs via interfering with SOCS3 and PIAS3 respectively in breast cancer Gastric cancer-derived exosomal miR-135b-5p impairs the function of Vγ9Vδ2 T cells by targeting specificity protein 1 TGF-β-inducible microRNA-183 silences tumor-associated natural killer cells Download references The results shown here are in part based upon data generated by the TCGA Research Network: https://www.cancer.gov/tcga Heather Dawson for providing pictures of PD-L1 stained tumour samples This study was funded by: CTU-Forschungs-Grants Insel Gruppe Swiss National Science Foundation (SNSF): P300P3_155328 Bernische Stiftung für klinische Krebsforschung Open access funding provided by University of Bern These authors jointly supervised this work: Ramin Radpour Graduate School of Cellular and Biomedical Sciences Maryam Abdipourbozorgbaghi & Adrienne Vancura analysed the data and wrote the manuscript AV performed experiments and analysed the data wrote the manuscript and supervised the project The local ethical committee approved the studies with human participants (Kantonale Ethikkommission Bern Written informed consent was obtained from all participants Download citation DOI: https://doi.org/10.1038/s41416-024-02831-3 Metrics details Amniotic fluid (AF)-derived exosomal miRNA have been explored as potential contributors to the pathogenesis of Tetralogy of Fallot (TOF) This study aimed to investigate the expression profiles of AF-derived exosomal miRNAs and their potential contribution to TOF development Exosomes were isolated from AF samples obtained from pregnant women carrying fetuses diagnosed with TOF AF-derived exosomal miRNAs expression profiles were generated using the Agilent human miRNA Array V21.0 comparing 5 TOF samples with 5 healthy controls Differential expression analysis identified 257 significantly dysregulated miRNAs in the TOF group KEGG pathway enrichment analysis revealed that the predicted targets of these differentially expressed miRNAs were enriched in pathways associated with congenital disorders 25 of these miRNAs were previously reported to be regulated by both Notch and Wnt signaling pathways Further investigation using mouse embryonal carcinoma P19 cells revealed that miR-10a-5p overexpression inhibited cardiomyogenic differentiation as evidenced by the suppression of cardiomyocyte marker genes like TBX5 A dual-luciferase reporter assay confirmed TBX5 as a direct target of miR-10a-5p suggesting a regulatory mechanism involving their interaction our study demonstrates that miR-10a-5p may contribute to the pathogenesis of TOF by impairing cardiomyocyte differentiation through direct targeting of TBX5 These findings enhance our understanding of TOF and its molecular underpinnings These findings underscore the genetic complexity underlying TOF development the precise molecular mechanisms contributing to fetal TOF development are still not fully elucidated These findings have sparked interest in exploring the potential of exosomal miRNAs derived from amniotic fluid as valuable candidates for directly investigating the etiology of TOF no studies have explored the potential correlation between exosomal miRNAs derived from AF and the prenatal development of TOF the objective of this study was to investigate the expression patterns of exosomal miRNAs in AF and elucidate their involvement in TOF development Our findings revealed that 25 exosomal miRNAs derived from AF exhibited the potential to regulate the expression of genes associated with congenital heart disease thus representing promising candidate miRNAs implicated in TOF miR-10a-5p emerged as a suppressor of cardiomyocyte marker gene expression suggesting its ability to modulate cardiomyogenic differentiation by targeting TBX5 Considering that AF-derived exosomal miRNAs can provide direct insights into the maturation and degradation of fetal structures our study contributes to a better understanding of the etiology of fetal TOF and offers the potential for early diagnosis and body mass index (BMI) did not show significant differences between the TOF group and the control group (P > 0.05) The gestational week was determined based on the last menstrual period and an ultrasound scan conducted between gestational weeks 11 and 13+6 Fetuses with abnormal karyotypes were excluded from the study AF samples were collected by amniocentesis at the Second Affiliated Hospital of Fujian Medical University from January 2019 to June 2020 following the acquisition of informed consent from the pregnant women before any study procedures were performed This study received approval from the Ethics Committee of the Second Affiliated Hospital of Fujian Medical University (NO All experimental procedures adhered to the principles outlined in the World Medical Association Declaration of Helsinki the AF was subjected to centrifugation at 300×g to eliminate cells followed by centrifugation at 2,000×g for 30 min to remove cellular debris the resulting supernatant underwent centrifugation at 12,000×g for 45 min The resulting supernatant was carefully transferred to an ultracentrifuge tube and subjected to centrifugation at 110,000×g for 2 h The resulting pellet was resuspended in 10 ml of phosphate-buffered saline (PBS) filtered through a 0.22-µm filter (Millipore and subjected to centrifugation at 110,000×g for 70 min containing the concentrated exosome population was resuspended in 50 µl of PBS and stored at −80 °C until further use The morphology of exosomes was characterized using transmission electron microscopy (TEM) Approximately 20 µl of exosomes was fixed with 2% glutaraldehyde followed by counterstaining with 4% uranyl acetate Fixed exosomes were then placed onto formvar-coated 200-mesh copper grids and allowed to air-dry at room temperature for 2 min the grids were negatively stained with phosphotungstic acid Images were captured using a transmission electron microscope (FEI The size distribution of particles within the range consistent with exosomes was determined using nanoparticle tracking analysis (NTA) Each diluted exosome sample was subjected to three 60-second video recordings using a nanoparticle tracking analyzer (Nanosight the Nanosight system was calibrated and the automatic measurement settings were configured The samples were initially diluted at a ratio of approximately 1,000-fold the concentration was adjusted to ensure that it fell within the optimal working range (20–40 particles per frame) of the instrument The microarray analysis of the isolated exosomes was conducted by CapitalBio Corporation (Beijing Report NO.: JD-YX-2019-0856-JSFU-01) using the Agilent (Santa Clara The Agilent array design consisted of eight identical arrays per slide (8 × 60 K format) with each array containing probes targeting 2,549 human mature miRNAs based on miRBase R21.0 Each miRNA was probed 30 times for accurate detection The microarray experiments were performed following the manufacturer’s instructions miRNAs were labeled using the miRNA labeling reagent (Agilent Total RNA was dephosphorylated and ligated with pCp-Cy3 and the labeled RNA was subsequently purified and hybridized to the miRNA arrays The resulting images were scanned using a microarray scanner (Agilent and the data were gridded and analyzed using Agilent feature extraction software version 10.10 The miRNA array data obtained were processed using GeneSpring software V13 (Agilent) for tasks such as summarization the default 90th percentile normalization method was employed Differentially expressed (DE) miRNAs were identified by applying threshold criteria of P-value < 0.05 and |log2(fold change)| ≥ 1 which are considered statistically significant Further analysis involved log2 transformation and median-centering of the data based on miRNA expression utilizing the Adjust Data function in CLUSTER 3.0 software the resulting clustering tree was visualized using Java Treeview (Stanford University School of Medicine the KEGG DISEASE and OMIM databases were used to identify genes with established roles or predicted associations with TOF and CHD P19 cells were acquired from the American Type Culture Collection (ATCC The cells were cultivated in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco USA) supplemented with 10% fetal bovine serum (FBS) (Corning The cell culture was maintained in a humidified incubator at 37 °C with 5% CO2 P19 cells were grown as cell aggregates on bacteriologic dishes using DMEM containing 10% FBS and 1% dimethyl sulfoxide (Sigma-Aldrich the cell aggregates were transferred to culture flasks containing DMEM with 10% FBS All reactions were carried out in triplicate The relative expression levels of the miRNAs were normalized to the levels of U6 small nuclear RNA and the fold change was calculated using the 2-∆∆Ct method The results were represented as the fold change relative to the control To identify miR-10a-5p target binding sites within the 3’-untranslated region (UTR) of TBX5 mRNA HEK293 cells were plated in 24-well plates and co-transfected with either the wild-type or mutant (carrying a single point mutation) TBX5 3’-UTR reporter plasmids using Lipofectamine 3000 the cells were further transfected with the miR-10a-5p mimic or inhibitor (Sangon Biotech Following an additional 24-hour incubation period the cells were collected for the luciferase activity assay which was conducted using the Dual-Luciferase Reporter Assay System (Promega Statistical analyses were conducted using version 3.5.2 of the R statistical package All experiments were independently performed in triplicate to ensure reproducibility and the quantitative data are presented as mean ± standard deviation (SD) Statistical analyses were carried out utilizing Prism 7 software (GraphPad a two-tailed Student’s t-test was employed Statistical significance was defined as a P-value less than 0.05 (P < 0.05) Hierarchical clustering was carried out to assess the expression levels of differentially expressed miRNAs (DE-miRNAs) The resulting clusters were visualized through the use of a heatmap Identification of human AF-derived exosomes by TEM (A) Representative TEM image of AF-derived exosomes (B) Representative results of NTA analysis of exosomes from human AF Differentially expressed miRNAs in TOF AF-derived exosomes compared to AF-derived exosomes from healthy controls (A) Heatmap based on the 257 DE-miRNAs in AF-derived exosomes from healthy controls (N1-N5) and fetuses with TOF (T1-T5) (B) The genomic locations of DE-miRNAs are distributed throughout the human chromosomes (C) Overlap of DE-miRNAs in AF-derived exosomes from fetuses with TOF identified in the present study and differentially expressed myocardial miRNAs in TOF patients identified in previous studies (D) Overlap of DE-miRNAs in AF-derived exosomes from fetuses with TOF identified in the present study and differentially expressed circulating miRNAs in TOF patients and circulating miRNAs in women carrying fetuses with TOF identified in previous studies miR-15b-5p and miR-26a-5p exhibited altered expression in all three studies Target prediction of differentially expressed miRNAs (A) KEGG disease enrichment analysis of the target genes of DE-miRNAs (B) The top 20 KEGG pathways based on gene enrichment of DE-miRNAs GO-based gene enrichment analysis of the DE-miRNAs including biological process (C) cellular component (D) and molecular function (E) Expression of 25 DE-miRNAs and Construction of the miRNAs-mRNAs Interaction Network (A) Overlap of DE-miRNAs in AF-derived exosomes from fetuses with TOF identified in the present study versus Notch-regulated and Wnt-regulated miRNAs (B) Heatmap of the 25 of 257 miRNAs in this study overlapped with Notch-regulated and Wnt-regulated miRNAs simultaneously (C) The predicted target genes of the 25 DE-miRNAs were identified by screening the miRWalk3.0 database The network map indicated that 18 DE-miRNAs targeted 24 genes involving in tetralogy of Fallot and congenital heart diseases The regulatory influence of these miRNAs on the expression of these genes holds significant potential in terms of modulating heart development and contributing to CHD Effect of miR-10a-5p and miR-200a-3p on P19 cell differentiation (A) Six miRNAs with the largest fold changes in expression between TOF and control group were validated in all 5 TOF and 5 healthy samples used for array analysis and in 4 additional paired samples by qRT-PCR analysis The data were representative of at least three independent experiments (B) P19 embryonic carcinoma stem cells were transfected with miR-10a-5p mimic and the cells were stimulated with 1% DMSO to induce differentiation into cardiomyocytes qRT-PCR was used to analyze the expression of cardiomyocyte marker gene transcripts (TBX5 The results show that upregulation of miR-10a-5p inhibited the expression of cardiomyocyte marker genes (C) Overexpression of miR-200a-3p inhibited the expression of GATA4 but had no effect on the expression of TBX5 and NKX2.5 These findings provide compelling evidence that the upregulation of miR-10a-5p impedes the expression of cardiomyocyte marker genes during the cardiomyogenic differentiation of P19 cells (A) The binding site of miR-10a-5p in the 3′-UTR of TBX5 was predicted by bioinformatics analyses (B) Luciferase reporters expressing the wild-type or mutated 3′-UTR of TBX5 were designed according to miR-10a-5p seed sequences (C) A dual-luciferase reporter assay was performed to verify that miR-10a-5p regulated the luciferase activity of TBX5 3’UTR- wild-type but did not influence that of Tbx5 3’UTR-mutated these findings provide compelling evidence that TBX5 is indeed targeted by miR-10a-5p and the interaction between miR-10a-5p and the 3’-UTR of TBX5 mRNA plays a role in the regulation of TBX5 protein expression AF contains crucial factors for fetal development and provides valuable insights into the maturation and degeneration of fetal structures and western blotting techniques to confirm the presence of exosomes in AF we conducted a microarray analysis to compare the miRNA profiles of exosomes derived from AF samples obtained from fetuses diagnosed with TOF and healthy fetuses we identified a panel of 25 miRNAs present in AF-derived exosomes that are likely to play significant roles in the embryonic development of the heart most of these investigations have focused on the analysis of miRNA expression profiles in the peripheral blood or cardiac tissues of TOF patients These well-established TOF-related genes and pathways provide a solid foundation for comprehending the role of miRNAs in TOF development and have the potential to uncover valuable biomarkers for prenatal TOF diagnosis The negative regulation of TBX5 by miR-10a-5p suggests a mechanism by which miR-10a-5p modulates cell proliferation and apoptosis in cardiac cells indicating that the dysregulation of the miR-10a-5p/TBX5 axis may play a significant role in the pathogenesis of TOF our study utilized pluripotent P19 cells as a myocardial cell model to explore the influence of miR-10a-5p and TBX5 on the developmental mechanisms leading to cardiac structural malformations Our study provides novel insights into the role of AF-derived exosomal miRNAs in the pathogenesis of TOF which may limit the generalizability of our findings Larger cohort studies are necessary to validate these results while our control group consisted of pregnancies undergoing amniocentesis for standard prenatal diagnostic indications unrelated to TOF (such as advanced maternal age or family history of genetic disorders) the presence of other underlying conditions in these pregnancies cannot be entirely ruled out and may influence exosomal miRNA profiles while we demonstrated the impact of miR-10a-5p on cardiomyocyte marker gene expression in vitro further investigation is necessary to fully elucidate the phenotypic effects of miR-10a-5p upregulation on cardiomyocyte differentiation in vivo including direct assessment of differentiation kinetics and potential broader developmental consequences our study successfully confirmed the presence of exosomes in AF and provided initial insights into the dysregulated expression of miRNAs in exosomes derived from the AF of fetuses with TOF we identified 25 miRNAs that exhibited differential expression between AF-derived exosomes from TOF fetuses and those from healthy fetuses our findings demonstrated that miR-10a-5p exerts inhibitory effects on the expression of cardiomyocyte marker genes and may play a role in modulating cardiomyogenic differentiation by directly targeting TBX5 it is important to note that our understanding of the genetic mechanisms underlying TOF remains incomplete and the outcomes presented in this study highlight the need for further investigations in this field The data presented in this study is available on the GEO database (accession numbers: GSE186059) Hill, M. C. et al. Integrated multi-omic characterization of congenital heart disease. Nature 608, 181–191. https://doi.org/10.1038/s41586-022-04989-3 (2022) Morgenthau, A. & Frishman, W. H. Genetic Origins of Tetralogy of Fallot. Cardiol. Rev. 26, 86–92. https://doi.org/10.1097/CRD.0000000000000170 (2018) Mamalis, M. et al. Comparison of the Results of Prenatal and Postnatal Echocardiography and Postnatal Cardiac MRI in Children with a Congenital Heart Defect. J. Clin. Med. 12 https://doi.org/10.3390/jcm12103508 (2023) Gou, Z. et al. Prenatal diagnosis and mRNA profiles of fetal tetralogy of Fallot. BMC pregnancy childbirth. 22, 853. https://doi.org/10.1186/s12884-022-05190-0 (2022) Goodship, J. A. et al. A common variant in the PTPN11 gene contributes to the risk of tetralogy of Fallot. Circ. Cardiovasc. Genet. 5, 287–292. https://doi.org/10.1161/circgenetics.111.962035 (2012) Khatami, M., Heidari, M. M., Kazeminasab, F. & Zare Bidaki, R. Identification of a novel non-sense mutation in TBX5 gene in pediatric patients with congenital heart defects. J. Cardiovasc. Thorac. Res. 10, 41–45. https://doi.org/10.15171/jcvtr.2018.07 (2018) Silencing mutations in JAG1 gene may play crucial roles in the pathogenesis of Tetralogy of Fallot Page, D. J. et al. Whole Exome Sequencing Reveals the Major Genetic Contributors to Nonsyndromic Tetralogy of Fallot. Circ. Res. 124, 553–563. https://doi.org/10.1161/circresaha.118.313250 (2019) Bowen, C. M., Ditmars, F. S., Gupta, A., Reems, J. A. & Fagg, W. S. Cell-Free Amniotic Fluid and Regenerative Medicine: Current Applications and Future Opportunities. Biomedicines 10 https://doi.org/10.3390/biomedicines10112960 (2022) Bhatti, G. et al. The amniotic fluid proteome changes with term labor and informs biomarker discovery in maternal plasma. Sci. Rep. 13, 3136. https://doi.org/10.1038/s41598-023-28157-3 (2023) Zwemer, L. M. & Bianchi, D. W. The amniotic fluid transcriptome as a guide to understanding fetal disease. Cold Spring Harb Perspect. Med. 5 https://doi.org/10.1101/cshperspect.a023101 (2015) Goumy, C. et al. Reduced telomere length in amniocytes: an early biomarker of abnormal fetal development? Hum. Mol. Genet. 31, 2669–2677. https://doi.org/10.1093/hmg/ddac054 (2022) Evans, M. I., Andriole, S. & Evans, S. M. Genetics: update on prenatal screening and diagnosis. Obstet. Gynecol. Clin. North. Am. 42, 193–208. https://doi.org/10.1016/j.ogc.2015.01.011 (2015) Li, Y. et al. The application of late amniocentesis: a retrospective study in a tertiary fetal medicine center in China. BMC pregnancy childbirth. 21, 266. https://doi.org/10.1186/s12884-021-03723-7 (2021) Jeppesen, D. K. et al. Reassessment of Exosome Composition. Cell 177, 428–445e418. https://doi.org/10.1016/j.cell.2019.02.029 (2019) Pegtel, D. M., Gould, S. J. & Exosomes Annu. Rev. Biochem. 88, 487–514 https://doi.org/10.1146/annurev-biochem-013118-111902 (2019) Ebert, B. & Rai, A. J. Isolation and Characterization of Amniotic Fluid-Derived Extracellular Vesicles for Biomarker Discovery. Methods Mol. Biol. 1885, 287–294. https://doi.org/10.1007/978-1-4939-8889-1_19 (2019) Therapeutic and diagnostic applications of extracellular vesicles Dixon, C. L. et al. Amniotic fluid exosome proteomic profile exhibits unique pathways of term and preterm labor. Endocrinology 159, 2229–2240. https://doi.org/10.1210/en.2018-00073 (2018) Nguyen, C. M. et al. Placental Exosomes as Biomarkers for Maternal Diseases: Current Advances in Isolation, Characterization, and Detection. ACS Sens. https://doi.org/10.1021/acssensors.3c00689 (2023) Rezaie, J., Feghhi, M. & Etemadi, T. A review on exosomes application in clinical trials: perspective, questions, and challenges. Cell. Commun. Signal. 20, 145. https://doi.org/10.1186/s12964-022-00959-4 (2022) Davidson, S. M. et al. Methods for the identification and characterization of extracellular vesicles in cardiovascular studies: from exosomes to microvesicles. Cardiovasc. Res. 119, 45–63. https://doi.org/10.1093/cvr/cvac031 (2023) Zhang, J. et al. MicroRNA deregulation in right ventricular outflow tract myocardium in nonsyndromic tetralogy of fallot. Can. J. Cardiol. 29, 1695–1703. https://doi.org/10.1016/j.cjca.2013.07.002 (2013) Grunert, M., Appelt, S., Dunkel, I., Berger, F. & Sperling, S. R. Altered microRNA and target gene expression related to Tetralogy of Fallot. Sci. Rep. 9, 19063. https://doi.org/10.1038/s41598-019-55570-4 (2019) Xu, J. et al. Progress in research on the role of exosomal miRNAs in the diagnosis and treatment of cardiovascular diseases. Front. Genet. 13, 929231. https://doi.org/10.3389/fgene.2022.929231 (2022) Tian, C., Gao, L., Zimmerman, M. C. & Zucker, I. H. Myocardial infarction-induced microRNA-enriched exosomes contribute to cardiac Nrf2 dysregulation in chronic heart failure. Am. J. Physiol. Heart Circ. Physiol. 314, H928–h939. https://doi.org/10.1152/ajpheart.00602.2017 (2018) Isolation and characterization of exosomes from cell culture supernatants and biological fluids Dweep, H. & Gretz, N. miRWalk2.0: a comprehensive atlas of microRNA-target interactions. Nat. Methods. 12, 697. https://doi.org/10.1038/nmeth.3485 (2015) Kanehisa, M. & Goto, S. KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 28, 27–30. https://doi.org/10.1093/nar/28.1.27 (2000) Liang, D. et al. miRNA-940 reduction contributes to human Tetralogy of Fallot development. J. Cell. Mol. Med. 18, 1830–1839. https://doi.org/10.1111/jcmm.12309 (2014) Zhu, S. et al. Identification of maternal serum microRNAs as novel non-invasive biomarkers for prenatal detection of fetal congenital heart defects. Clin. Chim. Acta. 424, 66–72. https://doi.org/10.1016/j.cca.2013.05.010 (2013) Abu-Halima, M., Meese, E., Keller, A., Abdul-Khaliq, H. & Radle-Hurst, T. Analysis of circulating microRNAs in patients with repaired Tetralogy of Fallot with and without heart failure. J. Transl Med. 15, 156. https://doi.org/10.1186/s12967-017-1255-z (2017) Kozyrev, I. et al. Dysregulation of Notch signaling in cardiac mesenchymal cells of patients with tetralogy of Fallot. Pediatr. Res. 88, 38–47. https://doi.org/10.1038/s41390-020-0760-6 (2020) Matos-Nieves, A., Yasuhara, J. & Garg, V. Another Notch in the genetic puzzle of tetralogy of Fallot. Circ. Res. 1244, 462–464. https://doi.org/10.1161/CIR.0000000000000606 (2019) Hussain, N. et al. Down-regulation of miR-10a-5p in synoviocytes contributes to TBX5-controlled joint inflammation. J. Cell. Mol. Med. 22, 241–250. https://doi.org/10.1111/jcmm.13312 (2018) Yu, H., Wang, X. & Cao, H. Construction and investigation of a circRNA-associated ceRNA regulatory network in Tetralogy of Fallot. BMC Cardiovasc. Disord. 21, 437. https://doi.org/10.1186/s12872-021-02217-w (2021) Smith, T., Rajakaruna, C., Caputo, M. & Emanueli, C. MicroRNAs in congenital heart disease. Ann. Transl Med. 3, 333. https://doi.org/10.3978/j.issn.2305-5839.2015.12.25 (2015) Yang, Q. et al. Aberrant expression of miR-29b-3p influences heart development and cardiomyocyte proliferation by targeting NOTCH2. Cell Prolif, e12764 (2020). https://doi.org/10.1111/cpr.12764 Bittel, D. C., Kibiryeva, N., Marshall, J. A. & O’Brien, J. E. MicroRNA-421 Dysregulation is Associated with Tetralogy of Fallot. Cells 3, 713–723. https://doi.org/10.3390/cells3030713 (2014) Condorelli, G., Latronico, M. & Cavarretta, E. microRNAs in cardiovascular diseases: current knowledge and the road ahead. J. Am. Coll. Cardiol. 63, 2177–2187. https://doi.org/10.1016/j.jacc.2014.01.050 (2014) Shi, R. et al. Maternal exosomes in diabetes contribute to the cardiac development deficiency. Biochem. Biophys. Res. Commun. 483, 602–608. https://doi.org/10.1016/j.bbrc.2016.12.097 (2017) The relationship between amniotic fluid miRNAs and congenital obstructive nephropathy Li, D. et al. Characterization of circulating microRNA expression in patients with a ventricular septal defect. PLoS One. 9, e106318. https://doi.org/10.1371/journal.pone.0106318 (2014) Anderson, D. J. et al. NKX2-5 regulates human cardiomyogenesis via a HEY2 dependent transcriptional network. Nat. Commun. 9, 1373. https://doi.org/10.1038/s41467-018-03714-x (2018) Zhang, Y. et al. A new TBX5 loss-of-function mutation contributes to congenital heart defect and atrioventricular block. Int. Heart J. https://doi.org/10.1536/ihj.19-650 (2020) Akerman, M. et al. Differential connectivity of splicing activators and repressors to the human spliceosome. Genome Biol. 16, 119. https://doi.org/10.1186/s13059-015-0682-5 (2015) microRNA-10a targets T-box 5 to inhibit the development of cardiac hypertrophy Hussain, N. et al. Down-regulation of miR-10a-5p promotes proliferation and restricts apoptosis via targeting T-box transcription factor 5 in inflamed synoviocytes. Biosci. Rep. 38 https://doi.org/10.1042/BSR20180003 (2018) Zhang, X. et al. Gestational Leucylation Suppresses Embryonic T-Box Transcription Factor 5 Signal and Causes Congenital Heart Disease. Advanced science (Weinheim, Baden-Wurttemberg, Germany) 9, e2201034 (2022). https://doi.org/10.1002/advs.202201034 Gelb, B. et al. The Congenital Heart Disease Genetic Network Study: rationale, design, and early results. Circ. Res. 112, 698–706. https://doi.org/10.1161/circresaha.111.300297 (2013) Download references This work was supported by the Innovation and Entrepreneurship Project for High-level Talents of the Quanzhou Science and Technology Project (grant no First Affiliated Hospital of Xiamen University Collaborative Innovation Center for Maternal and Infant Health Service Application Technology of Education Ministry This study was approved by the Ethics Committee of the Second Affiliated Hospital of Fujian Medical University (NO 2019 − 233) and conducted according to the principles of the Declaration of Helsinki Download citation DOI: https://doi.org/10.1038/s41598-024-83576-0 Metrics details Nitrogen (N) deficiency responses are essential for plant survival and reproduction via an expression genome-wide association study (eGWAS) we reveal a mechanism that regulates microRNA (miRNA) dynamics necessary for N deficiency responses in Arabidopsis Differential expression levels of three NAC transcription factor (TF) genes involved in leaf N deficiency responses among Arabidopsis accessions are most significantly associated with polymorphisms in HASTY (HST) which encodes an importin/exportin family protein responsible for the generation of mature miRNAs HST acts as a negative regulator of N deficiency-induced leaf senescence and the disruption and overexpression of HST differently modifies miRNA dynamics in response to N deficiency altering levels of miRNAs targeting transcripts N deficiency prevents the interaction of HST with HST-interacting proteins This suggests that HST-mediated regulation of miRNA dynamics collectively controls regulations mediated by multiple N deficiency response-associated NAC TFs thereby being central to the N deficiency response network understanding the molecular mechanisms underlying N starvation-induced leaf yellowing is necessary to sustain plant growth in N-deficient environments despite the progress made in understanding the N deficiency response process the mechanisms regulating N deficiency responses remain largely unknown the mechanisms underlying these changes remain to be elucidated To investigate the molecular mechanisms regulating N deficiency responses we identified three NAC genes involved in N starvation-induced leaf senescence and conducted expression genome-wide association study (eGWAS) using 52 Arabidopsis accessions exhibiting natural diversity in the expression levels of these three NAC genes Expression levels of the three NAC genes showed a strong association with polymorphisms in HASTY gene (HST) which encodes an importin/exportin family protein that physically interacts with proteins involved in the generation of mature miRNAs Functional characterization of the HST revealed the essential role of HST-mediated regulation of miRNA dynamics in N deficiency-induced leaf senescence RT-qPCR analysis was performed on wild-type (WT) Col-0 seedlings grown initially on 1/2 MS agar plates for 5 days and then on N-deficient (0.3 mM N) medium for the indicated number of days Expression levels were normalized first against ACT2 transcript levels and then against the value obtained at time zero The same letters above each bar indicate that means did not differ significantly at the 0.05 level in Tukey’s multiple comparison test and SGR1 (e) and SGR2 (f) expression levels of WT The seedlings were initially grown on 1/2 MS agar plates for 5 days and then under control (6 mM N) or N-deficient (0.03 mM N) conditions for additional 7 days f Asterisks above each bar indicate significant differences between the WT and other samples (**p < 0.01; two-tailed Student’s t-test) expression levels were normalized first against ACT2 transcript levels and then against the value obtained in WT rosette leaves g Expression genome-wide association study (eGWAS) of 52 Arabidopsis accessions using NAP and ANAC055 expression levels as traits of interest Seedlings were initially grown on 1/2 MS agar plates for 5 days and then on N-deficient (0.03 mM N) medium for 5 days horizontal green lines indicate the significant genome-wide threshold (p-value = 5 × 10−6) Peaks consisting of single nucleotide polymorphisms (SNPs) located in the vicinity of the HASTY (HST) locus (At3G05040) are marked with a blue rectangle implying that HST may be involved in activation of NAP indicating that these two transgenic lines are HST overexpressors and total chlorophyll content of the shoots (c) of WT and 35S:HSTCol-0-MYC/hst-7 line 3 (L3) seedlings initially grown on 1/2 MS agar plates for 5 days and then under control (6 mM N) or N-deficient (0.3 mM and 0.03 mM N) conditions for 5 days d Immunoblot analysis of photosynthesis-associated proteins (Lhcb1 and 35S:HSTCol-0-MYC/hst-6 L1 seedlings initially grown on 1/2 MS agar plates for 5 days and then under control (6 mM N) or N-deficient (0.03 mM N) conditions for 5 days α-Tubulin was served as the loading control and fresh shoot (i) and root (j) weights of 4-week-old WT and 35S:HSTCol-0-MYC/hst-6 L1 plants grown hydroponically under N-sufficient (6 mM N) and then under N-free conditions for 2 weeks The 3rd or 4th rosette leaves were used for Fv/Fm ratio and chlorophyll content measurements and asterisks above each bar indicate significant differences between the WT and other samples (*p < 0.05; **p < 0.01; two-tailed Student’s t-test) a Venn diagrams showing differential changes in N deprivation-induced miRNA accumulation levels in WT and hst-6 leaves Total RNA was extracted from the shoots of WT and hst-6 seedlings grown initially on 1/2 MS agar plates for 5 days and then on N-sufficient (6 mM N; control) or N-deficient (0.3 mM N; low N [LN]) medium for 3 days Overlaps between genes whose expression increased (fold change [FC] > 2 p < 0.05) in hst-6 shoots and those whose expression increased (FC > 2 p < 0.05) during N deficiency in WT shoots are shown by gene number b Hierarchical clustering analysis of 168 miRNAs based on the N starvation-induced change in accumulation of each miRNA in WT shoots (WTLN/WTcontrol) and the relative value of accumulation in hst-6 shoots to that in WT shoots of each miRNA under control N conditions (hst-6control/WTcontrol) and LN conditions (hst-6LN/WTLN) Green and red rows represent downregulated genes and upregulated genes c Scatterplot representing the relationship between the effects of N deficiency and HST disruption on the accumulation of 168 miRNAs The analysis was performed using total RNA prepared from the nuclear fractions of the shoots of WT and 35S:HSTCol-0-MYC/hst-6 L1seedlings grown initially on 1/2 MS agar plates for 5 days and then on control (6 mM N) or N-deficient (0.3 mM N [LN]) medium for 3 or 5 days a Positions of the miR781 sequence and the miR781-guided cleavage site in NAP mRNA The cleavage site determined using RLM-5’RACE products is indicated by a vertical arrow in the alignment of the miR781 sequence with the miR781-like sequence in the NAP gene b Agarose gel electrophoresis of RLM-5’RACE products An arrowhead indicated the position of the main product The experiments were repeated 6 times with similar results c Time-course analysis of NAP expression levels in the shoots of WT and 35S:miR781 L1 seedlings grown initially under 1/2 MS agar plates for 5 days and then on N-deficient (0.3 mM N) medium for 2 and nap seedlings grown initially on 1/2 MS agar plates for 5 days and then on control (6 mM N) or N-deficient (0.03 mM N) medium for another 5 days g Image showing natural leaf senescence in 6-week-old WT and nap plants grown hydroponically under continuous white light irradiation h Images of dark-induced leaf senescence of detached leaves collected from 3-week-old WT The detached leaves after 0 and 3 days of dark incubation (DDI) are shown j Changes in the miR781 accumulation level in WT plants during natural (i) and dark-induced leaf senescence (j) l NAP expression levels in WT and 35S:miR781 (L1) plants during natural leaf senescence (k) and dark-induced leaf senescence in detached leaves incubated in the dark for the indicated time periods (l) i–l Relative miR781 accumulation and NAP expression levels Data were normalized first against ACT2 transcript levels and then against the value obtained at time 0 (c n = 4 biologically independent samples in (c i–l) and 5 biological independent samples in (e Significant differences between WT and other plants grown under the same nutrient conditions are indicated with asterisks (*p < 0.05 **p < 0.01; two-tailed Student’s t-test) in (c and with different letters (p < 0.05; Tukey’s multiple comparison test) in (i supporting the presence of the HST–miR781–NAP pathway WT and hst-6 seedlings were used as references the whiskers indicate the range from minimum to maximum values while the boxes extend from the 25th to 75th percentiles with the middle lines indicating the median values and 6 (pHST:HSTCol-0-MYC/hst-6) biologically independent samples i Analysis of the correlation of HST expression level with total chlorophyll content (h) and Fv/Fm ratio (i) and red dots represent the data obtained from five or more independent lines of pHST:HSTCol-0-MYC/hst-6 A black dot and white circle represent data from WT and hst-6 plants and pHST:HSTCol-0-MYC/Bak-7 seedlings grown initially