Metrics details Bacteria have evolved an extraordinary diversity of defense systems against bacteriophage (phage) predation the molecular mechanisms underlying these anti-phage systems often remain elusive we provide mechanistic and structural insights into Zorya phage defense systems we show that the Zorya type I and II core components assemble in a 5:2 complex that is similar to inner-membrane ion-driven rotary motors that power flagellar rotation gliding and the Ton nutrient uptake systems The ZorAB complex has an elongated cytoplasmic tail assembled by bundling the C-termini of the five ZorA subunits Mutagenesis demonstrates that peptidoglycan binding by the periplasmic domains of ZorB and ion flow through the motor is important for function in both type I and II systems we identify ZorE as the effector module of the Zorya II system Our work reveals the molecular basis of the activity of Zorya systems and highlights the ZorE nickase as crucial for population-wide immunity in the type II system b Schematic representation of the domain composition of each Zorya subtype component Only predictions with an e-value < 0.01 were included For sequences with multiple domains predicted the highest scoring one (bit score) is reported c Cryo-EM volumes of a type I ZorA5B2 complex from Shewanella sp strain ANA-3 (left) and a type II ZorA5B2 complex from Sulfuricurvum kujiense (right) ZorA subunits are displayed in shades of blue and the centrally located ZorB subunits are in shades of purple The inner membrane (gray) was assigned based on the micelle density surrounding the complex at lower contour levels d Models of type I ZorA5B2 from Shewanella sp strain ANA-3 (left) and type II ZorA5B2 from Sulfuricurvum kujiense (right) depicted as cartoon representations and colored as in (a) e Structural alignment of the type I (gray) and type II (blue) ZorA5B2 complexes shows a conserved core across both Zorya types f (i) Structural alignment of a single ZorA subunit from type I (gray) and type II (blue) and (ii) side-by-side comparison of these subunits in the same orientation colored in the rainbow (N-terminus blue g Comparison of ZorB dimers from type I (gray) or type II (blue) from the same view as the overlay displayed in (c) demonstrates the peptidoglycan binding domain differs in height (i) and orientation (ii) but the overall fold is consistent across Zorya types (iii) h (i) Structural conservation of the ZorAB core (left) and the polar ring formed from conserved serines/threonines of the ZorA pentamer surrounding the critically conserved aspartates on ZorB is consistent across type I (gray) type II (blue) ZorAB and MotAB (PDB 8UCS; pink) complexes (right) strain ANA-3 ZorA coordinate sodium at both sites that recruit the conserved aspartate of ZorB (top sporogenes MotAB recruits sodium at a single site (pink middle) and no metal or ion coordination is observed in Sulfuricurvum kujiense ZorAB (blue the ZorB periplasmic domains are dimerized in these presumed inactive complexes and structurally resolved unlike the equivalent region of the flagellar Mot complexes This provides the first view of the arrangement of a peptidoglycan binding domain with respect to the inner membrane complex The C-termini of ZorA bundle together to form a long We demonstrate that both these elaborations of the core membrane complex are essential to elicit protection against phages anti-phage activity requires the presence of the ZorE effector Biochemical characterization indicates that ZorE is a nickase in vitro and prevalently mediates single-stranded breaks in the bacterial chromosome in vivo mediate protection by recruiting nuclease complexes that can damage host DNA in vivo our study uncovers the molecular mechanism underlying Zorya-mediated phage defense revealing a highly sophisticated strategy to thwart phage infection The C-terminal extension of the ZorA subunits (residues 236–696 of type I Shewanella ANA-3 kujiense) could not be fully resolved in these high-resolution volumes presumably due to its variable location with respect to the rest of the complex As for all other such complex structures solved to date both complexes are presumed to be in an inactive state since they show no open path for ion flow from the periplasmic to the cytoplasmic face a region of MotB immediately above the membrane forms a ‘plug’ helix which folds back between the periplasmic MotA loops to lock the complex in a blocked state—activation is proposed to be driven by pulling this plug away from the membrane following engagement of the PG-binding domains the Zorya complexes are blocked via a collar formed from periplasmic extensions of ZorA TM helices 2 and 3 and elaborate ZorA periplasmic loops that pack against the ZorB subunit (as also seen in type 9 and Ton systems) Mutational analysis additionally highlighted that for Zorya I and Zorya II systems, the D24 residue of ZorB, implicated in ion conductance in homologous systems, is crucial for defense (Fig. 2a, b) Taken together these in vitro and in vivo assays demonstrate that PG-binding is required for anti-phage activity we followed the dynamics of Zorya I and Zorya II-mediated defense over a 12-h infection period coli MT56 harboring VC or Zorya I was grown in LB supplemented with 0.02% l-Rhamnose and infected with ɸAlma at MOI 5 or 0.05 f growth rate (OD600nm) of each culture was measured at several time points coli MT56 carrying VC or Zorya II were grown in LB supplemented with 0.02% l-Rhamnose and infected with ɸT7 at MOI 5 or 0.05 l the growth rate (OD600nm) of each culture were measured at several time points points show mean ± SEM (n = 3 biological replicates) Statistical significance was calculated with Graphpad applying a two-way ANOVA comparison test the p-values for the VC vs Zorya I comparisons are as follows: for the 3-h time point d The p-values for the VC vs Zorya I comparisons are as follows: for the 3-h time point g The p-values for the VC vs Zorya II comparisons are as follows: for the 3-h time point j The p-values for the VC vs Zorya II comparisons are as follows: for the 3-h time point To confirm that the observed phenotypes were not artifacts of protein overexpression we conducted the same experiments by expressing Zorya I and II from their native promoters a The anti-phage activity of Zorya I and Zorya II under the control of their native promoter was evaluated by calculation of their fold protection against a suite of newly isolated environmental coliphages Fold protection was calculated by dividing the value of efficiency of plating (EOP) for strains expressing Zorya I or Zorya II by the EOP value of a strain carrying the empty vector (pSUPROM) when infected with phages as shown in panel (a) b Efficiency of plating (EOP) measurement for E pSUPROM) or the same vector carrying Zorya II Zor AB II or ZorE under the control of their native promoter Points show mean ± SEM (n = 3 biological replicates) Statistical significance was calculated with Graphpad applying a one-way ANOVA with Dunnett’s multiple comparison test pSUPROM) or the same vector expressing Zorya II under its native promoter was infected with ɸphAvM at MOI 5 or 0.05 the growth rate (OD600nm) of each culture was measured at several time points c The p-values for the VC vs Zorya II comparisons are as follows: for the 3-h time point f The p-values for the VC vs Zorya II comparisons are as follows: for the 3-h time point Zorya II-mediated defense enforces population-wide immunity restricting phage proliferation at the cost of bacterial fitness a ZorE-Strep titrated against a constant amount of supercoiled pSG483 plasmid DNA (6 nM) Samples were incubated at 37 °C for 60 min in the presence of 5 mM Mg 2+ b Densitometry quantification of nicking of pSG483 by ZorE as shown in panel (a) c ZorE (768 nM) was incubated with supercoiled plasmid pSG483 (6 nM) at 37 °C for 0 to 60 min with 5 mM Mg2+ d Densitometry quantification of nicking of pSG483 by ZorE as shown in panel (c) e ZorE (768 nM) was incubated with relaxed plasmid pSG483 (6 nM) for 0 to 60 min with 5 mM Mg2+ at 37 °C f Densitometry quantification of nicking of pSG483 by ZorE as shown in panel (d) reactions were stopped by the addition of EDTA and SDS and products were analyzed by gel electrophoresis in a 1× TAE control lanes represent forms of plasmid pSG483; R and f densitometry was performed using ImageJ (version 1.54g) with background subtracted and band intensity measured in triplicate and supercoiled pSG483 DNA of the total pSG483 DNA per lane was determined by calculating the average intensity (n = 3) of each lane’s nicked as a percentage of the total average intensity of all bands per lane Relative band intensity was determined by normalizing the average (n = 3) intensity of the “0 μM ZorE” lane to 100% and taking the average intensity of the subsequent lanes’ bands as a percentage of the “0 μM ZorE” lane Error bars represent the standard error of the mean of triplicate data pGM39) or the same plasmid encoding Zorya I or ZorE were grown in LB supplemented with 0.2% l-Rhamnose for 2 h cells were stained with DAPI and imaged by fluorescence microscopy or ZorCD were grown as in (g) and total genomic DNA (gDNA) was extracted followed by electrophoretic analysis (Methods) was used to assess for DNA breaks ZorAB II or ZorE were induced as in (g) and total gDNA was isolated as in (h) Genomic DNA was subjected to neutral and alkaline treatment pSUPROM) or the same plasmid harboring Zorya II or ZorE under the control of their native promoter were grown in the presence and absence of ɸphAvM (MOI 0.1) until first burst event Total gDNA was extracted and subjected to neutral and alkaline treatment as in panels (h–i) or ZorE under the control of their native promoter were grown in the presence and absence of ɸphAvM (MOI 0.1) Strains were fractionated to produce a soluble cytoplasmic fraction (CP) and a total membrane fraction (TM) Samples were analyzed by immunoblot with antibodies to the His6 tag (for detection of ZorE) and Strep-tag (for detection of ZorB) OmpC was used as a membrane control and CsrA as cytoplasmic control gels are representative of three independent experiments These results indicate that ZorE’s main activity is nicking it can also induce double-strand breaks or generate nicks on opposing strands at later stages Altered migration of DNA in a neutral buffer (detected as smaller bands and/or a smear) is indicative of the prevalence of DSBs whereas altered migration of DNA in an alkaline buffer indicates the presence of SSBs We conclude that ZorAB II-mediated recruitment likely increases ZorE’s local concentration thereby enhancing its ability to efficiently target DNA during the defense process In this study we report mechanistic and structural insights into the Zorya phage defense systems demonstrating that the core components ZorA and ZorB form a macromolecular complex reminiscent of flagellar proteins MotA and MotB the ZorA-ZorB complex exhibits unique features We show that these domains are crucial for Zorya I and Zorya II anti-phage activity We also demonstrate that ZorB can bind to peptidoglycan and that mutations in the PG-binding domain abolish peptidoglycan binding and anti-phage activity We suggest that in the absence of a phage threat the peptidoglycan layer is either pushed down or damaged may trigger a conformational change in both ZorA and ZorB leading to the opening of the ion channel likely by pulling up of the ZorB component relative to ZorA ion flow through the opened channel will then lead to rotation of ZorA with respect to the PG-tethered ZorB we note that a limitation of this study is that direct observation of peptidoglycan binding by ZorB in vivo during phage infection is currently not feasible presenting a challenge in fully validating this model efficient degradation of phage and chromosomal DNA is only observed at high concentrations of ZorE in vitro As localization data suggest that ZorAB mediates ZorE’s recruitment specifically at the site of infection and exclusively following a phage attack it is likely that this process is responsible for increasing ZorE’s local concentration and facilitating its optimal nickase activity against chromosomal and phage DNA during infection These alterations caused by SSBs and loss of DNA supercoiling could account for the growth defect caused by ZorE Interestingly the Zorya systems represent a unique example where part of a conserved bacterial macromolecular machinery has been adapted to provide a complex and modular defense strategy against mobile genetic elements (MGEs) As efforts towards the discovery and characterization of anti-phage strategies increase it is tempting to speculate that more examples of the adaptation of bacterial macromolecular machinery for anti-phage defense may have occurred Phage lysates were stored in phage buffer (10 mM Tris–HCl pH 7.4 neat lysates or their serial dilutions were added to 200 μL of E coli DH5α and incubated for 5 min at room temperature The mixture was added to 5 mL of soft agar and poured onto LB agar plates Plates were then incubated at 37 °C overnight Soft agar lawns containing confluent plaques were scraped off and mixed with 3 mL of phage buffer and 500 μL of chloroform Mixtures were vortexed for 2 min and incubated for 30 min at 4 °C Samples were then centrifuged at 4000×g for 20 min and the supernatant was collected and added to 100 μL of chloroform for storage For measurements of the efficiency of plating (EOP), 10 μL of neat phage lysate or a serial dilution of the lysate were added to 200 μL of an overnight culture of E. coli MT56 carrying the empty vector (Supplementary Table 2) or a vector encoding Zorya I Five mL of soft agar was added to each culture and poured onto LB agar plates supplemented with 0.02% l-Rhamnose and kanamycin EOP was measured as the number of PFU/mL−1 of a test strain divided by the number of PFU/mL of the control strain the ratio between the EOP values on strains carrying tested Zorya homologs and the EOP value on a strain carrying an empty vector was calculated coli MT56 harboring empty vector or the same vector encoding Zorya I or their mutants were grown in LB supplemented with kanamycin and 0.02% L- Rhamnose monohydrate to an OD600nm of ~0.4 Strains carrying Zorya I and its mutants were infected with ϕAlma at MOI 0.5 Strains expressing Zorya II and its mutants were infected with ϕMak at an MOI of 0.1 An aliquot of each culture was collected at t = 0 h the cultures’ aliquots were also serially diluted and plated on LB agar plates to measure CFU/mL or plated onto E coli DH5α top lawns to evaluate the number of released phages (PFU/mL) Zorya II cells were challenged with phage phAvM coli MT56 harboring pGM39 (empty vector) or the same vector encoding Zorya I and Zorya II were grown in LB supplemented with kanamycin and 0.2% l-Rhamnose for 2 h Cells were normalized to an OD600nm of 1 and stained with DiBAC4(3) (Bis-[1,3-Dibutylbarbituric Acid] Trimethine Oxonol; Thermo) at 10 μM Stained samples were incubated for 10 min in the dark and subsequently washed with fresh LB Cells were analyzed in a FACS LRS Fortessa equipped with a 488 nm laser (Becton Dickinson) using thresholds on the side and forward scatter to exclude electronic noise Bacterial cells were selected using side scatter (SSC-A) vs forward scatter (FSC-A) Analysis was performed using FlowJo v10.4.2 (Treestar Inc.) cells were treated with polymyxin B (5 μg/mL) at 37 °C for 30 min prior to staining PMB-treated cells were used to define the DiBAC4(3)-positive quadrant For kinetic measurements of DiBAC4(3) fluorescence during phage infection E Zorya II or their mutants were grown in LB supplemented with kanamycin and 0.2% l-Rhamnose to an OD600nm of ~0.4 ϕAlma and ϕMak were added at a MOI of 1 for evaluation of Zorya I and Zorya II activity DiBAC4(3) was added to a final concentration of 250 nM and fluorescence measurements were performed using a 96-well optical-bottom black plate and TECAN infinite nano M+ Microplate reader with an excitation wavelength of 488 nm and emission wavelength of 530 nm for DiBAC4(3) For kinetic measurements of propidium iodide (PI) fluorescence during phage infection the same growth conditions as for DiBAC4(3) were used PI was added at a final concentration of 200 μM and fluorescent measurements were performed with the use of a 96-well optical-bottom black plate and TECAN infinite nano M+ Microplate reader with an excitation wavelength of 544 nm and emission of 612 nm To assess the mechanism of Zorya I and Zorya II-expressing cells that are metabolically active the CellTiter Blue stain (Promega) was used A volume of 90 μL of each culture was added to each well of a 96-well optical-bottom black plate Ten microliter of the CellTiter Blue dye was then added to each well and the fluorescence at 560/590 nm was recorded with a TECAN infinite nano M+ Microplate reader coli Mt56 carrying empty vectors were incubated for 10 min at 100 °C Overnight cultures (5 mL) were diluted into 25 mL LB containing 0.2% l-Rhamnose and 100 μg/mL kanamycin and grown for 2 h 200 μL of each culture were collected at timepoints t = 0 h and t = 2 h and stained with 4′,6-diamidino-2-phenylindole (DAPI) at a final concentration of 5 μg/mL Cells mixed with DAPI were incubated at 37 °C for 15 min and then 1 μL of each culture was transferred on a microscope slide with a pad of 1% UltraPure agarose (Invitrogen) in H2O Images were collected on a Zeiss LSM980 Microscope equipped with Widefield Camera Axiocam 705 mono and Light Source Colibri 5 Type RGB-UV-4-channel fluorescence light source with integrated control unit and a Plan Apochromat 63x objective individual cells were identified from thresholded brightfield images and converted to the region of interest (ROI) using Fiji Extremely elongated cells had to be excluded from the analysis as it was not possible to threshold them as single cells in Fiji Fluorescence images were background-subtracted and ROIs were used to measure the integrated density (sum of pixel values over the whole cell area) of the DAPI fluorescence signals Data were plotted as a swarm plot on GraphPad Prism 9 coli MT56 harbouring empty vector (pSUPROM) or the same vector encoding Zorya II or its mutants were grown in LB supplemented with Kan for 2 h Genomic DNA was extracted with a Monarch genomic DNA extraction kit (NEB) following manufacturer instructions DNA was eluted in a neutral buffer (100 mM Tris-HCl pH 7.5 1 mM EDTA) and treated with RNAse A for 15 min at 37 °C 300 ng of genomic DNA resuspended in this neutral buffer was analyzed on 0.8% agarose gels for assessment of double-stranded breaks (DSB) The presence of alkaline unwinding-sensitive sites (AU-SSs) such as single-stranded (SSB) was investigated with alkaline/neutral treatment for evaluation 3 μL of 1 M Na2HPO4 pH 1.85 was added to 20 μL of a neutral buffer containing 300 ng of genomic DNA The solution was homogenized by pipetting and then 9 μL of 0.1 M HCl were added The solution was homogenized again before incubating in ice for 4 min Loading dye was added and DNA was analyzed on a 0.8% agarose gel cells were grown up to OD600nm = 0.6 and infected with ϕAlma (for Zorya I) ϕT7 (for Zorya II) or ϕphAvM (for Zorya II_native) Cells were then recovered after the first burst event and processed as detailed above kujiense (type II) ZorAB sample at an A280nm of 0.25 and 2.3 25 mA) 300-mesh R1.2/1.3 Quantifoil Au grids Grids were blotted for 2 s in 100% humidity at 8 °C and plunged frozen in liquid ethane using a Vitrobot Mark IV (Thermo Fisher Scientific) Data were collected in a counted mode in EER format on a CFEG-equipped Titan Krios G4 (Thermo Fisher Scientific) operating at 300 kV with a Selectris X imaging filter (Thermo Fisher Scientific) with a slit width of 10 e−V and Falcon 4 direct detection camera (Thermo Fisher Scientific) at 165,000x magnification Movies were collected at a total dose of 54.0 e−/Å2 (ZorAB type I) or 57.0 e−/Å2 (ZorAB type II) demonstrating that the core and peptidoglycan-binding domains of both maps were equivalent despite the difference in the tilt angle of the ZorA cytoplasmic extensions with respect to the core using a soft mask encompassing partial TM helices and the cytoplasmic extension of ZorA yielded a 4.9 Å volume with clearly defined but partial cytoplasmic helices For large-scale expression of ZorE-Strep for biochemistry Single colonies were then used to inoculate 150 mL Terrific Broth (Melford) supplemented with Kn for overnight growth at 37 °C with 180 rpm shaking Starter cultures were re-seeded 1:100 v/v into each of 12 × 2 L baffled flasks containing 1 L Terrific Broth supplemented with Km and were subsequently incubated at 37 °C with 150 rpm shaking until reaching an OD600nm of 0.4 Flasks were then supplemented with l-Rhamnose to a final concentration of 0.2% w/v and incubated for a further 4 h at 37 °C with 150 rpm shaking Cells were