on 1/2 MS agar plates for 5 days and then on control (6 mM N) or N-deficient (0.03 mM N) medium for 5 days asterisks above each bar indicate significant differences between WT and other samples in (b and l) or between HSTT1006A and other samples (d **p < 0.01; two-tailed Student’s t-test) we concluded that the T1006A substitution markedly damaged the functionality of HST a Relative miRNA accumulation levels in the shoots of 10-day-old Yeg-3 and hst-6 seedlings grown on 1/2 MS agar plates The data of 20 miRNAs whose accumulation was significantly up- or downregulated in the hst-6 mutant are shown Levels of each miRNA were normalized first against the transcript levels of ACT2 and then against the value obtained from Col-0 seedlings c Time-course analysis of three miRNAs (miR164a The seedlings were grown initially on 1/2 MS agar plates for 5 days and then on N-deficient (0.3 mM N) medium for 3 or 5 days n = 4 biologically independent samples with three rosette leaves per sample Asterisks indicate significant differences between WT and other samples (*p < 0.05; **p < 0.01; two-tailed Student’s t-test) d Yeast two-hybrid assays performed with HST or HSTT1006A as prey and DCL1 as bait The DNA-binding domain (BD) and transactivation domain (AD) of yeast Gal4 served as controls Transformants were grown on non-selective (-LW) and selective (-LWHA) media The experiment was repeated two times with similar results e Bimolecular fluorescence complementation (BiFC) assays and HAT1006A–RAN1 interactions were examined in protoplasts isolated from the rosette leaves of 3-week-old Col-0 plants The N-terminal of GFP (nGFP) was fused to HST and HST1006A while the C-terminal region of GFP (cGFP) was fused to DCL1 and RAN1 f RNA immunoprecipitation (RIP)–RT-qPCR assays for the quantitative evaluation of the interactions of HST or HST1006A with six miRNAs (miR164a HST-MYC and HST1006A-MYC fusion proteins were immunoprecipitated using anti-MYC antibodies from the cell lysates of 35S:HSTCol-0-MYC/Col-0 (L1) and 35S:HSTT1006A-MYC/Col-0 (L5) seedlings g RNA immunoprecipitation (RIP) –RT-qPCR assays for the quantitative evaluation of the interactions between HST and three miRNAs (miR164a and miR781) in the presence or absence of DCL1 Cell lysates were prepared from 35S:HSTCol-0-MYC/Col-0 (L1) seedlings and from seedlings homozygous for the introduced 35S:HSTCol-0-MYC construct and dcl1 alleles (35S:HSTCol-0-MYC/Col-0 x dcl1) that were grown on 1/2 MS agar plates for 12 days The HST-MYC fusion protein was immunoprecipitated from the cell lysate Asterisks above each bar indicate significant differences between Col-0 and other samples (b c) or between 35S:HSTCol-0-MYC/Col-0 (L1) and other samples (f suggesting the requirement of DCL1 in the interaction of HST with miRNAs these results demonstrate that the T1006A substitution decreases the interaction ability of HST with DCL1 and miRNAs leading to reduced accumulation of specific miRNAs a Time-course analysis of the expression levels of HST and DCL1 in the rosette leaves of WT (Col-0) seedlings grown initially on 1/2 MS agar plates for 5 days and then on N-deficient (0.3 mM N) medium for the indicated number of days Each gene expression level was normalized first against the ACT2 transcript level and then against the value obtained from the samples at time zero Significant differences among samples are indicated with different letters (p < 0.05; Tukey’s multiple comparison test) HST-MYC and HST1006A-MYC fusion proteins were extracted from the cell lysates of pHST:HSTCol-0-MYC/hst-6 and pHST:HSTT1006A-MYC/hst-6 seedlings grown initially on 1/2 MS agar plates for 5 days and then on N-deficient (0.3 mM N) medium for the indicated number of days The HST-nGFP construct was co-transfected with the DCL1-cGFP or RAN1-cGFP construct into protoplasts isolated from the rosette leaves of 3-week-old Col-0 plants grown hydroponically in control (6 mM N) or N-deficient (0.3 mM N) medium d Co-immunoprecipitation (co-IP) assay of HST-MYC and DCL1-FLAG proteins using 35S:HSTCol-0-MYC/35S:DCL1-FLAG seedlings grown initially on 1/2 MS agar plates for 5 days and then on N-deficient (0.3 mM N) medium for the indicated number of days The 35S:HSTCol-0-MYC/35S:DCL1-FLAG plant is the T3 progeny of the 35S:HSTCol-0-MYC/Col-0 (L1) × 35S:DCL1-FLAG/Col-0 (L1) cross homozygous for the two introduced constructs: 35S:HSTCol-0-MYC/Col-0 and 35S:DCL1-FLAG/Col-0 The HST-MYC protein and six miRNAs (miR164a and miR781) were co-immunoprecipitated using the cell lysates of 35S:HSTCol-0-MYC/Col-0 seedlings that were grown initially on 1/2 MS agar plates for 5 days and then on N-deficient (0.3 mM N) medium for the indicated number of days Co-immunoprecipitated miRNAs and UBQ10 transcripts (negative control) were quantified by RT-qPCR Asterisks above each bar indicate significant differences between samples that were collected before and after 3 or 5 days of low N treatment (*p < 0.05 b–d These experiments were repeated at least two times with similar results despite identifying the miRNA biogenesis pathway and observing large-scale changes in miRNA profiles in response to various stimuli the physiological importance of dynamic changes in miRNA profiles under stress conditions and the molecular mechanisms responsible for the dynamic changes have yet to be clarified by the eGWAS of Arabidopsis accessions with differential expression levels of NAP and ANAC055 that encode N deficiency response-associated senNAC TFs that HST activity modulates the biogenesis of N deficiency-related miRNAs including miR164 targeting the ORE1 transcripts and miRNA781 targeting the NAP transcripts we propose that HST-mediated regulation of miRNA dynamics is a regulatory mechanism that controls N deficiency responses in plants This mechanism is likely central to the network regulating N deficiency responses because it regulates the activity of multiple N deficiency-responsive TFs the finding that HST activity is closely linked to the biogenesis of selective miRNAs provides a clue to reveal how miRNA profiles dynamically change in response to developmental and environmental stimuli it is unknown whether CRD1 and HASTY homologs in other plant species are involved in N deficiency responses and other environmental responses Functional characterization of HASTY homologs in other plant species would clarify whether HASTY-mediated miRNA dynamics is an important process common to many plant species for N deficiency responses suggesting that the miR781-NAP module is critical for N deficiency only in some Brassica species whose expression is regulated by N deficiency in an HST-dependent manner will lead to a full understanding of the significance of miRNA-mediated regulation in N deficiency responses the identification of the target genes of each miRNA may reveal the miRNA-mediated N deficiency response network in plants the T1006A substitution may affect the function of its N-terminal region leading to the reduced ability to interact with DCL1 and miRNAs it is still possible that even though the T1006A substitution does not affect the nuclear localization of HST it is vital for HST activity in the nucleus By comparing the amino acid sequences of HST proteins encoded by different HST alleles the significance of the 1006th threonine residue was first identified the T1006A substitution was found to induce different HST activity levels in distinct Arabidopsis accessions which were at least partly responsible for the different speeds of N starvation-induced leaf senescence in these accessions T1006 is undoubtedly critical for HST activity investigating the role of T1006 in maintaining biochemical and structural properties and consequently the activity of HST would be precious for understanding the mechanism that regulates HST activity and then HST-mediated miRNA biogenesis in response to N deficiency it is currently unknown whether dicing bodies also contain the HST examining the formation of dicing bodies under various nutrient stress conditions and their relationship with HST-mediated regulation of N deficiency responses may provide a clue to understand the mechanism of HST-mediated N deficiency responses to identify regulatory genes involved in the gene regulatory network responsible for N deficiency responses we found a mechanism regulating N deficiency responses and thus demonstrated the potential of eGWAS in plant studies The HST-mediated regulation of the biogenesis of selective miRNAs is an unanticipated mechanism distinct from the known regulatory mechanisms of N deficiency responses which are controlled by single or multiple homologous TFs this mechanism integrates regulations caused by different TFs and is superordinate eGWAS based on expression levels of TF genes may be one of the best experimental approaches to discover mechanisms integrating regulations by individual TFs as well as key regulatory genes involved in specific physiological processes in plants the characterization of additional peaks observed in our eGWAS may reveal other genes and polymorphisms related to N starvation-induced leaf senescence The above Arabidopsis accessions and Arabidopsis mutants were obtained from the Arabidopsis Biological Resource Center (ABRC) at Ohio State University Since all Arabidopsis mutants and all generated transgenic plants except for the 35S:HSTCol-0-MYC/Yeg3 and 35S:HSTCol-0-MYC/Bak-7 lines seedlings were grown under continuous light conditions (70 μmol m−2s−1) at 23 °C To examine N deficiency-induced leaf senescence 5-day-old seedlings grown on 1/2 MS agar plates were grown for 5 or 7 days on agar plates containing 6 which were prepared by replacing 30 mM N nutrients (10 mM KNO3 and 10 mM NH4NO3) in 1/2 MS medium with 6 mM (2 mM KNO3 and 2 mM NH4NO3) or 0.03 mM (0.01 mM KNO3 and 0.01 mM NH4NO3) N nutrients under continuous light conditions (70 μmol m−2s−1) at 23 °C To examine N-deficiency-induced leaf senescence during the late-vegetative growth phase seedlings were hydroponically grown in solution containing 1/2 MS salts and 3 mM MES-KOH (pH 5.7) for 2 weeks and then in solution containing 1/2 N-free MS salts and 6 mM N (2 mM KNO3 and 2 mM NH4NO3) or that containing 1/2 N-free MS salts and 3 mM MES-KOH (pH 5.7) for another 2 weeks under continuous light conditions (70 μmol m−2s−1) at 23 °C seedlings hydroponically grown in nutrient solution containing 1/2 MS salts and 3 mM MES-KOH (pH 5.7) for 2 weeks were further grown in nutrient solution containing 1/2 N-free MS salts and 6 mM N (2 mM KNO3 and 2 mM NH4NO3) or that containing 1/2 N-free MS salts and 3 mM MES-KOH (pH 5.7) for 5 weeks to investigate seed development under different N conditions To examine the dark-induced leaf senescence phenotype plants were grown on nutrient-containing peat moss (Jiffy-7; Sakata Seed Co. Japan) under continuous light conditions (70 μmol m−2s−1) at 23 °C for 3 weeks rosette leaves were detached from plants and floated on 3 mM MES-KOH buffer (pH5.7) in the dark for 3 days plants were grown on nutrient-containing peat moss under continuous light conditions (70 μmol m−2s−1) at 23 °C for 6 weeks the absorbance of each extract was measured at 647 and 664 nm Transcript levels of each gene were normalized relative to that of ACTIN2 (ACT2) The number of biological replicates in each experiment is indicated in the figure legends Chlorophyll fluorescence and Fv/Fm ratio were measured using a kinetics multispectral fluorescence imaging system (FluorCam 800 MF; Photon System Instruments according to the manufacturer’s instructions All plasmids used to generate transgenic plants were constructed with PCR-amplified DNA fragments and the Gateway® cloning system. PCRs were performed using genomic DNA (to clone promoter regions) or cDNA libraries (to clone cDNAs) and gene-specific primers (Supplementary Data S9) Transgenic plants in the T2 generation with T-DNA insertion(s) at a single locus were selected and homozygous T3 plants were used for all analyses eGWAS was performed using the easyGWAS web interface (https://easygwas.ethz.ch/). The genome sequence information of the 52 naturally occurring Arabidopsis accessions used in this study was obtained from the 1001 genome website (https://1001genomes.org/) A Manhattan plot was generated using the accelerated mixed model and then 10-mg aliquots of the ground samples were homogenized in 100 μL of SDS-PAGE sample loading buffer (10% [w/v] glycerol The homogenates were centrifuged at 10,000 × g for 3 min and the obtained supernatants were incubated at 80 °C for 5 min A 4 μL aliquot of each supernatant was subjected to SDS-PAGE The separated proteins were electroblotted onto immobilon-P transfer membranes (cat and then detected using antibodies directed against Lhca1 (cat Peroxidase activity of the secondary antibody (anti-rabbit IgG HRP-linked antibody; cat Japan) was visualized with Supersignal West Dura Extended Duration Substrate (cat Yeast was transformed with plasmids constructed based on pGBT9 and pGADT7 using lithium acetate-polyethyleneglycol solution After transformation with the plasmids of interest the transformants were selected at 30 °C on synthetic defined (SD) medium lacking leucine (Leu) and tryptophan (Trp) (SD/-Leu/-Trp) and single colonies were streaked on plates containing SD/-Leu/-Trp or SD medium lacking Leu and adenine (Ade) (SD/-Leu/-Trp/-His/-Ade) Plates were photographed after 5 days of incubation at 30 °C The transfected protoplasts were incubated at room temperature in the dark for 18 h before observing under a fluorescence microscope (BX51; Olympus Co. and proteins were eluted from the beads with SDS-PAGE sample loading buffer at 80 °C for 3 min The extracted proteins were separated on SDS-polyacrylamide gels transferred onto an Immobilon-P transfer membrane (Merck Millipore) followed by an anti-mouse or -rabbit IgG HRP-linked antibody (cat Cell Signaling Technology Japan) and Supersignal West Dura Extended Duration Substrate (Thermo Fisher Scientific) and sonicated using a Biorupter II (COSMO BIO CO. Protein G-agarose beads conjugated to anti-MYC polyclonal antibody (cat Japan) were used to digest the protein and genomic DNA RNA was purified using the RNeasy Mini Kit and qPCR was performed on the StepOnePlus™ Real Time PCR System using the KAPA SYBR Fast qPCR Kit Four biological replicate samples were analyzed with consistent results Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article Plant nitrogen acquisition under low availability: regulation of uptake and root architecture Plasticity of the Arabidopsis root system under nutrient deficiencies The Arabidopsis nitrate transporter NRT2.5 plays a role in nitrate acquisition and remobilization in nitrogen-starved plants assimilation and remobilization in plants: challenges for sustainable and productive agriculture Enhanced NRT1.1/NPF6.3 expression in shoots improves growth under nitrogen deficiency stress in Arabidopsis Molecular basis of nitrogen starvation-induced leaf senescence Differences between maize and rice in N-use efficiency for photosynthesis and protein allocation Chemical composition of phloem sap from the uppermost internode of the rice plant The Arabidopsis nitrate transporter NRT1.7 is responsible for source-to-sink remobilization of nitrate Nitrate transporters and peptide transporters CHL1 is a dual-affinity nitrate transporter of Arabidopsis involved in multiple phases of nitrate uptake Leaf senescence: systems and dynamics aspects Trifurcate feed-forward regulation of age-dependent cell death involving miR164 in Arabidopsis Arabidopsis NITROGEN LIMITATION ADAPTATION regulates ORE1 homeostasis during senescence induced by nitrogen deficiency PIFs: pivotal components in a cellular signaling hub A molecular framework underlying low-nitrogen-induced early leaf senescence in Arabidopsis thaliana Arabidopsis BBX14 negatively regulates nitrogen starvation- and dark-induced leaf senescence MicroRNAs and their regulatory roles in plants Involvement of miR169 in the nitrogen-starvation responses in Arabidopsis Two young microRNAs originating from target duplication mediate nitrogen starvation adaptation via regulation of glucosinolate synthesis in Arabidopsis thaliana Identification of nitrogen starvation-responsive microRNAs in Arabidopsis thaliana Role of microRNAs involved in plant response to nitrogen and phosphorus limiting conditions Mutation of the Arabidopsis NAC016 transcription factor delays leaf senescence Regulatory network of NAC transcription factors in leaf senescence Time-evolving genetic networks reveal a NAC troika that negatively regulates leaf senescence in Arabidopsis Repression of nitrogen starvation responses by members of the Arabidopsis GARP-type transcription factor NIGT1/HRS1 subfamily Arabidopsis STAY-GREEN2 is a negative regulator of chlorophyll degradation during leaf senescence Nuclear processing and export of microRNAs in Arabidopsis HASTY modulates miRNA biogenesis by linking pri-miRNA transcription and processing Discovering microRNAs from deep sequencing data using miRDeep Differential expression analysis for sequence count data Gene regulatory cascade of senescence-associated NAC transcription factors activated by ETHYLENE-INSENSITIVE2-mediated leaf senescence signalling in Arabidopsis the Arabidopsis ortholog of exportin 5/MSN5 Arabidopsis micro-RNA biogenesis through Dicer-like 1 protein functions Recent advances in the regulation of plant miRNA biogenesis Nucleo-cytosolic shuttling of ARGONAUTE1 prompts a revised model of the plant microRNA pathway Keeping up with the miRNAs: current paradigms of the biogenesis pathway Identification of nuclear dicing bodies containing proteins for microRNA biogenesis in living Arabidopsis Plants regulates miRNA accumulation and crown root development in rice The rice NUCLEAR FACTOR0YA5 and MICRORNA169a module promotes nitrogen utilization during nitrogen deficiency The role of Exportin-5 in microRNA biogenesis and cancer Local auxin biosynthesis acts downstream of brassinosteroids to trigger root foraging for nitrogen Mapping of candidate genes in response to low nitrogen in rice seedlings gene interactions and key regulators affecting intramuscular fatty acid content and composition in porcine meat Expression GWAS of PGIP1 identifies STOP1-dependent and STOP1-independent regulation of PGIP1 in aluminum stress signaling in Arabidopsis A NIGT1-centred transcriptional cascade regulates nitrate signalling and incorporates phosphorus starvation signals in Arabidopsis A revised medium for rapid growth and bioassays with tobacco tissue cultures A iasmonate-activated MYC2–Dof2.1–MYC2 transcriptional loop promotes leaf senescence in arabidopsis Determination of accurate extinction coefficients and simultaneous equations for assaying chlorophylls a and b extracted with four different solvents: verification of the concentration of chlorophyll standards by atomic absorption spectroscopy Rapid and efficient site-directed mutagenesis by single-tube “megaprimer” PCR method A gateway cloning vector set for high-throughput functional analysis of genes in planta Protocol: A highly sensitive RT-PCR method for detection and quantification of microRNAs Abiotic stress-associated miRNAs: detection and functional analysis NIGT1 family proteins exhibit dual mode DNA recognition to regulate nutrient response-associated genes in Arabidopsis Gateway vectors for plant genetic engineering: overview of plant vectors application for bimolecular fluorescence complementation (BiFC) and multigene construction STAY-GREEN and chlorophyll catabolic enzymes interact at light-harvesting complex II for chlorophyll detoxification during leaf senescence in Arabidopsis The F-box protein FKF1 inhibits dimerization of COP1 in the control of photoperiodic flowering Download references by the Core Research for Evolutional Science and Technology Japan Science and Technology Agency (grant no and the Japan Society for the Promotion of Science (KAKENHI grant nos Graduate School of Agricultural and Life Sciences initiated the project and designed experiments performed experiments and analyzed the data reviewer(s) for their contribution to the peer review of this work Download citation DOI: https://doi.org/10.1038/s41467-024-52339-w Sorry, a shareable link is not currently available for this article. Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily. Volume 18 - 2024 | https://doi.org/10.3389/fncel.2024.1457704 Amyotrophic lateral sclerosis (ALS) is a fatal adult-onset disease marked by a progressive degeneration of motor neurons (MNs) present in the spinal cord Death in most patients usually occurs within 2–4 years after symptoms onset Despite promising progress in delineating underlying mechanisms splicing or proper nucleocytoplasmic shuttling there are no effective therapies for the vast majority of cases A reason for this might be the disease heterogeneity and lack of substantial clinical and molecular biomarkers The identification and validation of such pathophysiology driven biomarkers could be useful for early diagnosis and treatment stratification Recent advances in next generation RNA-sequencing approaches have provided important insights to identify key changes of non-coding RNAs (ncRNAs) implicated with ALS disease microRNAs (miRNAs) have emerged as key post-transcriptional regulators of gene expression to target several genes/pathways by degrading messenger RNAs (mRNAs) or repressing levels of gene expression we expand our previous work to identify top-regulated differentially expressed (DE)-miRNAs by combining different normalizations to search for important and generalisable pathomechanistic dysregulations in ALS as putative novel biomarkers of the disease For this we performed a consensus pipeline of existing datasets to investigate the transcriptomic profile (mRNAs and miRNAs) of MN cell lines from iPSC-derived SOD1- and TARDBP (TDP-43 protein)-mutant-ALS patients and healthy controls to identify potential signatures and their related pathways associated with neurodegeneration Transcriptional profiling of miRNA–mRNA interactions from MN cell lines in ALS patients revealed differential expression of genes showed greater vulnerability to KEAP1-NRF2 stress response pathway sharing a common molecular denominator linked to both disease conditions We also reported that mutations in above genes led to significant upregulation of the top candidate miR-10b-5p which we could validate in immortalized lymphoblast cell lines (LCLs) derived from sporadic and familial ALS patients and postmortem tissues of familial ALS patients our findings suggest that miRNA analysis simultaneously performed in various human biological samples may reveal shared miRNA profiles potentially useful as a biomarker of the disease underlying pathomechanisms causing MN degeneration and cell death are poorly understood In this study using datasets from above mentioned published study by us we aimed to investigate the transcriptomic profile (mRNA and miRNA sequencing data) of mutant MNs from the same ALS patients by employing different analytical methods for normalization and statistical testing We generated a consensus pipeline to evaluate the usefulness and accuracy of different post-analytic methods commonly used for differentially expressed gene (DEG) analysis with the overall aim to find out the top hit rather than multiple numbers We identified the most robustly dysregulated miRNAs and biological pathways enriched in the target genes shared between different forms of ALS and validate the top candidate miRNA in different patient-derived biomaterials of sALS and fALS patients suggesting it as a putative future biomarker Analyses of postmortem samples from fALS patients were performed in accordance with the declaration of Helsinki Informed written consent was provided by all participating individuals the next of kin gave permission for material to be collected and used for medical research purposes All procedure had been approved by the local ethics committee (EK45022009) Native frozen brainstem tissue samples were derived from six fALS (3 SOD1: 3 D90A, G127X) and (2 C9ORF72) and three age- and gender-matched neurologically-healthy controls, respectively (Supplementary Table 2) All fALS patients autopsied at the clinical science department but there was no significant difference in the age at death or RNA integrity number (RIN) values ALS patients = 3.46 ± 0.6754 (mean ± S.D) and healthy controls = 2.77 ± 0.6351 (mean ± S.D) p-value of a t-test comparing the RIN was 0.1711 limma-voom and GSA results was performed by finding their common miRNAs and a Venn diagram was created to offer a graphic representation of the outcomes the enrichment p-values (p-value ≤0.05) were calculated and adjusted by multiple test FDR correction statistical method between DE-miRNAs and DE-mRNAs using Partek™ Genomics Suite™ software v7.0 We retrieved experimentally validated mRNA targets of miRNAs from miRTarBase v9.0 (Huang et al., 2022) and DIANA-TarBase v8.0 (Karagkouni et al., 2018) and integrated them with DE-mRNAs selected from the GSE210969 dataset. Partek™ Flow™ software, v11.0. and InteractiVenn tool (Heberle et al., 2015) were used to generate the Venn diagrams for the overlapping candidate target mRNAs/genes The general pipeline for miRNA-seq analysis used in this study and differential gene expression analysis as well as statistical analyses including Venn comparisons Hierarchical clustering (with Euclidean distance measure and average linkage clustering) visualization maps and QC assessment of DE-miRNAs and DE-mRNAs were performed on the Partek™ Flow™ software v11.0 to aid the visualization and interpretation of the expression patterns of DE-miRNA datasets p-values (p-value ≤0.05) were calculated and adjusted for multiple testing using FDR correction statistical method between DE-miRNAs and DE-mRNAs using Partek™ Genomics Suite™ software v7.0 The outcomes were described using mean ± standard deviation (SD) and standard error of the mean (SEM) once the data were verified for the normal distribution two-tailed Student’s t-tests were performed using GraphPad Prism v9.4.1 p-values/FDRs ≤0.05 were considered statistically significant Differential expression of SOD1 and TARDBP mutant MN miRNAs (A) Venn diagrams showing DE-miRNAs identified by three normalization methods of DESeq2 and quantile at FDR ≤ 0.05 p-value ≤0.05 and log2FC ≥ 1.5 or log2FC ≤ −1.5 for SOD1 MNs versus healthy controls and (B) TARDBP MNs versus healthy controls (C) Differentially expressed miRNAs and the corresponding fold changes with SOD1 MNs and (D) TARDBP MNs Bars indicate mean ± S.E.M (A) Heatmaps representing the number and DE-miRNAs identified in a discovery set by each method Expression values were normalized across SOD1 mutant MN (SOD1 1 SOD1R115G) and (B) TARDBP mutant MN (TARDBP 1 and TARDBP 2 (2 clones from one patient) TARDBPS393L) samples (rows: ALS patients; HC and miRNA clustering (columns) was applied Color scale at the left of the heatmap represents the Z-score ranging from blue (low expression) to red (high expression) upregulation of miR-10b-5p was also detectable in LCLs of sporadic patients suggesting that our bioinformatics approach indeed yielded in a single candidate which could not only be found in in vitro cell modes but also CNS tissue and peripheral blood of patients it was also identified as a promising candidate for genetic and sporadic ALS patients Dysregulation of miR-10b-5p by qPCR in a validation set (A) Results are presented enclosing ALS postmortem subjects presenting SOD1 or C9orf72 mutations in a unique biological group (n = 6) versus healthy controls (n = 3) The increase of miR-10b-5p levels did not reach statistical significance but showed a strong trend (p = 0.0740) in fALS patients compared to healthy controls and the lack of statistical significance is rather due to the small sample number available than to indistinct results (B) Bar plots of relative expression of miR-10b-5p detected in LCLs of healthy controls (n = 14) fALS (n = 14) and sALS (n = 14) patients Genetic backgrounds of the LCLs are indicated by the name of the familial genes SOD1 and C9orf72 carrying the mutation for LCLs or by sALS for LCLs Compared to healthy controls miR-10b-5p levels were significantly increased in fALS mutant LCLs as well as in LCLs derived from sALS patients Dots represent mean relative expression values of each sample [*p ≤ 0.05 **p ≤ 0.01 ***p ≤ 0.001 in a two-tailed Student’s t-test (Bonferroni) bars indicate ± SEM; asterisks represent p-values compared to the healthy controls] (A) Venn diagram showing the relations between validated experimental miR-10b-5p targets and mRNAs upregulated in SOD1 MNs and (B) TARDBP MNs (C) GO enrichment analysis of miR-10b-5p in SOD1 MNs (D) GO enrichment analysis of miR-10b-5p in TARDBP MNs Analysis was carried out by EnrichR illustrating significantly downregulated processes/functions (Gene Ontology; biological process molecular function and cellular component) for the genes targeted by miR-10b-5p and the X-axis represents the enrichment significance (−log10 (p-value)) (E) Pathway enrichment analysis of miR-10b-5p in SOD1 MNs (F) Pathway enrichment analysis of miR-10b-5p in TARDBP MNs Enriched Reactome and KEGG Pathway analysis performed on the identified downregulated target genes of miR-10b-5p in SOD1-MNs and TARDBP-MNs patients (versus healthy controls) using EnrichR tools and the X-axis represents the enrichment significance (−log10 (p-value)) p-value in which the terms containing more genes tend to have a more significant p-value Pathway analysis revealed the alteration of multiple pathways in SOD1-MNs and TARDBP-MNs Illustration of the miRNA-target mRNA network The resulting miRNA-target gene interactions for the common miR-10b-5p are visualized as a network with significantly (p ≤ 0.05) enriched shared/unique pathway terms included for each subnetwork in SOD1 MNs and TARDBP MNs miRNA and target genes are marked green and blue circles; shared genes marked pink circles The colors of pathway terms indicate their membership in the respective networks We performed an unbiased systematic pipeline for mRNA and miRNA profiling using a combination of three different normalizations to investigate both mRNA-miRNA expression in iPSC-derived MNs from SOD1- and TARDBP-ALS patients (versus healthy controls) It is thus tempting to hypothesize that those alterations in miR-10b-5p expression resulting from specific mutations in ubiquitously expressed genes (as TARDBP C9ORF72 or SOD1) or in sporadic cases of ALS might be represented as active participants in the convergence of different ALS target genes on common pathways future functional studies are indeed to confirm the relevance of the miR-10b-5p converge on shared pathways including both SOD1 and TARDBP (and other ALS genes) relevant to MN neurodegeneration further biochemical characterization of miR-10b-5p in the context of ALS and neurodegenerative diseases is urgent to better understand its potential role as a therapeutic biomarker for disease progression This is in consistent with the individual role of single miRNAs which can also be tissue or even cell-type dependent future transcriptional profiling studies (both the mRNA and miRNA levels) combined with experimental follow-up in LCLs as well in postmortem tissue including a larger sample size/homogenous cohorts are warranted to confirm any significant correlations between dysregulated miRNAs/pathways (e.g. miR-10b-5p) and disease severity/duration in ALS This underpins a putative cell protective role of miR-10b-5p miRNA expression profiling can also be used to correlate disease stage/clinical variables in various diseases There are also some limitations in our study Even though we validated the upregulation of miR-10b-5p in LCLs and postmortem tissues from sALS and fALS patients a broader validation in iPSC-derived MNs is needed including also other Mendelian gene mutations of fALS although the current data showed that there was an inverse correlation between expression of the miR-10b-5p and gene targets it is thus important to validate this finding using future studies of additional brain samples using broader populations of brain and spinal cord might strengthen the finding of our results and explore the potentiality for miR-10b-5p-mediated gene regulation of different pathways and key targets during cell survival and development in ALS neurodegeneration our bioinformatics pipeline combining three different ways of normalization indeed was helpful to identify few top hit DE-miRNAs The validation in brain tissue of fALS and blood LCLs of fALS and sALS patients indicate that the upregulation of miR-10b-5p might be a general feature of ALS pathophysiology but that it’s unclear if it’s a protective adaptation or a pathogenic change contributing to the diseases that perturbed miRNA expression could be a common molecular ground of multiple subtypes of ALS to understand the pathogenesis further functional studies will be necessary to unravel the pathomechanisms underpinning the involvement of miR-10b-5p in SOD1 and TARDBP-ALS neurodegeneration but worth doing because miR-10b-5p may turn out as a potential therapeutic target and normalization of expression may have beneficial effects in several pathways including KEAP1-NRF2 stress response associated with neurodegeneration The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary material The studies involving humans were approved by Technische Universität Dresden The studies were conducted in accordance with the local legislation and institutional requirements The participants provided their written informed consent to participate in this study The author(s) declare that financial support was received for the research AH is supported by the Hermann and Lilly Schilling-Stiftung für medizinische Forschung im Stifterverband Part of the work (author BPD) was funded by the framework of the Professorinnenprogramm III (University of Rostock) of the German federal and state governments AF is supported by the Deutsche Forschungsgemeinschaft (DFG; grant #521487152) report research grants from the Swedish Research Council the Knut and Alice Wallenberg Foundation (grants nr We acknowledge the great help of Jared Sterneckert for sharing SOD1 and control iPSC cell lines We are also grateful to Christoph Dieterich for sharing RNA-seq and miRNA-seq data of our cell lines with us The Supplementary material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fncel.2024.1457704/full#supplementary-material MicroRNA alterations in chronic traumatic encephalopathy and amyotrophic lateral sclerosis An miRNA fingerprint using neural-enriched extracellular vesicles from blood plasma: towards a biomarker for amyotrophic lateral sclerosis/motor neuron disease Crossref Full Text | Google Scholar Bergström Association of NFE2L2 and KEAP1 haplotypes with amyotrophic lateral sclerosis Amyotroph Lateral Scler Frontotemporal Degener 15 Impaired antioxidant KEAP1-NRF2 system in amyotrophic lateral sclerosis: NRF2 activation as a potential therapeutic strategy Differences of time-dependent microRNA expressions in breast cancer cells El Escorial revisited: revised criteria for the diagnosis of amyotrophic lateral sclerosis Crossref Full Text | Google Scholar Altered calcium dynamics and glutamate receptor properties in iPSC-derived motor neurons from ALS patients with C9orf72 miRNAs as biomarkers in disease: latest findings regarding their role in diagnosis and prognosis Downstream effects of mutations in SOD1 and TARDBP converge on gene expression impairment in patient-derived motor neurons An integrative miRNA-mRNA expression analysis identifies miRNA signatures associated with SOD1 and TARDBP patient-derived motor neurons Wide-ranging analysis of MicroRNA profiles in sporadic amyotrophic lateral sclerosis using next-generation sequencing FUS mutant human Motoneurons display altered transcriptome and microRNA pathways with implications for ALS pathogenesis DeJesus-Hernandez Expanded GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes chromosome 9p-linked FTD and ALS Ataxin-2 intermediate-length polyglutamine expansions are associated with increased risk for ALS Dysregulated miRNA biogenesis downstream of cellular stress and ALS-causing mutations: a new mechanism for ALS Generation of lymphoblastoid cell lines (LCLs) Crossref Full Text | Google Scholar Dysregulated miRNAs as biomarkers and Therapeutical targets in neurodegenerative diseases ALS-FTLD associated mutations of SQSTM1 impact on Keap1-Nrf2 signalling Impact of serum storage conditions on microRNA stability Günther Alteration of mitochondrial integrity as upstream event in the pathophysiology of SOD1-ALS miRNA malfunction causes spinal motor neuron disease Crossref Full Text | Google Scholar InteractiVenn: a web-based tool for the analysis of sets through Venn diagrams MicroRNAs located in the Hox gene clusters are implicated in huntington's disease pathogenesis microRNA profiles in Parkinson's disease prefrontal cortex miR-10b-5p expression in Huntington's disease brain relates to age of onset and the extent of striatal involvement Study of plasma-derived miRNAs mimic differences in Huntington's disease brain Correlation of microRNA-10b upregulation and poor prognosis in human gliomas DIANA-TarBase v8: a decade-long collection of experimentally supported miRNA-gene interactions MicroRNA signatures in genetic frontotemporal dementia and amyotrophic lateral sclerosis miRBase: annotating high confidence microRNAs using deep sequencing data Age-dependent neurodegeneration and organelle transport deficiencies in mutant TDP43 patient-derived neurons are independent of TDP43 aggregation The impact of kinases in amyotrophic lateral sclerosis at the neuromuscular synapse: insights into BDNF/TrkB and PKC signaling MicroRNA-10b-5p downregulation inhibits the invasion of glioma cells via modulating homeobox B3 expression The biogenesis of miRNAs and their role in the development of amyotrophic lateral sclerosis Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 Circulating miR-181 is a prognostic biomarker for amyotrophic lateral sclerosis Impaired antioxydative Keap1/Nrf2 system and the downstream stress protein responses in the motor neuron of ALS model mice Circulating microRNAs as stable blood-based markers for cancer detection Müller In silico analysis of regulatory networks underlines the role of miR-10b-5p and its target BDNF in huntington's disease 4-Aminopyridine induced activity rescues Hypoexcitable motor neurons from amyotrophic lateral sclerosis patient-derived induced pluripotent stem cells Impaired DNA damage response signaling by FUS-NLS mutations leads to neurodegeneration and FUS aggregate formation Diagnostic circulating miRNAs in sporadic amyotrophic lateral sclerosis Ranganathan p53 and cell cycle proteins participate in spinal motor neuron cell death in ALS Derivation and expansion using only small molecules of human neural progenitors for neurodegenerative disease modeling Limma powers differential expression analyses for RNA-sequencing and microarray studies A scaling normalization method for differential expression analysis of RNA-seq data ALS along the axons - expression of coding and noncoding RNA differs in axons of ALS models Role of miRNAs in neurodegeneration: from disease cause to tools of biomarker discovery and therapeutics Mitogen-activated protein kinase pathway in amyotrophic lateral sclerosis PubMed Abstract | Crossref Full Text | Google Scholar Nuclear erythroid 2-related factor 2-antioxidative response element signaling pathway in motor cortex and spinal cord in amyotrophic lateral sclerosis Profiles of microRNA in aqueous humor of normal tension glaucoma patients using RNA sequencing Micro-RNA abundance and stability in human brain: specific alterations in Alzheimer's disease temporal lobe neocortex Muscle microRNA signatures as biomarkers of disease progression in amyotrophic lateral sclerosis miR-10b-5p rescues diabetes and gastrointestinal Dysmotility PubMed Abstract | Crossref Full Text | Google Scholar Therapeutic potential of targeting microRNA-10b in established intracranial glioblastoma: first steps toward the clinic Large-scale SOD1 mutation screening provides evidence for genetic heterogeneity in amyotrophic lateral sclerosis Overexpression of miR-124 in motor neurons plays a key role in ALS pathological processes Crossref Full Text | Google Scholar Mutations in the profilin 1 gene cause familial amyotrophic lateral sclerosis A new shrinkage estimator for dispersion improves differential expression detection in RNA-seq data An expectation-maximization algorithm for probabilistic reconstructions of full-length isoforms from splice graphs Circulating microRNAs: novel biomarkers for cardiovascular diseases FUS-SMN protein interactions link the motor neuron diseases ALS and SMA Peripheral monocytes are functionally altered and invade the CNS in ALS patients Weishaupt JH and Hermann A (2024) Upregulated miR-10b-5p as a potential miRNA signature in amyotrophic lateral sclerosis patients Received: 01 July 2024; Accepted: 28 October 2024; Published: 07 November 2024 Copyright © 2024 Dash, Freischmidt, Helferich, Ludolph, Andersen, Weishaupt and Hermann. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) *Correspondence: Andreas Hermann, YW5kcmVhcy5oZXJtYW5uQG1lZC51bmktcm9zdG9jay5kZQ== Metrics details A Correction to this article was published on 12 November 2024 This article has been updated Pediatric Burkitt lymphoma (pBL) is the most common non-Hodgkin lymphoma in children These patients require prompt diagnosis and initiation of therapy due to rapid tumor growth The roles of tumor tissue and circulating microRNAs (miRNAs) in the diagnosis or prognostication have not been fully elucidated in pBLs Differentially expressed (DE) miRNAs were identified with microRNA sequencing (miRNA-Seq) in tumor tissues and plasma of diagnostic pBLs The diagnostic potential of total miRNA concentrations and overexpressed miRNAs were evaluated through receiver operating characteristic (ROC) analyses Log-rank test was employed to evaluate survival differences associated with DE miRNAs Selected miRNA expressions were cross-validated with quantitative reverse transcription PCR (qRT-PCR) Total circulating cell-free miRNAs were higher in pBL cases compared to controls Cancer-associated pathways were enriched among miRNAs differentially expressed in pBL tumor tissues Several upregulated miRNAs in pBL tumors demonstrated high diagnostic potential ROC analysis of overexpressed plasma miRNAs revealed circulating cell-free or exosomal miRNAs that can distinguish pBLs from control cases integrative analysis of overexpressed circulating exosomal miRNAs showed an enhanced diagnostic potential for certain triple combinations Kaplan–Meier analyses of DE miRNAs in tumor tissues identified miRNAs predicting overall survival Differentially expressed miRNAs in tumor tissue and plasma of pBL have the potential to improve diagnosis and prognosis Differentially expressed miRNAs in treatment-naive pediatric Burkitt lymphoma cases have diagnostic or prognostic biomarker potential This is the first study that applied miRNA-Seq on treatment-naive pediatric Burkitt lymphoma cases for identification of differentially expressed miRNAs both in tumor tissue and plasma samples with diagnostic potential Through systematic analysis of differentially expressed miRNAs tumor tissue miRNAs associated with the overall survival of pBLs have been discovered differentially expressed miRNAs identified in pediatric Burkitt lymphoma cases can potentially improve the current tissue-based or non-invasive clinical practice in terms of diagnosis or prognostication The original online version of this article was revised: the author Nazan Çetingül was incorrectly assigned affiliation 7 The correct affiliation should have been number 8: “Department of Child Health and Diseases A Correction to this paper has been published: https://doi.org/10.1038/s41390-024-03704-4 Sporadic childhood Burkitt lymphoma incidence in the United States during 1992-2005 Burkitt lymphoma and other high-grade B-cell lymphomas with or without MYC Sporadic Burkitt’s lymphoma of the head and neck in the pediatric population Assessment of pain caused by invasive procedures in cancer patients MicroRNAs modulate hematopoietic lineage differentiation Integrative microRNA and mRNA deep-sequencing expression profiling in endemic Burkitt lymphoma Cell-free circulating mirna biomarkers in Cancer Clinical relevance of circulating cell-free microRNAs in cancer Exosomal microRNA: A diagnostic marker for lung cancer Evaluation of tumor-derived exosomal miRNA as potential diagnostic biomarkers for early-stage non-small cell lung cancer using next-generation sequencing MicroRNA-155 is a potential molecular marker of natural killer/T-cell lymphoma Analysis of circulating microRNAs in adrenocortical tumors The clinical use of circulating microRNAs as non-invasive diagnostic biomarkers for lung cancers A three-miRNA signature as promising non-invasive diagnostic marker for gastric cancer A circulating miRNA signature as a diagnostic biomarker for non-invasive early detection of breast cancer Plasma exosome microRNAs are indicative of breast cancer Plasma exosomal miRNA-139-3p is a novel biomarker of colorectal cancer Plasma exosomes as novel biomarker for the early diagnosis of gastric cancer Identification of a hemolysis threshold that increases plasma and serum zinc concentration Whole transcriptome sequencing reveals cancer-related prognostically significant transcripts and tumor-infiltrating immunocytes in mantle cell lymphoma Deregulated serum concentrations of circulating cell-free microRNAs miR-17 and miR-373 in human breast cancer development and progression MiRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades edgeR: A Bioconductor package for differential expression analysis of digital gene expression data R Studio Team. Posit | The Open-Source Data Science Company. Integrated Development Environment for R. RStudio, PBC, Boston, MA https://posit.co/ (2022) MicroRNA expression profiling reveals miRNA families regulating specific biological pathways in mouse frontal cortex and hippocampus Genome-wide discovery of somatic coding and noncoding mutations in pediatric endemic and sporadic Burkitt lymphoma Circulating microRNA profile as a potential biomarker for obstructive sleep apnea diagnosis Circulating microRNA profile associated with obstructive sleep apnea in alzheimer’s disease Altered miRNA expression in sputum for diagnosis of non-small cell lung cancer EasyROC: An interactive web-tool for roc curve analysis using r language environment Presentation of ileal Burkitt lymphoma in children Understanding receiver operating characteristic (ROC) curves Molecular distinctions between pediatric and adult mature B-cell non-Hodgkin lymphomas identified through genomic profiling Clinical relevance of circulating cell-free microRNAs in ovarian cancer Circulating cell-free miRNAs as biomarker for triple-negative breast cancer Plasma concentrations and cancer-associated mutations in cell-free circulating dna of treatment-naive follicular lymphoma for improved non-invasive diagnosis and prognosis MicroRNA expression patterns in oral squamous cell carcinoma: hsa-mir-99b-3p and hsa-mir-100-5p as novel prognostic markers for oral cancer MiR-100-5p inhibition induces apoptosis in dormant prostate cancer cells and prevents the emergence of castration-resistant prostate cancer Serum miR-10a-5p and miR-196a-5p as non-invasive biomarkers in non-small cell lung cancer MiR-410 Is overexpressed in liver and colorectal tumors and enhances tumor cell growth by silencing FHL1 via a direct/indirect mechanism Mir-106b-5p: A master regulator of potential biomarkers for breast cancer aggressiveness and prognosis Upregulation of miR-20a and miR-106b is involved in the acquisition of malignancy of pediatric brainstem gliomas The oncogenic role of miR-BART19-3p in Epstein-Barr virus-associated diseases Patients with obstructive sleep apnea present with chronic upregulation of serum HIF-1α protein Download references We thank Ayla Anar (İzmir Biomedicine and Genome Center) and Çetin Demir (Hacettepe University Oncology Hospital) for technical assistance in experiments We thank Efe Serinan (Dokuz Eylül University Oncology Institute) for his contribution in logistic issues at the beginning of the project We also thank ChatGPT 3.5 for providing information regarding the specificity of overexpressed miRNAs identified in the pBL cases This study was supported by TÜBİTAK (The Scientific and Technological Research Council of Turkey) 1001 program (no:118S505) (C.K.) İzmir International Biomedicine and Genome Institute İzmir Tepecik Education and Research Hospital Behçet Uz Pediatric Diseases and Surgery Training and Research Hospital Department of Child Hematology and Oncology A.C.: Conducted research and/or analyzed data; E.E.S.: Computationally analyzed miRNA-Seq data; E.E.S and T.H.: Performed biostatistical analyses; Z.Ö.S. N.O.: Provided pediatric Burkitt lymphoma patient samples as well as demographic and T.K.E: Contributed OSA blood and tonsil samples; N.O.: Established and coordinated the oncologist and pathologist group The patient samples used in this study were approved by the institutional review board of the Medical School at Dokuz Eylül University (protocol no: 3837-GOA) Parental consent was obtained for all participating children in the study Download citation DOI: https://doi.org/10.1038/s41390-024-03478-9 Metrics details This article delves into Alzheimer’s disease (AD) a prevalent neurodegenerative condition primarily affecting the elderly It is characterized by progressive memory and cognitive impairments Recent research highlights the potential involvement of microRNAs in the pathogenesis of AD short non-coding RNAs comprising 20–24 nucleotides significantly influence gene regulation by hindering translation or promoting degradation of target genes This review explores the role of specific miRNAs in AD progression focusing on their impact on β-amyloid (Aβ) peptide accumulation intracellular aggregation of hyperphosphorylated tau proteins Our insights contribute to understanding AD’s pathology offering new avenues for identifying diagnostic markers and developing novel therapeutic targets This review examines the changes in miRNA expression and their consequent effects on neuronal dynamics in the AD brain discussing their significance in advancing our understanding of the disease’s progression and potential preventative strategies Recent insights into the role of miRNAs in AD offer promising directions for unraveling its pathological processes and developing novel therapeutic strategies The microRNA (miRNA) biosynthesis pathway is categorized into classical and non-classical miRNA genes are transcribed to generate primary miRNAs (pri-miRNAs) which are processed by Drosha and DGCR8 to form precursor miRNAs (pre-miRNAs) and then transferred to the cytoplasm where Dicer generates double-stranded miRNAs which ultimately bind to RISC to regulate the translation of target mRNAs; (2) the non-classical pathway directly generates double-stranded miRNA This capability makes miRNAs promising therapeutic targets for complex diseases due to their ability to regulate multiple genes simultaneously miRNAs are crucial regulators of gene expression influencing a wide array of biological processes and disease pathologies The aberrant expression of miRNAs is intricately linked to the development and progression of diseases Understanding the role and mechanisms of miRNAs in the brain and their impact on disease progression is essential for developing novel diagnostic and therapeutic strategies particularly in the context of neurodegenerative diseases like AD underscoring the inhibitory role of these miRNAs on APP expression These insights into miRNA-mediated regulation of APP and Aβ production not only deepen our understanding of AD’s molecular basis but also hint at novel miRNA-targeted therapeutic strategies for managing or potentially altering the course of the disease These findings collectively suggest that miRNAs play a critical role in AD by modulating tau phosphorylation and aggregation offering potential therapeutic targets for intervention The alteration in miRNA expression patterns not only affects neuronal survival but may also contribute to the accumulation of pathogenic proteins like hyperphosphorylated tau thereby disrupting normal neuronal function and contributing to the clinical manifestations of AD These insights into the roles of specific miRNAs in neuroinflammation offer potential therapeutic targets for modulating inflammatory responses in AD Pharmacological modulation of these miRNAs could provide novel strategies for mitigating neuroinflammation and its detrimental effects on neuronal health in AD The intricate relationships between miRNAs and neurodegenerative processes in AD point to a significant role for miRNAs in cellular and biological responses to OS Understanding these mechanisms could unveil novel therapeutic strategies centered around neuroprotective transcriptional repressors and excitatory effects associated with OS responses many of which are upregulated in the disease highlight the potential of miRNA modulation as a therapeutic strategy or biomarker for AD The dysregulation of miRNAs may play a pivotal role in AD’s onset and progression offering new insights into the molecular underpinnings of the disease and opening avenues for targeted interventions to mitigate mitochondrial and synaptic dysfunction in AD This unique origin is supported by similarities between mitochondrial and bacterial DNA including their mode of propagation through binary division this symbiotic bacterium evolved into the mitochondria observed in today’s eukaryotic cells This dysfunction includes alterations in mitochondrial DNA all contributing to the neurodegenerative process offering neuroprotection against Aβ toxicity by modulating the SIRT1 signaling pathway Understanding the mechanisms by which mitochondrial dysfunction and miRNA dysregulation contribute to AD offers potential pathways for therapeutic intervention aiming to restore mitochondrial function and neuronal health As research continues to unravel these complex interactions the potential for developing targeted treatments to mitigate the impact of mitochondrial dysfunction in AD grows offering hope for future advancements in the management and treatment of this debilitating condition synaptic dysfunction is a critical pathological feature leading to cognitive decline The intricate relationship between synaptic activity and mitochondrial function highlights the complexity of AD’s impact on neuronal health The role of miRNAs extends beyond the regulation of synaptic activity to encompass mitochondrial functions critical for energy production and cellular health Mitochondrial miRNAs are of particular interest due to their potential involvement in AD pathogenesis These miRNAs regulate genes encoding proteins essential for mitochondrial dynamics directly impacting neuronal survival and function While the significance of mitochondrial miRNAs in regulating mitochondrial health is well recognized their specific contributions to synaptic functions remain less understood Current knowledge on how mitochondrial miRNAs influence processes like mitochondrial transport These processes are vital for effective neurotransmission and synaptic plasticity suggesting that mitochondrial miRNAs could play a role in modulating these critical aspects of neuronal function The investigation into miRNAs associated with synaptic activity and neurotoxicity has revealed only a handful of candidates This gap in knowledge presents a significant opportunity for research aimed at identifying new miRNAs involved in these processes and understanding their regulation in the context of AD Unraveling the specific roles of mitochondrial miRNAs in synaptic dysfunction could shed light on the molecular mechanisms driving cognitive decline in AD and offer new targets for therapeutic intervention The bidirectional influence between miRNAs and mitochondrial health highlights the importance of these molecules in the cellular response to oxidative stress and their potential as therapeutic targets for diseases involving mitochondrial dysfunction and AD pathology underscores the complexity of genetic and molecular mechanisms contributing to the disease APOE4 not only influences lipid metabolism and amyloid-beta deposition but also interacts with specific miRNAs to modulate disease progression and severity These findings highlight the potential of targeting miRNAs as a therapeutic strategy to mitigate the adverse effects of APOE4 in AD offering new avenues for research and treatment development Understanding the regulatory roles of miRNAs in the context of APOE4 can provide insights into personalized medicine approaches for managing AD tailoring interventions based on genetic risk factors and molecular pathologies Specific microRNAs play key roles in the development of Alzheimer's disease (AD) All these factors are intertwined with the dysregulation of myriad miRNAs not only help in early diagnosis and disease monitoring but may also become new therapeutic targets and provide new ideas for intervention strategies in Alzheimer’s disease STAT signal transducer and activator of transcription ERK1/2 extracellular regulated protein kinases1/2] These results suggests that modulation of miR-132 expression could provide new therapeutic strategies for AD we can construct miRNA-target gene networks revealing the regulatory network of miRNAs in the pathogenesis of AD This approach will allow us to study the regulatory pathways and signaling of miRNAs providing a comprehensive understanding of the complex mechanisms involved in AD this knowledge will support the development of relevant therapeutic strategies for AD offering significant insights into the disease’s pathogenesis and potential treatment avenues The potential of miRNAs as therapeutic agents in AD is vast but yet to be fully realized Developing miRNA-based therapies will involve overcoming challenges related to delivery such as nanoparticle-based delivery systems could provide solutions to these challenges enabling precise modulation of pathological miRNA levels within the brain bridging the gap between research findings and clinical applications will be crucial This transition will necessitate rigorous clinical trials to validate the efficacy and safety of miRNA-based diagnostics and therapeutics which tailor interventions based on individual genetic and molecular profiles could significantly enhance treatment outcomes for AD patients miRNAs represent a frontier in AD research with the potential to revolutionize diagnostics and therapeutics As our understanding of their roles in AD deepens the prospects for developing effective interventions to delay or reverse the progression of this devastating disease become increasingly tangible The journey from bench to bedside is complex and fraught with challenges but the potential rewards for patients and society are immense driving the continued pursuit of knowledge in this promising area of neuroscience Data available on request from the authors The global prevalence of dementia: a systematic review and metaanalysis Global trends in Alzheimer disease clinical development: increasing the probability of success Alzheimer disease: an update on pathobiology and treatment strategies LTP and memory impairment caused by extracellular Aβ and Tau oligomers is APP-dependent Diagnosis and management of dementia: review PET imaging of amyloid in Alzheimer’s disease microRNA diagnostic panel for Alzheimer’s disease and epigenetic trade-off between neurodegeneration and cancer MicroRNAs and mild cognitive impairment: a systematic review An unconventional role for miRNA: let-7 activates Toll-like receptor 7 and causes neurodegeneration The epigenetics of Alzheimer’s disease: factors and therapeutic implications Atherosclerosis is exacerbated by chitinase-3-like-1 in amyloid precursor protein transgenic mice Shared biologic pathways between Alzheimer disease and major depression: a systematic review of MicroRNA expression studies Probing the interactions of lamotrigine and phenobarbital with tau protein: experimental and molecular modeling studies Review on Alzheimer’s disease: Inhibition of amyloid beta and tau tangle formation Successive cleavage of β-amyloid precursor protein by γ-secretase β-Amyloid precursor protein (APP) and the human diseases New insights into blood-brain barrier maintenance: the homeostatic role of β-amyloid precursor protein in cerebral vasculature Alzheimer’s disease pathogenesis and therapeutic interventions The therapeutic potential of the neuroactive peptides of soluble amyloid precursor protein-alpha in Alzheimer’s disease and related neurological disorders Oxidative stress and beta amyloid in Alzheimer’s disease PLCG2 is associated with the inflammatory response and is induced by amyloid plaques in Alzheimer’s disease oxidative stress and autophagy in progression of Alzheimer’s disease Boosting of tau protein aggregation by CD40 and CD48 gene expression in Alzheimer’s disease Arsenic and tau phosphorylation: a mechanistic review Hyperphosphorylated tau (p-tau) and drug discovery in the context of Alzheimer’s disease and related tauopathies Corrigendum to “Di-(2-ethylhexyl) phthalate could disrupt the insulin signaling pathway in liver of SD rats and L02 cells via PPARγ“ Innate immunity and cell death in Alzheimer’s disease Early- and late-onset Alzheimer disease: Are they the same entity Integrated late onset Alzheimer’s disease (LOAD) susceptibility genes: cholesterol metabolism and trafficking perspectives Early-onset Alzheimer’s disease: nonamnestic subtypes and type 2 AD Nonamnestic presentations of early-onset Alzheimer’s disease Early-onset and late-onset Alzheimer’s disease are associated with distinct patterns of memory impairment A review of the familial Alzheimer’s disease locus PRESENILIN 2 and its relationship to PRESENILIN 1 Therapeutic approaches targeting Apolipoprotein E function in Alzheimer’s disease Clinicopathological correlations and cholinesterase expression in early-onset familial Alzheimer’s disease with the presenilin 1 mutation Presenilin1 exerts antiproliferative effects by repressing the Wnt/β-catenin pathway in glioblastoma ApoE lipidation as a therapeutic target in Alzheimer’s disease and amyloid-beta on cerebrospinal fluid p-tau levels in the European prevention of Alzheimer’s dementia longitudinal cohort study (EPAD LCS) Plasma ApoE4 levels are lower than ApoE2 and ApoE3 levels and not associated with plasma Aβ40/42 ratio as a biomarker of amyloid-β amyloidosis in Alzheimer’s disease Association of candidate genetic variants and circulating levels of ApoE/ApoJ with common neuroimaging features of cerebral amyloid angiopathy Apolipoprotein E in cardiometabolic and neurological health and diseases Dissecting the association of apolipoprotein E gene polymorphisms with type 2 diabetes mellitus and coronary artery disease The association between head trauma and Alzheimer’s disease An integrative machine-learning meta-analysis of high-throughput omics data identifies age-specific hallmarks of Alzheimer’s disease The epidemiology of Alzheimer’s disease modifiable risk factors and prevention Lifestyle modifications and nutritional interventions in aging-associated cognitive decline and Alzheimer’s disease Alcohol consumption and risk of Alzheimer’s disease: a dose-response meta-analysis The role of heme and copper in Alzheimer’s disease and type 2 diabetes mellitus Mechanistic and etiological similarities in diabetes mellitus and Alzheimer’s disease: antidiabetic drugs as optimistic therapeutics in Alzheimer’s disease Metabolism: a novel shared link between diabetes mellitus and Alzheimer’s disease Blood pressure and Alzheimer’s disease: a review of meta-analysis Long-term blood pressure variability across the clinical and biomarker spectrum of Alzheimer’s disease The circadian rhythm of arterial blood pressure in Alzheimer’s disease and vascular dementia Environmental toxins and Alzheimer’s disease progression Editorial: effects of environmental toxins on brain health and development Letter to the editor: Comment on “multiannual monitoring (1974-2019) of rare earth elements in wild growing edible mushroom species in Polish forests” by Siwulski et al A recurring question - What are the real concentrations and patterns of REE in mushrooms Ageing as a risk factor for neurodegenerative disease Predicting Alzheimer’s disease progression using deep recurrent neural networks Alzheimer’s disease as a case study of changing conceptualizations of disease The role of the precursor structure in the biogenesis of microRNA Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs The diverse roles of RNA helicases in RNAi Regulation of microRNA biogenesis and its crosstalk with other cellular pathways RISC-target interaction: cleavage and translational suppression MicroRNA-193b is a regulator of amyloid precursor protein in the blood and cerebrospinal fluid derived exosomal microRNA-193b is a biomarker of Alzheimer’s disease MicroRNA-10a binds the 5’UTR of ribosomal protein mRNAs and enhances their translation Regulation of cell cycle associated genes by microRNA and transcription factor Interplay between miRNAs and host genes and their role in cancer MicroRNAs and target molecules in bladder cancer Epigenetics and microRNAs in cardiovascular diseases Severity of hepatitis C virus (genotype-3) infection positively correlates with circulating microRNA-122 in patients sera Crosstalk between microRNA-122 and FOX family genes in HepG2 cells MicroRNA-455-3p as a potential peripheral biomarker for Alzheimer’s disease Are circulating microRNAs peripheral biomarkers for Alzheimer’s disease Identification of novel circulatory microRNA signatures linked to patients with ischemic stroke microRNA-34a (miRNA-34a) mediated down-regulation of the post-synaptic cytoskeletal element SHANK3 in sporadic Alzheimer’s disease (AD) microRNA-146a signaling in Alzheimer’s disease (AD) and Prion disease (PrD) Subjective cognitive decline in preclinical Alzheimer’s disease Alzheimer’s disease is associated with reduced expression of energy metabolism genes in posterior cingulate neurons Rare variants and transcriptomics in Alzheimer disease The regulation of microRNAs in Alzheimer’s disease The neuropathological diagnosis of Alzheimer’s disease Oleic acid is an endogenous ligand of TLX/NR2E1 that triggers hippocampal neurogenesis Molecular pathogenesis of Alzheimer’s disease: an update Presenilin-dependent gamma-secretase-mediated control of p53-associated cell death in Alzheimer’s disease Loss of microRNA cluster miR-29a/b-1 in sporadic Alzheimer’s disease correlates with increased BACE1/beta-secretase expression MicroRNA regulation of Alzheimer’s Amyloid precursor protein expression MicroRNA-101 downregulates Alzheimer’s amyloid-β precursor protein levels in human cell cultures and is differentially expressed Deregulated lncRNA MAGI2-AS3 in Alzheimer’s disease attenuates amyloid-β induced neurotoxicity and neuroinflammation by sponging miR-374b-5p MicroRNA-149 is downregulated in Alzheimer’s disease and inhibits β-amyloid accumulation and ameliorates neuronal viability through targeting BACE1 MiR-124 acts as a target for Alzheimer’s disease by regulating BACE1 miR-15b represses BACE1 expression in sporadic Alzheimer’s disease MiR-16 attenuates β-amyloid-induced neurotoxicity through targeting β-site amyloid precursor protein-cleaving enzyme 1 in an Alzheimer’s disease cell model miR-34a-5p and miR-125b-5p attenuate Aβ-induced neurotoxicity through targeting BACE1 MiR-29c-3p may promote the progression of Alzheimer’s disease through BACE1 MiR-340 reduces the accumulation of Amyloid-β through targeting BACE1 (β-site amyloid precursor protein cleaving enzyme 1) in Alzheimer’s disease MiR-22-3p regulates amyloid β deposit in mice model of Alzheimer’s disease by targeting mitogen-activated protein kinase 14 MicroRNA-195 downregulates Alzheimer’s disease amyloid-β production by targeting BACE1 miR-186 is decreased in aged brain and suppresses BACE1 expression MicroRNA-16 targets amyloid precursor protein to potentially modulate Alzheimer’s-associated pathogenesis in SAMP8 mice TRPV1 expression regulation… A further step in defining its biology: commentary for K “The anticancer antibiotic mithramycin-A inhibits TRPV1 expression in dorsal root ganglion neurons” [Neurosci miR128 up-regulation correlates with impaired amyloid β(1-42) degradation in monocytes from patients with sporadic Alzheimer’s disease Multiple isoforms of human microtubule-associated protein tau: sequences and localization in neurofibrillary tangles of Alzheimer’s disease Microtubule-associated proteins connect microtubules and neurofilaments in vitro Participation of structural microtubule-associated proteins (MAPs) in the development of neuronal polarity Tau in Alzheimer disease and related tauopathies Targeted deletion of miR-132/-212 impairs memory and alters the hippocampal transcriptome Memory formation and retention are affected in adult miR-132/212 knockout mice MicroRNA-132 promotes neurons cell apoptosis and activates Tau phosphorylation by targeting GTDC-1 in Alzheimer’s disease MicroRNA-425-5p promotes tau phosphorylation and cell apoptosis in Alzheimer’s disease by targeting heat shock protein B8 MiR-124-3p attenuates hyperphosphorylation of Tau protein-induced apoptosis via caveolin-1-PI3K/Akt/GSK3β pathway in N2a/APP695swe cells Reduced miR-512 and the elevated expression of its targets cFLIP and MCL1 localize to neurons with hyperphosphorylated tau protein in Alzheimer disease Candidate Alzheimer’s disease biomarker miR-483-5p lowers TAU phosphorylation by direct ERK1/2 repression Hyperphosphorylation of Tau due to the interference of protein phosphatase methylesterase-1 overexpression by MiR-125b-5p in melatonin receptor knockout mice Inflammation and the degenerative diseases of aging Inflammation as a central mechanism in Alzheimer’s