harvested by centrifugation at 4200×g for 30 min at 4 °C then serially resuspended in ice-cold buffer A (50 mM Tris HCl pH 8.0 Resuspended cells were disrupted by sonication (40% amplitude 3 min total pulse) and clarified by centrifugation at 45,000×g for 50 min at 4 °C Clarified cell lysate was transferred to a chilled glass beaker on ice and applied to a 5 mL StrepTrap HP column (Cytiva) pre-equilibrated in buffer A The StrepTrap column was then washed with 50 mL buffer A Bound proteins were then eluted with 50 mL of buffer B (50 mM Tris HCl pH 8.0 The eluate was subsequently concentrated by centrifugation using a 10 kDa MWCO Vivaspin concentrator (Sartorius) and the concentrated protein sample was then applied to a Superdex 75 increase 10/300GL (S-75; Cytiva) pre-equilibrated in sizing buffer (50 mM Tris HCl pH 7.9 The resulting peak was centrifugally concentrated to ~1 mg/mL snap-frozen in liquid nitrogen in aliquots ready for use ZorE (1 µg) was resolved on a 4–20% (v/v) polyacrylamide Mini-PROTEAN TGX precast gel for 15 min at 300 V Solution-phase mass determination of ZorE-Strep was performed using the TwoMP (Refeyn) mass photometer Samples were first diluted ~1000-fold in PBS buffer A25 Experimental data were obtained in the form of mass photometry videos recorded for 1 min using the AcquireMP v2.5 software (Refeyn) on precleaned poly-lysine-treated high-sensitivity microscope slides A mass calibration was done using thyroglobulin and conalbumin from the calibration kits (Cytiva) The experimental data were then fit to this calibration and graphs were generated using the DiscoverMP v2.5 software (Refeyn) To test the efficiency of ZorE nuclease activity we used the pSG483 plasmid This plasmid carries a unique Nb.Bpu10I site The nicking reaction was set up by adding 500 ng of pSG483 and 15 Nb.Bpu10I (Thermo) in a final volume of 300 μL The nicking reaction was incubated for 4 h at 37 °C and inactivated at 80 °C for 20 min Relaxed DNA was obtained by adding ATP and T4 ligase (NEB) to the mix for 1 h at room temperature BamHI digestion for 1 h at 37 °C was used to obtain linear pSG483 and 1536 nM of purified ZorE were incubated with 6 nM of pSG483 plasmid or 200 ng of E Samples were incubated for 60 min in the presence of 5 mM Mg2+ at 37 °C To test the activity of ZorE in the presence of various metals ZorE (768 nM) was incubated with supercoiled pSG483 (6 nM) at 37 °C for 60 min in the presence of 5 mM To test ZorE specificity for DNA topoisomers ZorE (768 nM) was incubated with supercoiled and nicked plasmid pSG483 (6 nM) at 37 °C for 0 to 120 min with 5 mM MgOAc All reactions were stopped by the addition of EDTA and SDS and products were analyzed by gel electrophoresis in a 1× TAE ZorB I165–287 (from S. marcescens ATCC 274) and ZorB II115–235 (from E. coli ATCC8739) or their point mutations as detailed in Fig. 1 were cloned in a pT12-based plasmid under the control of a l-Rhamnose-inducible and in frame with a C-term twin-strep tag Strains were inoculated in 1 L terrific broth (Formedium) at a starting OD600nm of 0.05 and grown at 30 °C l-Rhamnose was added at a final concentration of 0.2% Cells were then grown for 12 h at 16 °C and recovered by centrifugation 4000×g Recovered cells were resuspended in 10 mL of Buffer A (50 mM Tris-HCl pH 8 150 mM NaCl) in the presence of cOmplete™ EDTA-free protease inhibitor (Merck) and lysed by sonication (cycles of 20 min on The lysate was cleared by centrifugation (14,000×g and added to 1 mL column-volume of Strep-Tactin™XT Sepharose resin (IBA Lifesciences) pre-equilibrated with Buffer A The unbound lysate was removed by centrifugation for 2 min at 700×g The resin was subsequently washed with 10-column volumes of Buffer A and elution was performed with 5-column volumes of Buffer B (100 mM Tris-HCl coli Mt56 was grown in 2 L of LB until the late exponential phase (~OD600nm = 1) Cells were collected and resuspended in 10 mL of buffer A (100 mM Tris pH 7 SDS was added to a final concentration of 6% and samples were boiled for 1 h Samples were centrifuged at 80,000×g for 10 min and SDS was removed by washing pellets 10× times with 5 mL of MilliQ water Samples were resuspended in 20 mL of 100 mM Tris pH 7 and then treated with 15 μg/mL of DNase and 60 μg/mL RNase for 2 h at 37 °C and samples were incubated overnight at 37 °C EDTA and SDS were added to the sample at a final concentration of 10 mM and 1% Samples were boiled for 20 min and then centrifuged at 80,000×g for 1 hr Pellets were washed 5× times with MilliQ water and finally resuspended 100 mM Tris For the PG-binding assay, ZorB I165–287 and ZorB II115–235 or their point mutants as detailed in Fig. 2e–h (75 mg) were mixed to PG in a fresh tube and incubated at 25 °C for 1 h on an end-over-end rotator at 10 rpm Samples were centrifuged at 20,000×g for 30 min and washed 3× times with 100 mM Tris the supernatant was retained for analysis on SDS-PAGE The pellet was resuspended in 15 mL of 100 mM Tris and 5 mL of 4× Laemni buffer was added for analysis on SDS-PAGE For separation of cytoplasm and total membrane fractions, E. coli MT56 cultures as reported in Fig. 6 were grown to an OD600nm = 0.6 in a final volume of 500 mL of LB ɸphAvM was added to an MOI of 0.1 and cells were grown until the first burst event Cells were recovered by centrifugation and resuspended in 1 mL of buffer A (50 mM Tris HCl pH 8.0 3 min total pulse) and debris was removed by centrifugation (13,000×g The cleared supernatant was subjected to ultracentrifugation (80,000×g was mixed with Laemni buffer for analysis on SDS-PAGE The pellet was resuspended in 500 mL of buffer A and an aliquot Samples were then subjected to immunoblot analysis ZorE-His was detected using an Anti-His monoclonal antibody (1:6000 Invitrogen) and ZorB-Strep using an anti-Strep monoclonal primary antibody (1:10,000 both with an HRP-conjugated anti-Mouse secondary antibody (1:10,000 detection was obtained with an HRP-conjugated anti-rabbit secondary antibody (1:10,000 To identify bacterial genomes that contain both Zorya I and Zorya II operons cblaster v 1.3.18 was used66 Filters used were minimum identity (-mi) = 30% minimum coverage(-mc) = 60% and minimum hits in a cluster (-mh) = 6 Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article All custom scripts used can be found at: https://github.com/GM110Z/Zorya-paper A functional selection reveals previously undetected anti-phage defence systems in the E Systematic discovery of antiphage defense systems in the microbial pangenome Phages and their satellites encode hotspots of antiviral systems Bacteria deplete deoxynucleotides to defend against bacteriophage infection Cyclic CMP and cyclic UMP mediate bacterial immunity against phages Multiple phage resistance systems inhibit infection via SIR2-dependent NAD+ depletion Bacterial gasdermins reveal an ancient mechanism of cell death Wein, T. et al. CARD-like domains mediate anti-phage defense in bacterial gasdermin systems. Nature https://doi.org/10.1038/s41586-024-08498-3 (2025) Antiviral activity of bacterial TIR domains via immune signalling molecules Diverse enzymatic activities mediate antiviral immunity in prokaryotes An expanded arsenal of immune systems that protect bacteria from phages Bacterial retrons function in anti-phage defense The novel anti-phage system Shield co-opts an RmuC domain to mediate phage defense across Pseudomonas species Li, Y. et al. A family of novel immune systems targets early infection of nucleus-forming jumbo phages. Preprint at https://doi.org/10.1101/2022.09.17.508391 (2022) Core defense hotspots within Pseudomonas aeruginosa are a consistent and rich source of anti-phage defense systems A conserved family of immune effectors cleaves cellular ATP upon viral infection Phages overcome bacterial immunity via diverse anti-defense proteins Diverse functions of restriction-modification systems in addition to cellular defense History of CRISPR-Cas from encounter with a mysterious repeated sequence to genome editing technology The phage defence island of a multidrug resistant plasmid uses both BREX and type IV restriction for complementary protection from viruses The defense island repertoire of the Escherichia coli pan-genome Defense islands in bacterial and archaeal genomes and prediction of novel defense systems Structural and functional evidence of bacterial antiphage protection by thoeris defense system via NAD+ degradation Cryo-EM structure of the RADAR supramolecular anti-phage defense complex Molecular basis of RADAR anti-phage supramolecular assemblies Todeschini, T. C., Wu, Y., Naji, A., Mondi, R., & Nobrega, F. L. Kiwa rescues RecBCD for anti-phage activity. Preprint at https://doi.org/10.1101/2023.02.26.530102 (2023) The evolutionary success of regulated cell death in bacterial immunity Toxin-antitoxin systems as mediators of phage defence and the implications for abortive infection DISARM is a widespread bacterial defence system with broad anti-phage activities BREX is a novel phage resistance system widespread in microbial genomes Identification and classification of antiviral defence systems in bacteria and archaea with PADLOC reveals new system types Structures of the stator complex that drives rotation of the bacterial flagellum Structures of the type IX secretion/gliding motility motor from across the phylum bacteroidetes Ion selectivity and rotor coupling of the Vibrio flagellar sodium-driven stator unit Diverse Durham collection phages demonstrate complex BREX defense responses TolB protein of Escherichia coli K-12 interacts with the outer membrane peptidoglycan-associated proteins Pal Hu, H. et al. Structure and mechanism of the Zorya anti-phage defense system. Nature https://doi.org/10.1038/s41586-024-08493-8 (2024) Accumulation of defense systems in phage-resistant strains of Pseudomonas aeruginosa Development of a rapid electrophoretic assay for genomic DNA damage quantification A nucleotide-sensing endonuclease from the Gabija bacterial defense system Yang, X.-Y. et al. Molecular basis of Gabija anti-phage supramolecular assemblies. Nat. Struct. Mol. Biol. https://doi.org/10.1038/s41594-024-01283-w (2024) Prokaryotic Gabija complex senses and executes nucleotide depletion and DNA cleavage for antiviral defense A nuclease domain fused to the Snf2 helicase confers antiphage defence in coral‐associated Halomonas meridiana Alteration of DNA supercoiling serves as a trigger of short-term cold shock repressed genes of E DNA supercoiling and transcription in bacteria: a two-way street coli membrane protein production strain Mutant56(DE3) Stream single-particle cryo-EM analysis in real time cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination A Bayesian approach to beam-induced motion correction in cryo-EM single-particle analysis Real-space refinement in PHENIX for cryo-EM and crystallography UCSF ChimeraX: structure visualization for researchers Tools for macromolecular model building and refinement into electron cryo-microscopy reconstructions Highly accurate protein structure prediction with AlphaFold MolProbity: more and better reference data for improved all-atom structure validation CheckMyMetal: a macromolecular metal-binding validation tool AL2CO: calculation of positional conservation in a protein sequence alignment Evans, R. et al. Protein complex prediction with AlphaFold-Multimer. Preprint at https://doi.org/10.1101/2021.10.04.463034 (2022) Overview of the CCP4 suite and current developments From cells to muropeptide structures in 24 h: peptidoglycan mapping by UPLC-MS Structural and functional characterization of SiiA an auxiliary protein from the SPI4-encoded type 1 secretion system from Salmonella enterica MUSCLE: a multiple sequence alignment method with reduced time and space complexity SeqKit: a cross-platform and ultrafast toolkit for FASTA/Q file manipulation trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses Interactive tree of life (iTOL) v5: an online tool for phylogenetic tree display and annotation IQ-TREE 2: new models and efficient methods for phylogenetic inference in the genomic era cblaster: a remote search tool for rapid identification and visualization of homologous gene clusters Download references This work was funded by a Wellcome Trust Sir Henry Wellcome Fellowship (218622/Z/19/Z) to G.M An Intramural Research Program of the NIH to S.M.L a Biotechnology and Biological Sciences Research Council Newcastle-Liverpool-Durham Doctoral Training Partnership studentship [grant number BB/T008695/1] to J.J.R. an Engineering and Physical Sciences Research Council Molecular Sciences for Medicine Center for Doctoral Training studentship [grant number EP/S022791/1] to M.J.G and a Lister Institute Prize Fellowship to T.R.B The authors wish to thank Prof Graham Stewart The authors also wish to thank Dr Abigail Kelly for her technical assistance in the Mass Photometry (Refeyn) data collection the authors have applied a CC BY public copyright license to any Author Accepted Manuscript version arising from this submission These authors contributed equally: Giuseppina Mariano Newcastle University Biosciences Institute wrote the manuscript with contributions from all authors reviewers for their contribution to the peer review of this work Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations Download citation DOI: https://doi.org/10.1038/s41467-025-57397-2 Anyone you share the following link with will be able to read this content: a shareable link is not currently available for this article Sign up for the Nature Briefing: Microbiology newsletter — what matters in microbiology research fake teams are being deployed as a tool to normalise a violent denial of the past On 12 April a new club played its first game in Russia’s football pyramid A healthy enough crowd gathered at Novokolor Arena in Kamensk-Shakhtinsky 20 miles from the border with Ukraine’s occupied territories encouraged by a slick buildup on social media They watched “Zarya Luhansk” begin their slog through the Third League the fifth tier of a complicated Russian system whose composition shifts annually with a 5-0 home win over Volgar Astrakhan’s second team Some had travelled by chartered bus from the city their club purports to represent Read moreBut “Zarya” – the only difference between the prefixes, which mean “dawn”, is that of preferred Russian and Ukrainian spelling – began their campaign to little pushback from football’s authorities. The imitation club was founded in December 2023 and has played 82 matches, many in a “Commonwealth League” set up for teams from the regions Russia has annexed They finished third in last year’s 10-team competition Among their rivals in that event is a sham “Shakhtar Donetsk” The appearance of a replica “Zarya” in Russia’s setup feels like a red line crossed nobody is suggesting football should not be played in any form by those in occupied regions they will stage their matches in Russia rather than in the country it has invaded There may technically be no breach here even if Zorya who prefer not to legitimise the new club’s activities with comment are not banking on a long spell in the nominally amateur Third League A glance at their operation suggests significant financial backing told local media this month they planned to “close the issue in this calendar year” when asked how quickly he would like “Zarya” to reach Russia’s two-tier Second League from where a clear path up the divisions is visible He made clear they must follow the “historical traditions” of the prewar Zorya View image in fullscreenPlayers of FC Zorya Luhansk stand with children who originate from Ukranian territory occupied by Russia in Kyiv this month Photograph: Yurii Yuriev/Global Images Ukraine/Getty ImagesThey have signed a number of players The door has also been left open to play home games in Luhansk although Asatryan said “curfew and a certain regime situation” preclude that Training sessions have been held in Avanhard Stadium Zorya’s home until the war in Donbas forced their relocation in 2014; this week they warmed up in Perevalsk It is not difficult to see this project for what it is “Zarya” were formed at the instruction of the illegitimate Luhansk People’s Republic which controls the city and its surrounding area Football is being deployed as a tool to normalise a violent denial of the past and the cold truth for anyone expecting a response from the authorities is that they are simply the latest example in a concerning but virtually ignored trend Should “Zarya” earn promotion to Football National League 2B they would probably meet the Crimean teams Rubin Yalta and Sevastopol They were incorporated into the Russian pyramid two years ago and began their third season in the competition last month the Ukrainian Football Association complained vociferously that the clubs had breached Uefa rules prohibiting sides from Crimea competing in tournaments organised by the Russian Football Union (RFU) It asked that governing bodies take action against the RFU suggesting it should be ejected by Uefa and Fifa The loophole apparently deployed by the RFU was that Football National League 2B does not operate under its auspices and the four who responded directly confirmed their players are employed on professional contracts added “professional club” to their official profile on the Russian social networking site VK Free weekly newsletterThe best of our sports journalism from the past seven days and a heads-up on the weekend’s action The Football National League’s statutes for this season say that it organises “all-Russian football competitions among professional football clubs of the second league” It describes itself as ultimately deferential to the RFU The RFU offered no answer when asked whether Rubin or Sevastopol neither of whom have yet been allowed into the Russian Cup would be granted promotion to the third tier if it were earned this season Nor did Uefa respond fully when asked, with reference to the Crimean pair and “Zarya”, about its stance in relation to clubs from the occupied territories. In July 2023 it told the Guardian it was “assessing the situation” regarding Crimea Uefa said it had consistently communicated its position on the matter There has been no public or private update on its assessment; maybe that process is about to enter its third year Fifa did not reply to questions on the situation Perhaps the issue appears trivial to those in football’s corridors of power Maybe three clubs from sovereign Ukrainian territory one a clear rip-off of an existing institution being blended into the aggressors’ football pyramid is deemed an irrelevant footnote when the headline is that Russia and its sides remain banned from international events There appears little appetite to stop others following suit and presumably plenty of interest from Russia’s football authorities in accepting them on a slow and bobbly artificial surface in the Crimean city Yevpatoria “Zarya” defeated “Shakhtar” 3-0 in this season’s third set of Commonwealth League match days brought roars from the crowd and wild jubilation on the touchline among players and staff “They’re celebrating as if they won the Champions League,” said the commentator on the freely available online feed but how far will the creep of clubs representing Ukraine’s occupied territories into Russia’s league system be allowed to continue This is the archive of The Observer up until 21/04/2025 The Observer is now owned and operated by Tortoise Media in collaboration with the Embassy of Poland in Pakistan hosted a captivating fundraising dinner gala under its Cultural Diplomacy Initiative bringing together the elegance of European music and the power of community-driven philanthropy The event featured mesmerizing performances by distinguished artists from the Kuwait Music Academy laureate of the prestigious Chopin Competition joined forces with tenor Kamil Mateusz Derylo and the exceptionally gifted pianist and soprano Kinga Masternak which have graced stages across Europe and the Gulf brought an unforgettable night of artistic brilliance and musical excellence to Islamabad Guests were treated to a remarkable blend of piano virtuosity and timeless European classics honoring the rich tradition of Polish music and the enduring beauty of opera All proceeds of Rs1 million from the gala evening were given to Pehli Kiran Schools (PKS) a non-profit organization dedicated to educating street children from the impoverished areas benefiting over 5000 out-of-school and underserved children we are committed to creating meaningful impact through initiatives that promote culture we proudly raise cultural exchange while supporting causes that uplift vulnerable communities This collaborative event with the Embassy of Poland beautifully combined the power of music with the spirit of giving and we are honoured to contribute to Pehli Kiran Schools in their mission to provide quality education to underserved children.” said: “Culture is a powerful bridge between nations and tonight’s event demonstrated how music can connect hearts and inspire action We are proud to partner with Serena Hotels in supporting education through Pehli Kiran Schools and showcasing the richness of Polish musical heritage.” Director General Parks and Horticulture Authority Ahmed Hassan Ranjha during his visit to PHA Gorakhpur Nursery on May.. Pakistan’s Director General Haj Abdul Wahab Soomro shaking hands with Tawafa Company Al-Rajhi members on May 5,.. A Pakistani employee of the state-run Islamabad Electric Supply Company takes a meter reading with his smartphone at.. Federal Secretary Ministry of Communications Ali Sher Mehsud looks on in a meeting on April 25 Representational image shows government workers loading pushcarts on a loading truck during an anti-illegal.. Government Muslim Higher Secondary School no Copyright © 2025. The News International, All Rights Reserved | Contact Us | Authors Metrics details Here we investigate the molecular basis of Zorya defence using cryo-electron microscopy We present cryo-electron microscopy structures of ZorAB and show that it shares stoichiometry and features of other 5:2 inner membrane ion-driven rotary motors The ZorA5B2 complex contains a dimeric ZorB peptidoglycan-binding domain and a pentameric α-helical coiled-coil tail made of ZorA that projects approximately 70 nm into the cytoplasm We also characterize the structure and function of the soluble Zorya components ZorC and ZorD finding that they have DNA-binding and nuclease activity Comprehensive functional and mutational analyses demonstrate that all Zorya components work in concert to protect bacterial cells against invading phages We provide evidence that ZorAB operates as a proton-driven motor that becomes activated after sensing of phage invasion ZorAB transfers the phage invasion signal through the ZorA cytoplasmic tail to recruit and activate the soluble ZorC and ZorD effectors which facilitate the degradation of the phage DNA our study elucidates the foundational mechanisms of Zorya function as an anti-phage defence system As phage invasion initiates with cell envelope interactions some defence systems might detect changes in the envelope as early infection signals such defence mechanisms have not yet been identified but it has not been ruled out that ZorAB could instead act as the sensor of infection Using single-particle cryo-electron microscopy (cryo-EM) proteomics and total internal reflection fluorescence (TIRF) microscopy we decipher several key aspects of the Zorya defence mechanism We identified that ZorA and ZorB form a unique 5:2 proton motive force (PMF)-driven motor complex with a long intracellular tail and propose that it acts as a phage infection sensor and signal transduction complex After phage perturbation of the cell envelope the peptidoglycan-binding domain (PGBD) of ZorB anchors the complex to the cell wall and proton flow drives ZorA and its tail to rotate around ZorB This rotation induces recruitment of the soluble effectors ZorC and ZorD which have DNA-binding and nuclease activities leading to the local degradation of invading phage DNA to facilitate direct (non-abortive) defence determined using efficiency of plaquing (EOP) assays the average amino acid identity between proteins encoded by each phage (providing an estimate of the relatedness between phages) One-step phage growth curve for phage Bas24 infection of E normalized to the plaque-forming units (PFU) per ml at the initial timepoint Infection time courses for liquid cultures of E Phage titres at the end timepoint for each sample from the infection time courses in e measured as PFU per ml on indicator lawns of E coli either without (control) or with EcZorI The limit of detection (LOD) is shown by dotted lines that were infected at an MOI of 5 with Bas24 coli cells with and without EcZorI infected with Bas24 at an MOI of 5 Quantification of the time-lapse microscopy in h displaying the measured cell area relative to the initial timepoint data are the mean of at least three biological replicates (datapoints indicate replicates) and error bars (c and d) or shaded regions (e) represent the standard s.e.m derived from independent biological triplicates Source Data Negative-stain EM image of purified EcZorAB particles Representative high-resolution two-dimensional classes of EcZorAB images from cryo-EM Domain architectures of the EcZorAB complex are shown tan and coral) surround two ZorB subunits (white and dark grey) viewed from the plane of the membrane The detergent micelle is shown as a translucent surface representation in cyan The dashed lines show inner membrane boundaries Two cross-section views of the EcZorAB TMD and tail are shown Cross-section view of the EM density map from the plane of the membrane with two cross-section views of the model shown Composite model of the EcZorAB whole complex Images in b are representative of at least three replicates Time-lapse phase-contrast microscopy analysis of E coli cells expressing empty vector control or EcZorI with or without exposed to Bas24 at an MOI of 5 in the presence or absence of 30 µM CCCP Quantification of the time-lapse microscopy images in i displaying the measured cell area relative to the initial timepoint images These observations support the idea that PMF-driven rotation of ZorA around ZorB is essential for Zorya anti-phage defence Time-lapse montage of SYTOX-Orange-labelled Bas24 infections The arrows indicate phage particles that appear to adsorb and inject their DNA Schematic of the apparent transfer of labelled phage DNA from the capsid to inside the cell Quantification of intracellular fluorescence levels over time in individual E comparing the infection dynamics in Zorya-deficient cells and EcZorI-expressing cells (data from l The dotted points indicate cell lysis of E The bold lines represent the mean estimated from a linear regression analysis j and k are representatives of at least three replicates Source Data These experiments provide further evidence supporting phage DNA degradation by the EcZorI system Source Data and that ZorC and ZorD alone (without ZorAB) do not provide protection from phage infection we provide structural and functional insights into the Zorya defence system and propose that Zorya acts early in infection by sensing perturbation of the cell envelope to initiate a localized anti-phage response near the cell membrane Our work paves the way for further research to understand the detailed mechanisms of this unique activation signal for anti-phage defence the GTDB v214.1 bacterial reference tree was filtered for genomes present in RefSeq v209 and collapsed to the phylum level The EcZorI operon with its native promoter region was amplified by PCR from the E coli strain NCTC9026 genome (purchased from the National Collection of Type Cultures (NCTC)) and subcloned into a modified pACYC vector using the In-Fusion cloning strategy (In-Fusion Snap Assembly Master Mix; TaKaRa The PaZorI operon was amplified from the P aeruginosa strain DSM24068 genome (DSMZ-German Collection of Microorganisms and Cell Cultures; Leibniz Institute) and was subcloned into a modified pACYC vector under the E coli ZorI native promotor using the In-Fusion cloning strategy where EcZorI zorC or zorCD genes were replaced by PaZorI zorC or zorCD) plasmids were constructed based on standard cloning techniques (In-fusion snap assembly) All plasmids were verified by either Sanger or Nanopore sequencing separating clusters with proteome coverage <40% Overnight cultures of ΔRM possessing either pControl or pEcZorI were used to inoculate fresh LB + chloramphenicol cultures at a 1:100 dilution The inoculated cultures were grown at 30 °C with shaking until reaching an OD600 of 0.4–0.6 washed with LB + chloramphenicol and resuspended at an OD600 of 1.0 in LB + 10 mM MgSO4 + 2 mM CaCl2 10 ml samples of resuspended cells were infected with phage Bas24 at an MOI of 10−4 then the samples were mixed and incubated at 30 °C without shaking For the 0 min timepoint (total input phages) 100 µl samples were removed and added to 0.35% LB agar seeded with ΔRM + pControl (as an indicator lawn) then poured on top of 1.5% LB agar + chloramphenicol centrifuged to pellet cells and the supernatant (containing unabsorbed phages) was then filtered through a 0.2 µm PES syringe filter Samples (100 µl) of the filtered supernatant were added to indicator overlays (as above) poured onto 1.5% LB agar + chloramphenicol All overlay plates were incubated overnight at 30 °C before counting plaques the percentage of unabsorbed phages was calculated as the timepoint plaque count/plaque count for the time 0 min pControl sample For the one-step phage growth curves (burst time and size) 2 ml samples of the cells resuspended at and OD600 of 1.0 in LB + 10 mM MgSO4 + 2 mM CaCl2 (as above) were infected with phage Bas24 at an MOI of 10−4 then the samples were mixed and two tenfold diluted samples were prepared and the dilution series for each sample was then incubated at 30 °C without shaking 100 µl samples of each dilution were removed and added to 0.35% LB agar seeded with ΔRM + pControl (as an indicator lawn) the PFU was normalized to the PFU of the 0 min pControl samples coli recipient ΔRM possessing either pControl or pEcZorI Matings were performed at the indicated donor to recipient ratios (D:R) and incubated overnight on LB agar + chloramphenicol + ALA at 30 °C The conjugation efficiency was determined by plating dilution series of the matings onto LB agar + chloramphenicol + kanamycin (transconjugants) and LB agar + chloramphenicol (total recipients) The transconjugant frequency was defined as the transconjugant CFU/recipient CFU Chemically competent cells of ΔRM possessing either pControl or pEcZorI were prepared according to the Inoue method45 with HEPES-KOH pH 6.8 used for the transformation buffer Cells were stored in 200 µl aliquots at −80 °C before use 5 ng of plasmid (quantified using a Qubit BR kit) was used Plasmids used were as described above for the conjugation assays (ColE1 Phage Bas24 was then added at an MOI of 5 to each sample; control samples without phage addition were also included tenfold serial dilutions of each sample were plated (100 µl each) onto LB + chloramphenicol The cell survival rate was calculated as [CFU obtained + Bas24]/[CFU obtained without phage addition] Phage primary stocks were prepared using the double-agar method The phages were collected by adding SM buffer (100 mM NaCl 5 mM CaCl2) on top of the overlay agar and mixed for 4 h at 4 °C The suspension was collected and centrifuged for 15 min at 4,000g High-titre phage samples were obtained by inoculating 1–3 l of LB with a 103 dilution of an overnight culture of ∆RM and grown at 37 °C to an OD600 of 0.3 The bacterial culture was inoculated with the primary stock to an MOI of 0.025 and infection was carried out at 37 °C at 90 rpm until a clear lysate was obtained 1 µg ml−1 of DNase I and 1 µg ml−1 of boiled RNase A were added to the cleared lysate The lysate was gently stirred at 90 rpm for 30 min at room temperature Phages were concentrated by polyethylene glycol (PEG) precipitation NaCl was gradually added to a final concentration of 1 M followed by gradual addition of 10% PEG 8,000 with continuous stirring at room temperature until dissolved 4 °C) and the clear supernatant was removed The precipitate was resuspended in the minimal amount (up to 2 ml) of SM buffer that allowed solubilization Insoluble materials were removed by adding 20% (v/v) of chloroform and centrifuged (8,000g The supernatant was stored at 4 °C to be used as phage sample for the next step The phage was then purified by rate zonal separation using OptiPrep Density Gradient Medium (Sigma-Aldrich) in a density gradient ranging from 50 to 10% The phage sample was applied on the top of the gradient and centrifuged (150,000g dialysed against SM buffer and the samples were stored at 4 °C The phage genomes were extracted using the Phage DNA isolation kit from Norgen Biotek Stocks of Bas24 were treated with Pierce Universal Nuclease according to the manufacturer’s protocol for 1 h at 37 °C SYTOX Orange (Invitrogen) stock solution was added to 10 ml of the phage lysate at a concentration of 1:2,000 and incubated overnight at 4 °C in the dark Stained phage particles were subsequently purified by PEG precipitation PEG 6,000 was added to the lysate to a final concentration of 10% (w/v) and incubated overnight at 4 °C to allow for phage aggregation and precipitation The lysate was centrifuged at 4,000g for 30 min at 4 °C to pellet the phages and the supernatant was carefully discarded without disturbing the phage pellet The phage pellet was then washed by gently adding a 1 ml SM buffer centrifuged at 6,000g for 2 min and used for subsequent time-lapse microscopy experiments coli ZorA and ZorB code for 729 and 246 residues The tandem gene was PCR amplified from the E coli strain NCTC9026 genome and subcloned into a modified pET vector containing a C-terminal human rhinovirus (HRV) 3C protease cleavage site and a twin-Strep-tag II (resulting in pET11a-ZorA-ZorB-3C-TSII) The plasmids containing the recombinant genes were transfected into E coli C43(DE3) competent cells and the proteins were expressed in LB medium the temperature was decreased from 37 °C to 24 °C then grown until the OD600 reached approximately 0.8–1.0 before 0.5 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) was added for overnight protein induction and the cell pellet was resuspended in buffer A containing 20 mM HEPES-NaOH pH 7.5 300 mM NaCl supplemented with EDTA-free protease inhibitor (Thermo Fisher Scientific) and lysozyme from chicken white egg (Sigma-Aldrich) to a final concentration of 50 μg ml−1 and deoxyribonuclease I from bovine (Sigma-Aldrich) to a final concentration of 30 μg ml−1 The mixture was disrupted by high-pressure homogenizer and centrifuged at 185,000g for 1 h The pellet containing the membrane was collected and solubilized using buffer B containing 30 mM HEPES-NaOH pH 7.5 supplemented with EDTA-free protease inhibitor at 4 °C for 2 h The solubilized membrane was then centrifuged at 90,000g for 40 min and the supernatant was loaded onto a gravity flow column containing 2 ml (resin volume) of Strep-Tactin Superflow high-capacity resin (IBA) pre-equilibrated with wash buffer containing 20 mM HEPES-NaOH pH 7.5 The resins were washed five times with 2–3 resin volumes of the wash buffer and elution was carried out five times with 0.5 resin volume (1 ml) of elution buffer containing 20 mM HEPES-NaOH pH 7.5 The recombinant protein was then concentrated and loaded onto a pre-equilibrated (20 mM HEPES-NaOH pH 7.5 0.002% LMNG) Superose 6 Increase 10/300 GL size-exclusion chromatography column The fractions from the elution peak corresponding to the molecular mass of the ZorAB complex were pooled and the protein was concentrated for cryo-EM grid preparation and functional experiments The procedures for expression and purification of ZorAB mutants were similar to those for the ZorAB wild type The ZorB and MotB PGBDs were purified similarly to ZorC and ZorD with a few modifications The ZorB and the ZorB(Y151A/N152A/L155A/R159A) PGBD vectors were transformed into Rosetta-gami-2(DE3) competent E Cells were grown in LB medium supplemented with 100 μg ml−1 ampicillin 34 μg ml−1 chloramphenicol and 10 μg ml−1 tetracycline at 37 °C to an OD600 of 0.7 The cells were then induced with 0.5 mM IPTG and allowed to grow for 16 h at 18 °C The cultures were collected and the cell pellets resuspended in lysis/wash buffer (50 mM Tris-HCl pH 8.0 150 mM NaCl supplemented with EDTA-free protease inhibitor cocktail (Roche)) 1 mg of DNase I and 0.5 mM MgCl2 was added to the resuspended cells The cells were lysed using the Avestin Emulsiflex C3 homogenizer cooled to 4 °C and soluble lysates were cleared by centrifugation at 30,000g at 4 °C for 30 min The supernatant was then run over a gravity-flow column containing 2 ml (resin volume) of Strep-Tactin 4Flow high-capacity resin (IBA) pre-equilibrated with wash buffer (50 mM Tris-HCl pH 8.0 The resin was washed with 20 ml lysis/wash buffer and protein was eluted in 12 ml elution buffer (50 mM Tris-HCl pH 8.0 The elution was then concentrated and run over a Superose 6 Increase 10/300 GL size-exclusion chromatography column into gel-filtration buffer (20 mM Tris-HCl pH 8.0 The MotB PGBD was expressed and purified identically to the ZorB PGBDs with the exception that it was expressed in BL21(DE3) gold E coli in LB medium supplemented with 100 μg ml−1 ampicillin The predicted zorC gene encodes 560 residues The zorC gene together with a short region upstream of the zorC N terminus that encodes 7 residues (LPVGYAT) was PCR amplified from the DNA genome of E coli strain NCTC9026 and subcloned into the modified pET vector (resulting in pET11a-ZorC-3C-TSII) coli BL21 (DE3) gold chemically competent cells were transformed with the plasmids and the protein was expressed in LB medium with the presence of 100 μg ml−1 of ampicillin the temperature was decreased to 16 °C and 0.5 mM IPTG was added for overnight protein induction and the cell pellet was resuspended using buffer containing 20 mM Tris-HCl pH 7.5 10% glycerol and 500 mM NaCl supplemented with EDTA-free protease inhibitor (Thermo Fisher Scientific) The cells were lysed using an Avestin Emulsiflex C3 homogenizer cooled to 4 °C and centrifuged at 18,000g for 40 min The supernatant was then added to a gravity-flow column containing 3 ml (resin volume) of Strep-Tactin Superflow high-capacity resins (IBA) pre-equilibrated with wash buffer (20 mM Tris-HCl pH 7.5 Resins were washed five times with 2–3 resin volumes of wash buffer and elution was performed with 4 CV of elution buffer (20 mM Tris-HCl pH 7.5 The recombinant protein was pooled and concentrated and was loaded onto a pre-equilibrated (20 mM Tris-HCl pH 7.5 500 mM NaCl) Superose 6 Increase 10/300 GL size-exclusion chromatography column and another round of size-exclusion chromatography was carried out with buffer 20 mM HEPES-NaOH pH 7.5 and 150 mM NaCl to decrease the NaCl concentration The fractions from the elution peak corresponding to the molecular mass of ZorC were pooled and the protein was concentrated to approximately 1 mg ml−1 for cryo-EM grid preparation and functional experiments ZorC proteins used for EMSAs were exchanged into buffer containing 20 mM Tris-HCl pH 7.5 Pure fractions were concentrated and flash-frozen in small aliquots and stored at −80 °C until use The sample purity was assessed using SDS–PAGE The procedures of expression and purification of ZorC mutants were similar to those for the ZorC wild type The predicted zorD gene encoding 1,086 residues was PCR amplified from the DNA genome of E coli strain NCTC9026 and was subcloned into the modified pET vector The expression and purification of ZorD protein were similar to those for the ZorC protein the suspension buffer contained 150 mM NaCl 20 mM HEPES-NaOH pH 7.5 and 10% glycerol; the wash buffer was the same as the suspension buffer and the elution buffer contained 150 mM NaCl 10% glycerol and 10 mM desthiobiotin; and the size-exclusion chromatography buffer contained 150 mM NaCl and 20 mM HEPES-NaOH pH 7.5 Purified ZorD was concentrated to 0.4–0.6 mg ml−1 for functional experiments and cryo-EM grid preparation ZorD protein was kept in the elution buffer and flash-frozen in small aliquots and stored at −80 °C until use Grid preparation and data collection strategies for the ZorAB mutants were similar to those for the ZorAB wild type ZorC (final concentration 0.6 mg ml−1) was mixed with commercial pUC19 plasmid (NEB) (final concentration of 0.5 μg μl−1) The samples were incubated at room temperature for 30 min followed by 30 min at 4 °C before grid preparation The samples (3 μl) were applied to UltraAuFoil R 2/2 200 mesh Gold grids (glow discharged 60 s at 10 mA) and plunge-frozen as described above but with the following settings: blotting force 15 it is worth noting an irregularity in the AF2 model which introduces a substantial twist in the ZorA tail raising possibilities of other pentameric forms of the ZorA tail and further reflecting its conformational dynamics ∆RM cells were incubated in 1 l LB medium until the OD600 reached 0.8 Cells were collected and resuspended in 12 ml PBS buffer and split into two 50 ml Falcon tubes then 10% (w/v) SDS solution (in PBS) was added to a final concentration of 6% (w/v) The Falcon tubes were boiled for 1 h with stirring at 500 rpm The heat was turned off and the tube was allowed to cool to ambient temperature overnight the solutions from both Falcon tubes were pooled into one 50 ml Falcon tube and centrifuged at room temperature for 45 min at 108,000g The pellet was washed five times with 5 ml Milli-Q water The PG was resuspended in 20 ml