disease Neuroinflammation in neurodegenerative disorders: the roles of microglia and astrocytes Microglia as a potential bridge between the amyloid beta-peptide and tau Astrocytes: key regulators of neuroinflammation A Nurr1/CoREST pathway in microglia and astrocytes protects dopaminergic neurons from inflammation-induced death Neurotoxic reactive astrocytes are induced by activated microglia Knockout of glutamate transporters reveals a major role for astroglial transport in excitotoxicity and clearance of glutamate Amyloid-β alters ongoing neuronal activity and excitability in the frontal cortex Astrocyte energy and neurotransmitter metabolism in Alzheimer’s disease: Integration of the glutamate/GABA-glutamine cycle Microglial autophagy is impaired by prolonged exposure to β-amyloid peptides: evidence from experimental models and Alzheimer’s disease patients BORC coordinates encounter and fusion of lysosomes with autophagosomes Elucidating the interactive roles of glia in Alzheimer’s disease using established and newly developed experimental models Toll-like receptor 4-dependent upregulation of cytokines in a transgenic mouse model of Alzheimer’s disease Role of toll-like receptor signalling in Abeta uptake and clearance RAGE and amyloid-beta peptide neurotoxicity in Alzheimer’s disease NLRP3 is activated in Alzheimer’s disease and contributes to pathology in APP/PS1 mice Pattern recognition receptors and inflammation The glial nature of embryonic and adult neural stem cells Molecular dissection of reactive astrogliosis and glial scar formation synapses: a tripartite view on cortical circuit development Stimulation of the neurotrophin receptor TrkB on astrocytes drives nitric oxide production and neurodegeneration Astrocytes and synaptic plasticity in health and disease and TLR4 in Alzheimer’s disease (AD): from risk factors to therapeutic targeting MicroRNA-146a switches microglial phenotypes to resist the pathological processes and cognitive degradation of Alzheimer’s disease MiR-146a-5p contributes to microglial polarization transitions associated With AGEs Cell-to-cell miRNA transfer: from body homeostasis to therapy Resveratrol alleviates lipopolysaccharide-induced inflammation in PC-12 cells and in rat model Roles of the miR-155 in neuroinflammation and neurological disorders: a potent biological and therapeutic target Identification of a protective microglial state mediated by miR-155 and interferon-γ signaling in a mouse model of Alzheimer’s disease miR-155 is involved in Alzheimer’s disease by regulating T lymphocyte function Late-onset dementia: a mosaic of prototypical pathologies modifiable by diet and lifestyle Molecular basis of Alzheimer’s disease: focus on mitochondria Oxidative stress in Parkinson’s disease: a systematic review and meta-analysis RNA oxidation in Alzheimer disease and related neurodegenerative disorders Oxidative damage to RNA in aging and neurodegenerative disorders Oxidative stress: a key modulator in neurodegenerative diseases Oxidative stress and altered mitochondrial protein expression in the absence of amyloid-β and tau pathology in iPSC-derived neurons from sporadic Alzheimer’s disease patients Osthole decreases beta amyloid levels through up-regulation of miR-107 in Alzheimer’s disease MicroRNA‑125b regulates Alzheimer’s disease through SphK1 regulation miR-125b promotes tau phosphorylation by targeting the neural cell adhesion molecule in neuropathological progression MiR-146a regulates SOD2 expression in H2O2 stimulated PC12 cells An NF-kappaB-sensitive micro RNA-146a-mediated inflammatory circuit in Alzheimer disease and in stressed human brain cells MicroRNA-146a suppresses ROCK1 allowing hyperphosphorylation of tau in Alzheimer’s disease Oxidative stress mediated-alterations of the microRNA expression profile in mouse hippocampal neurons Defensive effect of microRNA-200b/c against amyloid-beta peptide-induced toxicity in Alzheimer’s disease models The protective role of microRNA-200c in Alzheimer’s disease pathologies is induced by beta amyloid-triggered endoplasmic reticulum stress The amyloid hypothesis of Alzheimer’s disease: progress and problems on the road to therapeutics Amyloid-β and tau complexity - towards improved biomarkers and targeted therapies Physical basis of cognitive alterations in Alzheimer’s disease: synapse loss is the major correlate of cognitive impairment Dendritic spine pathology in neurodegenerative diseases The role of synaptic microRNAs in Alzheimer’s disease Amyloid β oligomers suppress excitatory transmitter release via presynaptic depletion of phosphatidylinositol-4,5-bisphosphate Roles of tau protein in health and disease Neuropathologic substrate of mild cognitive impairment Drosophila models of human tauopathies indicate that Tau protein toxicity in vivo is mediated by soluble cytosolic phosphorylated forms of the protein A novel perspective on tau in Alzheimer’s disease The role of protein misfolding and Tau Oligomers (TauOs) in Alzheimer’s disease (AD) Distinct amyloid-β and tau-associated microglia profiles in Alzheimer’s disease Microglial turnover in ageing-related neurodegeneration: therapeutic avenue to intervene in disease progression Peripheral inflammatory biomarkers in Alzheimer’s disease: a brief review Amyloid beta and phosphorylated tau-induced defective autophagy and mitophagy in Alzheimer’s disease Mitochondrial morphology provides a mechanism for energy buffering at synapses The origin and diversification of mitochondria Alterations in mitochondrial quality control in Alzheimer’s disease Dynamics of dynamin-related protein 1 in Alzheimer’s disease and other neurodegenerative diseases Defective mitophagy in Alzheimer’s disease Protective effects of a mitochondria-targeted small peptide SS31 against hyperglycemia-induced mitochondrial abnormalities in the liver tissues of diabetic mice MicroRNAs identified in highly purified liver-derived mitochondria may play a role in apoptosis Identification of mouse liver mitochondria-associated miRNAs and their potential biological functions Up-regulation of the mitochondrial malate dehydrogenase by oxidative stress is mediated by miR-743a c-Myc suppression of miR-23a/b enhances mitochondrial glutaminase expression and glutamine metabolism Hypoxia-regulated microRNA-210 modulates mitochondrial function and decreases ISCU and COX10 expression MicroRNA-338 regulates local cytochrome c oxidase IV mRNA levels and oxidative phosphorylation in the axons of sympathetic neurons Expression of microRNA-34a in Alzheimer’s disease brain targets genes linked to synaptic plasticity Corrigendum: “Tectoridin inhibits osteoclastogenesis and bone loss in a murine model of ovariectomy-induced osteoporosis” [Exp MiR-195 dependent roles of mitofusin2 in the mitochondrial dysfunction of hippocampal neurons in SAMP8 mice Oxygen and ion concentrations in normoxic and hypoxic brain cells A new discovery of MicroRNA-455-3p in Alzheimer’s disease Modulation of miR-34a/SIRT1 signaling protects cochlear hair cells against oxidative stress and delays age-related hearing loss through coordinated regulation of mitophagy and mitochondrial biogenesis Evidence for a neuroprotective microRNA pathway in amnestic mild cognitive impairment Synaptic basis of Alzheimer’s disease: focus on synaptic amyloid beta Deregulated mitochondrial microRNAs in Alzheimer’s disease: Focus on synapse and mitochondria miR-132/212 knockout mice reveal roles for these miRNAs in regulating cortical synaptic transmission and plasticity Brain microRNAs associated with late-life depressive symptoms are also associated with cognitive trajectory and dementia RNA and oxidative stress in Alzheimer’s disease: focus on microRNAs P3-085: Interaction network of tau protein and amyloid protein precursor under oxidative stress in Alzheimer’s disease mitochondrial dysfunction and cellular stress response in Friedreich’s ataxia APOE4 causes widespread molecular and cellular alterations associated with Alzheimer’s disease phenotypes in human iPSC-derived brain cell types Expression of human apolipoprotein E3 or E4 in the brains of Apoe-/- mice: isoform-specific effects on neurodegeneration Cellular source of apolipoprotein E4 determines neuronal susceptibility to excitotoxic injury in transgenic mice Gain of toxic apolipoprotein E4 effects in human iPSC-derived neurons is ameliorated by a small-molecule structure corrector Plasma apolipoprotein E levels and risk of dementia: a Mendelian randomization study of 106,562 individuals miR-107 and miR-650 levels in Alzheimer’s disease MicroRNA-195 rescues ApoE4-induced cognitive deficits and lysosomal defects in Alzheimer’s disease pathogenesis Inhibition of microRNA-203 protects against traumatic brain injury induced neural damages via suppressing neuronal apoptosis and dementia-related molecules integrative analysis implicates exosome-derived MicroRNA dysregulation in schizophrenia Cerebrospinal fluid inflammatory cytokine aberrations in Alzheimer’s disease Parkinson’s disease and amyotrophic lateral sclerosis: a systematic review and meta-analysis miR-212 and miR-132 are downregulated in neurally derived plasma exosomes of Alzheimer’s patients Emerging blood exosome-based biomarkers for preclinical and clinical Alzheimer’s disease: a meta-analysis and systematic review Restoring miR-132 expression rescues adult hippocampal neurogenesis and memory deficits in Alzheimer’s disease miR-132 improves the cognitive function of rats with Alzheimer’s disease by inhibiting the MAPK1 signal pathway MicroRNA-132 provides neuroprotection for tauopathies via multiple signaling pathways Combining eQTL and SNP annotation data to identify functional noncoding SNPs in GWAS trait-associated regions Network medicine: a network-based approach to human disease Interactome mapping suggests new mechanistic details underlying Alzheimer’s disease A molecular network of the aging human brain provides insights into the pathology and cognitive decline of Alzheimer’s disease Alzheimer disease susceptibility loci: evidence for a protein network under natural selection Targeted brain proteomics uncover multiple pathways to Alzheimer’s dementia Integrated proteomics and network analysis identifies protein hubs and network alterations in Alzheimer’s disease Association of TMEM106B with cortical APOE gene expression in neurodegenerative conditions Frontotemporal lobar degeneration and MicroRNAs is regulated by the microRNA-132/212 cluster and affects progranulin pathways Download references This work was supported by the National Natural Science Foundation of China (82071676) the NSFC-RGC Joint Research Scheme (32061160472) College of Life and Environmental Sciences Key Laboratory of Ethnomedicine of Ministry of Education Chinese Academy of Sciences Key Laboratory of Brain Connectome and Manipulation Shenzhen Key Laboratory of Translational Research for Brain Diseases The Brain Cognition and Brain Disease Institute Shenzhen–Hong Kong Institute of Brain Science—Shenzhen Fundamental Research Institutions Guangdong Provincial Key Laboratory of Brain Science YC conceived and designed this study; YBL and QF analyzed and collated the data; MG and YD participated in the literature call and collected samples The YBL drafted the manuscript with critical revisions from YWC and YC Download citation DOI: https://doi.org/10.1038/s41398-024-03075-8 Metrics details RNA secondary structure (RSS) of primary microRNAs (pri-miRNAs) is a key determinant for miRNA production Here we report that RNA helicase (RH) Brr2a modulates the structural complexity of pri-miRNAs to fine tune miRNA yield Brr2a interacts with microprocessor component HYL1 and its loss reduces the levels of miRNAs derived from both intron-containing and intron-lacking pri-miRNAs Brr2a binds to pri-miRNAs in vivo and in vitro Brr2a hydrolyses ATP and the activity can be significantly enhanced by pri-miRNAs Brr2a variants with compromised ATPase or RH activity are incapable of unwinding pri-miRNA and their transgenic plants fail to restore miRNA levels in brr2a-2 most of tested pri-miRNAs display distinct RSS rendering them unsuitable for efficient processing in brr2a mutants vs Col-0 this study reveals that Brr2a plays a non-canonical role in miRNA production beyond splicing regulation Cellular functions of eukaryotic RNA helicases and their links to human diseases microRNA biogenesis and stabilization in plants MicroRNAs and their regulatory roles in plant–environment interactions SWI2/SNF2 ATPase CHR2 remodels pri-miRNAs via Serrate to impede miRNA production Active 5′ splice sites regulate the biogenesis efficiency of Arabidopsis microRNAs derived from intron-containing genes mirEX 2.0 - an integrated environment for expression profiling of plant microRNAs Chromatin-associated microprocessor assembly is regulated by the U1 snRNP auxiliary protein PRP40 Arabidopsis JANUS regulates embryonic pattern formation through Pol II-mediated transcription of WOX2 and PIN7 Molecular mechanisms of pre-mRNA splicing through structural biology of the spliceosome Functions and mechanisms of RNA helicases in plants Structural basis for functional cooperation between tandem helicase cassettes in Brr2-mediated remodeling of the spliceosome Mutational analysis of a DEAD box RNA helicase: the mammalian translation initiation factor eIF‐4A Unravelling the mechanisms of RNA helicase regulation The Arabidopsis MOS4-associated complex promotes MicroRNA biogenesis and precursor messenger RNA splicing RNA-binding proteins contribute to small RNA loading in plant extracellular vesicles Structural basis of microRNA processing by Dicer-like 1 BRR2a affects flowering time via FLC splicing Highly specific gene silencing by artificial microRNAs in Arabidopsis Transcriptome analyses revealed diverse expression changes in ago1 and hyl1 Arabidopsis mutants Arabidopsis Serrate coordinates histone methyltransferases ATXR5/6 and RNA processing factor RDR6 to regulate transposon expression Dual roles of the nuclear cap-binding complex and SERRATE in pre-mRNA splicing and microRNA processing in Arabidopsis thaliana has a multifaceted role in miRNA biogenesis in Arabidopsis The Prp8 RNase H-like domain inhibits Brr2-mediated U4/U6 snRNA unwinding by blocking Brr2 loading onto the U4 snRNA Brr2p-mediated conformational rearrangements in the spliceosome during activation and substrate repositioning Identification of pri-miRNA stem-loop interacting proteins in plants using a modified version of the Csy4 CRISPR endonuclease Structural evidence for consecutive Hel308-like modules in the spliceosomal ATPase Brr2 Mutational analysis of a DEAD box RNA helicase: the mammalian translation initiation factor eIF-4A Crystal structure of a DEAD box protein from the hyperthermophile Methanococcus jannaschii The architecture of the spliceosomal U4/U6.U5 tri-snRNP The epigenetic factor FVE orchestrates cytoplasmic SGS3-DRB4-DCL4 activities to promote transgene silencing in Arabidopsis Genome-wide probing RNA structure with the modified DMS-MaPseq in Arabidopsis Parallel degradome-seq and DMS-MaPseq substantially revise the miRNA biogenesis atlas in Arabidopsis A loop-to-base processing mechanism underlies the biogenesis of plant microRNAs miR319 and miR159 The loop position of shRNAs and pre-miRNAs is critical for the accuracy of dicer processing in vivo Spliceosome disassembly factors ILP1 and NTR1 promote miRNA biogenesis in Arabidopsis thaliana The large N-terminal region of the Brr2 RNA helicase guides productive spliceosome activation Interplay of cis- and trans-regulatory mechanisms in the spliceosomal RNA helicase Brr2 A comprehensive online database for exploring~ 20,000 public Arabidopsis RNA-seq libraries Recurrent evolution of heat-responsiveness in Brassicaceae COPIA elements NF-YB2 and NF-YB3 have functionally diverged and differentially induce drought and heat stress-specific genes An update to database TraVA: organ-specific cold stress response in Arabidopsis thaliana DMS-MaPseq for genome-wide or targeted RNA structure probing in vivo Download references all the members of the Zhang Laboratory for their help and careful proofreading of this manuscript and the TAMU HPRC (High Performance Research Computing) group for supercomputing support The work was supported by grants from NIH R35GM151976 NSF MCB 2139857 and Welch Foundation A-2177-20230405 to X.Z These authors contributed equally: Xindi Li State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-products Key Laboratory of Biotechnology in Plant Protection of MARA and Zhejiang Province State Key Laboratory of Plant Physiology and Biochemistry participated in DMS-MaPseq library preparation wrote the initial draft of the manuscript and X.Z Nature Plants thanks Lin Liu and the other Pan-transcriptome analysis showed the expression association of DCL1 and RHs identified in IP-MS/MS of microprocessor components P ≥ 0.05; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001 Heatmap revealed the distinct expression levels of three Brr2 homolog genes in Arabidopsis Fluorescence signal of YFP-Brr2a and mCherry-HYL1 in tobacco leaf cells Multiple sequence alignment (MSA) exhibited the highly conserved the motifs associated with ATPase activity within N terminal helicase cassette of Brr2a across mammals Asterisk represented the point mutation of brr2a-2 Sequence alignment of the amiR-Brr2a with the transcripts of Brr2a sRNA blot analyses of the artificial miRNA in transgenic plants The sequence alignment of the amiR-Brr2a with the transcripts of putative off-targets 5’ RACE assays (g) and RT-qPCR (h) revealed the absence of off-target effects in the brr2a-3 Col-0 and brr2a-2 served as negative controls two-way ANOVA analysis with Dunnett’s multiple comparisons test At least three independent experiments were performed Source data unpaired two-sided t-test (a) and hypergeometric distribution test (b Source data sRNA-seq analysis exhibited the significantly expression of amiR-Brr2a in brr2a-3 vs Col-0 sRNA-seq analysis presented the sRNA species and their genomic distributions across Col-0 Each sample consists of three independent biological replicates with distinct sRNA species annotated using different colors RT-qPCR validated that the expression of most miRNA targets was increased in brr2a-3 and hyl1-2 vs Col-0 unpaired two-tailed t-test (a) and two-way ANOVA analysis with Dunnett’s multiple comparisons test (c) P ≥ 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001 (a Source data two-way ANOVA analysis with Dunnett’s multiple comparisons test (c) and unpaired two-tailed t-test (f) P ≥ 0.05; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001 (c Source data Coomassie Brilliant Blue staining of SDS-PAGE gels displayed the recombinant truncated Brr2a and its variants purified from E The experimental conditions were optimized for at least 6 times for purifying N-Brr2a and its variants and 3 times for purifying C-Brr2a and the proteins were later purified and obtained for multiple times under the best optimized conditions; and the results were always consistent b,c Two independent EMSA assays showed the distinct binding affinities of truncated Brr2a and its variants to dsRNA (b) The statistical analysis of EMSA results exhibited the distinct affinities of C-Brr2a (d) and N-Brr2a (e) and its variants to ssRNA in vitro The Kd and R2 values were quantified from autography signal of labelled RNAs with s.d from three independent replicates fitting a Hill slope model N/C-Brr2a represented N/C terminal truncated Brr2a; N-EQ or N-AA represented the variants of N-Brr2a carrying mutations E640Q or S676A and T678A Source data Two independent replicates of TLC assays showed the distinct ATPase activity of truncated Brr2a and its variants in vitro Two independent replicates of unwinding assays showed the helicase activity of truncated Brr2a and its variants in vitro Western blot analysis validated the comparable IP product of Brr2a and its variants used for unwinding assay The IPs were performed using M2 beads with brr2a-2 complementary lines Function compromised variants were slightly more concentrated during elution Eluted proteins were detected by an anti-MYC antibody The Native-PAGE results from an additional independent replicate of unwinding assays showed the distinct RH activity of truncated Brr2a and its variants in vitro Western blot analysis validated the successful immunoprecipitation of Brr2a and its variants from indicated brr2a-2 complementary lines in RIP assays Proteins were detected by an anti-MYC antibody N/C-Brr2a represented N/C terminal truncated Brr2a; N-EQ or N-AA represented the variants of N-Brr2a carrying mutations E640Q or S676A and T678A; Brr2a-EQ and Brr2a-AA represent the variants of full-length Brr2a carrying mutations E640Q and S676A T678A Source data Schematic approach using optimized DMS-MaPseq method to probe RSS profile of pri-miRNAs in Arabidopsis Genome wide profile of DMS activity in brr2a-3 vs Col-0 Averaged raw DMS reactivities (with read coverage ≥1000) at each type of nucleotides (A Noting that a higher DMS reactivity value indicated less RNA structural complexity Meta profile showed the structural switch at 5‘ arm (c) and 3‘ arm (d) of LTB processed pri-miRNAs in brr2a-3 vs Col-0 The DMS activity at each site was represented with a box plot as well as on the X-axis of the statistical analysis graph upper stem and miRNA/* duplex regions were consistently marked in red and pink/blue position 0 represents the base at the processing site in the miRNA/* region The numerical values indicated the distance of other bases located in the miRNA/* region or lower stem region Source data RSS of pri-miR170 (left) and pri-miR172b (right) exhibited structural switch at the lower stem and miRNA duplex regions Both pri-miR170 and pri-miR172b represented two of cases processed with BTL direction RSS of pri-miR844a exhibited structural switch at the upper stem and miRNA/* duplex regions in brr2a-3 vs Col-0 with distinctions highlighted by green dashed boxes Pri-miR844a represented one of cases processed with BTL direction RSS of pri-miR162a and pri-miR400 exhibited structural switch at terminal loop and lower stem in brr2a-3 vs Col-0 Pri-miR162a and pri-miR400 represented cases processed by LTB direction RSS of pri-miR157a and pri-miR2112 exhibited structural switch at upper stem in brr2a-3 vs Col-0 Both pri-miR157a and pri-miR2112 displayed the structure suitable for processing in brr2a-3 vs Col-0 Pri-miR157a and miR2112 represented two of cases processed with LTB direction RSS of pri-miR164a exhibited similar structure in brr2a-3 vs Col-0 pink and blue circles respectively represent miRNA and miRNA* Gray triangles label the first cutting sites Source data Download citation DOI: https://doi.org/10.1038/s41477-024-01788-8 Metrics details Large artery atherosclerosis (LAA) is a prevalent cause of acute ischemic stroke (AIS) Understanding the mechanisms linking atherosclerosis to stroke is essential for developing appropriate intervention strategies we found that the exosomal miRNA Novel-3 is selectively upregulated in the plasma of patients with LAA–AIS Novel-3 was predominantly expressed in macrophage-derived foam cells and its expression correlated with atherosclerotic plaque vulnerability in patients undergoing carotid endarterectomy Exploring the function of Novel-3 in a mouse model of cerebral ischemia we found that Novel-3 exacerbated ischemic injury and targeted microglia and macrophages expressing ionized calcium-binding adapter molecule 1 in peri-infarct regions Novel-3 increased ferroptosis and neuroinflammation by interacting with striatin (STRN) and downregulating the phosphoinositide 3-kinase–AKT–mechanistic target of rapamycin signaling pathway Blocking Novel-3 activity or overexpressing STRN provided neuroprotection under ischemic conditions Our findings suggest that exosomal Novel-3 which is primarily derived from macrophage-derived foam cells targets microglia and macrophages in the brain to induce neuroinflammation and could serve as a potential therapeutic target for patients with stroke who have atherosclerosis World Stroke Organization (WSO): Global Stroke Fact Sheet 2022 Ischemic strokes due to large-vessel occlusions contribute disproportionately to stroke-related dependence and death: a review Wang, Q. et al. A novel perspective on ischemic stroke: a review of exosome and noncoding RNA studies. Brain Sci. https://doi.org/10.3390/brainsci12081000 (2022) Extracellular microRNAs in blood differentiate between ischaemic and haemorrhagic stroke subtypes MicroRNAs as biomarkers for CNS cancer and other disorders Exosomes in atherosclerosis: convergence on macrophages and intercellular interactions of exosomes and other extracellular vesicles Histological correlates of carotid plaque surface morphology on lumen contrast imaging Oncogenic activation of PI3K–AKT–mTOR signaling suppresses ferroptosis via SREBP-mediated lipogenesis Striatin family proteins: the neglected scaffolds 17β-Estradiol upregulates striatin protein levels via Akt pathway in human umbilical vein endothelial cells Identification of circular RNA hsa_circ_0001599 as a novel biomarker for large-artery atherosclerotic stroke Comprehensive analysis of peripheral exosomal circRNAs in large artery atherosclerotic stroke Circulating exosomal circRNAs contribute to potential diagnostic value of large artery atherosclerotic stroke Exosomal miR-27b-3p secreted by visceral adipocytes contributes to endothelial inflammation and atherogenesis Exosomes—beyond stem cells for restorative therapy in stroke and neurological injury a rising star in drug delivery and diagnostics Selenium drives a transcriptional adaptive program to block ferroptosis and treat stroke Iron metabolism mediates microglia susceptibility in ferroptosis ACSL4 exacerbates ischemic stroke by promoting ferroptosis-induced brain injury and neuroinflammation UBIAD1 alleviates ferroptotic neuronal death by enhancing antioxidative capacity by cooperatively restoring impaired mitochondria and Golgi apparatus upon cerebral ischemic/reperfusion insult Microglia ferroptosis is regulated by SEC24B and contributes to neurodegeneration Redox lipid reprogramming commands susceptibility of macrophages and microglia to ferroptotic death A lymphocyte–microglia–astrocyte axis in chronic active multiple sclerosis Ferroptosis: molecular mechanisms and health implications Critical role of striatin in blood pressure and vascular responses to dietary sodium intake Striatin heterozygous mice are more sensitive to aldosterone-induced injury Galangin inhibited ferroptosis through activation of the PI3K/AKT pathway in vitro and in vivo Isolation of extracellular vesicles: general methodologies and latest trends Direct isolation of small extracellular vesicles from human blood using viscoelastic microfluidics Dual fluorescence detection of protein and RNA in Drosophila tissues Zhou, S. et al. Dandelion polysaccharides ameliorate high-fat-diet-induced atherosclerosis in mice through antioxidant and anti-inflammatory capabilities. Nutrients https://doi.org/10.3390/nu15194120 (2023) Inhibition of mTOR pathway restrains astrocyte proliferation migration and production of inflammatory mediators after oxygen–glucose deprivation and reoxygenation Circulating myocardial microRNAs from infarcted hearts are carried in exosomes and mobilise bone marrow progenitor cells The novel estrogenic receptor GPR30 alleviates ischemic injury by inhibiting TLR4-mediated microglial inflammation CD11c+ microglia promote white matter repair after ischemic stroke Dong, M. AS-exos exacerbates microglial ferroptosis-driven neuroinflammation. figshare https://doi.org/10.6084/m9.figshare.26719024.v1 (2024) Download references We thank Jiangsu Simcere Diagnostics for its technical support for the transcriptional analysis Tongji Hospital) for providing carotid endarterectomy samples we are greatly indebted to all the patients who participated in the study without whom this study would never have been accomplished This study was funded by the Ministry of Science and Technology China Brain Initiative Grant (STI2030-Major Projects 2022ZD0204700 to W.W.) the National Natural Science Foundation of China (grants 82371404 to D.-S.T. and 81873743 to D.-S.T.) and the Knowledge Innovation Program of Wuhan Shuguang Project (2022020801020454 to C.Q.) These authors contributed equally: Chuan Qin Huazhong University of Science and Technology Hubei Key Laboratory of Neural Injury and Functional Reconstruction All authors were involved in the collection and critical review of data All authors approved the final version of the manuscript Lidia Garcia Bonilla and Zhaolong Zhang for their contribution to the peer review of this work Volcano plot and heatmap depicting differentially expressed plasma ex-miRNAs in LAA patients versus HD Volcano plot depicting differentially expressed genes in microglia sorted from MCAO mice treated with Ctrl-exos or AS-exos Dashed lines reveal fold change and significance thresholds Up-regulated and down-regulated genes are shown in orange and blue GSEA pathway analysis of differentially expressed genes highlighting changes to ferroptosis-related The P value was estimated using an empirical phenotype-based permutation test Heatmap of hierarchically differentially expressed genes in the pathways related to PI3K-AKT-mTOR signaling Volcano plot depicting differentially expressed genes in HMC3 cells treated with LAA-exos or HD-exos Up-regulated and down-regulated genes are shown in purple and blue highlighting changes to mitochondrion-related Heatmap of hierarchically differentially expressed genes in the pathways related to inflammatory Representative images and quantitative analysis of intracellular Fe2+ levels (FerroOrange) (N = 6) One-way ANOVA and Tukey’s multiple comparison tests Illustration of the experimental design of microglia sorting and quantitative analysis Illustration of the in vitro experimental design of Coculture experiment of primary neurons and microglia Representative images and quantitative analysis of MAP2+ neurons with proliferation marker (Ki67) (N = 6) Quantitative analysis of cell viability of MAP2+ neurons Representative immunostaining images and quantitative analysis showing that CreER protein were more distributed in the nucleus one week after tamoxifen injection than without tamoxifen (N = 6) The yellow arrows indicated cells without CreER protein distributed in the nucleus The red arrows indicated cells with CreER protein distributed in the nucleus Representative images and quantitative analysis of STRN expression in Iba-1+ MM at 3days after MCAO treated with AAV-NC or AAV-Novel-3Sponge (N = 6) Illustration of the in vivo experimental design injecting Novel-3 antagomir Representative images and quantitative analysis of Cy3 labeled antagomiR-NC and antagomiR-Novel-3 colocalization with Iba1+ MM at 3 days after MCAO (N = 6) Representative images of immunostaining showed Iba-1+ cells 3D construction and sholl analysis in the peri-infarct areas of MCAO mice with daily administration of AS-exos and treatment of NC antagomiR or Novel-3 antagomiR (N = 6) Quantitative analysis of microglial density and morphological changes including solidity Representative images and quantitative analysis of Iba-1+ microglia with lipid peroxidation marker (4-Hydroxynonenal 4-HNE) and oxidized DNA marker (8-OHdG) at 3days after MCAO (N = 6) Quantitative analysis of behavioral tests as measured by the mNSS Two-tailed Mann-Whitney U tests and Two-way ANOVA tests for mNSS Two-way ANOVA tests for foot fault rate and rotarod test Representative images and quantitative analysis of Nissl staining of MCAO mice with daily administration of AS-exos and treatment of NC antagomiR or Novel-3 antagomiR (N = 6) Black dashed lines indicate the border of infarct area Dot plots indicated percentage of infarct area of individual mouse in each group RT-qPCR analysis and heatmap of genes in the pathways related to inflammatory responses Representative images and quantitative analysis of intracellular Fe2+ levels (FerroOrange) and oxidized lipid (C11-BODIPY581/591) (N = 6) which originated predominantly from macrophage-derived foam cells mainly targeted microglia to induce ferroptosis and neuroinflammation during ischemic stroke Download citation DOI: https://doi.org/10.1038/s43587-024-00727-8 Metrics details MEF2C is a critical transcription factor in neurodevelopment whose loss-of-function mutation in humans results in MEF2C haploinsufficiency syndrome (MHS) a severe form of autism spectrum disorder (ASD)/intellectual disability (ID) Despite prior animal studies of MEF2C heterozygosity to mimic MHS MHS-specific mutations have not been investigated previously particularly in a human context as hiPSCs afford we use patient hiPSC-derived cerebrocortical neurons and cerebral organoids to characterize MHS deficits we found that decreased neurogenesis was accompanied by activation of a micro-(mi)RNA-mediated gliogenesis pathway We also demonstrate network-level hyperexcitability in MHS neurons as evidenced by excessive synaptic and extrasynaptic activity contributing to excitatory/inhibitory (E/I) imbalance the predominantly extrasynaptic (e)NMDA receptor antagonist corrects this aberrant electrical activity associated with abnormal phenotypes MEF2C regulates many ASD-associated gene networks suggesting that treatment of MHS deficits may possibly help other forms of ASD as well the molecular mechanisms underlying ASD remain largely unknown hindering the development of robust diagnostics and effective therapies in this field these data argue that finding a successful treatment for the MEF2C haploinsufficiency form of ASD may in fact benefit other forms of ASD as well the effects of MHS-specific mutations have not been studied previously here we used MHS patient-derived human induced pluripotent stem cells (hiPSCs) and CRISPR/Cas9 technology for isogenic controls to generate cerebrocortical neurons in 2-dimensional (2D) cultures and 3D cerebral organoids These mutations manifest varying degrees of haploinsufficiency and are disease-specific This approach allowed us to study human neuronal development and function in the presence of patient-relevant mutations in MEF2C-deficient compared to control cells and thus to elucidate molecular and electrophysiological mechanisms underlying MHS pathophysiology hiPSCs were plated on Matrigel coated plates (Corning #354248) and cultured using mTeSR1 (STEMCELL Technologies The colonies were manually passaged weekly using StemPro™ EZPassage™ Disposable Stem Cell Passaging Tool (Thermo-Fisher Scientific Ctrl1 hiPSCs (Hs27, ATCC #CRL-1634; see Table S1) were used to produce the MEF2C deletion isogenic line at the Yale Stem Cell Center which used CRISPR/Cas9 to generate an 11 bp deletion in MEF2C Single clones were picked and further sequenced by Sanger sequencing An isogenic line with an 11 bp deletion was further characterized by whole-exome gene sequencing No off-target effects were detected in coding regions The isogenic line also maintained its pluripotency feeder-free hiPSCs cultured on Matrigel were