of buffer containing 50 mM Tris-HCl pH 7.0 and α-amylase was added (Sigma-Aldrich) to a final concentration of 100 μg ml−1 and incubated for 2 h at 37 °C 50 μg ml−1 RNase A (Roche) and 10 μg ml−1 DNase (Sigma-Aldrich) were added and incubated for an additional 2 h at 37 °C The mixture was then supplemented with 20 mM MgSO4 10 mM CaCl2 and 100 μg ml−1 trypsin (Sigma-Aldrich) EDTA at pH 8 was added to a final concentration of 10 mM and 10% (w/v) SDS solution to a final concentration of 1% (w/v) The mixture was boiled for 20 min in a water bath and allowed to cool to ambient temperature The tube was centrifuged at 108,000g for 45 min The resulting pellet was washed five times with Milli-Q water to remove residual SDS the pellet was resuspended in 300 μl of Milli-Q water aliquoted into 35 μl portions and stored at −20 °C the purified PG was washed with 1 ml PBS + 0.002% LMNG buffer and centrifuged at 20,000g for 30 min Purified ZorAB and ZorAB ZorB(Y151A/N152A/L155A/R159A) mutant (10 μl at a concentration of 2 mg ml−1; ZorAB ZorB(Y151A/N152A/L155A/R159A) mutant is less stable requiring the use of freshly purified protein) was incubated with the PG at room temperature for 1 h The pellet was washed three times with 700 µl of the pull-down buffer by mixing and centrifugation (10 min The supernatant was retained for SDS gel analysis The pellet was resuspended with 20 μl of buffer and 5 μl of loading dye was added for SDS gel analysis mutant ZorB PGBD (ZorB(Y151A/N152A/L155A/R159A) PGBD) MotB PGBD (positive control) and ZorE (negative control) PG (PGN-ECndi ultrapure peptidoglycan (InvivoGen); due to the low yield of the laboratory-purified PG) was washed and resuspended in resuspension buffer (20 mM potassium phosphate Each pull-down reaction contained 10 µl of washed 25 mg ml−1 PG 4 µl of the indicated protein (each added from a 5 mg ml−1 stock) and the pull-down buffer (20 mM potassium phosphate pH 6 The samples were incubated for 30 min at 20 °C with gentle mixing The insoluble PG was pelleted by centrifugation at 20,000g at 12 °C for 10 min and the soluble supernatant was retained for SDS–PAGE analysis the pellet was resuspended in 100 µl of pull-down buffer and 15 µl of each sample (soluble supernatant and resuspended pellet) was mixed with 3 µl loading dye for SDS–PAGE analysis All components were incubated at 4 °C for 30 min and loaded onto a 1.5% (w/v) agarose gel made with 20 mM sodium phosphate buffer (pH 7.2) The samples were run for 30 min at 100 V and 4 °C using 20 mM sodium phosphate (pH 7.2) as the running buffer The gels were visualized using the Odyssey XF Imaging System at 600 nm ZorD was incubated with 200 ng pUC19 (linearized by KpnI) in the reaction buffer containing 1× Cutsmart buffer (NEB) and 2 mM ATP (NEB) in a total volume of 25 μl The reactions were incubated at 37 °C for 1 h with shaking at 600 rpm using the Eppendorf ThermoMixer DNA product was purified using the NucleoSpin Gel and PCR Clean-up kit (Machery Nagel) using the standard protocol and was analysed with 1% E-Gel EX 200 nM proteins were incubated with around 100 ng purified phage genomic DNA in the same reaction buffer indicated above The reactions were terminated by adding 1× E-gel loading buffer and product was analysed with 1% E-Gel EX coli ∆RM transformed with pEcZorI (or pControl) were used to inoculate (at a 1:1,000 dilution) 3 ml LB medium with antibiotics then grown to an OD600 of approximately 0.4 resuspended in 500 μl of 0.2 M Tris-HCl pH 8.0 and 250 μl of 6% (w/v) SDS was added to a final concentration of 1% after which the sample was heated at 99 °C for 10 min The mixture was sonicated (Misonix Ultrasonic Liquid Processor with microtip Probe) to fragment DNA and RNA with the following settings: amplitude 10 For MS analysis, we performed protein aggregate capture digestion of proteins55 250 μl of bacterial lysate was taken from the total sample and 750 μl of acetonitrile was added into the mixture along with 50 µl magnetic microspheres that had been prewashed with PBS buffer The mixture was allowed to settle for 10 min before retention of the magnetic microspheres by a magnetic plate Beads were washed once with 1 ml acetonitrile and once with 1 ml of 70% ethanol after which all ethanol was removed and the beads were stored at −20 °C until further processing supplemented with 100 µl ice-cold 50 mM Tris-HCl pH 8.5 buffer supplemented with 2.5 ng μl−1 Lys-C and gently mixed (on ice) every 5 min for 30 min Digestion was performed for 3 h using the Eppendorf ThermoMixer with shaking at 1,250 rpm and 37 °C the beads were chilled on ice and 250 ng of sequencing-grade trypsin was added after which samples were gently mixed (on ice) every 5 min for 30 min Final digestion was performed overnight using the Eppendorf ThermoMixer with shaking at 1,250 rpm and 37 °C Peptides were separated from magnetic microspheres using 0.45 µm filter spin columns and peptides were reduced and alkylated by adding TCEP and chloroacetamide to 5 mM for 30 min before peptide clean-up using the low-pH C18 StageTip procedure C18 StageTips were prepared in-house by layering four plugs of C18 material (Sigma-Aldrich Activation of StageTips was performed with 100 μl 100% methanol followed by equilibration using 100 μl 80% acetonitrile in 0.1% formic acid and two washes with 100 μl 0.1% formic acid Samples were acidified to pH < 3 by addition of trifluoroacetic acid to a concentration of 1% StageTips were washed twice using 100 μl 0.1% formic acid after which peptides were eluted using 80 µl 30% acetonitrile in 0.1% formic acid All fractions were dried to completion using a SpeedVac at 60 °C Dried peptides were dissolved in 25 μl 0.1% formic acid and stored at −20 °C until MS analysis Approximately 1 µg of peptide was analysed per injection All samples were analysed on the EASY-nLC 1200 system (Thermo Fisher Scientific) coupled to the Orbitrap Astral mass spectrometer (Thermo Fisher Scientific) The samples were analysed on 20-cm-long analytical columns and packed in-house using ReproSil-Pur 120 C18-AQ 1.9 µm beads (Dr Maisch) and elution of peptides from the column was achieved by application of gradients with stationary phase buffer A (0.1% formic acid) and increasing amounts of mobile phase buffer B (80% acetonitrile in 0.1% formic acid) The primary analytical gradient ranged from 10% B to 38% B over 57.5 min followed by a further increase to 48% B over 5 min to elute any remaining peptides Ionization was achieved using a NanoSpray Flex NG ion source (Thermo Fisher Scientific) ion transfer tube temperature of 275 °C and RF funnel level of 50% All full precursor (MS1) scans were acquired using the Orbitrap mass analyser while all tandem fragment (MS2) scans were acquired in parallel using the Astral mass analyser MS1 AGC target to 250 (2,500,000 charges) and MS1 maximum injection time to 150 Precursors were analysed in data-dependent acquisition mode with charges 2–6 selected for fragmentation using an isolation width of 1.3 m/z and fragmented using higher-energy collision disassociation with normalized collision energy of 25 Monoisotopic precursor selection was enabled in peptide mode Repeated sequencing of precursors was minimized by setting expected peak width to 20 s with an exclusion mass tolerance of 10 ppm and exclusion of isotopes MS2 scans were acquired using the Astral mass analyser MS2 fragment scan range was set to 100–1,500 m/z MS2 intensity threshold to 50,000 charges per second and MS2 maximum injection time to 5 ms therefore requiring a minimum of 250 charges for attempted isolation and identification of each precursor acquiring full MS scans at ~3.3 Hz and with auto-fitting of Astral scans resulting in MS2 acquisition at a rate of ~100–200 Hz digestion was performed using ‘Trypsin/P’ with up to 2 missed cleavages (default) with a minimum peptide length of 6 and a maximum peptide mass of 5,000 Da No variable modifications were considered for the first MS/MS search which is only used for precursor mass recalibration For the MS/MS main search a maximum allowance of three variable modifications per peptide was set including protein N-terminal acetylation (default) peptide N-terminal glutamine to pyroglutamate and replacement of three protons by iron (cation Fe[iii]) on aspartate and glutamate Unmodified and modified peptides were stringently filtered by setting a minimum score of 10 and 20 First-search mass tolerance was set to 10 ppm and the maximum charge state of considered precursors was set to 6 Label-free quantification (LFQ) was enabled Matching between runs was enabled with a match time window of 1 min and an alignment time window of 20 min Matching was allowed only between same-condition replicates Data were filtered by posterior error probability to achieve a false-discovery rate of <1% (default) log2-transformed them and aligned them to the molecular-mass-adjusted LFQ intensity values from our own data resulting in 1,901 out of 2,418 quantified protein groups receiving a known copy-number value (R2 = 0.6129) We next subtracted the overall median from all log2 values and determined the absolute delta between the values of each pair which we considered to be a ‘proteomic ruler’ Linear regression was performed on the remaining pairs (R2 = 0.9868) to determine a conversion factor between molecular-mass-adjusted LFQ intensity and absolute copy number coli strains expressing ZorB–HaloTag and ZorC or ZorD translational fusions to mNG were incubated shaking at 180 rpm in LB Lennox containing 20 mM MgSO4 5 mM CaCl2 and supplemented with 12.5 µg ml−1 chloramphenicol at 30 °C a subculture was inoculated 1:100 and grown at 30 °C until an OD600 between 0.3–0.5 was reached cells were washed once in PBS supplemented with a final concentration of 0.2% glucose and stained with 1 µM TMR ligand for 30 min cells were washed twice with PBS supplemented with 0.2% glucose Cells were then exposed to phages at indicated MOIs or incubated untreated for 30 min in a 2 ml Eppendorf tube under shaking conditions (<650 rpm in an Eppendorf ThermoMixer) at 30 °C 1 µl of cells and phage mix was spotted onto an agarose pad (1.2% in Milli-Q water of UltraPure agarose the obtained ZorB binary masks were overlayed in MicrobeJ onto the original image and cells were manually detected in MicrobeJ intensity in both HaloTag and mNG channel per cell and mNG signal of the entire cell body were extracted We defined co-localization of ZorB with a cytoplasmic Zorya component (ZorC or ZorD) if mNG signal within the detected ZorB complex area was 1.5-fold greater than the average cytoplasmic mNG fluorescence of the complete cell cells containing at least one ZorB with either ZorD or ZorC were considered to be co-localized Statistics were calculated in Prism GraphPad 9 using the in-built unpaired t-tests or one-way ANOVA The final graphs and videos were prepared using a custom Python script coli K-12 host was transformed with this plasmid and then infected with phage Bas54 to enable homologous recombination The lysate from this infection—containing wild-type and recombinant phages—was then subjected to CRISPR–Cas13a selection against the parental wild type using a crRNA targeting CTCTGAAGACCTCCAGTAGTAAGATGTAAGT (5′–3′) which includes the 3′ end of gp69 and the downstream region which is disrupted by insertion of the parS site CRISPR–Cas13a selection was performed using a two-plasmid setup of pAH221 (expressing LbuCas13a) and pAH218_LbuCas13a_parS_H1 (expressing the crRNA) Plaques growing after CRISPR–Cas13a selection were screened for successful insertion of the parS site by PCR and the sequence of the recombinant was confirmed by Sanger sequencing The start of the tail for the representative was used to infer the start of the tail for each other protein in the respective alignment Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article The pan-immune system of bacteria: antiviral defence as a community resource The arms race between bacteria and their phage foes CRISPR technology: a decade of genome editing is only the beginning Millman, A. et al. An expanded arsenal of immune systems that protect bacteria from phages. Cell Host Microbe https://doi.org/10.1016/j.chom.2022.09.017 (2022) Discovery of phage determinants that confer sensitivity to bacterial immune systems Santiveri, M. et al. Structure and function of stator units of the bacterial flagellar motor. Cell https://doi.org/10.1016/j.cell.2020.08.016 (2020) Structural basis of torque generation in the bi-directional bacterial flagellar motor Systematic exploration of Escherichia coli phage–host interactions with the BASEL phage collection A new class of biological ion-driven rotary molecular motors with 5:2 symmetry Ion-driven rotary membrane motors: from structure to function Crystal structure of the cell wall anchor domain of MotB a stator component of the bacterial flagellar motor: implications for peptidoglycan recognition Conformational change in the periplamic region of the flagellar stator coupled with the assembly around the rotor Crystal structure of type IX secretion system PorE C-terminal domain from Porphyromonas gingivalis in complex with a peptidoglycan fragment PeSTo: parameter-free geometric deep learning for accurate prediction of protein binding interfaces Recent structural advances in bacterial chemotaxis signalling Accurate structure prediction of biomolecular interactions with AlphaFold 3 Snf2 family ATPases and DExx box helicases: differences and unifying concepts from high-resolution crystal structures Prophages encode phage-defense systems with cognate self-immunity Imaging with total internal reflection fluorescence microscopy for the cell biologist Wadhwa, N. & Berg, H. C. Bacterial motility: machinery and mechanisms. Nat. Rev. Microbiol. https://doi.org/10.1038/s41579-021-00626-4 (2021) Structural remodeling of bacteriophage T4 and host membranes during infection initiation Bacteriophage-encoded virion-associated enzymes to overcome the carbohydrate barriers during the infection process Revenge of the phages: defeating bacterial defences Cryo-transmission electron microscopy of frozen-hydrated sections of Escherichia coli and Pseudomonas aeruginosa GraphPad Prism v.9.0.0 for Mac OS X. www.graphpad.com (GraphPad Software PADLOC: a web server for the identification of antiviral defence systems in microbial genomes RefSeq: an update on prokaryotic genome annotation and curation MMseqs2 enables sensitive protein sequence searching for the analysis of massive data sets Muscle5: high-accuracy alignment ensembles enable unbiased assessments of sequence homology and phylogeny FastTree 2—approximately maximum-likelihood trees for large alignments GTDB: an ongoing census of bacterial and archaeal diversity through a phylogenetically consistent rank normalized and complete genome-based taxonomy Introducing EzAAI: a pipeline for high throughput calculations of prokaryotic average amino acid identity Diverse CRISPR-Cas complexes require independent translation of small and large subunits from a single gene SEVA 4.0: an update of the Standard European Vector Architecture database for advanced analysis and programming of bacterial phenotypes An improved Escherichia coli donor strain for diparental mating Complete genome sequences of the Escherichia coli donor strains ST18 and MFDpir High efficiency transformation of Escherichia coli with plasmids Positive-unlabeled convolutional neural networks for particle picking in cryo-electron micrographs Coot: model-building tools for molecular graphics StarMap: a user-friendly workflow for Rosetta-driven molecular structure refinement Macromolecular structure determination using X-rays neutrons and electrons: recent developments in Phenix The PyMOL Molecular Graphics System, v.2.5. pymol.org/2 (Schrödinger GROMACS: high performance molecular simulations through multi-level parallelism from laptops to supercomputers Protein aggregation capture on microparticles enables multipurpose proteomics sample preparation MaxQuant enables high peptide identification rates individualized p.p.b.-range mass accuracies and proteome-wide protein quantification UniProt: the Universal Protein Knowledgebase in 2023 Chi, H. et al. Comprehensive identification of peptides in tandem mass spectra using an efficient open search engine. Nat. Biotechnol. https://doi.org/10.1038/nbt.4236 (2018) OpenMS: a flexible open-source software platform for mass spectrometry data analysis The Perseus computational platform for comprehensive analysis of (prote)omics data The quantitative and condition-dependent Escherichia coli proteome a tool for high throughput bacterial cell detection and quantitative analysis Fiji—an open source platform for biological image analysis ilastik: interactive machine learning for (bio)image analysis The P1 plasmid is segregated to daughter cells by a ‘capture and ejection’ mechanism coordinated with Escherichia coli cell division NanoJ: a high-performance open-source super-resolution microscopy toolbox Fast4DReg—fast registration of 4D microscopy datasets Bleach correction ImageJ plugin for compensating the photobleaching of time-lapse sequences Broad-spectrum CRISPR-Cas13a enables efficient phage genome editing An efficient one-step site-directed deletion single and multiple-site plasmid mutagenesis protocol ColabFold: making protein folding accessible to all MOLEonline: a web-based tool for analyzing channels Improvements to the APBS biomolecular solvation software suite The PRIDE database resources in 2022: a hub for mass spectrometry-based proteomics evidences Structure of the ISW1a complex bound to the dinucleosome Download references The Novo Nordisk Foundation Center for Protein Research is supported financially by the Novo Nordisk Foundation (NNF14CC0001) acknowledges support from an NNF Hallas-Møller Emerging Investigator grant (NNF17OC0031006) an NNF Hallas-Møller Ascending Investigator grant (NNF23OC0081528) and an NNF Project grant (NNF21OC0071948) is also a member of the Integrative Structural Biology Cluster (ISBUC) at the University of Copenhagen acknowledges support from Lundbeck Foundation postdoc fellowship R347-2020-2429 acknowledges support from the Health Research Council of New Zealand (Sir Charles Hercus Fellowship) and from Bioprotection Aotearoa (Tertiary Education Commission We acknowledge the use of the New Zealand eScience Infrastructure (NeSI) high-performance computing facilities in this research was supported by a University of Otago Doctoral Scholarship acknowledge funding by the Deutsche Forschungsgemeinschaft (DFG German Research Foundation)—Projektnummer 548567920 in the framework of the priority program SPP2330 acknowledges funding by the European Research Council (ERC) under the European Union’s Horizon 2020 research and innovation programme (grant agreement no 864971) and by the Max Planck Society as Max Planck Fellow acknowledge support from Novo Nordisk Bioscience PhD program acknowledges support from the National Key Research and Development Program of China (2021YFF1200404) the National Science Foundation of China (32371300) and computational resources from the Information Technology Center and State Key Lab of Computer-Aided Design (CAD) & Computer Graphics (CG) of Zhejiang University laboratory was supported by the Novo Nordisk Foundation (NNF14CC0001) The Danish Council of Independent Research (grant agreement numbers 4002-00051 4183-00322A and 8020-00220B) and The Danish Cancer Society (grant agreement R146-A9159-16-S2) acknowledge funding by a Starting Grant (TMSGI3_211369) of the Swiss National Science Foundation (SNSF) We thank the staff at the Danish Cryo-EM Facility at the Core Facility for Integrated Microscopy (CFIM) at the University of Copenhagen and Tillmann Pape and Nicholas Heelund Sofos for support during data collection; and B Rasmussen for their support in MS and mass photometry These authors contributed equally: Haidai Hu Structural Biology of Molecular Machines Group Novo Nordisk Foundation Center for Protein Research Institute of Biology/Molecular Microbiology Ivo Alexander Hendriks & Michael Lund Nielsen Department of Physics and Kavli Institute for Nanoscience Discovery Max Planck Unit for the Science of Pathogens performed molecular biology and mutagenesis collected cryo-EM data and determined all of the structures presented in this study TIRF and labelled phage microscopy experiments labelled phages and performed the western blotting of the ZorB–HaloTag fusions optimized the nuclease and EMSA experiments wrote the first draft of the manuscript together with N.M.I.T supervised the generation of the manuscript The authors declare no competing interests Nature thanks David Taylor and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Peer reviewer reports are available infected at different multiplicities of infection (MOI) of phage Bas02 and Bas08 Phage titres at the end timepoint for each sample from the