induced to differentiate by exposure for 2 weeks to a cocktail of small molecules: 2 μM each of A83-01 and PNU74654 in DMEM/F12 medium supplemented with 20% Knock Out Serum Replacement (Invitrogen) Cells were then scraped manually to form floating neurospheres and maintained for 2 weeks in DMEM/F12 medium supplemented with N2 and B27 (Invitrogen) and 20 ng ml−1 of basic FGF (R&D Systems) neurospheres were seeded on polyornithine/laminin-coated dishes to form rosettes that were manually picked expanded and frozen down as human neural progenitor cells (hNPCs) hNPCs were plated onto polyornithine/laminin-coated glass coverslips or plates at a density of 1.5 × 106 cells/cm2 in DMEM/F12 medium supplemented with N2 and B27 0.1 µM of compound E (γ secretase inhibitor the medium was supplemented with GDNF (20 ng ml−1) and BDNF (20 ng ml−1) spheroids were generated from hiPSCs using SMAD inhibitors spheroids were transferred to Neurobasal medium supplemented with EGF and FGF-2 for 19 days the medium was supplemented with BDNF and NT3 until day 43 the organoids were maintained in Neurobasal medium only Cerebral organoids were maintained on an orbital shaker until use in experiments Histology was performed after 2 to 3 months of differentiation the cerebral organoids were used for multielectrode array (MEA) analysis This 3–4 month interval was chosen for analysis here because exploratory data showed insufficient cell types were expressed in the isogenic control cells prior to the 3-month time point we used four patient-related MEF2C haploinsufficient (MHS) mutations and three control hiPSC lines including a line isogenic/gene corrected to one of the patient-related lines Due to the nature of growing the hiPSC cultures and organoids with the extensive quality control (QC) involved in every batch with electrophysiological recordings not every control was available for every experiment we always ran multiple controls for each experiment the isogenic/gene-corrected control was always used for every experiment adding to our confidence that sufficient controls were used for each experimental paradigm cells were dissociated with Accutase (STEMCELL Technologies and the suspension was seeded onto glass coverslips coated with 20 µg/cm2 poly-l-ornithine (Sigma-Aldrich #3420-001-01) at a density of 25,000 cells/cm2 Cells were lysed with cell lysis buffer (Cell Signaling Technologies #9803) supplemented with protease inhibitor cocktail (Roche Protein concentrations were determined using Pierce™ BCA Protein Assay Kit (Thermo-Fisher Scientific 8–12%) were used for protein separation prior to transfer onto nitrocellulose membrane blockade with blocking buffer (Li-Cor) for 1 h and reaction overnight at 4 °C with mouse anti-MAP2 (1:2,000; Sigma-Aldrich RRID:AB_477193) and then mouse anti-GAPDH (1:10,000; Sigma-Aldrich Membranes were then reacted with goat anti-mouse infrared (IR) dye-conjugated secondary antibody (Li-Cor antibody RRID AB_621842) for 1 h at room temperature (RT) The membrane was scanned using an Odyssey® scanner and analyzed with Prism 7.04 software (GraphPad) Ctrl1 hNPCs were transfected with miRNA inhibitors using HiPerFect Transfection reagent (Qiagen # 301705) according to the manufacturer’s instructions The following inhibitors were used (purchased from Qiagen): hsa-miR-4273 miRCURY LNA miRNA mimic (339173); negative control A miRCURY LNA miRNA mimic (YM00479903) and cells were maintained for an additional 2 weeks before being fixed and stained NRXN3: F- AGTGGTGGGCTTATCCTCTAC; R- CCCTGTTCTATGTGAAGCTGGA S100β: F- TGGCCCTCATCGACGTTTTC; R- ATGTTCAAAGAACTCGTGGCA The following primers were purchased from Qiagen: SOX2 Data were normalized to 18s rRNA expression miRNA was extracted using a mirVana™ miRNA Isolation Kit (Thermo Fisher and each sample was reverse transcribed using miScript II RT Kit (Qiagen qRT-PCR reactions were performed with miScript SYBR Green PCR Kit (Qiagen #218075) in a LightCycler480II instrument (Roche) The following primers were purchased from Qiagen: miR-663b (MS00037884) or neurons at 2 time-points of differentiation (1 and 3 months) were fixed with 4% PFA for 15 min and washed 3 times with PBS Phase-contrast images of two-month-old 3D organoids were acquired on an EVOS cell imaging system (Thermo-Fisher Scientific) for size measurements Two- to three-month-old cerebral organoids were fixed in 4% PFA at 4 °C overnight followed by serial incubation in 15% and 30% sucrose in PBS overnight Fixed organoids were embedded in tissue freezing medium (TFM and were flash frozen with isopentane and liquid nitrogen Frozen organoids were sectioned in a cryostat using optimal cutting temperature (OCT) compound and then sectioned at 15-µm thickness Cells or sections were blocked with 3% BSA and 0.3% Triton X-100 in PBS for 30 min cultures were blocked with 3% BSA and 0.1% Saponin (wt/vol) in PBS Cells/sections were incubated with primary antibody in blocking solution overnight at 4 °C and then washed with PBS 647) conjugated secondary antibodies were used at 1:1000 Primary antibodies and dilutions were as follows: Rabbit anti-NANOG (1:500 RRID:AB_10559205); mouse anti-TRA1-60 (1:500 RRID:AB_2195767); mouse anti-nestin (1:250 RRID:AB_477193); chicken anti-β3-tubulin (1:500 RRID:AB_727049); guinea pig anti-VGLUT1 (1:250 RRID:AB_887872); rabbit anti-synapsin I (1:500 RRID:AB_325399); rat anti-CTIP2 (1:150; Abcam RRID:AB_2064130); rabbit anti-TBR2 (1:300; Abcam RRID:AB_2549714); rabbit anti-brain lipid binding protein (BLBP) (1:200 Coverslips were mounted on slides with fluorescent mounting medium (DAKO) and visualized with a Zeiss Axiovert (100M) epifluorescence microscope or ImageXpress automated high-content confocal microscopy (Molecular Devices) For synaptic staining of PSD95 and synapsin I punctae were visualized using a Nikon A1 confocal microscope Imaging conditions were identical for each set of stains (e.g. and PSD-95 were performed with Fiji software The number of synapses was calculated as co-localized punctae of synapsin I/PSD-95 staining per neurite length identified with β3-tubulin with Fiji software and VGAT were performed using MetaXpress (Molecular Devices) Quantification of immunostained cells was performed in a masked fashion normalized to cell number (by Hoechst staining for cell nuclei) and compared with the same masking/thresholding settings which is expressed under the EF1α promoter along with Renilla luciferase (expressed under CMV promoter) control vector using a Human Stem Cell Nucleofector Kit according to the manufacturer’s instructions (Lonza Cells were plated in a 96-well plate and terminally differentiated into neurons Cells were harvested at various time points of differentiation over a period of 11 days and then analyzed using a Dual-Glo luciferase assay kit (Promega) following the manufacturer’s instructions Firefly luciferase activity was normalized to Renilla luciferase activity No read trimming or filtering was done with this data set because the quality distribution and variance appeared normal Total counts of read-fragments aligned to known gene regions within the human hg38 RefSeq reference annotation were used as the basis for quantification of gene expression Fragment counts were derived using HTS-seq program using hg38 Ensembl transcripts as model Various QC analyses were conducted to assess the quality of the data and to identify potential outliers Differentially-expressed genes (DEGs) were identified using three bioconductor packages which were then considered and ranked based on adjusted p-values (FDR) of ≤0.1 Gene set enrichment analysis (GSEA) was performed using the top DEGs (determined by EdgeR) DEGs were selected based on several false discovery rate (FDR) Benjamini–Hochberg adjusted p values and simple p values A total of 1029 genes were used for the enrichment analysis We analyzed the expressed genome using the following software: PANTHER Overrepresentation Test (Released 20190711); GO Ontology database released 2019-02-02; Reference list: Homo sapiens (all genes in database) most DEGs were further analyzed by qPCR to validate the results dissociated organoids were resuspended in ice-cold NbActiv-1 containing 1% BSA at a concentration of 3000 cells/μl and labeled with CellPlex cell multiplexing oligonucleotides conjugated to a lipid (10x Genomics) Cells were loaded onto a Chromium Single Cell 3′ Chip (10x Genomics) and processed through the Chromium controller to generate single-cell gel beads in emulsion (GEMs) scRNA-seq libraries were prepared from captured cells using standard protocol and libraries sequenced on a NextSeq 2000 instrument (Illumina) We also used canonical markers that were enriched in the unsupervised clusters in order to cross-validate the identity of the clusters the summary statistics of these annotated clusters were used for population comparisons After the initial cell-type classification and annotation we performed additional unsupervised subclustering analysis using the Seurat function FindClusters on the radial glial cell (RGC) and GABAergic interneuron populations identified by the previous annotation we filtered out cells with only a low number of genes detected The resolution for the clustering was set at 0.4 The resulting subclusters were then analyzed to investigate their features as described in the text DEG analyses in specific cell populations were conducted on the cell types determined by SuperCT using the Seurat FindAllMarkers function we first used the subset of the target cell types The Seurat object of this subset of cells was then used to find markers and grouped by organoid types (isogenic wild-type [WT] or mutant) Output genes of FindAllMarkers were considered differential genes we used the TPM (number of transcripts of a specific gene per million total molecules counted by barcodes) to measure gene expression in a group of cells of a specific type A two-tailed paired Student’s t-test of NRXN3 expression data from 3 mutant vs 3 WT samples showed statistically increased expression of NRXN3 in hiPSC-derived GABAergic neurons (see manuscript text for details) To compare gene expression profiles between bulk RNA-seq and scRNA-seq datasets we calculated pseudo-bulk expression values from the scRNA-seq data we summarized the unique molecular identifiers (UMIs) of specific genes and the total UMIs from the scRNA-seq UMI matrix Pseudo-bulk expression values were calculated as the ratio of gene-specific UMIs to total UMIs in each cell group We then used the RRHO package in R to perform the rank-rank hypergeometric overlap test comparing the differentially expressed genes between isogenic types from both scRNA-seq and bulk RNA-seq studies Whole-cell recordings were performed with patch electrodes of 3 to 5 MΩ resistance pipettes were filled with an internal solution composed of (in mM): K-gluconate The external solution was composed of Ca2+ and Mg2+-free Hank’s Balanced Salt Solution (HBSS; GIBCO) to which were added: CaCl2 The presence of sodium current was established by inhibition with 1 µM TTX Potassium currents were confirmed by their inhibition with 20 mM TEA chloride (Tocris) and 5 mM 4AP (TCI) Recordings were performed using a MultiClamp 700B amplifier (Molecular Devices) at a data sampling frequency of 2 kHz with an analog-to-digital converter Voltage-clamp and current-clamp protocols were applied using Clampex v10.6 (Molecular Devices) Preliminary analysis and offline filtering at 500 Hz were achieved using Clampfit v10.6 (Molecular Devices) Agonist-induced currents (glutamate- and GABA-evoked) were recorded in voltage clamp mode at a holding potential of –70 mV in the nominal absence of extracellular Mg2+ and in the presence of 20 μM glycine (Sigma) and TTX (1 μM Agonist was applied via a rapid gravity-flow The internal solution for these recordings was (in mM): CsCl The internal solution for these recordings was composed of (in mM): K-gluconate The external solution comprised Ca2+ and Mg2+-free Hank’s Balanced Salt Solution (HBSS; GIBCO) to which were added the following: MgCl2 The internal solution contained (in mM): K-gluconate Miniature excitatory postsynaptic currents (mEPSCs) and miniature inhibitory postsynaptic currents (mIPSCs) were recorded at –70 mV and 0 mV at 21 °C after equilibrium in TTX (1 µM) for at least 20 min The internal solution used for recording mEPSCs and mIPSCs was comprised of (in mM): Cs-gluconate 130; CsCl 5; MgCl2 NJ) was used to calculate the frequency and amplitude of spontaneous synaptic events Based upon pilot experiments performed to determine when neuronal properties developed we recorded from 2D cultures ~5–6 weeks after neuronal differentiation from hNPCs and from cerebral organoids at 3–4 months of development Recordings were performed on a Maestro MEA (Axion Biosystems) using the “neural broadband analog mode” setting with a sampling frequency of 12.5 kHz in control conditions and after drug treatment at 37 °C and analyzed with Axion Biosystems Maestro Axis software (version 2.4.2) an electrode displaying >5 spikes per min was considered active A network burst was defined as a minimum of 25 electrodes displaying >10 spikes per electrode at <100 ms inter-spike interval Network burst frequency was calculated as total number of network bursts recorded per second during the analysis window expressed in Hz Synchronous firing was determined by analyzing a 20 ms synchrony window which is the time window around zero used for computing the area under the cross-correlation curve pooled interelectrode cross-correlation gives the synchrony index defined as a unitless measure of synchrony between 0 and 1 such that values closer to 1 indicate higher synchrony we used at least 3 independent sets of cultures from separate differentiations or 3 independent groups of cerebral organoids from separate differentiations Sample size was determined from prior power analyses based on prior data obtained in our laboratory All data were acquired by an investigator blinded to the sample groups Statistical analyses were performed using GraphPad Prism software Statistical significance was determined by a two-tailed unpaired Student’s t-test for single comparisons by ANOVA followed by a post hoc Dunnett’s test for multiple comparisons with single Ctrl or by a Sidak’s test corrected for multiple comparisons with multiple Ctrls and between selected pairs For non-parametric data such as percentage change in calcium event frequency we used a Kruskal–Wallis test followed by a post hoc Dunn’s test for multiple comparisons and Mann–Whitney U test for single comparisons we used the Kolmogorov–Smirnov test performed with Mini Analysis software (Synapstosoft Data with p values < 0.05 were considered to be statistically significant the variance was similar between groups being compared No samples or data were excluded from the analysis as more points cannot be resolved sufficiently Exact p values for all comparisons made in the main figures and supplementary figures are listed in a separate file (Supplementary Information file 1) and merged images in 4-week-old hiPSC-derived cultures Patient-relevant mutation-bearing hiPSCs abbreviated MHS-P1 through P4 The genetic background of MHS-P2 is isogenic to Ctrl1 B Quantification of GFAP intensity for each MHS line normalized to Hoechst and relative to Ctrl1 (at left) Grouped analysis of GFAP expression for Ctrl vs C Quantification of MAP2 intensity for each MHS line normalized to Hoechst and relative to Ctrl1 (at left) Grouped analysis of MAP2 expression for Ctrl vs D Representative immunoblot of MAP2 expression with GAPDH as loading control E Quantification of MAP2 protein expression for each MHS line F Grouped analysis of MAP2 expression showing a decrease in protein levels in MHS lines vs G Comparison of MEF2 luciferase reporter gene activity normalized to Renilla at day 7 of differentiation of MHS hiPSCs compared to controls (at left) and at various time points of neuronal differentiation for each MHS line vs Statistical analysis was performed on area under the curve (AUC) Sample size listed above bars (number of fields for immunofluorescence panels in ≥3 independent experiments) Individual datapoints shown on bar graphs wherever possible in this and subsequent figures (for sample sizes <25) ††††p < 0.0001 by Student’s t-test for pairwise comparisons or ANOVA with Dunnett’s post-hoc test for multiple comparisons to single Ctrl and with Sidak’s test for comparison to multiple Ctrls; comparison to Ctrl1 (*) Ctrl1 and its isogenic line MHS-P2 designated by (~) in this and subsequent figures A Top gene ontology (GO) terms for hits found in ChIP-seq analysis of the 198 MEF2C binding targets in hNPCs B List of miRNAs identified that contain binding sites for MEF2C C Relative gene expression levels of miRNA identified by ChIP-seq in control hNPCs and hNPCs expressing constitutively active MEF2 containing a VP16 transactivation domain (MEF2CA) D Relative gene expression of miRNA in Ctrl and MHS patient hiPSC-derived cells after 2 weeks in culture E Relative gene expression of miRNA in MHS patient hiPSC-derived cells exposed to ‘miR-4273 mimic’ or control miR after 2 weeks in culture F MAP2 neuronal marker expression in MHS hiPSC-derived cells expressing ‘miRNA mimic’ compared to non-target control mimic after 2 weeks in culture G GFAP astrocytic marker expression in MHS hiPSC-derived cells expressing ‘miRNA mimic’ compared to non-target control mimic after 2 weeks in culture H Schematic diagram of miRNA effect on neurogenesis and gliogenesis I Top GO biological process terms based on differentially-expressed genes (DEGs) by RNA-seq after 5 weeks in culture in MHS patient hiPSC-neurons vs J Top DEGs from RNA-seq showing higher expression in MHS hiPSC-neurons vs K Top DEGs from RNA-seq showing lower expression in MHS hiPSC-neurons vs L Bar Plot of normalized counts for the various genes acquired from RNA seq data on control lines (Ctrl1 M NRXN3 mRNA expression in each MHS patient vs N NRXN3 mRNA expression in all MHS patients combined vs Sample sizes (n) are listed above bars from at least 3 independent experiments **p < 0.01 by ANOVA with Dunnett’s post-hoc test for multiple comparisons or by two-tailed Student’s t-test for single comparisons both our ChIP-seq and RNA-seq results support the notion that gene expression in our MHS hiPSC-derived cells correlates with pathways known to be involved in dysfunctional neurogenesis A Recordings of spontaneous action potential (sAP) at resting membrane potential (RMP) B Quantification of sAP frequency in neurons from each MHS patient (P1-P4) compared to each control (Ctrl1 C Representative traces of glutamate- and GABA-evoked currents (each at 100 µM) E Quantification of glutamate and GABA current density F Ratio of glutamate to GABA current densities G Representative patch-clamp recordings of evoked AMPAR-EPSCs at holding potential (Vh = −70 mV) and NMDAR-EPSCs (Vh = +60 mV) I Input-output curves of evoked AMPAR-EPSCs and NMDAR-EPSCs K Quantification of peak current amplitude of evoked AMPAR-EPSCs and NMDAR-EPSCs from each patient L Quantification of ratio of peak AMPA/NMDA EPSCs from individual neurons for Ctrl and each MHS patient (above); grouped analysis (below) Number of neuronal recordings (n) listed above bars from at least 4 experiments in each case ****,####p < 0.0001 by ANOVA for multiple comparisons with Sidak’s post-hoc test in B D or Dunnett’s post-hoc test in H and I; comparison to Ctrl1 (*) A Representative mEPSCs recorded at –70 mV in the presence of 1 µM TTX from Ctrl1 and MHS hiPSC-neurons in culture for 5 weeks C Cumulative probability and quantification of mean mEPSC amplitude and interevent interval (inversely related to frequency) Cumulative probability of MHS mEPSC interevent interval was significantly decreased compared to Ctrl (p < 0.0001 by Kolmogorov–Smirnov test) F Cumulative probability and quantification of mean mIPSC amplitude and interevent interval Cumulative probability of MHS mIPSC interevent interval was significantly increased compared to Ctrl (p < 0.0001 by Kolmogorov–Smirnov test) responses of each MHS patient’s neurons vs and Hoechst in Ctrl1 and MHS hiPSC-neurons H Quantification of VGLUT1 in various MHS hiPSC-neurons compared to Ctrl1 I Quantification of VGAT in various MHS patient neurons compared to Ctrl1 J Quantification of the VGLUT1/VGAT ratio in various MHS patients Number of neuronal recordings or imaged fields (n) listed above bars from at least 4 experiments in each case ****,####,††††p < 0.0001 by ANOVA with Sidak’s post-hoc test in B Ctrl3 (†); Dunnett’s post-hoc test for multiple comparisons with single Ctrl (see Methods) the relative deficit in MEF2C transcriptional activity in MHS hiPSC-neurons compared to Ctrl could also contribute to the increase in mEPSC frequency as a result of decreased excitatory synaptic pruning of MHS hiPSC-neurons as they mature In contrast to excitatory neurotransmission we found that inhibitory transmission is relatively depressed by both electrophysiological and histological parameters in MHS hiPSC-neurons the increase in excitation and decrease in inhibition that we observed in MHS hiPSC-neurons may lead to hyperexcitability in the neural network thus contributing to ASD-like pathophysiology in MHS patients in the next series of experiments we investigated the properties of neural network activity in MHS vs Ctrl using hiPSC-derived 2D cultures and 3D cerebral organoids A Spontaneous neuronal calcium transients recorded from individual Ctrl1 and MHS hiPSC-neurons loaded with Fluo-4 AM B Quantification of Ca2+ transient frequency for events with rise times <200 ms (individual Ctrl1 and MHS hiPSC-neurons responses in upper panel C Representative calcium traces showing decrease in spontaneous calcium transient frequency after application of 10 µM NitroSynapsin D Quantification of calcium transient frequency before and after application of NitroSynapsin E Quantification of difference in normalized fluorescence (ΔF/F0Drug–ΔF/F0Control) as area under the curve (AUC) in response to NitroSynapsin F Representative heat maps and raster plots of MEA recordings from Ctrl and MHS hiPSC neurons before (w/o) and after treatment with 5 µM NitroSynapsin G–J Quantification of MEA recordings by mean firing rate electrode burst frequency (representing bursting of individual neurons) network burst frequency (representing bursting of the entire neural network) Sample size listed above bars represents number of cells (n) analyzed in 5–10 independent experiments responses of each MHS patient’s 2D neurons vs ††††p < 0.0001 by ANOVA by Sidak’s post-hoc test for comparison to Ctrl1 (*) or to Ctrl2 (#) or within a group (†) between NitroSynapsin treatment vs comparison was made by non-parametric Kruskal–Wallis test (see Methods) Uniform Manifold Approximation and Projection (UMAP) analysis of isogenic Ctrl1 and MHS hiPSC-derived cerebral organoids by cell-type (A) and by genotype (B) C Bar charts showing relative cell-type composition of each individual organoid captured from scRNA-seq D Violin plots showing the distribution of expression of NRXN3 by cell type Note the increased expression of NRXN3 in MHS GABAergic neurons E Heatmap of key marker genes to annotated clusters one of our male patient samples (MHS-P1) displayed somewhat less hyperexcitability Our results revealed the presence of GABAergic-related transcripts in the subclusters derived from the GABAergic cluster as evidenced for example by the expression of GAD1 and GAD2 and CALB2 transcripts within subcluster 3 of GABAergic neurons in the MHS mutant organoids compared to isogenic Ctrl This finding is consistent with an alteration in the development and specification of a subpopulation of GABAergic interneurons in the MHS cerebral organoids We speculate that the heightened expression of these genes in MHS organoids may represent an abortive compensatory response to the MEF2C mutation potentially aimed at preserving or reinstating GABAergic function through the upregulation of critical genes involved in interneuron development and functionality although we identified varying transcriptional signatures no statistically significant differences were found in the profiles of these markers between MHS and isogenic Ctrl cerebral organoids Additionally, we performed a rank-rank hypergeometric overlap (RRHO) analysis to compare gene expression profiles from bulk RNA-seq and scRNA-seq data. Despite the different time points (5 weeks vs. 3 months) and culturing conditions for 2D vs. 3D cultures, the RRHO heatmap (Fig. S9D) reveals a significant region of overlap The central red and yellow regions indicate strong concordance between the datasets particularly for genes with mid-to-high expression levels Peripheral blue regions show minimal overlap suggesting less agreement for lower-ranked genes These findings support the reliability of the single-cell data in reflecting the gene expression patterns observed in bulk RNA-seq especially for genes with increased expression these immunocytochemical findings provide added context to our transcriptomic data highlighting posttranscriptional changes not necessarily captured in the RNA sequencing analysis A Representative heat maps and single traces from Ctrl1 and MHS hiPSC-derived cerebral organoids in individual MEA wells at 3–4 months of age B Representative raster plots of MEA recordings in Ctrl and MHS cerebral organoids C Representative raster plots and heat maps of MEA recordings in Ctrl and MHS cerebral organoids after treatment with NitroSynapsin (NitroSyn) D–I Quantification of MEA mean firing rate F and H; or grouped MHS patient cerebral organoids vs Sample size is listed above bars from 6 to 7 separate cerebral organoids recorded for each genotype ****,####,††††p < 0.0001 by ANOVA with Sidak’s post-hoc test for comparison to Ctrl1 (*) or to Ctrl2 (#) we found similar results in 2D cultures and cerebral organoids in the context of the human MHS form of ASD/ID using patient-derived hiPSCs bearing MEF2C mutations studied after up to 3–4 months in culture Schematic diagram showing that MHS-hiPSCs generate more astrocytes and fewer cerebrocortical neurons the MHS neuronal population consists of fewer inhibitory neurons and excitatory neurons resulting in increased presynaptic glutamate release increased postsynaptic intracellular Ca2+ levels The novel NMDAR antagonist NitroSynapsin ameliorates this hyperactivity arguing that this phenotype is due to complete loss of MEF2C activity at a very early stage of development a similar approach may prove effective in for other forms of ASD/ID Another potential limitation concerns lack of definitive parcellation of cell types by scRNA-seq especially during development of the brain when phenotypes are changing and in neurodevelopmental diseases where intermediate phenotypes might be observed the platforms presented here provide a model system based on hiPSC-derived 2D cultures and 3D cerebral organoids on which to begin study of neurodevelopmental diseases by comparing mutant to carefully selected controls we concentrated on effects on neurons here MEF2C is also expressed in brain microglia and this is being explored in a separate set of experiments We also acknowledge that our findings of decreased neurogenesis and increased gliogenesis (of astrocytes) very early on in development may not be directly linked and their association will require further study potential biases could include lack of adequate representation of different races geographic regions (where environmental factors could come into play) and patient fibroblast samples obtained at various ages this is the first study to faithfully reproduce many of the features of human MHS in hiPSC-based model systems including the lack of normal neuronal and synaptic differentiation and the presence of a hyperelectrical phenotype as observed on EEGs of children with the MHS form of ASD/ID • Original data for ChIP-Seq and RNA-Seq will be available online • The data sets generated during the current study are available within the paper or from the corresponding author on reasonable request • This paper does not report original code • Any additional information required to reanalyze the data reported in this paper is available from the Lead Contact upon request cell lines and model organisms and tools are either available through commercial sources or the corresponding authors All unique/stable reagents generated in this study are available from the Lead Contact with a completed standard institutional Materials Transfer Agreement (MTA) Further information and requests for resources and reagents listed in Key Resources Table should be directed to the Lead Contact Diagnostic and statistical manual of mental disorders Developmental Disabilities Monitoring Network Surveillance Year 2010 Principal Investigators Centers for Disease Control and Prevention (CDC) Prevalence of autism spectrum disorder among children aged 8 years - autism and developmental disabilities monitoring network The CHARGE Study: an epidemiologic investigation of genetic and environmentalfactors contributing to autism Genetic epidemiology and insights into interactive genetic and environmental effects in autism spectrum disorders a MADS/MEF2-family transcription factor expressed in a laminar distribution in cerebral cortex Myocyte enhancer factor (MEF) 2C: a tissue-restricted member of the MEF-2 family of transcription factors A new myocyte-specific enhancer-binding factor that recognizes a conserved element associated with multiple muscle-specific genes Human SRF-related proteins: DNA-binding properties and potential regulatory targets Human myocyte-specific enhancer factor 2 comprises a group of tissue-restricted MADS box transcription factors MEF2: a central regulator of diverse developmental programs Transcription factor MEF2C influences neural stem/progenitor cell differentiation and maturation in vivo Myocyte enhancer factor 2C as a neurogenic and antiapoptotic transcription factor in murine embryonic stem cells Neuronal activity-dependent cell survival mediated by transcription factor MEF2 a transcription factor that facilitates learning and memory by negative regulation of synapse numbers and function MEF2C hypofunction in neuronal and neuroimmune populations produces MEF2C haploinsufficiency syndrome–like behaviors in mice MEF2C regulates cortical inhibitory and excitatory synapses and behaviors relevant to neurodevelopmental disorders Mutations in MEF2C from the 5q14.3q15 microdeletion syndrome region are a frequent cause of severe mental retardation and diminish MECP2 and CDKL5 expression Identifying autism loci and genes by tracing recent shared ancestry Integrative functional genomic analyses implicate specific molecular pathways and circuits in autism Genome sequencing identifies major causes of severe intellectual disability MEF2C haploinsufficiency caused by either microdeletion of the 5q14.3 region or mutation is responsible for severe mental retardation with stereotypic movements Refining the phenotype associated with MEF2C haploinsufficiency MEF2C Haploinsufficiency features consistent hyperkinesis and has a role in dorsal and ventral neuronal developmental pathways Transcriptomic analysis of autistic brain reveals convergent molecular pathology Human-specific transcriptional networks in the brain Histone acetylome-wide association study of autism spectrum disorder Emerging roles for MEF2 in brain development and mental disorders NitroSynapsin therapy for a mouse MEF2C haploinsufficiency model of human autism A more efficient method to generate integration-free human iPS cells Mechanisms of hyperexcitability in Alzheimer’s disease hiPSC-derived neurons and cerebral organoids vs isogenic controls Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling Generation and assembly of human brain region–specific three-dimensional cultures Roles of two types of anion channels in glutamate release from mouse astrocytes under ischemic or osmotic stress PrimerBank: a resource of human and mouse PCR primer pairs for gene expression detection and quantification Isogenic human iPSC Parkinson’s model shows nitrosative stress-induced dysfunction in MEF2-PGC1α transcription Dominant-interfering forms of MEF2 generated by caspase cleavage contribute to NMDA-induced neuronal apoptosis Histone methylation-dependent mechanisms impose ligand dependency for gene activation by nuclear receptors Macrophage/cancer cell interactions mediate hormone resistance by a nuclear receptor derepression pathway Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities Individual brain organoids reproducibly form cell diversity of the human cerebral cortex SuperCT: a supervised-learning framework for enhanced characterization of single-cell transcriptomic profiles Reliability of human cortical organoid generation A time course analysis of the electrophysiological properties of neurons differentiated from human induced pluripotent stem cells (iPSCs) Predicting the functional states of human iPSC-derived neurons with single-cell RNA-seq and electrophysiology Reliable activation of immature neurons in the adult hippocampus SHANK3 and IGF1 restore synaptic deficits in neurons from 22q13 deletion syndrome patients NitroSynapsin ameliorates hypersynchronous neural network activity in Alzheimer hiPSC models Extrasynaptic NMDARs oppose synaptic NMDARs by triggering CREB shut-off and cell death pathways Co-expression of MAP-2 and GFAP in cells developing from rat EGF responsive precursor cells APP intracellular domain acts as a transcriptional regulator of miR-663 suppressing neuronal differentiation MicroRNAs in neural stem cells and neurogenesis Transcriptional profiling of MEF2-regulated genes in human neural progenitor cells derived from embryonic stem cells MicroRNA expression profiling in neurogenesis of adipose tissue-derived stem cells The harmonizome: a collection of processed datasets gathered to serve and mine knowledge about genes and proteins and regional gene expression patterns in autism Synaptic neurexin complexes: a molecular code for the logic of neural circuits Directed differentiation of embryonic stem cells into cardiomyocytes by bacterial injection of defined transcription factors The role of neurexins in schizophrenia and autistic spectrum disorder Modeling a neurexin-3α human mutation in mouse neurons identifies a novel role in the regulation of transsynaptic signaling and neurotransmitter release at excitatory synapses Developmental diversification of cortical inhibitory interneurons Activity-dependent regulation of MEF2 transcription factors suppresses excitatory synapse number Genome-wide analysis of MEF2 transcriptional program reveals synaptic target genes and neuronal activity-dependent polyadenylation site selection A calcium-regulated MEF2 sumoylation switch controls postsynaptic differentiation Pharmacologically targeted NMDA receptor antagonism by NitroMemantine for cerebrovascular disease Memantine preferentially blocks extrasynaptic over synaptic NMDA receptor currents in hippocampal autapses Balance between synaptic versus extrasynaptic NMDA receptor activity influences