infection time courses (g) Data in f-h represent the means of 3 replicates and the shaded regions represent the SEM n = 4 technical replicates derived from n = 3 culture replicates Soft mask used for local refinement of the ZorB PGBDs Local refinement map of the ZorB PGBDs (made with the soft mask shown in i) A representative of a model segment of the ZorB PGBDs fitted into of the local refinement EM density map shown in j Fit of lipids found in the TMD of ZorA in the EcZorAB cryo-EM map Images in a and b are representatives of at least 3 replicates Amino acids and secondary structural predictions (Psipred) of the EcZorA The peptides found by mass spectrometry that covered ZorA protein are indicated as green lines above the amino acids Top hits from an HHpred sequence homology search of the ZorA tail are shown A composite model of EcZorAB with the ZorA tail folding into a pentameric super coiled-coil with the helical pitch of the tail α-helix shown Hydrophobicity of the tail tube exterior surface calculated by ChimeraX Hydrophobicity and polarity of the tail tube interior surface calculated by MOLEonline Cartoon representation of the EcZorAB complex in an inactive state with the ZorB dimer interfaced highlighted Topology diagrams of ZorB PGBDs and isolated crystal structures of the flagellar stator unit MotB and PomB PGBDs indicating a conserved folding architecture The two disulfide bonds identified from ZorB PGBDs Structural comparison of PGBD of EcZorB with that of ProE that in complex with PG fragment with the zoom in view highlighting the conserved residues from EcZorB that are likely involved in PG binding Structural comparison of EcZorB PGBD and AlphaFold3 predicted EcMotB PGBD highlighting EcZorB PGBD is fused without a linker to the ZorB TM In vitro pull-down assay of isolated EcZorAB complex with purified E In vitro pull-down assay of isolated EcZorAB complex and EcZorAB complex with mutations in the ZorB PGBD (ZorABY151A/N152A/L155A/R159A) with purified E In vitro pull-down assay of isolated ZorB PGBD mutant ZorB PGBD (ZorBY151A/N152A/L155A/R159A PGBD) MotB PGBD (positive control) and ZorE (negative control) with purified E showing the surrounding residues of the two Asp26 from ZorB Cartoon representation of the cryo-EM structure of the proton-driven flagellar stator unit MotAB from Campylobacter jejuni (CjMotAB) in its inactive state showing the surrounding residues of the two Asp22 from MotB Cartoon representation of the cryo-EM structure of the sodium-driven flagellar stator unit PomAB from Vibrio alginolyticus (VaPomAB) in its inactive state showing the surrounding residues of the two Asp24 from PomB The absence of the strictly conserved threonine residue on ZorA TM3 (k) required for sodium ion binding indicates that EcZorAB is a proton-driven stator unit A representative of an SDS gel of the purified EcZorAB ‘linker mutant’ complex (with ZorB residues 46–52 replaced by a GGGSGGS linker) A representative cryo-EM image of EcZorAB ‘linker mutant’ sample Representative 2D classes of the EcZorAB ‘linker mutant’ in comparison with that of the EcZorAB wild type highlighting the flexibility of the ZorB PGBDs in the mutant A representative negative stain EM image of EcZorAB ‘PG-binding mutant’ sample Low pass filter of the cryo-EM density map of the EcZorAB linker mutant after non-uniform refinement Transmembrane helix density of the EcZorAB ‘linker mutant’ and that in the wild type EcZorAB q are representatives of at least 3 replicates with similar results ZorA tail truncations indicated in the composite model of EcZorAB complex Cartoon representation of the EcZorAB ZorA single subunit Interaction between the beginning of the ZorA tail and the β-hairpin motif Extra density found inside the tail from cryo-EM map which was modeled as a palmitic acid molecule with the amino acids involved in the interactions indicated Structural comparison of the ZorA wild type (cyan) and ZorA Ca2+ binding site mutation (ZorAE86A/E89A the arrows highlight the changes from wild type to the mutant Predicted ZorA lipid binding sites using PeSTo An EM image of the EcZorAL250G/L254G/L258G/L261GZorB mutant under cryogenic condition and representative 2D classes An EM image of the EcZorAL250N/L254N/L258N/L261NZorB mutant under cryogenic condition and representative 2D classes An EM image of the ZorA∆223–729ZorB mutant under cryogenic condition and representative 2D classes Negative staining images of the EcZorAB wild type ZorA tail tip deletion (ZorA∆359–592) as measured in (g) Data represent the mean of at least eight measurements (data points indicate measurements) and error bars represent the standard error of the mean (SEM) Cryo-EM maps and resolutions of ZorA mutants with gold standard (0.143) Fourier Shell Correlation (GSFSC) curves Source Data coli cells expressing empty vector control EcZorI ZorBD26N and EcZorI ZorA483–729 exposed to Bas24 at an MOI of 5 Quantitation of the time-lapse microscopy in (c) displaying the measured cell area relative to the first timepoint of the time-lapse Data represent the means of three biological replicates and the shaded region indicate standard deviation Quantitative Western blot of selected EcZorI-HaloTag translational fusions Top: total protein stain of whole cell lysate Promega) Western blot against ZorB-HaloTag protein fusions Mean ± standard deviation from four biological replicates Source Data Gel is representative of at least 3 replicates Local refinement of the EcZorC core domain with a soft mask with the local resolution (in Å) estimated in cryoSPARC Gold standard (0.143) Fourier Shell Correlation (GSFSC) curves of the local refined of the EcZorC core domain Representative of a model and segments of the ZorC fitted into EM density map The right panel is the final model of EcZorC built from a cryo-EM map Electrostatic distribution of EcZorC calculated from AlphaFold3-predicted model In vitro interaction of EcZorC with 55 bp dsDNA (36.36% GC) Image is representative of at least 3 replicates AlphaFold3-predicted model of ZorC in complex with 18 bp dsDNA The colour code (per-atom confidence estimate on a 0–100 scale) in f and i are same coli cells expressing ParB-mSc in the presence or absence of EcZorI ParB foci are observed prior to cell lysis whereas EcZorI-expressing cells lack ParB focus formation and survive phage infection AlphaFold3 predicted ZorD–ZorC–dsDNA-ATP-Mg2+ complex with a confidence-coloured (per-atom confidence estimate on a 0–100 scale) model shown in the right panel PaZorI and the constructs for PaZorCD or PaZorD complementation of EcZorI gene deletions Anti-phage defence provided by the constructs in (a) as measured using EOP assays for phages Bas49 Data represent the mean of at least 3 replicates (data points indicate replicates) and are normalized to the control samples lacking Zorya Strategy of fusing mNeonGreen (mNG) or HaloTag (HT) or both into EcZorI operon The effects of the mNeongreen (mNG) fusions to EcZorI components on anti-phage defence as measured using EOP assays for phage Bas24 Data represent the mean of at least 3 replicates (data points indicate replicates) and are normalized to the control samples lacking EcZorI The boxed constructs (ZorB C-terminal mNG fusion: ZorB-mNG; ZorB C-terminal HT fusion: ZorB-HT; ZorC N-terminal mNG fusion: mNG-ZorC; ZorD C-terminal mNG fusion: ZorD-mNG; Dual-tagged constructs ZorB C-terminal HT fusion and ZorC N-terminal mNG fusion: ZorB-HT + mNG-ZorC; ZorB C-terminal HT fusion and ZorD C-terminal mNG fusion: ZorB-HT + ZorD- mNG) were used for subsequent microscopy experiments Exemplary denoised TIRF and brightfield microscopy pictures of mNG expression driven by the EcZorI native promoter (p-mNG) either untreated or exposed to Bas24 at an MOI of 5 for 30 min Exemplary denoised TIRF microscopy pictures of ZorB C-terminal mNG fusion either untreated or exposed to Bas24 at an MOI of 5 for 30 min Comparison of detected maxima of the ZorAB complex foci between untreated or exposed to Bas24 at an MOI of 5 for 30 min (n cells > 250 from n = 3 replicates) Means are derived from three independent biological replicates Exemplary denoised TIRF microscopy pictures of ZorD-mNG either untreated or exposed to increasing Bas24 at MOIs of 1 Statistical comparison of ZorD-mNG maxima between untreated and conditions stated in h Means and exemplarily images in e and h derive from at least three independent biological replicates For g and i data are presented as mean values and Tukey whiskers Source Data coli lysates with or without expression of the EcZorI proteins Supplementary Videos 1 and 2: cells expressing empty vector or EcZorI exposed to Bas24 (MOI 5) for 5 min and subsequently spotted onto an 1.2% agarose pad (1:5 The graph on the left shows the cell total cell area set in correlation to the first timepoint (t = 0) See the description for Supplementary Video 1 Supplementary Videos 3–6: empty vector or EcZorI was exposed to Bas24 (MOI 5) for 30 min either in the presence or absence of CCCP (described in detail in Fig See the description for Supplementary Video 3 Time-lapse microscopy of representative ParB–mScarlet-expressing cells containing the empty vector or a vector expressing EcZorI in the presence of Bas54-parS phages Time-lapse microscopy of representative cells expressing empty vector or EcZorI and exposed to SYTOX-Orange-labelled Bas24 Download citation DOI: https://doi.org/10.1038/s41586-024-08493-8 Sorry, a shareable link is not currently available for this article. Sign up for the Nature Briefing: Microbiology newsletter — what matters in microbiology research, free to your inbox weekly. 13 Apr 2025 15:00:00 GMT?.css-1txiau5-AnswerContainer{color:var(--GlobalColorScheme-Text-secondaryText2);}Veres Rivne won 2–1 over Zorya on Sun Predicted lineups are available for the match a few days in advance while the actual lineup will be available about an hour ahead of the match The current head to head record for the teams are Zorya 4 win(s) Have scored 5 goals in their last 5 matches 13 Apr 2025 15:00:00 GMT?Veres Rivne won 2–1 over Zorya on Sun 13 Apr 2025 15:00:00 GMT.InsightsHave scored 8 goals in their last 5 matches Zorya is playing home against Veres Rivne at Valeriy Lobanovskyi on Sun Dear Reader,Unfortunately our comment platform isn\'t available at the moment due to issues with our paywall and authentication vendor Ukraine’s Premier League is holding its first full season with fans present since the start of the full-scale war in 2022 with crowd sizes limited by the capacity of nearby bomb shelters crowd sizes are determined by the capacity of the nearest bomb shelter For the first time since the full-scale war began in 2022 the Ukrainian Premier League is holding a full season with fans present as martial-law bans on public gatherings have been eased Dynamo Kyiv supporters eagerly snap up the 1,700 tickets available for each home game at the 16,000-seat Valeriy Lobanovskyi Stadium Many fans are keen to experience a rare moment of calm free from the country’s traditionally intense sporting rivalries While the war forced Dynamo to relocate its home matches in the Europa League to Hamburg it uses its home stadium in Kyiv for domestic league matches Vitalii Kozubra brought his 9-year-old son Makar to watch Dynamo a club displaced by Russian attacks in eastern Ukraine this is something people can enjoy together,” Kozubra said noting the friendly atmosphere at the stadium Makar marveled at the difference between watching a game in person and on television all 22 of them draped in Ukrainian yellow-and-blue flags which included servicemen and families with children The stadium was alive with the sound of players’ exertion and the thud of the ball Children rushed to the touchline for autographs drawn by the few foreign players from Brazil Ivory Coast and Panama who have chosen to remain despite the war Ukraine’s 16-team top-flight league has managed to continue Matches are scheduled for early afternoon due to frequent power outages and the logistical challenges of travelling across Europe’s second-largest country during war When air raid sirens interrupt play – sometimes for hours – players and fans alike head to shelters as alarms blare from loudspeakers and thousands of mobile phones with no air alarms during our home games,” said Dynamo club spokesman Andrii Shakhov “But it’s a different story for away games.. The longest one we had lasted 4½ hours because of four air alarms.” Ukrainian soccer players are subject to the draft at age 25 but clubs can apply for exemptions under business protection rules Two teams currently play permanently outside their home field due to the war while two others withdrew after fighting started due to stadium damage The country's soccer tradition dates back to its Soviet past fan movements often became expressions of Ukrainian identity After Ukraine declared independence in 1991 soccer continued to be a source of national pride through years of political and financial turmoil Ukraine reached the quarterfinals of the 2006 World Cup and co-hosted the 2012 European Championships supporters’ groups have set aside violent rivalries for more than a decade ever since they united to back protesters during the deadly 2013-14 uprisings against Russian influence they organized military recruitment drives to fight in the ensuing wars “Dexter,” a red-bearded Dynamo supporter and civilian contractor for the military explained why the truce among rival fan groups still holds “It became necessary because we needed to unite against a common enemy These internal conflicts lost their relevance when people from rival fan groups ended up fighting together in the same military units,” he said while walking his dog along the banks of the Dnipro River He added that fan organizations are involved in nearly every aspect of the war effort and providing technical skills like computer programming to the military He and others serving in or working alongside the armed forces spoke on the condition that they be identified only by their call signs in keeping with Ukrainian military protocol Dynamo officials estimate that more than 80% of their pre-2022 fanbase is now serving on the front lines in eastern Ukraine or performing other military duties servicemen from the 3rd Assault Brigade played a match on a field near bombed-out buildings Many of these fighters had been recruited through soccer-related channels and acquaintances “Organized fans play a huge role in this war because they’re highly motivated,” said a serviceman with the call sign “Shtahet,” a Dynamo supporter currently on deployment Combat medic “Poltava” noted that soccer remains a vital morale booster “We get together whenever we can and rent spaces to play,” he said Dynamo fan “Escobar” was grateful to catch a game while home on leave before heading back to the front in uniform and wearing a camouflage bucket hat “There are no bad feelings between the teams and it’s great to see such a friendly atmosphere.” Vitaliy Buyalskyi and Maksym Braharu scored second-half goals for Dynamo and even though Zorya players looked dejected as they walked off the field Dmytro Zhyhinas and Evgeniy Maloletka in Kyiv contributed Follow AP’s coverage of the war in Ukraine at https://apnews.com/hub/russia-ukraine 05 Apr 2025 10:45:00 GMT?.css-1txiau5-AnswerContainer{color:var(--GlobalColorScheme-Text-secondaryText2);}Zorya won 2–1 over Vorskla on Sat The current head to head record for the teams are Vorskla 8 win(s) Have scored 7 goals in their last 5 matches 05 Apr 2025 10:45:00 GMT?Zorya won 2–1 over Vorskla on Sat 05 Apr 2025 10:45:00 GMT.InsightsHave scored 2 goals in their last 5 matches Vorskla is playing home against Zorya at Vorskla Butovsky Stadion on Sat Вы используете блокировщик рекламы в вашем браузере В этом случае Вы не сможете пользоваться всеми функциональными возможностями нашего сайта и его отдельными страницами который мы используем для отображения видеоконтента активированный блокировщик рекламы может вызывать проблемы с загрузкой сайта и корректным его отображением чтобы получить возможность использовать наш сайт в полной мере внесите Dynamo.kiev.ua в «белый список» вашего блокировщика что любые попытки обсуждения этого и других решений редакции сайта немедленно влекут за собой ограничение по п.2.9 правил сайта Former Zorya player Parit Jikhani spoke about the conflict with the former team coach Anatoliy Chantsev Anatoliy Chantsev ruined my career for no reason Стать участником фан-зоны Нажимая на кнопку, вы соглашаетесь с условиями членства в фан-зоне конвертировать карму в шурики Устанавливайте наше приложение и всегда оставайтесь в курсе футбольных новостей the rescheduled match of the 16th round of the Ukrainian championship took place between «Inhulets» and «Zorya» «Inhulets» rose from the last position in the UPL standings Now the last place is occupied by Odessa’s «Chornomorets» — with 18 points 11 Mar 2025 13:30:00 GMT?.css-1txiau5-AnswerContainer{color:var(--GlobalColorScheme-Text-secondaryText2);}Dynamo Kyiv vs Zorya on Tue The current head to head record for the teams are Dynamo Kyiv 25 win(s) Have scored 9 goals in their last 5 matches 11 Mar 2025 13:30:00 GMT?Dynamo Kyiv vs Zorya on Tue 11 Mar 2025 13:30:00 GMT ended in a 2–2 tie.InsightsHave scored 9 goals in their last 5 matches Dynamo Kyiv is playing home against Zorya at Valeriy Lobanovskyi on Tue SAM Lote A Bloco B - Edifício Sede do Detran/DF CEP 70.620-000 Central de Atendimento ao Cidadão: 154 (para quem está no DF) ou 0800 644 0154 (para quem está fora do DF) On March 13, 2022 the Russian military attacked the Zorya-Mashproekt gas turbine complex in southern Ukraine a complex that once supplied engines to the Russian navy This strike represented the coup de grace and final indicator of the end of Russia’s longstanding dependence on the key industrial capacity of Ukraine The strike also offers evidence of continuing Russian efforts to reduce dependence on Western suppliers and develop domestic capabilities This decoupling may be a bellwether for how Russia and other states act in future conflicts—namely reducing dependencies where countries want to mitigate risks in case of armed conflict If Russia or other states have moved to onshoring acquiring capabilities from other countries this could signal their plans for strategic realignment through force or other coercive methods is the core of Ukraine’s shipbuilding heartland Image may not be republished without permission. Please contact imagery@csis.org CSIS analyzed this strike to understand Russia’s decision which was enabled by years of industrial planning and import substitution Russia’s stand-off strikes damaged significant portions of the plant and caused large fires likely crippling the plant’s ability to produce turbines in the near term Before the outbreak of the war, Russia was most likely concerned with the concept of weaponized interdependence which is when states with a high level of centrality within the global system use their comparative advantage in the military arms’ supply chain to punish or coerce another Weaponized interdependence presents a unique threat to a Russian economy that relied heavily on the West and foreign partners for key goods and components the Russian government may have worked to roll back the interconnectedness it once embraced For states that are seeking to use a calculated application of violence to degrade the rules-based international order being able to decouple from the global economy might soon be a prerequisite for the use of force Zorya-Mashproekt supplied high performance marine gas turbines not only to the Russian navy This impressive showing in the global market was in large part due to Ukraine’s expertise in producing these massive systems which are extremely difficult to manufacture Russia set out on a complex localization process that would take several years to complete The fact that the plant relies on Western machinery which enhances the Russian military’s capabilities presents a serious risk in the Russia’s military supply chain Russia’s focus on localizing production from Ukraine does reveal key lessons in its efforts to procure Western equipment to manufacture military equipment and the end of the Cold War led many to believe that war would be difficult to rationalize for states because free trade of goods and ideas would drive down the risk of conflict between trading partners The war in Ukraine seriously imperils those assumptions the Kremlin took clear steps to reduce their reliance on a historically major trading partner as evident by the import substitution of marine gas turbines and the strike on Zorya-Mashproekt Russia spent significant resources to localize production away from Ukraine sending signals that Russia was actively seeking to look both inwards and seek partnerships with Indo-Pacific states in order to decouple from Ukraine While efforts to localize