inclusions and neurotoxicity of mutant huntingtin Neurexins: molecular codes for shaping neuronal synapses Distinct circuit-dependent functions of presynaptic neurexin-3 at GABAergic and glutamatergic synapses Neurexin-3 defines synapse- and sex-dependent diversity of GABAergic inhibition in ventral subiculum Human astrocyte maturation captured in 3D cerebral cortical spheroids derived from pluripotent stem cells Cell diversity and network dynamics in photosensitive human brain organoids Establishing cerebral organoids as models of human-specific brain evolution Radial glia serve as neuronal progenitors in all regions of the central nervous system Whole-brain in vivo base editing reverses behavioral changes in Mef2c-mutant mice Myocyte enhancer factor 2c regulates dendritic complexity and connectivity of cerebellar Purkinje cells Expression of mef2 genes in the mouse central nervous system suggests a role in neuronal maturation Altered adult neurogenesis and gliogenesis in patients with mesial temporal lobe epilepsy are produced in the Emx1-expressing lineage Transcriptional and functional consequences of alterations to MEF2C and its topological organization in neuronal models Model of autism: increased ratio of excitation/inhibition in key neural systems FOXG1-dependent dysregulation of GABA/glutamate neuron differentiation in autism spectrum disorders Excitation-inhibition balance as a framework for investigating mechanisms in neuropsychiatric disorders Magnetic resonance spectroscopy study of the glutamatergic system in adolescent males with high-functioning autistic disorder: a pilot study at 4T Download references This work was supported in part by NIH grants R35 AG071734 California Institute for Regenerative Medicine (CIRM) award DISC2-11070 (to S.A.L.) and postdoctoral fellowship grant #11721 from Autism Speaks Statewide California Electronic Library Consortium These authors contributed equally: Dorit Trudler Neurodegeneration New Medicines Center and Department of Molecular Medicine National Institute of Science Education and Research (NISER)-Bhubaneswar an Off Campus Center of Homi Bhabha National Institute Department of Molecular and Human Genetics Sanford Burnham Prebys Medical Discovery Institute Department of Integrative Structural and Computational Biology Scientific experiments were performed by DT The original manuscript draft was prepared by DT is an inventor on worldwide patents for the use of memantine and related aminoadamantane and aminoadamantane nitrate drugs for neurodegenerative and neurodevelopmental disorders participates in a royalty-sharing agreement with his former institution Boston Children’s Hospital/Harvard Medical School which licensed the drug memantine (Namenda®) to Forest Laboratories/Actavis/Allergan/AbbVie NitroSynapsin (aka EM-036) is licensed to EuMentis Therapeutics a biotech in the Boston area for which S.A.L The other authors declare no financial conflicts of interest All data are available in the main text or the supplementary materials All methods were performed in accordance with the relevant guidelines and regulations the use of human cells was approved by the institutional review boards of the Scintillon Institute and The Scripps Research Institute (TSRI; IRB-19-7428) and informed consent was obtained from all participants or their appropriate legal guardians Download citation DOI: https://doi.org/10.1038/s41380-024-02761-9 Metrics details Despite progress in breast cancer treatment a significant portion of patients still relapse because of drug resistance The involvement of microRNAs in cancer progression and chemotherapy response is well established this study aimed to elucidate the dysregulation of the microRNA-449 family (specifically and microRNA-449c-5p) and its impact on resistance to doxorubicin a commonly used chemotherapeutic drug for the treatment of triple-negative breast cancer We found that the microRNA-449 family is downregulated in triple-negative breast cancer and demonstrated its potential as a diagnostic biomarker our findings indicate that the downregulation of the microRNA-449 family is mediated by the microRNAs-449/SIRT1-HDAC1 negative feedback loop it was found that the microRNA-449 family dysregulates the fatty acid metabolism by targeting ACSL4 which is a potential prognostic biomarker that mediates doxorubicin response through regulation of the drug extrusion pump ABCG2 our results suggest that the microRNA-449 family might be a potential therapeutic target for the treatment of triple-negative breast cancer since it is implicated in doxorubicin response through ACSL4/ABCG2 axis regulation our results also highlight the value of microRNAs-449 and ACSL4 as diagnostic and prognostic biomarkers in triple-negative breast cancer Proposed model of miRNAs-449 downregulation in TNBC and doxorubicin response MiRNAs-449 are downregulated in TNBC through a negative feedback loop with SIRT1 and HDAC1 thus diminishing the intracellular doxorubicin concentration and promoting doxorubicin resistance MiRNAs-449 overexpression downregulates the ACSL4/ABCG2 axis and sensitizes doxorubicin-resistant cells to doxorubicin TNBC: triple-negative breast cancer; DOX: doxorubicin; SIRT1: Sirtuin 1; HDAC1: Histone deacetylase 1; ACSL4: Acyl-CoA Synthetase Long-Chain Family Member 4; ABCG2: ATP-binding cassette superfamily G member 2 it is crucial to decipher the molecular and genetic bases of drug resistance to find new therapeutic tools which might help to improve the efficacy of current treatments This study aims to clarify the dysregulation of the miRNAs-449’s in TNBC and to understand its involvement in doxorubicin response and miRNA-449c-5p) expression was analyzed by RT-qPCR in TNBC cell lines (MDA-MB- 231 and MDA-MB-436) and the non-tumor immortalized line (MCF10A) (mean ± SD) (n = 3) MiRNA-449 family expression was analyzed by RT-qPCR in a discovery cohort of TN (n = 55) sample patients and healthy tissues (n = 19) samples (mean ± SD) C ROC curve analyses were performed for miRNAs-449 in TNBC tissue samples (n = 55) and healthy tissue samples (n = 19) D Representation of OS Kaplan Meier curves in TNBC samples (n = 97) from TCGA group based on an optimal cut-off of miRNAs-449 for low (black) and high (red) expression (p = 0.0500 for miRNA-449a HDAC1 (A) and SIRT1 (B) expression were analyzed by RT-qPCR (mean ± SD) (n = 3)and Western blot (C) in TNBC cell lines (MDA-MB-231 and MDA-MB-436) and the non-tumor immortalized line MCF10A and miRNA-449c-5p) expression was analyzed by RT-qPCR in TNBC cell lines (MDA-MB- 231 and MDA-MB-436) after siHDAC1 (D) or siSIRT1 (E) transfection (mean ± SD) (n = 3) Acetyl-H3 (Ac-H3) and H3 expression was analyzed by Western blot in TNBC cell lines after TSA (F) (10 nM MiRNA-449 family expression was analyzed by RT-qPCR in TNBC cell lines after TSA (H) (10 nM these results reinforced the hypothesis that miRNAs-449 expression is regulated by histone acetylation MiRNAs-449 mimics transfection was performed in MDA-MB-231 and MDA-MB-436 cell lines HDAC1 (A) and SIRT1 (B) expression was analyzed by RT-qPCR (mean ± SD) (n = 3) and Western blot (C) and miRNA-449c-5p mimics were transfected separately in MDA-MB-231 and MDA-MB-436 cell lines HDAC1 (D) and SIRT1 (E) expression was analyzed by RT-qPCR (mean ± SD) (n = 3) and western blot (F) These findings motivated further research focused on ACSL4 Thus, basal expression of ACSL4 was analyzed in our cohort of primary biopsies from TNBC and healthy breast tissue samples, which showed a significantly higher expression in TNBC patient’s tissues than in healthy tissues (p < 0.0001) (Fig. 4A). These results suggest an inverse correlation with miRNAs-449 expression in TNBC. A ACSL4 expression was analyzed by RT-qPCR in a discovery cohort of TNBC (n = 33) sample patients and healthy tissue samples (n = 19) (mean ± SD) B Luciferase reporter assay was performed in HEK-293T cell line co-transfected with pEZX-MT06 (3’UTR ACSL4 containing or empty vector) and miRNA-449a miRNA-449b-5p or miRNA-449c-5p mimics separately (mean ± SD) (n = 4) ACSL4 expression was analyzed by RT-qPCR (mean ± SD) (n = 3) (C) and western blot (D) after miRNAs-449 mimics transfection in MDA-MB-231 and MDA-MB-436 cell lines ACSL4 expression was analyzed by RT-qPCR (mean ± SD) (n = 3) (E) and Western blot (F) after miRNAs-449 mimics transfection separately in MDA-MB-231 and MDA-MB-436 cell lines These results suggest that ACSL4 is directly regulated by miRNA-449a and miRNA-449b-5p and miRNA-449c-5p) expression was analyzed by RT-qPCR in MDA-MB-231 and MDA-MB-231R cell lines (mean ± SD) (n = 3) ACSL4 expression was analyzed by RT-qPCR (mean ± SD) (n = 3) (B) and Western blot (C) in MDA-MB-231 and MDA-MB-231R cell lines D ACSL4 expression was analyzed by RT-qPCR in a discovery cohort of non-relapse (n = 12) and relapse (n = 20) TNBC patient tissue samples after chemotherapy treatment (mean ± SD) E ROC curve analysis was performed for ACSL4 in TNBC patient tissue samples who relapse (n = 20) or not (n = 12) after chemotherapy-containing treatment F Representation of DFS Kaplan Meier curves in TNBC samples (n = 53) based on an optimal cut-off of ACSL4 for low (black) and high (red) expression (p = 0.0500) although it did not reach statistical significance These results might indicate an involvement of ACSL4 in chemotherapy response ACSL4 expression was analyzed by RT-qPCR (mean ± SD) (n = 3) (A) and Western blot (B) in MDA-MB-231 and MDA-MB-231R cell lines after doxorubicin treatment (1 µM Cell cytotoxicity was analyzed by WST-1 to determine the IC50 value (mean ± SD) (n = 3) and MDA-MB-231R cell lines were transfected with miRNAs-449 mimics (C) These results suggest that the miRNA-449 family increases sensitivity to doxorubicin through ASCL4 downregulation ABCG2 expression was analyzed by RT-qPCR (mean ± SD) (n = 3) (A) and Western blot (B) in MDA-MB-231 and MDA-MB-231R cell lines C ABCG2 expression was analyzed by western blot in MDA-MB-231 and MDA-MB-231R cell lines after miRNAs-449 mimics Representative images (D) (×40 magnification) and quantification of mean fluorescence intensity (E) of doxorubicin intracellular accumulation after miRNAs-449 mimics this study focuses on the dysregulation of the miRNA-449 family and its role in the modulation of doxorubicin response our results pointed out an indirect downregulation of HDAC1 and SIRT1 by miRNA-449c-5p altogether providing evidence of a negative regulatory feedback loop between the miRNAs-449 and HDAC1/SIRT1 the current study focused on the relationship between miRNAs-449 and ACSL4 in TNBC which could be associated with a tissue-specific role of ACSL4 this study suggests an oncogenic role for ACSL4 in TNBC Our results pointed out for the first time a drug extrusion pump modulation by miRNAs-449 we observed that miRNAs-449 overexpression negatively modulated ABCG2 expression through ACSL4 downregulation thus increasing doxorubicin accumulation and sensitivity our findings confirmed that the miRNA-449 family is downregulated in TNBC and might be useful as diagnostic biomarkers that are associated with poor prognosis Our results evidence the regulation of miRNAs-449 expression through HDAC1 and SIRT1 histone deacetylases in silico analysis revealed the significant involvement of miRNAs-449 in fatty acid metabolism by targeting ACSL4 We confirmed that miRNAs-449 inhibit ACSL4 expression particularly through direct interactions involving miRNA-449a and miRNA-449b-5p miRNAs-449 were found to enhance doxorubicin sensitivity by downregulating ACSL4/ABCG2 leading to increased intracellular drug accumulation these findings suggest that miRNAs alone or in combination with ACSL4 inhibitors are a potential therapeutic strategy to overcome doxorubicin resistance The cell lines used in this study were cultured at cell passages of less than 30 in order to maintain the viability and genetic stability of the cells and routinely test for mycoplasma by using MycoStripTM 50 kit (#rep-mysnc-50 Cell lines were treated with 10 nM of trichostatin A (TSA USA) for 24 h or 300 µM of nicotinamide (NAM Sigma-Aldrich) for 24 h before real-time quantitative PCR (RT-qPCR) and Western blot analyses for epigenetic studies DMSO at 0.2% and distilled water at 0.12% were used as negative controls Cells were treated with doxorubicin at 1 µM for 48 h for RT-qPCR and Western blot 5 µM for 3 h for quantification of intracellular doxorubicin uptake 0.001 µM) for 48 h for further IC50 value analyses Cell lines were transfected with 100 nM of small interfering RNA (siRNA) targeting Acyl-CoA Synthetase Long-Chain Family Member 4 (ACSL4) (siACSL4#1: #122222 and siACSL4#2: #122223 or 50 nM of miRNAs-449 mimics (hsa-miRNA-449a (#MC11127) Ambion) molecules were used as negative transfection controls Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) was used for transfection following the manufacturer’s instructions, and the medium was refreshed with a supplemented medium after 4 h. Transfection efficiency was verified after 48 h and 72 h by RT-qPCR and Western blot, respectively (Fig. S2) The putative miRNAs-449 binding sites at the 3′UTR ACSL4 mRNA (NM_004458.2) or 3′UTR ABCG2 mRNA (NM_004827.2) were cloned into the pEZX-MT06 plasmid (Genecopeia pEZX-MT06 empty vector was used as a negative control plasmid HEK-293T cells were seeded in a 24-well plate at 105 cells/well and co-transfected with 5 ng/µl of 3′UTR containing plasmid or control plasmid pEZX-MT06 Ambion) mimic or miRNA-negative transfection control (#4464059 Ambion) using lipofectamine 2000 reagent (Invitrogen) and following manufacturer’s instruction luciferase activity was measured using Luc-PairTM Duo-Luciferase Assay Kit 2.0 (#217LF002 China) according to manufacturer’s recommendations and luminescence was detected in the microplate reader LUMIstar Omega (BMG Labtech was extracted using TRIZOL reagent (Invitrogen) as described by the manufacturer 1 µg of RNA was either retrotranscribed using a High-Capacity cDNA Reverse Transcription Kit (#4368813 or TaqmanTM MicroRNA Reverse Transcription Kit (#4366597 Applied Biosystems) for miRNAs following manufacturer’s protocol RNU43 (#001608) and miRNAs-449 specific primers (miRNA-449a: #001030 and miRNA-449c-5p: #001608) obtained from Applied Biosystems were used to generate cDNA from miRNA RNA was then retro-transcribed to cDNA at either 25 °C for 10 min and 37 °C for 2 h for mRNA The resulting cDNA was amplified using TaqMan® Universal Master Mix (#M3004E Applied Biosystems) and TaqMan 20× assays (Applied Biosystems) (miRNA-449a: #001030 ACSL4: #Hs00244871_m1) following manufacturer’s instructions on 9700HT Fast Real-Time PCR system (Applied Biosystems) PCR conditions were as follows: 50 °C for 2 min Data was analyzed following the comparative critical threshold (2−ΔΔCT) method using GAPDH (#Hs03929097_g1) or RNU43(#001095) as endogenous controls for mRNA and miRNA expression Cells were collected and lysed on ice using Pierce® RIPA buffer (#89900 Thermo Fisher Scientific) supplemented with a protease and phosphatase inhibitor cocktail (#A32961 Thermo Fisher Scientific) according to the manufacturer’s instructions Cell lysates were then sonicated by the Sonics Vibra Cell VC 505 (Sonics&Materials USA) (40% pulse and 10 s) and centrifuged (15 min Proteins were collected and quantified using the PierceTM BCA Protein Assay Kit (#23227 Thermo Fisher Scientific) following the manufacturer’s protocol Protein samples (30 µg) were loaded in 6-12% sodium dodecyl sulfate (SDS)-polyacrylamide gels and transferred to nitrocellulose membranes (#1620115 Membranes were blocked for 1 h with 5% of bovine serum albumin in 0.1% TBS-Tween20 and incubated with antibodies against SIRT1 (1:1000 Thermo Scientific) was used as a loading control membranes were washed with 0.1% TBS-Tween20 and incubated for 1 h with an anti-mouse (1:2000 Cell Signaling) IgG horseradish peroxidase-linked secondary antibody membranes were washed and signals were developed using PierceTM ECL Western blotting reagent (#32106 Thermo Fisher Scientific) or ultra-sensitive ECL Super Signal West Femto (#34095 in the ImageQuant Las 4000 system (GE-Healthcare Bioscience Chemiluminescent images were analyzed by employing ImageJ-win64 for Windows cells were seeded at 104 cells/well in a 96-well plate cells were exposed to different concentrations of doxorubicin (from 0.001 to 100 µM) for 48 h Viability was then measured with Colorimetric Cell Viability Kit II (WST-1) (#K304-2500 Absorbance was then measured at 450 nm and 650 nm (background) in the microplate reader Spectra Max Plus (Thermo Fisher Scientific) Intracellular doxorubicin uptake was analyzed by confocal microscopy 5 × 104 cells/well were seeded in an 8-well chamber (#30108 cells were exposed to 5 µM doxorubicin for 3 h cells were fixed with 4% paraformaldehyde (VWR BDH Chemicals counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (1:500 in PBS Fifteen pictures per well were acquired at the Central Medicine Research Unit (UCIM-UV) using a Leica DMi8 inverted fluorescence microscope (Wetzlar Germany) with a PE4000 LED light source and DFC9000GT camera at 40x magnification Doxorubicin and DAPI fluorescence were excited at 550 nm and 365 nm and the emission was 590 nm and 435–485 nm Mean doxorubicin fluorescence intensity per cell was analyzed with ImageJ (v1.53t USA) for windows in a minimum of 150 cells for each condition and results were normalized to scramble control condition The analysis settings were the same for all pictures and corresponding curves were calculated and plotted by the software DIANA TOOLS- mirPath v.3 (http://microrna.gr/miRPathv3) biological database was used to study cancer pathways affected by the miRNA-449 family while predicting possible targets TarBase v7.0 was selected for miRNAs-449 target gene analyses and pathways union was selected for regulated KEGG pathways analysis Pathways union derives a fused p-value for each pathway by combining the previously calculated significance levels between each miRNA and each pathway using Fisher’s Exact Test statistical analysis method total RNA was isolated from FFPE tissue using the RecoverAll Total Nucleic Acid Kit (Ambion) Expression of housekeeping GAPDH mRNA or miR-16 miRNA was used as an endogenous control The study was approved on the 25th of June of 2015 by the Research Ethics Committee of the Hospital Clínico (ethical approval number 2014/178) and all patients signed the written informed consent All statistical analyses were performed in GraphPad Prism version 8.0.1 software (La Jolla IC50 values were calculated using a variable slope (four parameters) curve Mean comparisons were performed using the two-tailed Student’s T-test for normal distribution otherwise the Mann–Whitney U-test was used Receiver-operating characteristic (ROC) curves were performed by plotting sensitivity (true positive) versus 100-specificity (false positive) and the area under the curve (AUC) was calculated The sensitivity and specificity were also calculated based on the highest value using Youden’s J index Principal Component analysis (PCA) was used to summarize the miRNAs signature into a single score vector This linear combination of all miRNAs is a weighted average where each miRNA is weighted by its importance within the first principal component A value of p < 0.05 was defined as statistically significant Assays were performed in technical and biological triplicate The datasets analyzed during the current study are available in the Kaplan–Meier plotter (https://kmplot.com/analysis/) and DIANA TOOLS- mirPath v.3 (http://www.microrna.gr/miRPathv3) repositories The other data generated or analyzed during this study are included in this published article and its supplementary information files Overview of recent advances in metastatic triple negative breast cancer Biomarkers in triple negative breast cancer: a review Chemoresistance evolution in triple-negative breast cancer delineated by single cell sequencing Mechanisms of doxorubicin-induced drug resistance and drug resistant tumour growth in a murine breast tumour model Acquisition of doxorubicin resistance in ovarian carcinoma cells accompanies activation of the NRF2 pathway Differential drug resistance acquisition to doxorubicin and paclitaxel in breast cancer cells Resistance to different anthracycline chemotherapeutics elicits distinct and actionable primary metabolic dependencies in breast cancer Anti-cancer effect of doxorubicin is mediated by downregulation of HMG-Co A reductase via inhibition of EGFR/Src pathway Mechanisms for inhibition of colon cancer cells by sulforaphane through epigenetic modulation and hTERT down-regulation Effects of SAHA and EGCG on growth potentiation of triple-negative breast cancer cells MicroRNA-148a suppresses epithelial-to-mesenchymal transition by targeting ROCK1 in non-small cell lung cancer cells Tumor-suppressive microRNA-145 targets catenin δ-1 to regulate Wnt/β-catenin signaling in human colon cancer cells MicroRNA-125b suppresses ovarian cancer progression via suppression of the epithelial-mesenchymal transition pathway by targeting the SET protein Expression of microRNA-146 suppresses NF-κB activity with reduction of metastatic potential in breast cancer cells MicroRNA-150 predicts a favorable prognosis in patients with epithelial ovarian cancer and inhibits cell invasion and metastasis by suppressing transcriptional repressor ZEB1 MiR-449a: a potential therapeutic agent for cancer E2F1-inducible microRNA 449a/b suppresses cell proliferation and promotes apoptosis MiR-449a suppresses the epithelial-mesenchymal transition and metastasis of hepatocellular carcinoma by multiple targets miR-449a and miR-449b are direct transcriptional targets of E2F1 and negatively regulate pRb–E2F1 activity through a feedback loop by targeting CDK6 and CDC25A Effect of miR-449a-mediated Notch signaling pathway on the proliferation apoptosis and invasion of papillary thyroid carcinoma cells MicroRNA-449a is downregulated in non-small cell lung cancer and inhibits migration and invasion by targeting c-Met miR-449a targets HDAC-1 and induces growth arrest in prostate cancer miR-449a inhibits colorectal cancer progression by targeting SATB2 Histone deacetylases activate hepatocyte growth factor signaling by repressing microRNA-449 in hepatocellular carcinoma cells The microRNA-449 family inhibits TGF-β-mediated liver cancer cell migration by targeting SOX4 Long-chain acyl-CoA synthetase 4–mediated fatty acid metabolism sustains androgen receptor pathway–independent prostate cancer Regulatory mechanisms leading to differential Acyl-CoA synthetase 4 expression in breast cancer cells Long chain fatty acyl-CoA synthetase 4 is a biomarker for and mediator of hormone resistance in human breast cancer The miRNA-449 family mediates doxorubicin resistance in triple-negative breast cancer by regulating cell cycle factors microRNAs exhibit high frequency genomic alterations in human cancer MYC activation is a hallmark of cancer initiation and maintenance meital Recurrent somatic mutation in DROSHA induces microRNA profile changes in Wilms tumour MicroRNA-449b-5p suppresses the growth and invasion of breast cancer cells via inhibiting CREPT-mediated Wnt/β-catenin signaling MiR-449a promotes breast cancer progression by targeting CRIP2 Downregulation of MicroRNA-449 promotes migration and invasion of breast cancer cells by targeting tumor protein D52 (TPD52) Downregulation of miRNA-449a expression associated with advanced stages and lymph node metastasis of breast cancer The significance of microRNA-449a and its potential target HDAC1 in patients with colorectal cancer Interactions between E2F1 and SirT1 regulate apoptotic response to DNA damage E2F1 and HDAC1 and represses transcription from E2F-responsive promoters Epigenetically regulated miR-449a enhances hepatitis B virus replication by targeting cAMP-responsive element binding protein 5 and modulating hepatocytes phenotype Histone deacetylase inhibition regulates miR-449a levels in skeletal muscle cells miR-449 inhibits cell proliferation and is down-regulated in gastric cancer Lipid metabolism and resistance to anticancer treatment The endogenous subcellular localisations of the long chain fatty acid-activating enzymes ACSL3 and ACSL4 in sarcoma and breast cancer cells Up-regulation of acetyl-CoA carboxylase α and fatty acid synthase by human epidermal growth factor receptor 2 at the translational level in breast cancer cells Fatty acid synthesis is required for breast cancer brain metastasis Fatty acid synthase (FASN) as a therapeutic target in breast cancer Fatty acid metabolism in breast cancer subtypes Functional interaction between acyl-coa synthetase 4 lipooxygenases and cyclooxygenase-2 in the aggressive phenotype of breast cancer cells Expression of long-chain fatty acyl-CoA synthetase 4 in breast and prostate cancers is associated with sex steroid hormone receptor negativity a new regulator of mTOR and a potential therapeutic target for enhanced estrogen receptor function in receptor-positive and -negative breast cancer Enhancer remodeling and microRNA alterations are associated with acquired resistance to ALK inhibitors DNA methylation mediated downregulation of miR-449c controls osteosarcoma cell cycle progression by directly targeting oncogene c-Myc Class II phosphoinositide 3-kinase C2β regulates a novel signaling pathway involved in breast cancer progression MicroRNA-449a enhances radiosensitivity by downregulation of c-Myc in prostate cancer cells miR-449a enhances radiosensitivity through modulating pRb/E2F1 in prostate cancer cells MiR-449a suppresses LDHA-mediated glycolysis to enhance the sensitivity of non-small cell lung cancer cells to ionizing radiation MicroRNA-449a reduces cell survival and enhances cisplatin-induced cytotoxicity via downregulation of NOTCH1 in ovarian cancer cells MicroRNA-449a inhibits triple negative breast cancer by disturbing DNA repair and chromatid separation New inhibitor targeting Acyl-CoA synthetase 4 reduces breast and prostate tumor growth therapeutic resistance and steroidogenesis LncRNA NEAT1 promotes docetaxel resistance in prostate cancer by regulating ACSL4 via sponging miR-34a-5p and miR-204-5p Acyl-CoA synthetase-4 is implicated in drug resistance in breast cancer cell lines involving the regulation of energy-dependent transporter expression ACSL4 promotes hepatocellular carcinoma progression via c-Myc stability mediated by ERK/FBW7/c-Myc axis High-fat diet impairs ferroptosis and promotes cancer invasiveness via downregulating tumor suppressor ACSL4 in lung adenocarcinoma Low ferroptosis score predicts chemotherapy responsiveness and immune-activation in colorectal cancer prognostic and immunological role of acyl-CoA synthetase long-chain family member 4 in a pan-cancer analysis Identification of ACSL4 as a biomarker and contributor of ferroptosis in clear cell renal cell carcinoma Clinically-relevant ABC transporter for anti-cancer drug resistance High expression of ABCG2 is associated with chemotherapy resistance of osteosarcoma Multidrug efflux transporter ABCG2: expression and regulation Web-based survival analysis tool tailored for medical research (KMplot): development and implementation Download references We thank the different associations that collaborate in breast cancer research and private donors for their generous contributions This work was supported by the Spanish Government and cofinanced by FEDER Funds (AES Program Biomedical Research Networking Centre for Cancer CB16/12/00241 IGC was founded by Margarita Salas’s postdoctoral grant (European Union-Next generation EU) AL was founded by Asociación Española Contra el Cancer (PRDVA19016LAME) JMC was founded by Sociedad Española de Oncología Médica (Río Hortega-SEOM) Interuniversity Research Institute for Molecular Recognition and Technological Development (IDM) Biomaterials and Nanomedicine Networking Biomedical Research Centre (CIBER-BBN) Hospital Clínico Universitario de València Center for Biomedical Network Research on Cancer (CIBERONC) Conceptualization of the manuscript was performed by STR and MT; writing of the original draft by STR; writing and PE; supervision by ET and PE; and funding acquisition by FR Human tissue collection performed in this study was approved on the 25th of June of 2015 by the Research Ethics Committee of the Hospital Clínico (ethical approval number 2014/178) and all patients signed the written informed consent Download citation DOI: https://doi.org/10.1038/s41420-024-02128-7 The dates displayed for an article provide information on when various publication milestones were reached at the journal that has published the article activities on preceding journals at which the article was previously under consideration are not shown (for instance submission All content on this site: Copyright © 2025 Elsevier B.V. Metrics details Identifying and breeding cattle that are more feed efficient is of great benefit to beef production it is crucial that genes contributing to feed efficiency are robust across varying management settings including dietary source as well as being relevant across contrasting breeds of cattle The aim of this study was to determine miRNAs that are contributing to the expression of residual feed intake (RFI) across two breeds and dietary sources miRNA profiling was undertaken in Longissimus dorsi tissue of Charolais and Holstein–Friesian steers divergent for RFI phenotype following two contrasting consecutive diets (high-forage and high-concentrate) Ten miRNA were identified as differentially expressed (adj P < 0.1) across the breed and diet contrasts examined Of particular interest was the differential expression of miR-2419-5p and miR-2415-3p both of which were up-regulated in the Low-RFI Charolais steers across each dietary phase Pathway analysis of target mRNA genes of differentially expressed miRNA revealed enrichment (P < 0.05) for pathways including metabolic related pathways adipogenesis as well as pathways related to skeletal muscle growth These results provide insight into the skeletal muscle miRNAome of beef cattle and their potential molecular regulatory mechanisms relating to feed efficiency in beef cattle two contrasting dietary sources were utilised in this study specifically cattle were first offered a high-forage diet We hypothesised that RFI phenotype would affect the miRNAome profile of longissimus dorsi muscle of beef cattle under contrasting dietary regimes Longissimus dorsi muscle tissue sample collection is previously outlined in Keogh et al.14 all steers received local anaesthetic to the site of biopsy collection (5 ml Adrenacaine For tissue collection a 6 mm diameter Bergstrom biopsy needle (Jørgen KRUUSE All instruments used for biopsy collection were sterilised washed with 70% ethanol and treated with RNaseZap (Ambion Care was taken to ensure biopsy samples were consistently harvested at a depth of ~ 2.5 cm into the muscle tissue snap frozen in liquid nitrogen and subsequently stored at − 80 °C for long term storage pending further processing The Qiagen RNeasy Plus Universal Mini kit (Qiagen Ltd according to the manufacturer’s instructions including steps for the purification of total RNA containing miRNA (Appendix C of the manufacturers protocol) Yield of the resultant RNA was determined by measuring the absorbance at 260 nm with a Nanodrop spectrophotometer (NanoDrop Technologies; Wilmington The Agilent RNA 6000 Nano LabChip kit (Agilent Technologies Ireland Ltd.) was used on an Agilent 2100 Bioanalyser to determine the quality of the RNA isolated from each sample All samples were deemed to be of sufficient quality (RNA integrity number (RIN) > 8) Small RNA sequencing for miRNA profiling was undertaken by a commercial sequencing facility (Macrogen Europe Inc. For all samples individual cDNA libraries were prepared using the Illumina Truseq small RNA Library Prep Kit (Illumina High throughput sequencing was undertaken on an Illumina HiSeq 2500 sequencing platform incorporating 50 bp single end sequencing for small RNA sequencing specific to miRNA were then re-evaluated for quality again using FastQC (version 0.11.8) The miRDeep2 mapper module (mapper.pl) was used with default parameters to collapse reads of the sequences into clusters Bowtie (version 1.1.1) was then employed to align the collapsed reads to the indexed reference genome Using default parameters and input files including the reference genome collapsed reads versus reference genome alignment known bovine mature miRNAs and their precursor sequences (including the hairpin structures) and Bos taurus (bta) as the species of interest the miRDeep2 module (miRDeep2.pl) was used to quantify bovine miRNAs the miRDeep2 quantifier module was used to quantify all known expressed miRNAs in the sequence data producing read counts for each individual sample The miRNA read counts were then assessed for differential expression using the R (v2.14.1) Bioconductor package miRNA read counts were firstly filtered for the removal of lowly expressed genes whereby any gene with less than one count per million in at least half the number of samples (n = 8) was removed from the analysis Retained read counts were then normalised using the trimmed mean of M-values normalisation method Normalised read counts were then analysed with a generalised linear model The following contrasts were tested for differential expression between the High- and Low-RFI steers: Charolais following a HF diet; Charolais following a HC diet; Holstein–Friesian following a HF diet and; Holstein–Friesian following a HC diet Genes with a Benjamini–Hochberg false discovery rate of 10% and a fold-change greater than 1.5 were considered differentially expressed This study was conducted at the Teagasc Animal and Grassland Research and Innovation Centre All procedures involving animals were approved by the Teagasc Animal Ethics Committee and all procedures involving animals in the current study were conducted under an experimental license (AE19132/P029) from the Health Products Regulatory Authority in accordance with the cruelty to Animals Act 1876 and the European Communities (Amendment of Cruelty to Animals Act 1876) Regulations 2002 and 2005 All experiments were performed in accordance with relevant regulations and the ARRIVE (Animal Research: Reporting on In Vivo Experiments) guideline Venn diagram representing the differentially expressed miRNA between cattle divergent for RFI across varying breed type and offered contrasting dietary composition CH-HF Charolais cattle under high-forage diet HF-HF Holstein–Friesian cattle under high-froage diet CH-HC Charolais cattle under high-concentrate diet HF-HC Holstein–Friesian cattle under high-concentrate diet AMPK signalling pathway enriched based on predicted target mRNA genes of miR-129-3p. Predicted target mRNA genes are highlighted in red and include CREB5 which displayed lower expression in the Holstein–Friesian steers following the HF diet (Keogh et al., 2023), whilst miR-129-3p followed the opposite direction of effect in the Holstein–Friesian steers at the same dietary phase, indicating a direct relationship between the miRNA and CREB5 gene. Adipogenesis pathway enriched based on predicted target mRNA genes of miR-7 Predicted target mRNA genes are highlighted in red and include FABP4 which displayed lower expressed in the CH steers following the HF diet (Keogh et al. whilst miR-7 followed the opposite direction of effect in the CH steers at the same dietary phase indicating a direct relationship between the miRNA and FABP4 gene which may be more impacted by individual animal genotype and consequent differences in body growth potential or composition Despite not identifying any miRNA as common across all the contrasts examined target genes of the miRNA identified as differentially expressed in this study were involved in common biological processes These included for example pathways involved in metabolism cellular growth and insulin receptor signalling which were all enriched based on the target genes of multiple miRNA reported as differentially expressed in this current study The remainder of this discussion will focus on the effect of RFI phenotype of these enriched biological processes However despite results within the literature suggesting a role for these miRNA dependent on prevailing dietary management the same result was not observed in the current study where both miRNA were only differentially affected by feed efficiency phenotype in the Charolais steers following the HF diet The lack of an effect within the Holstein–Friesian steers may be due to the difference in body composition between the two breeds further implicating the PTEN pathway towards variation in RFI phenotype which may be mediated by the miRNA identified as differentially expressed in this study The down-regulation of CREB5 in the Holstein–Friesian steers during the HF diet was of particular interest due to the up-regulation of miRNA (miR-129-3p and miR-21-5p) which were predicted to target the expression of this gene also in the Holstein–Friesian steers during the HF diet suggesting a potential direct relationship between these miRNA and the CREB5 gene CREB5 belongs to the CREB protein family which is known to regulate cell growth downstream of AMPK signalling and based on the results of this study may be affected by variation in RFI phenotype which in turn may be mediated by the miR-129-3p and miR-21-5p miRNA which were affected by RFI phenotype However results suggest that this relationship between the aforementioned miRNA and CREB5 is specific to the Holstein–Friesian cattle and only during a high forage diet Results indicate a role for AMPK signalling towards variation in RFI RFI phenotype clearly affected the metabolism of skeletal muscle however this is dependent on diet and breed IRS2 encodes the insulin receptor substrate 2 a cytoplasmic signalling molecule that mediates the control of various cellular processes by insulin PPP1R3C encodes a carbohydrate binding protein that affects glycogen biosynthesis by activating glycogen synthase and limiting glycogen breakdown dramatically increasing basal and insulin-stimulated glycogen synthesis upon overexpression PRKACA and PRKACB both encode subunits of a member of the serine/threonine protein kinase family (PKA) which is involved in the regulation of lipid and glucose metabolism results indicate a role for insulin receptor signalling towards variation in RFI however the results again are not consistent across diets or breeds similar to the inconsistency within the literature in relation to differences in systemic glucose and insulin concentrations between cattle divergent for RFI results indicate a clear role for adipogenesis towards mediating variation in RFI phenotype within the longissimus dorsi muscle results suggest a clear role for differential miRNA regulation towards adipogenesis and lipid metabolism processes within the longissimus tissue of beef cattle divergent for RFI the role for adipogenesis and lipid metabolism may impact the subsequent quality and indeed the fatty acid profile of the resultant meat produced similar to the previous biological processes discussed this effect is not consistent across breeds and dietary phases examined down-regulated in the Low-RFI cattle in each study highlighting a potential role for this gene towards variation in RFI Overall results from this study and that of the published literature highlight the relevance of biochemical growth processes including the TGF-beta signalling pathway and the somatotropic axis towards RFI in beef cattle which may be mediated through differentially expressed miRNA identified in this study this effect may be dependent on the breed examined as well as the dietary or management systems employed Results in the literature regarding the genomic control governing RFI in beef cattle are inconsistent suggesting a role for other genomic regions or transcriptional regulators towards variation in RFI the aim of this study was to evaluate the regulation of gene expression by miRNA between cattle divergent for RFI across different breed types offered contrasting diets we did not observe any singular miRNA as differentially expressed across all diets and breeds examined in this study target mRNA of differentially expressed genes revealed the functional control of biological processes related to metabolism adipogenesis and insulin signalling as well as skeletal muscle growth Results from this study provide further insight into the skeletal muscle miRNAome expression profiles of beef cattle divergent for RFI and their potential molecular regulatory mechanisms relating to feed efficiency across contrasting breeds and dietary regimes results highlight a clear effect of both breed and dietary composition on RFI phenotype in the skeletal muscle tissue of beef cattle The sequencing data underlying this article are available in NCBI’s Gene Expression Omnibus at [https://www.ncbi.nlm.nih.gov/geo/] and can be accessed with unique GEO ID GSE269311 Improving feed efficiency of beef cattle; current state of the art and future challenges Individual methane emissions (and other gas flows) are repeatable and their relationships with feed efficiency are similar across two contrasting diets in growing bulls Methane and carbon dioxide emissions from yearling beef heifers and mature cows classified for residual feed intake under drylot conditions Use of biological priors enhances understanding of genetic architecture and genomic prediction of complex traits within and between dairy cattle breeds Liver transcriptomic networks reveal main biological processes associated with feed efficiency in beef cattle Systems biology reveals NR2F6 and TGFB1 as key regulators of feed efficiency in beef cattle Global liver gene expression differences in Nelore steers with divergent residual feed intake phenotypes Gene expression differences in longissimus muscle of Nelore steers genetically divergent for residual feed intake Transcriptome profiling of the rumen epithelium of beef cattle differing in residual feed intake Transcriptome analyses reveal reduced hepatic lipid synthesis and accumulation in more feed efficient beef cattle The effect of breed and diet type on the global transcriptome of hepatic tissue in beef cattle divergent for feed efficiency An examination of skeletal muscle and hepatic tissue transcriptomes from beef cattle divergent for residual feed intake Residual feed intake in beef cattle is associated with differences in hepatic mRNA expression of fatty acid amino acid and mitochondrial energy metabolism genes longissimus thoracis et lumborum transcriptome of steers divergent for residual feed intake Transcriptomic analysis by RNA sequencing reveals that hepatic interferon-induced genes may be associated with feed efficiency in beef heifers Molecular physiology of feed efficiency in beef cattle Identification of gene networks for residual feed intake in Angus cattle using genomic prediction and RNA-seq Effect of divergence in residual feed intake on feeding behavior and body composition traits in growing beef heifers The repeatability of feed intake and feed efficiency in beef cattle offered high-concentrate Repeatability of feed efficiency in steers offered a high-concentrate diet Feed efficiency correlations in beef cattle offered a zero-grazed grass and a high concentrate diet Repeatability of feed efficiency measures in beef steers Andrews, S. FastQC: A quality control tool for high throughput sequence data. 2010. https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ Causal analysis approaches in Ingenuity Pathway Analysis Review: Biological determinants of between-animal variation in feed efficiency of growing beef cattle Bovine hepatic miRNAome profiling and differential miRNA expression analyses between beef steers with divergent feed efficiency phenotypes Evaluation of circulating microRNA profiles in blood as potential candidate biomarkers in a subacute ruminal acidosis cow model—A pilot study Bovine rumen epithelial miRNA–mRNA dynamics reveals post-transcriptional regulation of gene expression upon transition to high-grain feeding and phytogenic supplementation Global gene expression profiling reveals genes expressed differentially in cattle with high and low residual feed intake Mitochondrial protein gene expression and the oxidative phosphorylation pathway associated with feed efficiency and energy balance in dairy cattle Characterization and duodenal transcriptome analysis of Chinese beef cattle with divergent feed efficiency using RNA-Seq An integrative transcriptome analysis indicates regulatory mRNA–miRNA networks for residual feed intake in Nelore cattle Association of AMPK subunit gene polymorphisms with growth Consequences of divergent selection for residual feed intake in pigs on muscle energy metabolism and meat quality Correction to: Residual feed intake phenotype and gender affect the expression of key genes of the lipogenesis pathway in subcutaneous adipose tissue of beef cattle Co-expression networks reveal potential regulatory roles of miRNAs in fatty acid composition of Nelore cattle Characterization and profiling of liver microRNAs by RNA-sequencing in cattle divergently selected for residual feed intake Isolation and identification of bovine preadipocytes and screening of microRNAs associated with adipogenesis Energy cost of absorption and metabolism in the ruminant gastrointestinal tract and liver: A review Residual feed intake and blood variables in young Nellore cattle Effects of divergent selection for serum insulin-like growth factor-I concentration on performance and ultrasound measures of carcass composition traits in Angus bulls and heifers Grazed grass herbage intake and performance of beef heifers with predetermined phenotypic residual feed intake classification An examination of the association of serum IGF-I concentration and fiber type composition with variation in residual feed intake in progeny of Red Angus sires divergent for maintenance energy EPD Download references The authors would like to acknowledge receipt of funding from the Irish Department of Agriculture Food and the Marine (DAFM) via the IdentiFEED project (13/S/519) Kate Keogh received funding from the Research Leaders 2025 programme co-funded by Teagasc and the European Union’s Horizon 2020 research and innovation programme under Marie Skłodowska-Curie grant agreement number 754380 Animal & Grassland Research and Innovation Centre harvested the biological samples and contributed to the statistical analysis KK undertook laboratory and bioinformatic analysis and wrote the manuscript Download citation DOI: https://doi.org/10.1038/s41598-024-70669-z Metrics details Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN) are severe mucocutaneous disorders characterized by extensive tissue necrosis; they are often accompanied by severe ocular complications (SOC) The regulatory role of microRNAs (miRNAs) in modulating immune responses in SJS/TEN is not fully understood We explored the expression profiles of specific miRNAs and their potential impact on the regulation of key innate immune genes in patients with SJS/TEN with SOC We analyzed plasma samples from 100 patients with chronic stage SJS/TEN with SOC and 92 healthy controls to examine the expression levels of eight specific miRNAs (let-7a-5p miR-27b-3p) using quantitative RT-PCR (RT-qPCR) we subjected mononuclear cells from 12 SJS/TEN patients and 9 controls to RT-qPCR to assess the expression of the innate immune-related genes IFI44L Significant upregulation of 4 miRNAs (let-7a-5p and miR-27b-3p) was observed in the plasma of SJS/TEN patients; this correlated with the increased expression of TLR3 and IFIT2 were also significantly up-regulated in the mononuclear cells from these patients indicating a systemic modulation of immune response genes Our findings demonstrate that specific miRNAs are up-regulated in SJS/TEN with SOC and associated with the upregulation of critical immune response genes suggesting their involvement in the pathogenesis and persistence of SOC These miRNAs and their target genes may serve as potential biomarkers or therapeutic targets in managing SJS/TEN with SOC These findings suggest the role of common mechanisms in the pathogenesis of SJS/TEN with SOC and of allergic diseases such as allergic dermatitis and conjunctivitis To investigate the function of the miRNAs significantly up-regulated in the plasma of SJS/TEN with SOC patients we used their mimic-transfected THP-1 cells and subjected the dsRNA receptors TLR3 This study was approved by the institutional review board of Kyoto Prefectural University of Medicine All experimental procedures were conducted in accordance with the tenets of the Declaration of Helsinki Written informed consent was obtained from all participants after they were given a detailed explanation of the research purpose and experimental protocols we utilized TaqMan MicroRNA Reverse Transcription Kits (Applied Biosystems Lithuania) for the reverse transcription (RT) reaction Quantitative miRNA PCR assays were performed on a StepOne Plus instrument (Applied Biosystems) following the manufacturer’s instructions The specific primer and probe mix included in predesigned Taqman microRNA assays were let-7a-5p We normalized the expression of miRNA using spike-in cel-miR-39 (miR-39 THP-1 cells were cultured as recommended by the manufacturer; 2-day stimulation was with 100 ng/ml PMA (Sigma-Aldrich The miRNA mimics and controls for miRNA-let-7d-3p The mimics and their negative controls were mixed with Lipofectamine RNAiMAX (Invitrogen CA) and added to the THP-1 cells for 24 h (80% confluence) Total RNA was isolated using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions RT-qPCR assays were performed on a StepOne Plus instrument (Applied Biosystems) and IFIT2 (Hs01922738) were purchased from Applied Biosystems Quantification data were normalized to the expression of the housekeeping gene GAPDH Mononuclear cells were isolated using the Lymphoprep™ (Veritas Japan) according to the manufacturer’s instructions Total RNA was isolated using the TRIzol™ Reagent (ThermoFisher Data from quantitative miRNA PCR and RT-qPCR assays were expressed as mean ± standard error (SE). The assays were evaluated using Student’s t-test performed with Microsoft Excel. We also examined the interactions between different miRNAs and their target mRNAs using miRNeta (https://www.mirnet.ca/) Comparative analysis of miRNA expression levels between SJS/TEN with SOC patients and healthy controls This figure displays the quantitative miRNA PCR analysis results for specific miRNAs (let-7a-5p miR-130a-3p and miR-27b-3p) in plasma samples from two distinct groups: SJS: SJS/TEN with SOC patients Quantification was performed using miR-39 as an internal control to normalize the data The Y-axis indicates the fold increase in specific miRNA expression levels over the control samples Data points represent the mean ± standard error of the mean (SEM) for patients with SJS/TEN with SOC in the chronic stage (n = 100) compared to the healthy controls (n = 92) Statistical significance between the groups is denoted by asterisks: *p < 0.001 suggesting significant upregulation of miRNAs in the SJS/TEN with SOC patient group relative to the controls SJS/TEN with SOC: Stevens-Johnson syndrome/Toxic Epidermal Necrolysis with Severe Ocular Complications and RIG-I Gene Expression in THP-1 Cells Transfected with Specific miRNAs This figure shows the results of our RT-qPCR analysis measuring the expression levels of TLR3 and RIG-I genes in THP-1 cells following transfection with different miRNA mimics: let-7e-5p The Y-axis represents the fold increase in specific mRNA levels over the control samples (NC: non-targeting mimic control Data are presented as the mean ± standard error of the mean (SEM) from three independent experiments with each group consisting of four replicates Statistical significance is indicated by asterisks: *p < 0.05 highlighting differences in gene expression induced by each miRNA mimic compared to the control RT-qPCR analysis of innate immune-related gene expression in THP-1 cells transfected with specific miRNA mimics This figure displays the results of RT-qPCR analysis assessing the expression of innate immune-related genes in THP-1 cells transfected with different miRNA mimics: hsa-let-7e-5p The quantification data were normalized to the expression of the housekeeping gene GAPDH The Y-axis indicates the relative increase in specific mRNA levels compared to the control samples (NC: non-targeting mimic control Data are presented as the mean ± standard error of the mean (SEM) for each group (n = 4) derived from three representative experiments it demonstrates significant changes in gene expression induced by each miRNA mimic relative to the control Interaction and competition among miRNAs and their target mRNAs in SJS/TEN with SOC This figure illustrates the potential interactions and competitions between various miRNAs and their target mRNAs as identified in plasma samples from patients with SJS/TEN with SOC The study revealed that 8 miRNAs were up-regulated in these plasma samples in addition to the previously identified miR-628-3p utilizing comprehensive gene expression analysis of mimics for each of the 9 miRNAs involved Hexagons represent the eight up-regulated miRNAs in SJS/TEN with SOC MiRNA-151a-3p was excluded because it showed no interaction with the examined target mRNAs Green circles indicate the 11 target mRNAs examined in the context of all 9 miRNA mimics used in this study Gray circles represent target mRNAs identified in preliminary experiments using mimics of 5 or 6 miRNAs We performed RT-qPCR analysis of the innate immune-related genes; IFI44L, TNFSF10, AIM2, RSAD2, CXCL10, TRIM22, IFI27, and IFIT2; using mononuclear cells from 12 SJS/TEN patients with SOC in the chronic stage and 9 healthy controls. We found that MDA5, IFI44L, RSAD2, CXCL10, and IFIT2 were significantly up-regulated (Fig. 5). RT-qPCR analysis of innate immune-related gene expression in mononuclear cells derived from SJS/TEN with SOC patients and controls This figure presents the results of RT-qPCR analysis measuring the expression of innate immune-related genes in mononuclear cells from SJS/TEN patients with SOC in the chronic stage (n = 12) compared to the healthy controls (n = 9) The expression data were normalized to the housekeeping gene GAPDH The Y-axis indicates the relative increase in specific mRNA levels over control samples Data are expressed as the mean ± standard error of the mean (SEM) Statistical significance is denoted by an asterisk (*p < 0.05) highlighting differences in gene expression between the two groups that were significantly upregulated in patients with severe atopic keratoconjunctivitis compared to controls These miRNAs were also found to be elevated in the plasma of patients with SJS/TEN with SOC suggesting a common pathway of immune modulation across these inflammatory conditions As miRNA-let-7a-5p positively regulates key innate immune-related genes such as TLR3, RIG-I, and MDA522 we explored the potential regulatory effects of the other 7 miRNAs on these genes RT-qPCR analysis of THP-1 cells transfected with each respective miRNA mimic revealed that let-7e-5p and miR-27b-3p mimics could positively regulate TLR3 let-7d-3p and miR-130a-3p mimics appeared to negatively regulate these receptors and MDA5 also enhanced the expression of other innate immune-related genes such as IFI44L As shown in Fig. 4 and miR-27b-3p up-regulated target mRNAs related to the innate immune system and IFIT2 were significantly up-regulated in the mononuclear cells from patients with SJS/TEN with SOC Our findings suggest that these miRNAs up-regulated in SJS/TEN with SOC and IFIT2 contribute to the pathogenesis of SJS/TEN with SOC while let-7a-5p and let-7e-5p positively regulate key innate immune receptors This suggests that these miRNAs family members might contribute to the heightened immune reactivity observed in SJS/TEN with SOC Both revealed a complex role in our study by upregulating immune responses suggesting that depending on the cellular context and environmental cues their functions include pro- and anti-inflammatory actions MiR-130a-3p plays a significant role in inflammation, particularly in the context of metabolism-related inflammation28 MiR-130a-3p and let-7d-3p down-regulated the expression of TLR3 while let-7a-5p and let-7e-5p up-regulated their expression This suggests that their regulatory mechanism or mechanisms temper excessive immune responses in SJS/TEN with SOC The differential regulation of innate immunity-related genes by miRNAs, e.g. let-7a-5p, hsa-let-7e-5p, miR-146a-5p, and miR-27b-3p, which up-regulate TLR3, RIG-I, and MDA5, and by miR-130a-3p and let-7d-3p, which down-regulate these genes, illustrates the complexity of immune responses in SJS/TEN with SOC (Fig. 4) This intricate regulation underscores the delicate balance necessary for maintaining immune homeostasis Disruption of this balance can lead to severe clinical manifestations Analysis of an association between the levels of each miRNA and clinical data such as the patients’ age of onset the interval between onset and sample collection and the grade of conjunctival invasion into the cornea revealed no significant differences We cannot rule out the possibility that yet unknown factors play a complex role in the levels of each miRNA and IFIT2 are crucial components of the innate immune system and their dysregulation might contribute to the severe inflammatory responses observed in SJS/TEN with SOC The regulation of these genes by miRNAs highlights the complex genetic landscape of SJS/TEN and underscores their importance in mediating immune responses The upregulation of these genes in SJS/TEN with SOC might reflect an exacerbated immune response to viral or drug-induced stress potentially leading to widespread tissue damage Its upregulation in SJS/TEN with SOC might be essential for controlling the migration of immune cells to sites of inflammation which can either exacerbate or mitigate the disease process The regulation of TRAIL suggests a mechanism by which cellular apoptosis is either promoted or inhibited It may play a vital role in triggering inflammatory responses in SJS/TEN with SOC The modulation of these genes by the miRNAs we identified hints at a complex interplay between viral defence and apoptosis pathways that may become dysregulated in SJS/TEN with SOC and IFIT2 by miRNAs highlights the complex genetic landscape of SJS/TEN with SOC Our findings underscore the critical role these genes play in mediating the immune responses characteristic of SJS/TEN with SOC Because some innate immune related genes such as MDA5 were significantly up-regulated in the mononuclear cells of patients with SJS/TEN with SOC the up-regulated miRNAs and those genes might strongly contribute to the pathogenesis of SJS/TEN with SOC An understanding of the regulation of these genes by miRNAs may yield therapeutic targets Modulating the expression of these genes through miRNA-based therapies might help control the immune response and prevent the progression of ocular and skin complications in SJS/TEN with SOC particularly of mononuclear cells from these patients and the cross-sectional nature of our study limits our ability to draw causal inferences about the role of these miRNAs in disease progression Further studies are needed to explore the direct impact of these genes on the clinical outcomes of SJS/TEN and of their interactions with other signaling pathways During the preparation of this work the author(s) used ChatGPT4 in order to edit our English the authors reviewed and edited the content as needed and take full responsibility for the content of the publication The datasets used and/or analysed during the current study available from the corresponding author on reasonable request Melanoma differentiation-associated gene 5 Tumor necrosis factor (ligand) superfamily Radical S-adenosyl methionine domain containing 2 Interferon-induced protein with tetratricopeptide repeats 2 Predictive factors associated with acute ocular involvement in Stevens-Johnson syndrome and toxic epidermal necrolysis Stevens-Johnson syndrome/toxic epidermal necrolysis with severe ocular complications Pathogenesis of Stevens-Johnson Syndrome/Toxic epidermal necrolysis with severe ocular complications Severe ocular complications of SJS/TEN and associations among pre-onset and chronic factors: a report from the international ophthalmology collaborative group Independent strong association of HLA-A*02:06 and HLA-B*44:03 with cold medicine-related Stevens-Johnson syndrome with severe mucosal involvement Trans-ethnic study confirmed independent associations of HLA-A*02:06 and HLA-B*44:03 with cold medicine-related Stevens-Johnson syndrome with severe ocular surface complications Ocular surface inflammation is regulated by innate immunity Toll-like receptor 3 gene polymorphisms in Japanese patients with Stevens-Johnson syndrome Epistatic interaction between toll-like receptor 3 (TLR3) and prostaglandin E receptor 3 (PTGER3) genes HLA-A*0206 with TLR3 polymorphisms exerts more than additive effects in Stevens-Johnson syndrome with severe ocular surface complications Association between prostaglandin E receptor 3 polymorphisms and Stevens-Johnson syndrome identified by means of a genome-wide association study HLA-A*02:06 and PTGER3 polymorphism exert additive effects in cold medicine-related Stevens-Johnson syndrome with severe ocular complications Association of IKZF1 SNPs in cold medicine-related Stevens-Johnson syndrome in Thailand a new susceptibility gene for cold medicine-related Stevens-Johnson syndrome/toxic epidermal necrolysis with severe mucosal involvement Toll-like receptor 3 increases allergic and irritant contact dermatitis Toll-like receptor 3 enhances late-phase reaction of experimental allergic conjunctivitis Prostaglandin E(2)-EP(3) signaling suppresses skin inflammation in murine contact hypersensitivity Prostaglandin E receptor subtype EP3 in conjunctival epithelium regulates late-phase reaction of experimental allergic conjunctivitis Mucocutaneous inflammation in the Ikaros Family Zinc Finger 1-keratin 5-specific transgenic mice Regulation of innate immune response by mir-628-3p upregulated in the plasma of Stevens-Johnson syndrome patients Positive regulation of innate immune response by miRNA-let-7a-5p Regulation of gene expression by miRNA-455-3p upregulated in the conjunctival epithelium of patients with Stevens-Johnson syndrome in the chronic stage Let-7 microRNA as a potential therapeutic target with implications for immunotherapy Myeloid cell-targeted miR-146a mimic inhibits NF-kappaB-driven inflammation and leukemia progression in vivo microRNA-27b shuttled by mesenchymal stem cell-derived exosomes prevents sepsis by targeting JMJD3 and downregulating NF-kappaB signaling pathway Regulation and mechanism of mouse miR-130a/b in metabolism-related inflammation IFITM2 presents antiviral response through enhancing type I IFN signaling pathway Novel functions of IFI44L as a feedback regulator of host antiviral responses The interferon stimulated gene 54 promotes apoptosis CXC chemokine ligand 10 controls viral infection in the central nervous system: evidence for a role in innate immune response through recruitment and activation of natural killer cells Role of TNF superfamily ligands in innate immunity TRIM22 inhibits influenza a virus infection by targeting the viral nucleoprotein for degradation The IFN-stimulated gene IFI27 counteracts innate immune responses after viral infections by interfering with RIG-I signaling Download references Our work was partly supported by grants-in-aid from the Ministry of Education Science and Technology of the Japanese government and by grants-in-aid for scientific research form the Japanese Ministry of Health Download citation DOI: https://doi.org/10.1038/s41598-025-85528-8 Metrics details MicroRNAs(miRNAs) are promising biomarkers for early esophageal squamous cell carcinoma (ESCC) detection and prognostic prediction This study aimed to explore the potential biomarkers and molecular pathogenesis in the early diagnosis of ESCC 48 differentially expressed miRNAs (DEMs) and 1319 differentially expressed genes (DEGs) were identified between 94 ESCC tissues and 13 normal esophageal tissues in TCGA there are 6558 target genes of the 48 DEMs where 400 target genes are also among 1319 DEGs gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment indicate that the 400 DEGs significantly enriched in cell cycle And there are 66 DEGs among these six biological pathways where 22 DEMs were verified by different types of experiments in ESCC tissues single-factor Cox regression analysis show that only hsa-miR-34b-3p showed no significant correlation with the overall survival of ESCC patients We analyzed the expression trends of target genes for five miRNAs and identified three significantly different miRNAs (hsa-miR-205-3p the stage-specific miRNAs were also suggested These three qPCR validated miRNAs are also specific to the early stages of ESCC: hsa-miR-452-3p is specific to Stage I II and III; hsa-miR-205-3p is specific in Stage II and III; and hsa-miR-6499-3p is Stage II specific They might be the potential biomarkers for ESCC stage diagnosis This study identified three novel miRNA markers potentially related to the diagnosis of ESCC and participated in the occurrence and development of ESCC through cell cycle the specific pathogenesis of ESCC remains unclear we used the transcriptomic data of both miRNA and mRNA clinical survival information of ESCC from TCGA to explore novel key miRNA markers participating in progression of ESCC as well as their molecular pathogenic mechanism in ESCC DEMs and DEGs between ESCC and normal samples A Volcano plot of 1319 DEGs with FDR < 0.05 and 4-FoldChange; B Volcano plot of DEMs with FDR < 0.05 and 4-FoldChange; C Heatmap of 1319 DEGs; D Heatmap of 48 DEMs There are 6,559 target genes of 48 DEMs according to miRTarBase database (https://mirtarbase.cuhk.edu.cn/~miRTarBase/miRTarBase_2022/php/index.php) Common genes between 1319 DEGs and 6,559 target genes of 48 DEMs A Venn diagram of 1319 DEGs and the 6559 target genes of 48 DEMs where the 400 common genes are DEM regulated DEGs; B Heatmap of the 400 DEM regulated DEGs Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes(KEGG) enrichment analysis of 1319 DEGs, 6559 target genes of the 48 DEMs, and 400 DEM-regulated DEGs were shown in Fig. 3. GO and KEGG enrichment of DEGs and DEMs A Dot plot of top GO terms enriched from 6559 target gene of 48 DEMs; B Dot plot of top GO terms enriched from 1319 DEGs; C Dot plot of top GO terms enriched from 400 DEM-regulated DEGs; D Dot plot of top KEGG pathways enriched from 6559 target gene of 48 DEMs; E Dot plot of top KEGG pathways enriched from 1319 DEGs; F Dot plot of top KEGG pathways enriched from 400 DEM-regulated DEGs; G The occurrence heatmap shows that only 66 DEM-regulated DEGs participate in the top six KEGG pathways From GO enrichment of 6559 DEMs target genes in Fig. 3A the top enriched biological processes include cell growth and regulation of binding; the top cell components include cell-substrate junction and cell leading edge; and the top molecular function include DNA-binding transcription factor binding DNA-binding transcription activator activity RNA polymerase II-specific DNA-binding transcription factor binding cadherin binding From GO enrichment of 1319 DEGs in Fig. 3B the top enriched biological processes include epidermis development The top enriched cell components include the collagen-containing extracellular matrix The top enriched molecular functions include glycosaminoglycan binding extracellular matrix structural constituent From GO enrichment of 400 DEM-regulated DEGs in Fig. 3C the top enriched biological processes include organelle fission microtubule cytoskeleton organization involved in mitosis and regulation of chromosome segregation; the top cell components include the spindle and outer kinetochore; and the top molecular functions include DNA-binding transcription activator activity RNA polymerase II-specific extracellular matrix structural constituent conferring tensile strength From KEGG enrichment of 6559 DEMs target genes in Fig. 3D the top enriched KEGG pathways include Human papillomavirus infection From KEGG enrichment of 1319 DEGs in Fig. 3E the top enriched KEGG pathways include Cell Cycle Furthermore, KEGG enrichment of 400 DEM-regulated DEGs in Fig. 3F shows that the top enriched KEGG pathways include cell cycle Both GO and KEGG enrichment indicates that these six pathways were the main mechanisms of both DEM target genes and regulated DEGs, which related to ESCC. We thus filtered the DEM-regulated DEGs in these six ESCC-related pathways, and there are 66 DEM-regulated DEGs among them as shown in their occurrence heatmap of Fig. 3G The heatmaps of the DEM-regulated DEGs in six ESCC-related pathways A Heatmap of DEM-regulated DEGs in cell cycle pathway; B Heatmap of DEM-regulated DEGs in proteoglycans in cancer pathway; C Heatmap of DEM-regulated DEGs in p53 signaling pathway; D Heatmap of DEM-regulated DEGs in protein digestion and absorption pathway; E Heatmap of DEM-regulated DEGs in transcriptional misregulation in cancer pathway; F Heatmap of DEM-regulated DEGs in oocyte meiosis pathway A The heatmap of 9 DEMs in ESCC and normal samples; B The miRNA–mRNA regulatory networks of the 9 novel DEMs and their regulated DEGs; C Sankey diagram of the Sankey diagram of the novel 9 DEMs and the ESCC pathways these DEGs participate in GO and KEGG enrichment of 2280 target genes of 9 ESCC-related DEMs A Dot plot of top GO terms enriched from 2280 target genes of 9 ESCC-related DEMs; B Dot plot of top KEGG pathways enriched from 2280 target genes of 9 ESCC-related DEMs; C Chord plot of top KEGG pathways enriched from 2280 target genes of 9 ESCC-related DEMs qRT-PCR for 9 identified candidate novel miRNAs in KYSE-30 and Het-1 A cell lines (“ns” indicates p > 0.05; “*” indicates p < 0.05; “***” indicates p < 0.001; “****” indicates p < 0.0001) The qRT-PCR detection results of