production of critical goods may just be shrewd industrial policy that policy decision carries with it a potential increased risk of conflict by making conflict less costly for the state seeking to localize production Considering that Russia had less than a decade to complete this import substitution policy Russian efforts alone at localization will likely have limited ramifications on Russian readiness and production capabilities The bulk of the Russian surface fleet still relies on Ukrainian turbines which could be a serious vulnerability if Ukraine cannot or will not supply Russia with spare parts attempt to manufacture the parts domestically though that solution has two potential pitfalls the parts could be too complex to manufacture manufacturing parts likely relies on Western machine tooling If the West cuts off access to additional or replacement machine tools or to spare parts to maintain existing tools then Russia’s domestic manufacturing capability may slowly grind to a halt as machinery breaks down and cannot be repaired While Russia’s strike on the Zorya-Mashproekt gas turbine complex is just a single strike it could be evidence of how Russia thinks about and manages the application of force and industrial risks it turns out the Russia has been localizing key industries it once counted on Ukraine for that could be the start of a framework for understanding the connection between industrial integration and the risk of future conflict If Russia or other potential adversaries work to localize particular capabilities that it currently procures on the world market then it would be worth examining the source of those capabilities as a potential target if there is evidence that Russia is importing these capabilities from other nations this could be a signal of how it sees the world and how it wants to engage in its own strategic realignment As the world moves to an era of great power competition where competition sits in a context of industrial integration and cooperation understanding how industrial policy relates to other instruments of national power will be vital to estimating risk and responding to those seeking to undermine the international rules-based order Cook is the director of the Defense-Industrial Initiatives Group and a senior fellow in the International Security Program at the Center for Strategic and International Studies (CSIS) in Washington Alexander Holderness is a research assistant with the Defense-Industrial Initiatives Group at CSIS Grace Hwang is a program coordinator and research assistant with the Burke Chair in Strategy and Transnational Threats Project at CSIS is a senior fellow for imagery analysis (non-resident) with the iDeas Lab and Korea Chair at CSIS Jennifer Jun is a project coordinator and research assistant for imagery analysis of the iDeas Lab and Korea Chair at CSIS Commentary is produced by the Center for Strategic and International Studies (CSIS) tax-exempt institution focusing on international public policy issues Its research is nonpartisan and nonproprietary CSIS does not take specific policy positions and conclusions expressed in this publication should be understood to be solely those of the author(s) © 2022 by the Center for Strategic and International Studies See Media Page for more interview ©2025 Center for Strategic & International Studies Former Zorya player Mykyta Shevchenko stated that the "black-and-whites" still owe him money and the club has been banned from registering new football players — But Zorya recently officially announced the signing of midfielders Dejan Popara and Volodymyr Bilotserkovets… but they cannot register them until they settle their debts — How long has this ban been imposed on Zorya — The 45-day period since the decision of the Dispute Resolution Chamber expired Did they try to contact you to resolve the issue Burlesque is an artform that has been around for centuries and is yet still something that many have never experienced and may not even be quite sure exactly what it is It’s something I have loved for many years after seeing it for the first time when watching musicals such as Cabaret Since then I have been to numerous shows throughout the world including the Tropicana in Cuba the Moulin Rouge in Paris and even here in Brno I caught up with the Czech burlesque star Zorya Blue on the sun loungers on Dominikánské náměstí to find out a bit more about it.BD: So what’s your name and what do you do?Zorya: I’m Zorya Blue… which is my stage name Even most of the people from work don’t know my real name And I also host a podcast show about sex in Czech BD: What exactly is burlesque?Zorya: Burlesque… I could talk about this for hours But the short version is that it’s the art of performance during which we use the art of strip tease BD: How did you discover burlesque and how did you get into doing it yourself?Zorya: I first saw burlesque by accident We had a small party at home and wanted to move to some bar because of the neighbours There was a new bar opening around the corner and for their opening night but it was very classical burlesque and I really liked it then I did a beginners course and slowly moved into more advanced ones I still wasn’t thinking about actually performing it was just something I enjoyed and was doing as a hobby they organised a beginners performance night which I took part in I just thought I’d give it a try and see what it was like I just never stopped discovering and growing BD: And how long have you been performing now?Zorya: It’s hard to say because when is the moment when you become a performer You could count it from the first moment on the stage Now I do like 10 shows a month so is that first show the moment Or is it the moment you start getting money for the show Or when you do it full time and don’t have a typical day job I’ve done it full time for almost two years BD: I guess that’s when you started making liveable money?Zorya: You can’t really make enough to live off just from performing I guess it depends on your financial situation and some might even need 130k to be able to live how they’re used to it’s quite hard and it’s not that stable either and everything together makes it my full-time job BD: What would you say is the most difficult part of Burlesque?Zorya: Hmmm… I guess it depends on the person and their personality but I’m packing and unpacking almost every day basically BD: Is it very expensive when you’re first starting out and getting into it?Zorya: Even now you don’t want to invest a lot because you’re just starting and don’t know what you’ll do so even though it’s not a lot of money compared to performing professionally Then you get even better money but that means you need even better costumes too It’s much more expensive than people realise Some people will use fast fashion and get dresses for CZK 400 but that can be CZK 500 for a metre and you need like four metres so you’ve just spent almost CZK 2000 just for fabric Then someone needs to make the dress and you have to buy feathers or other decorations for it so… I’d say CZK 15,000 for a full costume is a really good price It could very easily end up at around CZK 40,000 or something like this BD: I suppose that you can then reuse the same costume?Zorya: Yeah yeah But still… you don’t get loads of shows out of it.  I came to see your Blue Pleasure show at Cabaret Des Péchés and I saw there was an advert for a book that you’ve written [‘Už budeš Can you tell me a little bit about that?Zorya: Yes It is in Czech but it’s a book that is inspired by my podcast but they are different to those on the podcast The idea for the book is what can you discover about your own sexuality what do people want to know?” and of course people want to know how to have better sex I thought I’d write more about discovery and self-discovery I have given introductions to a few different topics so people can get inspired and maybe look into them further BD: I noticed the book seems to have two different sides or covers…Zorya: Yes if you open it from the black side it’s more about BDSM and kink But I wanted to have lots of topics that will be relevant to a pretty wide range of people; modern dating polyamory and open relationships are all covered but it can give you an introduction.  did you find it was very easy and natural to get the interviews down on the page?Zorya: Well since it’s interviews I have great guests and I liked to write things as they were with very little editing I like people to be themselves and have that come across on the page More like two people talking and having a fun conversation as opposed to anything too formal How receptive did you find people when you were approaching them for the interviews?Zorya: For the book Some people used different names which is understandable There’s a chapter about sex for seniors and there was an 87-year-old woman who got a new boyfriend two years ago and we talk about intimacy so she wanted to be under a different name I don’t think it really matters whether she’s Jana her experiences are the same and her story is still just as important It was actually easier to get people for the book than for the podcast because people felt much more anonymous and felt they could be more intimate.  BD: Your show the other week was so much more than just burlesque Does that take a lot to organise?Zorya: Yeah especially when it’s the first time doing stuff like that Normally I produce straightforward burlesque shows called Blue Burlesque Shows which tour around the Czech Republic but the show you went to is more connected to the art of eroticism so it’s not a burlesque show but a pleasure show small interviews with sex specialists and overall more artsy performances It was a bit of an experiment which was inspired by the event I did for the book launch I did a big launch with these types of acts and I got so much positive feedback from it so I booked Cabaret Des Péchés here and it has worked out so well it was really great!Zorya: There will be another one on the 28th of November do you get performers from those cities?Zorya: Sometimes yeah but sometimes it can be hard to find performers in those cities I mix it up and can have performers from Poland BD: What would you say to someone who is unsure about attending the Blue Pleasure Show?Zorya: I would say it’s a show in Cabaret that will invoke a lot of emotions and maybe give you some bedroom inspiration but I still want everyone 18+ to be able to attend You don’t have to worry that you’ll come and anyone will cross your boundaries It’s just a fun show so come and watch and see how you like it BD: What does the future hold for Zorya Blue?Zorya: Oh my god Lately everyone asks me this and I don’t know Which doesn’t mean I won’t work for two months and I’ll have some time to recharge my batteries I only have a few shows over the summer and I can start thinking about the next season my brain will start working again and maybe develop a few ideas I have floating around I definitely want to grow and experience some new things and new challenges 2 years and 4 months ago I performed for the first-time outside Prague and now I’ve just finished an eight-city tour and have another 10-city tour booked up BD: What advice would you give anyone who’s just starting out as a burlesque performer?Zorya: If you really want to do it you have to keep in mind that it’ll be a lot of work People see you on the stage for only five minutes and think your life is just turning up at the club It’s a beautiful job and it’s my dream job but you have to take all this into consideration You need to give it a lot to do it really well BD: Is there anything you would like our readers to know about?Zorya: I have open classes in Brno every month or you could even just watch and follow along I also do private lessons or workshops and I’m in Brno all the time But I do warn you that burlesque is addictive Advertise with us Privacy Policy Brno Daily is a Czech media outlet for expats Our partners Attacking midfielder of “Zorya” Oleksandr Yatsyk became one of the heroes of the Ukrainian championship match against “Left Bank” (2:1) He had another great game and his 5th goal of the current season — You score against “Left Bank” in every match If we hadn’t immediately conceded in response at 2:0 But we were nervous at the end of the match Sukhoruchko failed to convert a one-on-one with Saputin.. Antyukh didn’t orient himself at that moment and mistakenly passed back I can’t say that the guests created anything near our goal you don’t often see such masterpieces even in the World Cup I went down the left flank and made a pass to the right flank where Denis redirected the ball to the far corner with one touch everything was done for me by Pylyp Budkivskyi I tapped the ball forward and scored with my second touch — The famous Italian coach Fabio Capello says that a score of 2:0 is worse than 1:0 and then it’s possible not to regain our focus — Now we look at the league table and see that Zorya is 7 points behind Polissya Is this distance to the European Cup zone manageable in the remaining 5 rounds of the season We need to win all our games at the end of the Ukrainian championship — What was interesting in the Zorya dressing room after this match — Denis Antyukh — he is the one who puts on the music He has “reserved” a column and always plays music in the dressing room Now that is how you hit the ground running in Europa League It took some time for the Foxes to get going but once they stumbled across the goal line the levy was breached and the rain kept falling so it was a slow day at the office for Kasper But there was a brief moment where he kicked the ball directly at a man in white and he was almost chipped from outside the box we might be looking at a different scoreline He hasn’t been as dynamic since his incredible start in the maroon colors of Leicester City He had some great chances to put the ball into the box which could come good once Islam Slimani is a target for him and the fans just immediately fall in love with him It’s like he went to the Youri Tielemans school of passing and did everything he needed to for the clean sheet but you could tell there was plenty of rust there for the old stalwart at LB Brendan did my boy dirty once more sitting him way too deep in the first half I never want to see Namplays Mendy higher up the pitch than Youri unless he’s on a breakaway and slipping in Jamie Vardy for a tap in I get that Brendan wants Mendy higher up the pitch to win the ball back through pressing so let the Belgian push up higher to create It really bugs me that he and Youri had the same amount of passes I feel like he got more defensive in the second half I understand he’s doing the job he’s asked to He worked a shift on the RW that I’m glad he’s willing to do to put James Maddison back in the center of the field We are blessed with some serious talent at CM but I don’t think playing all three of them at the same time is the way to go He scored a goal only Pipo Inzaghi could be proud of Getting his first goal in Europe is a huge accomplishment for him and I hope he scores loads more this season Harvey Barnes goal was smoother than Tim Meadows portrayal of The Ladies Man It most certainly won’t get anywhere near the amount of credit it deserves because he ins’t a crybaby in a cazoo shirt or play for a London club renowned for choking Keep doing your thing Harvey and be like Brandon Harvey Barnes dazzles under the Thursday night lights 1) Thursday nights under the lights are fun but definitely miss the fan buzz That video the official Leicester City Twitter account posted ahead of the game got us all a bit teary-eyed right It made me long to be back at the King Power under the lights Our home support and atmosphere has never been better than during European nights With some many European debutants in our team I’m sorry that they didn’t get the chance to experience that atmosphere It shouldn’t have dampened the mood though, this was a confident Leicester City performance and largely comfortable 3-0 win after weathering an early storm from our Ukrainian opponents. The Foxes home record in the Champions League back in 2016/17 was fundamental to our success and we’ve got this Europa League campaign off to a positive start Watching some of the football on show - ‘Leicester are so easy on the eye’ to quote the BT commentary - was a joy and should provide a perfect springboard for the run of the next few weeks which is solid with Premier League-Europa back to back fixtures The extra bonus being that we made it through the game with no new injuries and with another sixty-five minutes under his belt it was the fittest James Maddison has looked so far this season My only criticism of Barnes last season was that his good performances if this start to the season is anything to go by you were outstanding in your first Europa League game He took all the right kinds of risks and ran at the Zorya defence time and time again Watching the highlights back makes his performance stand out even more Barnes was front and centre to every positive piece of play from the Foxes Having tormented the Ukrainian defence for the whole game It might not have been the spectacular effort that hit the post but it was a well-crafted goal and his composure in that one-on-one was excellent There’s an energy every time Barnes has the ball that always feels like a goal Some of his link-up play with Kelechi Iheanacho was great and it’s nice to see them forming a partnership in Vardy’s absence Barnes didn’t quite get the same level of overlapping that James Justin has been providing in games This was Barnes’ show and what a joy it was to watch will be keen to ensure the winger is not going anywhere soon He’s certainly attracting attention and another Man of the Match performance won’t go unnoticed Gareth bale has posters of Harvey Barnes on his bedroom wall pic.twitter.com/ujvWGZNcnE 3) Brendan Rodgers does remember that Ayoze Perez is a striker Looking at the substitution bench against Zorya which I’d stopped doing given Rodgers has rarely played him as one It’s pretty criminal that we chose not to name Islam Slimani but logged Kiernan Dewsbury-Hall whose in the Championship on a season-long loan Whether this will come back to haunt us is yet to be seen Rodgers did make me a little giddy though by allowing Ayoze an opportunity to actually play his position You’d forgive the Spaniard for taking a moment to re-adjust to it the game was largely done by the time he made his appearance It was easy to be unconcerned about the lack of strikers in the squad when we won comfortably and two of the three goals came from our midfield but it’ll be interesting to see if this lasts It’s impossible to say if Perez is a viable option in this position when we just never play him there Kelechi may not have walked away with the Man of the Match award only because Barnes was just next level good but he did get a goal which felt like the least he deserved He’s another player that’s lacked consistency though it’s not always his fault He doesn’t often get a run of games and even when he does I was impressed by his positional play and his strength against Zorya feeding Barnes and Maddison through on several occasions it came from a great pass from the Zorya defender but he was quick to react to it A goal that had an air of confidence about it but he definitely stepped up and provided more of the traits that make Vardy so vital to Leicester City Already up there as one of the key players for this Foxes side Dennis Praet added another string to his bow His performance against Zorya was quietly effective at times passes through and a right-wing cameo that was pretty effective It feels like he’s covered most forward areas on the pitch for us this season and not only is he willing to do so he’s looked good in all of those positions too but there was one barn-storming run down the right to retrieve a sort of pass from Belgian teammate Castagne where he attempted a cross in and Zorya hastily knocked it behind for the corner Praet was denied the chance to add a goal to the tally by a very important block from the Zorya defender The Belgian’s willingness to slot into the midfield wherever needed allowed us to play James Maddison in his best position and leave us with a formation that allowed Barnes the freedom to dominate the attacking play "European debut and a goal I should be so happy with that, but kind of wish my family were up there and I had a full King Power Stadium watching me"James Maddison feels the Europa League game against Zorya was bittersweet pic.twitter.com/kXaVV7RP00 Bonus Learn: Kasper Schmeichel has always been the king of interviews for the Foxes intelligent in his choice of words and very well spoken It seems that he has a rival in James Maddison though His post match interview made it easy to see why everybody seems to love him His coaching