three novel miRNAs in KYSE-180 and Het-1 A cell lines (“*” indicates p < 0.05; “***” indicates p < 0.001; “****” indicates p < 0.0001) These validation results confirm the results from our bioinformatics analyses  indicating the potential utilization of these novel miRNA markers in the diagnosis and therapeutics of esophageal squamous cell carcinoma These three miRNAs are now at the forefront of our ongoing research We also performed the differential analysis of miRNAs on patients at four ESCC pathologic stages to show the stage specificity of the novel miRNA markers The results are shown in Supplementary Table 1 hsa-miR-29b-2-5p were common to all of the four stages in ESCC; hsa-miR-452-3p (qPCR validated) and hsa-miR-215-5p is common to Stage I II and III; hsa-miR-205-3p (qPCR validated) hsa-miR-4652-5p and hsa-miR-194-3p were specific in Stage II and III; hsa-miR-6499-3p (qPCR validated) and hsa-miR-767-5p were Stage II specific The three qPCR validated miRNAs were also specific to the first three stages of ESCC The bioinformatics analysis flow chart of this study (Note: TCGA stands for The Cancer Genome Atlas also known as the Cancer Genome Atlas Project; GO refers to Gene Ontology the gene ontology; KEGG stands for Kyoto Encyclopedia of Genes and Genomes the encyclopedia of genes and genomes in Kyoto; DEMs refer to differentially expressed miRNAs differentially expressed microRNAs; DEG refers to differentially expressed gene; qRT-PCR stands for Quantitative Real-time PCR quantitative real-time polymerase chain reaction) The miRNAs and mRNAs expression data were normalized by using the “GDCRNATools” package in R 4.2.2 The miRNAs and mRNAs with no expression on more than 50% samples were excluded in the following analysis The differentially expression analysis of miRNAs and mRNAs between tumor and adjacent normal tissues were conducted using the “limma” package The screening thresholds are FDR < 0.05 and logFC > 2 (where logFC > 0 indicates upregulated and logFC < 0 indicates downregulated in tumor samples) The miRNAs and mRNAs satisfying the screening thresholds are the differentially expressed miRNAs (DEMs) and differentially expressed genes (DEGs) The visualization of differentially expression analysis results was shown in VolcanoPlot using the “gdcVolcanoPlot” package in R 4.2.2 The heatmaps of DEMs and DEGs expression patterns were drawn using the “ComplexHeatmap” package in R 4.2.2 where the clustering distance used Euclidean distance of normalized expression data The miRNA–mRNA interactions were collected from miRTarBase database (https://mirtarbase.cuhk.edu.cn) The target genes of the DEMs were then filtered based on these miRNA–mRNA interactions The intersection of the target genes of DEMs and DEGs were analyzed by “VennDiagram” package in R 4.2.2 were performed on “clusterProfiler” package in R 4.2.2 The statistically significant enriched functional annotations and pathways were those with enrichment adjusted p-value The heatmap of the top enriched KEGG pathway with DEGs expression was drawn by “enrichplot” package in R 4.2.2 The miRNACancerMAP (https://cis.hku.hk/miRNACancerMAP) consists of miRNA expression and regulatory target genes in various cancers reported in PubMed Compared the miRNA markers related to ESCC from miRNACancerMAP with our DEMs the novel ESCC-related miRNA markers were obtained The miRNA–mRNA interactions between DEMs and DEM-regulated DEGs inferred from miRTarBase database was drawn on Cytoscape 3.7.2 The mRNA levels of newly identified miRNAs were measured using qPCR with each sample tested in triplicate for accuracy Primer sequences are provided in Supplementary Table 2 designed for specific primer fragments to ensure reliable gene expression data Statistical analysis was conducted using R language and GraphPad prism 9 Comparisons between two groups were done with t test and multiple groups with one-way analysis of variance (ANOVA) The data are presented as mean ± standard error of the mean (SEM) Normally distributed variables were compared by Student’s t test or one-way analysis of variance (ANOVA) followed by Bonferroni correction for multiple comparisons Chi-square test was used to analyze the counting data ESCC is a prominent subtype of esophageal cancer in Asia both early diagnosis and effective treatment are quite limited The pathogenic mechanisms of ESCC remains unclear The treatment approaches include surgical procedures Recent studies demonstrated that miRNA roled as an essential marker for early diagnosis and potential target of cancer MiRNAs are not very specific as potential drug targets as they negatively regulate many target genes the integration analysis of miRNA and mRNA are very important to figure out the specific miRNA–mRNA regulations related to disease progression TCGA is currently the biggest dataset on various cancers The integration analysis can help to make the target miRNAs more specifically as potential markers for ESCC and also compensate the information loss from small sample set we jointly analyzed ESCC RNA-seq and miRNA-seq data in the TCGA database and 400 DEM-regulated DEGs were identified According to KEGG enrichment of 400 DEM-regulated DEGs the top enriched KEGG pathways include cell cycle We call these six KEGG pathways as ESCC-related pathways And there are 66 DEM-regulated DEGs in these ESCC-related pathways 22 DEMs were reported to relate ESCC in PubMed Survival analysis on the remaining 10 DEMs confirmed their significant relatedness to ESCC except hsa-miR-34b-3p and hsa-miR-29b-2-5p) might be novel ESCC-related miRNA markers these nine ESCC-related novel miRNAs (hsa-miR-944 and hsa-miR-29b-2-5p) involved in cancer inhibition or carcinogenic effects and might be promising potential biomarkers for ESCC diagnosis and treatment targets They participate in the occurrence and development of ESCC through various pathways and the signaling pathway of oocyte meiosis These results require further validation in clinical samples We also performed the qPCR on two ESCC cell lines these three markers were also specific to the first three stages of ESCC indicating they might be the potential diagnosis biomarkers of ESCC stage The ESCC RNA-Seq, miRNA-Seq data, clinical data were obtained from The Cancer Genome Atlas(TCGA) (https://portal.gdc.cancer.gov/projects/TCGA-ESCA; dbGaP Study Accession number is phs000178) This study complies with its data use and publication rules Systematic profiling of ferroptosis gene signatures predicts prognostic factors in esophageal squamous cell carcinoma Annual cost of illness of stomach and esophageal cancer patients in urban and rural areas in China: a multi-center study and national burden of stomach cancer in 195 countries 1990–2017: a systematic analysis for the Global Burden of Disease study 2017 Epidemiology of esophageal squamous cell carcinoma MicroRNA expression profiles in superficial esophageal squamous cell carcinoma before endoscopic submucosal dissection: a pilot study Distinctive microRNA profiles relating to patient survival in esophageal squamous cell carcinoma Identification of serum microRNAs as novel biomarkers in esophageal squamous cell carcinoma using feature selection algorithms MicroRNAs in esophageal squamous cell carcinoma: application in prognosis & MicroRNAs New biomarkers for diagnosis therapy prediction and therapeutic tools for breast cancer Circulating miRNAs: roles in cancer diagnosis MicroRNAs: target recognition and regulatory functions Clinical significance of signal regulatory protein alpha (SIRPalpha) expression in esophageal squamous cell carcinoma Identification of key genes and pathways associated with esophageal squamous cell carcinoma development based on weighted gene correlation network analysis Identification of miR-375 as a potential prognostic biomarker for esophageal squamous cell cancer: a bioinformatics analysis based on TCGA and meta-analysis and invasion and promotes apoptosis in esophageal squamous cell carcinoma Identification and validation of hub microRNAs dysregulated in esophageal squamous cell carcinoma MiR-141-3p is upregulated in esophageal squamous cell carcinoma and targets pleckstrin homology domain leucine-rich repeat protein phosphatase-2 a negative regulator of the PI3K/AKT pathway Long non-coding RNA XIST promotes the progression of esophageal squamous cell carcinoma through sponging mir-129-5p and upregulating CCND1 expression ADAMTS9-AS2 regulates PPP1R12B by adsorbing miR-196b-5p and affects cell cycle-related signaling pathways inhibiting the malignant process of esophageal cancer Long non-coding RNA OIP5-AS1 inhibits the proliferation and migration of esophageal squamous carcinoma cells by targeting FOXD1/miR-30a-5p axis and the effect of micro- and nano-particles on targeting transfection system Down-regulation of miR-30a-3p/5p promotes esophageal squamous cell carcinoma cell proliferation by activating the wnt signaling pathway LncRNA TUG1 contributes to ESCC progression via regulating miR-148a-3p/MCL-1/Wnt/beta-catenin axis in vitro Circular RNA hsa_circ_0000654 promotes esophageal squamous cell carcinoma progression by regulating the miR-149-5p/IL-6/STAT3 pathway The suppressive effects of microRNA-139-5p on proliferation and invasion of esophageal squamous cell carcinoma Circ_0007624 suppresses the development of esophageal squamous cell carcinoma via targeting miR-224-5p/CPEB3 to inactivate the EGFR/PI3K/AKT signaling Mir-204-5p inhibits cell proliferation and induces cell apoptosis in esophageal squamous cell carcinoma by regulating Nestin MiR-455-3p acts as a prognostic marker and inhibits the proliferation and invasion of esophageal squamous cell carcinoma by targeting FAM83F Differential expression profiles of microRNAs as potential biomarkers for the early diagnosis of esophageal squamous cell carcinoma MicroRNA-153 inhibits tumor progression in esophageal squamous cell carcinoma by targeting SNAI1 A novel serum microRNA signature to screen esophageal squamous cell carcinoma LINC01518 knockdown inhibits tumorigenicity by suppression of PIK3CA/Akt pathway in oesophageal squamous cell carcinoma invasion and cell cycle in esophageal carcinoma via CCNA2/p53 axis miR-375 suppresses the growth and metastasis of esophageal squamous cell carcinoma by targeting PRDX1 migration and invasion of esophageal squamous cell carcinoma by targeting XPR1 migration and cisplatin resistance in esophageal squamous cancer cells by targeting FERMT2 Circular RNA circ_0006168 enhances taxol resistance in esophageal squamous cell carcinoma by regulating miR-194-5p/JMJD1C axis MicroRNA-675-3p promotes esophageal squamous cell cancer cell migration and invasion miR-205-3p promotes lung cancer progression by targeting APBB2 Mir-205-3p functions as a tumor suppressor in ovarian carcinoma Oncosuppressive role of microRNA-205-3p in gastric cancer through inhibition of proliferation and induction of senescence: oncosuppressive role of microRNA-205 in gastric cancer MiR-4652-5p targets RND1 to regulate cell adhesion and promote lung squamous cell carcinoma progression Identification of critical miRNAs as novel diagnostic markers for laryngeal squamous cell carcinoma Two miRNA prognostic signatures of head and neck squamous cell carcinoma: a bioinformatic analysis based on the TCGA dataset Mir-452-3p: a potential tumor promoter that targets the CPEB3/EGFR axis in human hepatocellular carcinoma Long noncoding RNA ZFAS1 promotes progression of oral squamous cell carcinoma through targeting miR-6499-3p/CCL5 axis Functional analysis of mir-767-5p during the progression of hepatocellular carcinoma and the clinical relevance of its dysregulation Identification of modules and novel prognostic biomarkers in liver cancer through integrated bioinformatics analysis Identification of a novel miRNA-based recurrence and prognosis prediction biomarker for hepatocellular carcinoma Mir-215-5p is an anticancer gene in multiple myeloma by targeting RUNX1 and deactivating the PI3K/AKT/mTOR pathway MiR-215-5p is a tumor suppressor in colorectal cancer targeting EGFR ligand epiregulin and its transcriptional inducer HOXB9 miRNA-215-5p suppresses the aggressiveness of breast cancer cells by targeting Sox9 Integrated study of miR-215 promoting breast cancer cell apoptosis by targeting RAD54B Potential plasma microRNAs signature miR-190b-5p mir-215-5p and miR-527 as non-invasive biomarkers for prostate cancer MiR-194-3p modulates the progression of colorectal cancer by targeting KLK10 Mir-194-3p represses the docetaxel resistance in colon cancer by targeting KLK10 Establishing a three-miRNA signature as a prognostic model for colorectal cancer through bioinformatics analysis MicroRNA-29b-2-5p inhibits cell proliferation by directly targeting Cbl-b in pancreatic ductal adenocarcinoma RNA-associated co-expression network identifies novel biomarkers for digestive system cancer Download references This work was supported by Grants from the Natural Science Foundation project of Hubei Province(2021CFB158) the Education Research Project of Hubei Province (No and the National Natural Science Foundation of China (No Hubei Provincial Clinical Research Center for Umbilical Cord Blood Hematopoietic Stem Cells Xinjiang Key Laboratory of Cardiac Electrophysiology and Remodeling The First Affiliated Hospital of Xinjiang Medical University and MX conduct the bioinformatics analysis and qPCR validation PY wrote the first draft of the manuscript Download citation DOI: https://doi.org/10.1038/s41598-024-76321-0 Metrics details An Author Correction to this article was published on 15 October 2024 MicroRNAs (miRNAs) are a key class of endogenous non-coding RNAs that play a pivotal role in regulating diseases Accurately predicting the intricate relationships between miRNAs and diseases carries profound implications for disease diagnosis these prediction tasks are highly challenging due to the complexity of the underlying relationships While numerous effective prediction models exist for validating these associations they often encounter information distortion due to limitations in efficiently retaining information during the encoding-decoding process Inspired by Multi-layer Heterogeneous Graph Transformer and Machine Learning XGboost classifier algorithm this study introduces a novel computational approach based on multi-layer heterogeneous encoder—machine learning decoder structure for miRNA-disease association prediction (MHXGMDA) we employ the multi-view similarity matrices as the input coding for MHXGMDA we utilize the multi-layer heterogeneous encoder to capture the embeddings of miRNAs and diseases aiming to capture the maximum amount of relevant features the information from all layers is concatenated to serve as input to the machine learning classifier ensuring maximal preservation of encoding details We conducted a comprehensive comparison of seven different classifier models and ultimately selected the XGBoost algorithm as the decoder This algorithm leverages miRNA embedding features and disease embedding features to decode and predict the association scores between miRNAs and diseases We applied MHXGMDA to predict human miRNA-disease associations on two benchmark datasets Experimental findings demonstrate that our approach surpasses several leading methods in terms of both the area under the receiver operating characteristic curve and the area under the precision-recall curve which employs a multi-kernel learning algorithm to construct a similarity heterogeneous network and then predicts association scores by a graph-convolution encoder Although the above methods improved the performance of miRNA-disease association prediction to a certain extent different types of associations are still not fully detected and the embedding features are not completely preserved resulting in insufficient local information being incorporated into the network models we propose a computational method based on multi-layer heterogeneous encoder - machine learning decoder structure for miRNA-disease association prediction MHXGMDA integrates three similarity knowledge networks firstly and disease-disease networks to construct biological feature vectors from the miRNA and disease semantic similarity matrices and Gaussian similarity matrices for multi-view encoding to construct biological feature vectors The embedding features of miRNAs and diseases are fully extracted using the multi-layer heterogeneous encoder and all layers are spliced to maximise the degree of information retention which are used as inputs to the XGBoost classifier in the decoding stage to complete the association prediction task We validated the effectiveness of MHXGMDA on two benchmark datasets using five-fold cross-validation Experimental results show that MHXGMDA outperforms several state-of-the-art models on several independent metrics The main contributions of this paper are summarised below: Consider biological meta-pathway information Combining a multi-layer heterogeneous encoder to capture different types of associations provides rich contextual information for encoding complex associative relationships between miRNA-disease and enhances the reliability in the prediction of unknown relationships Given XGBoost’s significant advantage over most machine learning algorithms in handling embedded features we utilise XGBoost as a decoder for miRNA-disease feature splicing matrices to further enhance the accuracy and stability of prediction We undertake comprehensive experiments across two benchmark datasets to ensure the validity of MHXGMDA and provide constructive comments through case studies with model predictions We found that negative association samples are much more than the positive samples in these two datasets and there is a large amount of noisy data in the unknown associations In order to reduce the adverse impact on the noise of the prediction results and to ensure the rationality of the selection of negative samples we labelled the positive samples of all the confirmed miRNA-disease associations as 1 and sampled the same number of negative samples at random as the number of positive samples in the remaining negative samples labelled as 0 Multi-view similarity feature extraction. We constructed homogeneous similarity matrices for miRNAs and diseases separately as inputs. Construction of multi-layer heterogeneous graph Transformer. We consider miRNAs and diseases as nodes, and traverse meta-paths in HGT to integrate multiple high-level coding information. Splice matrix classification. We apply the direct splicing method to fully fuse all the output features of the multi-layer heterogeneous encoder and decode them with the XGBoost classifier to derive the ultimate prediction outcomes. The overall architecture of the MHXGMDA for predicting miRNA-disease association Based on previous methods39 we apply Gaussian kernel function to the association network of topology between bioinformatic nodes so as to obtain miRNA semantic similarity matrix Gaussian interaction profile kernel similarity the disease similarity matrix is obtained by applying Gaussian kernel according to the disease semantic similarity matrix The multi-view similarity matrices are fused to extract miRNA–miRNA and disease–disease similarity features where \(S_{ms}\) represents miRNA semantic similarity its matrix expression \(A_{ms} \in R^{M\times M }\) \(S_{mg}\) represents miRNA Gaussian similarity its matrix expression \(A_{mg} \in R^{M\times M }\); Similarly \(S_{ds}\) represents disease semantic similarity its matrix expression \(A_{ds} \in R^{D\times D }\) \(S_{dg}\) represents disease Gaussian similarity its matrix expression \(A_{dg} \in R^{D\times D }\) the specific calculation method is detailed in the Supplementary Information which is used to fuse multi-view similarity as the final miRNA similarity matrix \(A_{m}\) and disease similarity matrix \(A_{d}\) Most of the previous methods failed to capture the dynamic property information of heterogeneous graphs and the design of HGT in heterogeneous graph data processing makes it a powerful tool for dealing with complex relationships and structures so we use HGT to learn node representations to capture potential features between miRNAs and diseases This can be divided into three steps: Firstly the attention weights of the target node miRNA with respect to the disease of each neighbouring source node where Attention is used to evaluate the significance of the source node Message extracts information based on the source node and Aggregate aggregates the neighbourhood information through attention weights \(e_{d,m}\) denotes the edge from the source node (disease) to the target node (miRNA) For the i-th attention head \(ATT\text {-}head^{i}\left( n_{d},e_{d,m},n_{m} \right)\) we project the source node d of type \(\tau \left( n_{d} \right)\) to generate the i-th key vector \(K^{i}\left( n_{d} \right)\) This linear projection process uses the \(K-Linear_{\tau \left( n_{d} \right) }^{i} :R^{dim}\rightarrow R_{h_{th}}^{dim}\) function,where \(h_{th}\) represents the number of attention heads and dim denotes the vector dimension of each head in an effort to cope with different meta relationships,we prepare different mapping matrices and \(K-Linear_{\tau \left( n_{d} \right) }^{i}\) is indexed according to the type \(\tau \left( n_{d} \right)\) of the source node d which aims to maximally preserve the unique features of various relationships and accurately reflect the relationships between different node types the target node m is linearly projected into \(Q-Linear_{\tau \left( n_{m} \right) }^{i}\) and the i-th query vector is generated,which is designed to help capture the associations between source and target nodes more precisely The specific calculation formulas are as follows: Since different meta-paths contribute to the target node to different degrees,for each meta-path triad we set a prior importance weight \(\mu _{\left\langle \tau (n_d),\phi (e_{d,m}),\tau (n_m) \right\rangle }\) which serves as an adjustment factor for attention In order to integrate enough information from different source nodes we collect all the attention vectors from its neighbours \(N\left( m \right)\) The next part is Heterogeneous Message Passing which calculates the information contribution of each source node to the target node The idea of multi-head information merging is adopted to splice the information of h heads to get the final representation The specific calculation method is as follows: Considering the heterogeneity of different edge types in information propagation we invoke a mapping matrix \({M\text {-}Linear}_{\tau \left( n_d\right) }^i\) based on a specific edge type denoting the i-th key vector obtained by linearly projecting the type \(\tau \left( n_{d} \right)\) of the source node \(n_{d}\) \(W_{\phi (e_{d,m}) }^{MSG}\) is the weight matrix associated with the edge \(e_{d,m}\) The information contributions from source nodes to target nodes are obtained from the view of multiple-heads (multi-heads) and they are combined into a final representation The final part is Target-Specific Aggregation Considering that the result of each single-head attention is softmax operated which means that the sum of the attention weights of all the source nodes is 1 it is straightforward to use the attention as the weight and perform a weighted summation of the message of all the source nodes to obtain the update vector of the target node to ensure the heterogeneity of the propagated information the model incorporates corresponding linear matrices in the residual network representing the embeddings of miRNAs and diseases Then, embedded nodes are connected according to the output of each HGT layer to fuse the information between different layers.The feature extraction effect is shown in Fig. 2. Visualisation of miRNA and disease feature heatmaps The subplots represent vectors of learned representations of miRNA with colours indicating the intensity of the individual feature components The miRNAs obtained from the multi-layer heterogeneous encoder were spliced with the disease features to obtain a fusion descriptor for miRNA-disease association where \(F_m\left( i\right)\) refers to the vector representation of the i-th miRNA within feature \(F_{m}\) and \(F_d\left( j\right)\) refers to the vector representation of the j-th disease within feature \(F_{d}\) Visualization of predicted score matrix and label matrix heatmaps The subgraphs respectively depict known and anticipated relationships between miRNAs and diseases the rows represent miRNAs while the columns correspond to various diseases and the combination is used as an input to the completely connected layer to predict the associations between RNAs and drugs sensitivity MINIMDA44 constructs an integrated network through multi-source information obtains embedding representations of miRNAs and diseases through integration of multimodal network’s higher-order neighbourhood information and finally uses a multilayer perceptron (MLP) to predict the latent associations between miRNAs and diseases and then introduces supernodes to construct a heterogeneous hypergraph to enrich the node information and learns miRNA-disease features through graph convolutional networks while combining matrix decomposition and variational autoencoder to extract linear and nonlinear features of miRNAs and diseases and then predict potential miRNA-disease associations CGHCN45 uses a graph convolutional network to capture initial features of miRNAs and diseases which is combined with a hypergraph convolutive machine network to further learn complex higher-order interaction information and trains a projection matrix to predict the association scores between them MGADAE35 predicts the correlation between miRNAs and diseases by fusing their similarity using multi-core learning learns representations through graph convolution and introduces an attention mechanism to integrate multi-layer representations They denote the AUC and PRC values corresponding to the number of heterogeneous layers of 2 the data point moves further away from the center point XGBoost’s ability to extract information from miRNA-disease splicing features on our model outperforms other classifiers we chose XGBoost as the best classifier in the MHXGMDA framework We compare MHXGMDA with seven other state-of-the-art models on two benchmark datasets, for all experimental setups with 5-CV training. Figure 5 shows the AUC, PRC for each model. ROC curves and PRC curves plotted by utilizing the cross validation results of different models ROC curve represents Receiver Operating Characteristic Curve PRC curve represents Precision-Recall Curve Ablation experience results on different network architectures of MHXGMDA the vertical axis denotes the corresponding values of the evaluation indicators under each variant Ablation experience results on different views of MHXGMDA The figure shows four indicator values of variant models from different views under two benchmark datasets where the train data of w/o SS only includes Gaussian similarity matrix w/o GS only includes semantic similarity matrix Experiments showed that nearly all possible associations forecasted by the model could be verified which sufficiently demonstrated the excellent performance and reliability of MHXGMDA in actually exploring miRNA-disease associations The red nodes represent the three diseases and the blue nodes represent the top10 miRNAs associated with the diseases a computational method based on multi-layer heterogeneous encoder—machine learning decoder structure for miRNA-disease association prediction MHXGMDA not only captures different types of biometric knowledge from multi-view similarity of miRNAs and diseases but also incorporates a multi-layer heterogeneous graph Transformer at the encoding stage to explore the dynamic information of miRNA-disease associations MHXGMDA applies XGBoost to learn miRNA-disease key features from multi-layer HGTs to deeply fuse the embedding information we tested the model experimentally on two association datasets The experiments demonstrate that our model surpasses state-of-the-art methods in exploring overlooked miRNA-disease associations validating the proficiency of MHXGMDA in identifying miRNA-disease associations and helping to pioneer new disease diagnosis and treatment options the fact that negative samples with sufficient experimental evidence of weak correlation between miRNAs and diseases are difficult to collect and the random sampling of negative samples in the MHXGMDA dataset may have unintended negative impacts we will construct a balanced dataset with more reliable negative samples to optimise the prediction of miRNA-disease associations We construct a multi-layer heterogeneous graph Transformer model based on similarity matrices from multi-views spectral kernel similarity of miRNA Gaussian interactions and spectral kernel similarity of disease Gaussian interactions we traverse different meta-paths with miRNAs and diseases as nodes to capture richer dynamic information In order to fully aggregate miRNA-disease embedding features we spliced all the representational matrices of the multilayer HGT outputs as inputs to the XGBoost machine learning model making maximum use of the encoding-decoding process information We applied MHXGMDA to compute the association scores of missing miRNAs with diseases at 5-CV our method provides a more promising approach to predict the association between miRNAs and diseases The datasets used in this article are all based on publicly available datasets mentioned in the Materials, which are available at https://github.com/yinboliu-git/MHXGMDA The code is publicly available at https://github.com/yinboliu-git/MHXGMDA A Correction to this paper has been published: https://doi.org/10.1038/s41598-024-76003-x Regulatory mechanisms of microrna expression Extensive modulation of a set of micrornas in primary glioblastoma New insights into the role of RNA-binding proteins in the regulation of heart development Mir-31 and mir-128 regulates poliovirus receptor-related 4 mediated measles virus infectivity in tumors Mrna stability and the control of gene expression: Implications for human disease The role of cytokine mRNA stability in the pathogenesis of autoimmune disease miRNA dysregulation in cancer: Towards a mechanistic understanding Human diseases caused by germline and somatic abnormalities in microrna and microrna-related genes Abnormal microrna expression in the course of hematological malignancies Regulatory mechanism of microrna expression in cancer Gene-chip studies of adipogenesis-regulated micrornas in mouse primary adipocytes and human obesity mirtools: microrna profiling and discovery based on high-throughput sequencing Prioritization of disease micrornas through a human phenome-micrornaome network Inferring the human microrna functional similarity and functional network based on microrna-associated diseases Novel human lncrna-disease association inference based on lncrna expression profiles Prediction of potential disease-associated micrornas using structural perturbation method Novel human mirna-disease association inference based on random forest Adaptive boosting-based computational model for predicting potential mirna-disease associations Prediction of potential disease-associated micrornas based on random walk Microrna: A new and promising potential biomarker for diagnosis and prognosis of ovarian cancer mirnas as biomarkers for early cancer detection and their application in the development of new diagnostic tools Computational drug repositioning based on multi-similarities bilinear matrix factorization Ncplp: A novel approach for predicting microbe-associated diseases with network consistency projection and label propagation Aemda: Inferring mirna-disease associations based on deep autoencoder A semi-supervised learning method for mirna-disease association prediction based on variational autoencoder Gcnpca: mirna-disease associations prediction algorithm based on graph convolutional neural networks Predicting mirna-disease associations based on graph attention network with multi-source information Predicting mirna-disease associations through deep autoencoder with multiple kernel learning Predicting mirna-disease association via graph attention learning and multiplex adaptive modality fusion mirna-disease association prediction based on heterogeneous graph transformer with multi-view similarity and random auto-encoder In 2023 IEEE International Conference on Bioinformatics and Biomedicine (BIBM) Mgcnrf: Prediction of disease-related mirnas based on multiple graph convolutional networks and random forest In IEEE Transactions on Neural Networks and Learning Systems (2023) Hgsmda: mirna-disease association prediction based on hypergcn and sørensen-dice loss Multi-kernel graph attention deep autoencoder for mirna-disease association prediction Predicting mirna-disease associations based on multi-view variational graph auto-encoder with matrix factorization Damirlocgnet: mirna subcellular localization prediction by combining mirna—Disease associations and graph convolutional networks Amhmda: Attention aware multi-view similarity networks and hypergraph learning for mirna—disease associations identification Gene expression value prediction based on xgboost algorithm Smalf: mirna-disease associations prediction based on stacked autoencoder and xgboost Comparison of multiple modalities for drug response prediction with learning curves using neural networks and xgboost Predicting circrna-drug sensitivity associations via graph attention auto-encoder Predicting mirna—disease associations via learning multimodal networks and fusing mixed neighborhood information Predicting mirna—disease associations by combining graph and hypergraph convolutional network Mirna-disease association prediction via hypergraph learning based on high-dimensionality features Microrna expression differentiates between primary lung tumors and metastases to the lung Hepatocellular carcinoma and microrna: New perspectives on therapeutics and diagnostics Download references This study was funded by the scientific research projects from Anhui Provincial Engineering Laboratory for Beidou Precision Agriculture Information: the research and implementation of a deep learning-enabled human-computer interaction mode for agricultural equipment (Grant number: BDSY2023002) These authors contributed equally: SiJian Wen and YinBo Liu These authors jointly supervised this work: XiaoLei Zhu and YongMei Wang School of Information and Artificial Intelligence Anhui Provincial Engineering Laboratory for Beidou Precision Agriculture Information developed the experiments and wrote the manuscript These authors jointly supervised this work: Z.X.L The original online version of this Article was revised: In the original version of this Article the title of the paper contained errors It now reads: “A method for miRNA-disease association prediction using machine learning decoding of multi-layer heterogeneous graph Transformer encoded representations” Download citation DOI: https://doi.org/10.1038/s41598-024-68897-4