with Brendon has rubbed off too in the way he talked tactics and formation Website by Make a Spectacle Released on April 11, 2016 via Independent but I’ll be the first to admit that I’m not a doom aficionado but tuning down to drop C and turning the fuzz pedal up to 11 isn’t enough for me There has to be something that excites me behind all that dirty low fuzz Sunnata’s new album Zorya is described in their press release as “doom metal / post-doom” and certainly is not your standard doom album often bass-led and definitely has riffs aplenty It’s also ridiculously catchy and in places I pretty much had to stop myself headbanging at my desk it’s just so damned good Each of the five tracks on the album clocks in at around the ten minute mark and each is chock full of expression using changes of pace and feel to build some genuinely explosive pieces Sunnata allow time to let the music breathe melodic pieces such as in the late stages of ‘Long Gone’ build slowly over the course of a couple of minutes only to brutally drop you straight back into the main hook Zorya by sunnata they create truly oppressive and claustrophobic atmospheres with slow before dropping some ridiculously heavy riffs I can only imagine the magnitude of the mosh pits this could create played on a proper sound system My favourite part of the album has to be the start of the title track “Have you ever spread your wings up high?” in harmony only to be repeatedly battered by bass and drums A great intro to a particularly punishing onslaught of a track If I had to describe this album by comparison to other bands I’d say that it’s like a cross between Fu Manchu and Monolord expertly built to take you to dark and stormy places this should be near the top of your list of albums to check out Regular visitor? Please consider a small subscription to help us keep the site running. As little as £1 a month could make all the difference. Click here for more details. If you’ve enjoyed reading our site please consider supporting our Patreon and help ensure we can keep up the good work in to the future. More Info Website by Make a Spectacle competing in this tournament for the seventh successive season made a perky start as they tried to boost their attempt to progress beyond the group stages for the first time Youri Tielemans did not escape Frappart’s attention in the 10th minute, when he was deservedly booked for sabotaging a counterattack by Zorya. That encapsulated a frustrating start for the hosts, who struggled to find a way through the visiting defence. Indeed, Rodgers’s side spent an uncomfortable amount of time chasing the ball as Zorya proved to be nimble passers. Kasper Schmeichel had to rescue his team in the 22nd minute when Zorya opened them up, the goalkeeper making a fine save to deny Vladyslav Kabaev. Just before the half-hour mark Leicester cut through with their first really sharp attack. Barnes’ shot from the left of the box bounced off the far post and Iheanacho prevented the goalkeeper from retrieving the rebound before feeding the ball to Maddison to convert from close range. Leicester took control after that, although Schmeichel nearly let Zorya back into the game with a sloppy pass just before the break. The goalkeeper was relieved to see Dmytro Ivanisenya’s lob drop over the bar. Leicester soon settled themselves with a brilliant goal. Iheanacho rolled a classy backheeled pass into the path of Barnes, who scampered into the penalty area and finished delightfully. Leicester never looked like dropping points after that. Barnes and Maddison began to thrive, although Maddison did not relish the crude tackling he seemed to attract. Iheanacho and Timothy Castagne joined in the creative play regularly and Fofana, who had another accomplished game at centre-back, glanced a header inches wide after venturing forward for a corner. Read moreRodgers decided to take Maddison out of harm’s way just after the hour profiting from a defensive error before spinning past his marker and firing into the net from 16 yards Leicester threatened to inflict further damage but the visitors did just enough to keep the scoreline respectable GameTyrant is a game news and culture from the team at GeekTyrant Covering video games on consoles like PlayStation TLM Partners and MadLife Divertissement are showing off an all-new video vignette for their upcoming two-player cooperative puzzle game The vignette showcases the two main characters One is the night goddess Aysu and the other is the sun goddess Solveig Players must use both characters’ abilities together if they plan to defeat their enemies to maximize the strengths and synergy of the sisters’ powers The game will feature both split-screen and online co-op play It will also allow for cross-play between players on PC and Nintendo Switch All names, trademarks, and images are copyrighted by their respective owners   ///   Copyright / DMCA NoticeCopyright © 2015-2022 GameTyrant Entertainment LLC All Rights Reserved ///   Privacy Policy Real Madrid have confirmed the signing of goalkeeper Andriy Lunin from Zorya Luhansk for a reported initial fee of €8.5 million Lunin's father confirmed earlier this week that Madrid along with other interested clubs including Napoli had been in touch about taking the teenager who already has two senior caps for Ukraine The permanent transfer to the La Liga giants was confirmed by a short club statement released Friday afternoon which did not make public the fee being paid "Real Madrid and FC Zorya Luhansk have agreed the signing of the player Andriy Lunin who will be attached to the [Spanish] club for the next six seasons," the statement said Marca have claimed that Madrid were to pay about €8.5m plus €4m in extras with the move fitting with the club's policy of snapping up the best young global talent Gareth Copley/Getty ImagesLunin could now be sent on loan or perhaps take the place in the senior squad of Luca Zidane who is expected to leave the Bernabeu this summer after his father Zinedine Zidane stepped down as coach New Blancos coach Julen Lopetegui, a former goalkeeper himself, has yet to make public his plans for the position, but current No. 1 Keylor Navas revealed this week that Lopetegui had attempted to sign him for former club Porto in 2014 Madrid have been heavily linked with signing another senior goalkeeper this summer Manchester United's David De Gea and Chelsea's Thibaut Courtois among the names popping up regularly in local media speculation which are of particular importance considering the vital role of gas export units in maintaining the stability of production maintenance and standby of such equipment,” said Mohammad Nemati Noting that the 8th turbine of the 10th South Pars refinery crashed earlier this year due to severe damage to the bearings of the HPC sector “Considering the existing operational emergency and the importance of sustainable gas production by simulating the related manufacturer's workshop in the 10th Refinery workshop the necessary facilities for the emergency repair of the turbine were provided and after examining and considering the existing risks the emergency repair of this turbine was conducted in the country for the first time.” “The great job was carried out with detailed planning and high supervision of the relevant officials and with the cooperation of knowledge-based contracting companies two months earlier than the usual repair time of this type of turbines,” Nemati said Zorya-Mashproekt is one of the largest manufacturers of gas turbine equipment for gas transportation systems Zorya-Mashproekt has manufactured gas turbines which today range from 5 MW to 33 MW in unit output the company has been delivering complete gas turbine power plants ranging from 100 kW to 110 MW unit output Zorya-Mashproekt has delivered more than 460 engines with a total power of more than 6,000 MW and over 36 million hours of operation These engines have been installed at oil-gas fields and municipalities for electric power generation and combined heat and power (CHP) cogeneration Brendan Rodgers’ side may need to win at home to AEK Athens next week to confirm top spot in Group G and, in theory, a more favourable draw for the knockout round. Although that was the target in Ukraine, the manager spared several first-team regulars from the trip and used the match as an opportunity to reintegrate three key players who had been missing for months. Read moreThe return of Soyuncu from the groin injury that had kept him out of action for two months did not last long with the centre-back pulling up after running to intercept a pass he just overstretched it a little,” said Rodgers we’ll have to analyse it when we get back.” Wilfred Ndidi and Ricardo Pereira enjoyed more fruitful comebacks Ndidi looked bright before being replaced in the 56th minute Pereira was naturally short of his spectacular best but put in a steady 45-minute performance on his first appearance after a lay-off of nearly nine months with cruciate ligament damage I feel very happy to be back,” the full-back said View image in fullscreenCaglar Soyuncu was forced off with an injury on his return after two months out. Photograph: Plumb Images/Leicester City FC/Getty ImagesZorya did not make life easy for Leicester. Vladyslav Kochergin and Andrejs Ciganiks forced awkward saves from Danny Ward in the first half. Leicester grew into the game without showing much creativity. That said, Cengiz Under, the most lively of Leicester’s attackers, should have fired them into the lead on the half hour after being sent clear by Dennis Praet but the winger dabbed the ball wide. Read moreZorya regrouped during the interval and gave Leicester a serious fright early in the second half when Vladlen Yurchenko powered a header against the crossbar Leicester cranked up the intensity in pursuit of the victory they wanted Under delivered an ideal free-kick to Wesley Fofana in the 75th minute but the young centre-back bungled his header from close range Nikola Vasilj then had to make two excellent saves to deny Kelechi Iheanacho and James Maddison But Leicester were then punished for nodding off in defence Sayyadmanesh arriving unmarked at the back post to tap in a low cross by Denys Favorov Leicester have lost three of their last four games in all competitions Nintendo Switch Review Codes Provided by Madlife Divertissement Finding a puzzle game that is designed to be played with a friend can be a wonderful experience if the game isn’t built in a way that works for both players then it could be an upsetting experience When developers Madlife Divertissement created Zorya: The Celestial Sisters it seems that they had a good idea on what to present but ended up with an overall questionable title After the citizens living under the reign of Aysu or Solveig it quickly became apparent that there was some favoritism for the gift of Daylight Upset to be forgotten and underappreciated ran away and found herself stranded on Earth There really isn’t too much to the gameplay and that is where the main concern on the build is Each level that loads up has a simple goal: reach the icon at the end that will help bring Aysu another step closer to the sky there will be one hidden coin that can be found as well it will be up to you to control the sun’s location and utilize the power of the sun to help Aysu you must provide the path that will lead her to the end goal of the level you get the best view of the map and can look around to see the best way across The other player takes on the role of Aysu it will be up to you to reach the icon without leaving the shadows so when it comes to looking inside buildings and under coverings it is up to you to find different aspects that are harder to see from a top-down view this means it will be up to you to find the coin and point out what’s in the nearby buildings more aspects will be added such as enemies and puzzle elements While Aryu simply has the ability to push things with a wind power Solveig is the one that will be able to really do anything about them Once Aryu pushes them out into the sunlit section of the level Solveig will be able to hone in the power of the sun to defeat the enemy or trigger the puzzle element There will be times when Aryu is more helpful than Solveig in these cases especially later in the game as you find more of the complex puzzles ahead it will always require the efforts of both roles to get things done it doesn’t truly make sense why this game is a forced co-op title they can both be controlled by a single player easily The controls for each character consist of movement and a couple of action buttons which can easily be split on a controller for a single player It would be different if this was a game that offered co-op and split the controls as they do but to force co-op just for this truly ruined it there is typically a lot of controls and reasoning for each character to be participating but this game could have easily have been a single-player experience as well Neither of these aspects was really remarkable in the game Levels were small and the environment around them was barren There was little effort done to make each level stand out from each other and it is obvious all of the efforts went into the path of solving the puzzle itself Having every level look like a barren island with a section in the middle is truly minimal effort At least the graphics of the game were fittingly cartoonish the voice work was pretty well done and had a nice storytelling tone But the music in the game was practically none existent and the characters in-game barely make any sounds even when thrown off of a higher floor of a building The sound effects used for the powers and when platforms moved were decent enough at least They tried to add some replayability by having a marker above each level to show if you completed it as either Aryu or Solveig so you know that you can switch roles and complete the level again the level is exactly the same and so is the puzzle there isn’t really any replayability to it there are hidden levels you can unlock as well This game simply had the controls of a single-player puzzle game where you control a single character and the sunlight then split it up between two players Forcing this game to be a co-op title and not making it offer a co-op experience as well as being playable as a single-player game is truly a baffling choice on the developer’s end Not only are you forced to do this game as a co-op title I played this game online with a friend on the Nintendo Switch and we lost connection at least once every 15 minutes Reconnecting takes about 2-3 minutes as well It is a very annoying thing to deal with when you are trying to just enjoy a co-op experience with a friend despite the puzzles being decent (especially in the later levels) the scenery and environment for the levels are so empty and barren There is nothing to look at if you wanted to even try to enjoy the environment your characters are in Zorya: The Celestial Sisters seems to have had their head in the right place when creating it but it just came out as a bland puzzle game that offers little to each player individually It is such a disappointing experience overall and an unfortunate letdown that could have been better if they decide to make another puzzle title they will either offer a single-player experience with the option of co-op or actually provide enough reasoning for two players to be playing the game together An enthusiast for all things Horror and often finding myself playing Indie games over AAA. I enjoy writing for games in both the journalist and creative capacity. If I’m not writing or gaming, you can find me at a theme park or convention.Follow me on Twitter to see updates on all my work and occasional life updates Renowned commentator Ihor Tsyhanyk made a prediction for the match of the 19th round of the Ukrainian championship "Zorya" — "Rukh" "Rukh" is going through difficult times right now but I want to tell you that this team will recover over time They have gone through very good preparation for the second half of the season so they must finish the current season on a positive note for themselves the controversial decision by referee Kozyriatsky had a significant impact on the result of the match "Zorya" against "Oleksandriya" (1:2) in the last round; Bartulovych's team did not deserve to lose and the mood against "Rukh" should be combative I have a feeling that the match will end in a draw with goals exchanged," said Tsyhanyk Current odds on the match "Zorya" — "Rukh" >>> with full cross-play functionality enabled on day one This adventure game lets players solve complex puzzles that become increasingly more difficult as they make their way through the lands of Vyraj You’ll play as one of two different characters; Aysu the night goddess who must stay within the shadows the all-powerful sun goddess who controls time and harnesses solar energy The game will feature both split-screen and online co-op and will allow for cross-play between PC and Nintendo Switch There will also be a “Friends Pass” that lets players invite friends to join in on the gameplay experience even if those friends have not purchased the game The game looks fantastic and promises to be an incredibly fun cooperative game to play with friends and family. To learn more, check out the launch trailer below Defense Security Monitor A Forecast International blog about the arms trade particularly for use in compressing natural gas Natural gas is a major component of the Russian economy as demonstrated by the importance of Nord Stream 2 but getting the gas to market requires compressor stations – and not just a few Compressor stations for natural gas are needed to compress the gas for continuous movement down a pipeline Compressor stations need to be placed every 40 to 70 miles (roughly 65 to 110 km) on a particular pipeline to move the gas Compression is usually provided by gas turbines and this is where Zorya-Mashproekt comes in Company literature from 2016 states that 1,150 Zorya compression turbines had been installed to that point As relations between Russia and the United States have soured President Joe Biden now saying that invasion of Ukraine by Russia is imminent what would happen if all that machinery would no longer be available for overhaul by Zorya-Mashproekt Do the Russians now have the capability to repair these machines Are they going to replace these machines with products from the homegrown UEC Saturn or Perm but besides fighting over land with little industry why not let the gas flow as it has since the fall of the USSR Carter Palmer has long held a keen interest in military matters and aviation As an analyst for Industrial & Marine Turbine Forecast Carter specializes in examining key gas turbine programs for electrical power generation He is also responsible for updating the reports and analyses within the Space Systems Forecast – Launch Vehicles & Manned Platforms and Space Systems Forecast – Satellites & Spacecraft products Forecast International’s International Military Markets service provides a country-by-country examination of the military capabilities The individual country reports are structured to condense a vast range of information into concise segments and military postures – all are detailed in these six services broken out by region (click each title for more details) Click here to learn more. Privacy Policy 30 Apr 2025 10:00:00 GMT?.css-1txiau5-AnswerContainer{color:var(--GlobalColorScheme-Text-secondaryText2);}Inhulets Petrove won 1–0 over Zorya on Wed The current head to head record for the teams are Inhulets Petrove 2 win(s) Haven't scored in their last 2 matches Haven't kept a clean sheet in 7 matches Zorya have won the previous 2 matches against Inhulets Petrove. 30 Apr 2025 10:00:00 GMT?Inhulets Petrove won 1–0 over Zorya on Wed 30 Apr 2025 10:00:00 GMT.InsightsHave scored 1 goals in their last 5 matches Zorya have won the previous 2 matches against Inhulets Petrove Inhulets Petrove is playing home against Zorya at Stadion Nika on Wed Aysu must safely navigate the shadows to regain her powers that are scattered across the never-sleeping lands of Viraj puzzle filled adventure where you and your partner must prove that you can communicate and collaborate to recover Aysu’s powers Embark on a puzzle filled adventure where you and your partner must solve increasingly complex puzzles the all-powerful sun goddess who controls time and can harness solar energy as the separated celestial sisters embark on their quest to reunite Watch a new trailer below. View a new set of screenshots at the gallery https://www.youtube.com/watch?v=M3WI8wMnjvU Reproduction in whole or in part in any form or medium without acknowledgment of Gematsu is prohibited Use of this site is governed by all applicable laws Website by 44 Bytes Sign In Register ATIKOKAN — Thunder Bay’s Zorya Ukrainian Dance Association traveled to Atikokan last weekend to perform a special concert for the Ukrainian refugees who have made Atikokan their home since the Russian invasion began in February 2022 Since arriving in Atikokan, a year ago, the Resolute sawmill near Atikokan has employed 31 Ukrainian men and women It was this connection with Resolute that made the event possible Zorya’s concert appropriately titled Heroyam Slava (Glory to the Heroes) a common Ukrainian slogan and rally call that celebrates Ukrainian independence after the collapse of the Soviet Union was dedicated to those fighting to protect their freedom in Ukrainian from Russia’s attack “It was a good feeling to organize it and a wonderful feeling to have a happy ending During the [Ukrainian] anthem at the very end I had a hard time,” Zorya’s Dance school coordinator Alice Chony said while holding back tears “To have been there and see what was there Cerhii (Serhii) Batarchuk said the performance filled him with a sense of culture and support “We are very appreciative because we know many families in Thunder Bay and Atikokan For someone to come from Thunder Bay to Atikokan to give support, it helps give a new ability to recover and live and try to the best that they can do now,” Batarchuk said Zorya’s dedication to Ukrainian dance inspires many generations to connect with their Ukrainian heritage which was something Batarchuk found quite interesting saved this culture and bring [it to Canada] and show It’s so beautiful” said Batarchuk Zonya trains students as young as four years old As they advance from beginner to senior levels their skills allow them to many different techniques The dance that stood out the most to Batarchuk was the Hopak which is performed by the senior ensemble to close out Zorya’s concerts The Hopak is a historical traditional dance The finale showcases each dancer’s technicality and grace “it translates to ‘you're powerful’ and we can come together and continues to live.”    Another highlight from the concert was 12-year-old Ilona Volosianko who joined Zorya in January Volosianko took to the stage to perform two songs One was a traditional folk melody — Yak ya Sey Zaspeevam (How I will Sing) — and the other was an original composition she created — Mriyu Pro Dim (I Dream of Home) she arrived in Thunder Bay with her family and continued to practice the Bandura with a teacher in Thunder Bay and online with her teacher in Ukraine When asked how Zorya was able to bring their concert to Atikokan “it all sort of fell into place.”   One of Zorya’s senior ensemble dancers is employed by Resolute in Thunder Bay The dancer helped contact Resolute in Atikokan the executive director of the Atikokan Economic Development Corporation “You know Alice organizes everything She just phoned and wonder if we could set up a venue and it just sort of grew from there,” said McKinnon McKinnon said at least one person from each refugee family is currently working at the sawmill the sawmill can run full shifts seven days a week He also acknowledges that many residents have provided a wealth of support to its new Ukrainian neighbours The concert was held in the gymnasium at the St Patrick’s Roman Catholic School where the room was filled with community members of all ages group About Us FC Zorya Luhansk website Slavutych Arena website the 12,000 capacity Slavutych Arena in Zaporizhia City has hosted top-tier football in Ukraine ever since it has welcomed not only the local Metalurg Zaporizhia but also the exiled Zorya Luhansk from the rebel-held eastern regions the stadium is at a good juncture for exploring the treasures of the city and the riverside beaches near the ground The stadium location allows supporters to enjoy the restaurants in the city before the game We have enjoyed a number of them over the years in Ukraine and visited Bar B.Q just five minutes from the ground there is a pleasing selection for hungry fans so do not despair if you arrive late for the game and bars located within a block of Sobornyi Avenue (one of the main roads in the city) They meet all needs ranging from cocktails to small sandwiches – there is even a McDonalds not too far away as well Most food outlets outside the stadium will accept cash and card but it is cash only once you enter the arena complex Bar B.Q has some delicious deluxe burgers on the go The Old Rabbit coffee shop is also highly recommended as a free space and an excellent place to relax before the game it is just a few kilometers away from the ground with and without alcohol but the unique surprise of cider (all of more or less a dollar US) I definitely recommend enjoying the cider on offer inside the ground as it is pretty unique in Ukraine It is also sweet being allowed to take alcohol on to the terraces in the Premier League The Slavutych Arena takes on a British style than seen elsewhere in Ukraine providing good vantage points from all sides of the ground The raised four stands allow a good atmosphere to reverberate around the stadium The four stands are very similar in make-up with the side terraces being covered in part by a roof All of the stands are raised quite a degree improving the view of the pitch there is finally a ground without an athletics track The premium seats are located center pitch but we were happy with our seats for less than US$2 The sizeable electronic scoreboard stands behind the goal and counts down the seconds until another Zorya victory That area behind the goal houses the visiting fans It is an impressive building for Ukraine and quite deservedly holds European football within it The stadium announcer introduces the team before the game and presents the halftime festivities with enthusiasm It encourages the majority of fans to get involved There is little of in-game entertainment as the fan engagement is still in its infancy it is great to see fans gather outside the main stand waiting for their heroes to appear from after game warm downs I have seen images in the past of supporters and players celebrating their favorite victories together given that they are covered from the elements Low attendance in Ukraine means that you have a good selection but the atmosphere is livelier there if that is your thing All four stands have access to food courts The downtown district of Zaporizhya stretches along the Dnipro’s right bank and the stadium is found on its western tip Just a couple of minutes walk from the main commercial road the stadium has got access to an abundance of sights and facilities to enjoy while in the city The ground is located in a prime neighborhood to explore such as Cloud Lounge and Virny are within a few hundred meters walk and serve a full range of beverages The district also hosts restaurants like Olimp A little further afield in central Zaporizhya the Lviv coffee shop is a necessity to see Tasty chocolate treats and delicious coffee await its guests located just a few hundred meters away from the ground on the riverfront provides a good option for overnighters near the ground Comfortable lodgings are available for less than $US50 the city offers a great variety of possibilities accessible through several websites You can choose from beach side lodgings to being in a central downtown location based on your wishes Given the fact that the host club ‘Zorya Luhansk’ plays in exile the city of Zaporuzhya has taken the club to heart The stadium regularly holds attendance within 1,000 of its near competitors even though the journey from their home city can take over four hours The ground usually is around 20% full but can grow to half full for the more significant matches They sit in the lower half of the league table for attendance but most clubs are in the same ballpark between 2,000 to 3,500 spectators Shakhtar Donetsk has lost around 50% of its attendance while having to play in exile with Zorya’s chants breaking out around the pitch during high points in the entertainment behind the goal to the left of the main stand who continually sing throughout the game and are known for their use of pyrotechnics You are guaranteed an exhilarating experience on that terrace supporters have plenty of methods for easy access to the stadium location and from afar Given the cost of public transport in Ukraine it is worth considering staying further away from the stadium to enjoy more of the city Buses in Zaporizhya are plentiful and cheap with maps easily accessible via mobile phone applications Although Uber or rideshare services have not arrived in Zaporizhya yet many taxi companies offer affordable trips for visitors the station is at the other end of the town With the stadium set back from the main road so any of the side streets are opportunities not worth ignoring It usually is entirely free as the local fans take public transport to and from the game Tickets are purchasable from several outlets around the ground before the game Each of the four stands has its own access points and an outside gathering area before entering the stands It certainly reminded me of a lower league UK variant the raised terraces may provide an issue with the staircase Toilet facilities are to a reasonable standard and easy access from the ground floor – the space can hold up to 12,000 people the trip to Zaporizhya city is one of the pricier in Ukraine but worth it compared to its European counterparts The Slavutych Arena has all the components of a great match day experience with the most expensive being around 2 dollars USD$ the main stand provides the most excellent facilities I enjoyed the burgers near the stadium for my own preference numerous restaurants are available near the ground The extensive public transport system with its unbelievably low prices makes movement around the city straight forward and opens up the space for car parking Given the vast array of food and drink outlets near the arena The cheaper seats opposite the main stand provide an equally pleasing view for a smaller price as well My visit to the Slavutych Arena was the most English of experiences that Ukraine had to offer You can park easily around the ground and walk up to the stadium The food courts also resemble a British occasion A trip to the Slavutych Arena will provide the big city experience that is comparable to other countries It is an impressive setup even if the attendance (at least for my game) was low The facilities around the city scream for a more extended city break that will allow you to enjoy more than just the game day Stadiumjourney.com Roma took care of business in their second Europa Conference League group-stage match Following last Sunday’s disappointing Derby della Capitale, Roma’s second loss in three matches the team needed a strong performance to bounce back and regain some confidence and their Europa Conference League group-stage match against Zorya Luhansk provided the perfect opportunity to do so scoring two goals in the second half to empathically claim victory on the night Despite the heavy rotation in the squad for this match the Giallorossi seemed determined to erase the bad taste from Sunday’s defeat right from the onset all characteristics missing at the beginning of the Lazio match The visual of Mourinho barking from the touchline encapsulated the intensity with which Roma started the match and it didn’t take long for their efforts to be rewarded who beat the offside trap to get on the end of a lovely ball in from Darboe dribbled past the keeper in a quintessential SES moment and cooly slotted the ball home to give Roma the lead on the night This was exactly what Roma needed coming off Sunday’s result a period of initial dominance following lackluster starts in previous games and an early goal so that the Giallorossi could really take a stranglehold of the game and build confidence The next ten minutes of the match slowed the game down considerably with Zorya looking reluctant to fully press the issue and pursue an equalizer while Roma were seemingly content with controlling possession and looking for opportunities to get a second goal on the counter It was at this point in the match that Zorya really began to grow into the match and look likely to score an equalizer forcing some frantic clearances from the Roma defense This brief period of Zorya dominance seemingly woke Roma up who began to look more threatening themselves with El Shaarawy forcing a corner and Perez nearly finding Smalling inside the box for a great chance with Calafiori putting in some dangerous crosses and Shomurodov forcing a fine save from the Zorya keeper You’d be forgiven for beginning to wonder whether Roma would rue these missed opportunities later on in the match who really should’ve done better on the attempt The last ten or so minutes of the first half were relatively straight-forward with both teams looking for their opportunities to make something happen but also not forcing the issue either at the risk of getting caught out resulting in the Giallorossi going into the half up by just the single goal The opening of the second half was a near mirror-image of the first with Roma producing a similar level of intent coming out of the gate as they did in the first this is exactly what you wanted to see from the Giallorossi coming out of the gate we’ve discussed the importance in not allowing these slow starts to become a habit so it was great to see the team break out of that trend It didn’t take long for Zorya to again begin to press the issue with a poor clearance by Smalling resulting in an action where the home team were able to whip a ball into the box that somehow missed every Zorya player inside further highlighting the need for Roma to grab a second goal Roma really began to take a stranglehold of the game and comfortably snuffing out any potential response from the home team As if sensing just how close Roma were to scoring Mourinho put on Abraham and Zaniolo in place of Shomurodov and Perez as Zaniolo looked dangerous from his first touch and Abraham nearly scored with his first few touches I began to wonder whether Roma would be unlucky on the day and be forced to sweat out the result but a 66th minute Smalling header off a corner-kick Roma continue their stellar play from set pieces this season following some great corner-kick opportunities in the Lazio game I mentioned on the podcast that I couldn't remember the last time that Roma consistently looked dangerous on set pieces specifically corner-kicks like they have this season thus far you have to be happy for him to get his goal given his injury troubles and limited playing time this season he always seems due for at least a couple of goals like this one every season Tammy Abraham arrives at the Roma party ✨ pic.twitter.com/VSMtKfQOEi Almost as if the second goal allowed the Giallorossi to finally exhale and relax the team really began to turn on the style pressing for the third goal and terrorizing the Zorya backline when just a couple of minutes later Abraham was able to squirm through the defense and kill off the game with Roma’s third of the night Talk about an instant impact off the bench for Abraham Credit to Mourinho for making the right substitutions yet again you hope that this goal will give Abraham a good injection of confidence that he can continue to build on With the game pretty much done and dusted at this point the rest of the match played out about how you would expect with Zorya pressing the issue but without much to show for their efforts The scoreline also afforded Mourinho the opportunity to give minutes to players such as Villar and Mayoral with the latter nearly scoring on several chances the second half concluded without much fanfare and the Giallorossi comfortably saw out the last twenty minutes of the match to claim all three points and remain perfect in the group the first half performance is exactly what I wanted to see following the derby loss looked fluid and extremely dangerous throughout and hopefully encourages Mourinho to continue to rotate the squad in these type of matches highlighted by a beautiful ball into SES for the goal You’d be forgiven for expecting Darboe to be a little rusty given his limited playing time thus far but the youngster was clearly up to the task today supplying quality pass after quality pass throughout the game who won in convincing fashion to stay top of the group while simultaneously giving many key pieces a well-deserved rest I would’ve liked to see Ibañez get some rest it certainly isn’t ideal to have one of your starting CBs play as a right-back for the full 90 ans you wonder at this point just how urgent finding a right-back will be for the winter market the Giallorossi did what they needed to do tonight which was get back to winning ways and build some momentum in advance of the Empoli match and the dreaded international break Roma resume league play and host Empoli on Sunday Menu.page-20160588{--colorD:#80ff00;--colorJ:#80ff00;--gradientTransparentJ:#80ff0000;--colorDC:#80ff00;--colorDA:#80ff00;--colorDF:#80ff00;--colorJD:#80ff00;--colorDJ:#80ff00;--colorJF:#80ff00;--colorJG:#80ff00;--colorDDC:#80ff00;--colorDTransparent:#80ff00;--colorJTransparent:#80ff00}EntertainmentWhy 'American Gods' Is Right to Leave Out Zorya's Nipples "Head Full of Snow," the third episode of 'American Gods,' makes an important adjustment to the novel StarzThere is a time and a place for nipples to be part of a story — and curiously the television adaptation of American Gods understands that more keenly than Neil Gaiman’s novel does Neil Gaiman’s magnum opus American Gods is a sprawling story that’s funny and weird and wise. It’s also erotic in certain scenes when sensuality doesn’t contribute to the plot. You’d think this tendency would only be amplified in its cable television adaptation, but the third episode of the Starz show does something entirely unexpected It tones down a scene’s sexual aspects in favor of focusing on how it serves the larger story In “Head Full of Snow,” protagonist Shadow Moon has an intimate encounter on a Chicago roof top with Zorya Polunochnaya, a Slavic goddess who is a pretty virgin He’s staying in her home overnight while on a road trip with his employer Mr and he’s trying to come to terms with the surreal and magical events that have suddenly invaded his otherwise ordinary life Both Shadow and the audience know that the youngest Zorya sister is a virgin because she goes out of her way to inform Shadow and proceeds to “gift” him with her first kiss Revering virginity is a practice that has significance within almost every religious pantheon (the Virgin Mary It makes perfect sense that American Gods would venture into that territory — and yet the American Gods show is able to address its cultural significance without dipping into fetishization The scene conveys her intention to gift Shadow with the moon in the form of a coin; it conveys the odd and unexpected intimacy of their kiss and yet she isn’t filmed in a way that makes her body the scene’s centerpiece there’s nothing wrong with including a character’s nipples — and yet when the character is not a large part of the story and this dominates their introductory scene half of Zorya Polunochnaya’s characterization is essentially centered on the shape and texture of her nipples All she wants is a kiss in exchange for a coin And while such an interaction is naturally steeped in sexuality the Bryan Fuller and Michael Green show wisely understands that it doesn’t need to zoom in too closely American Gods Season 1 is currently airing Sunday nights on Starz Dynamo forward Vladyslav Supriaga may continue his career at Zorya Luhansk According to the TaToTake telegram channel after Guerrero's transfer to the capital's club the lease of Supryaha may become part of the agreements between Zorya and Dynamo's managers If Dynamo and Zorya reach an agreement in principle in the coming days the 24-year-old striker will join Zorya until the end of the season It will be recalled that Supryaha's agreement with Dynamo is valid until June 30 The Giallorossi made it two wins from two to start their Europa Conference League group stage campaign as Stephan El Shaarawy scored the opener in an eventual 3-0 win El Shaarawy's smart finish came after just seven minutes as Jose Mourinho's side never really struggled on their trip to Ukraine were valiant in their attacking attempts at times but were ultimately blown away in the second half as first Smalling after a quick exchange with Nicolo Zaniolo Mourinho's side have one more game before the next international break: they host Empoli in Serie A on Sunday evening ZORYA LUHANSK (4-3-3): Matsapura; Favorov (Snurnitsyn) El Shaarawy (Mayoral); Shomurodov (Abraham) I confirm that I have read the privacy policy – EU VAT IT09305501000 - all rights reserved logos and artwork are registered or unregistered trademarks of Soccer S.r.l All other trademarks may be the property of their respective holders.