If you believe you don't have anything to offer When I was diagnosed with Cushing’s disease like I was on an island surrounded by raging waves I couldn’t possibly swim through I built a community of understanding people as well as by meeting up with local Cushing’s disease friends I assumed that no one other than people with Cushing’s disease could understand what I was going through when I shared social media posts about my insomnia People reached out to me for advice regarding their own insomnia and told me what had worked for them It changed my entire outlook when I realized there was a larger community to unlock Because of that, I’ve expanded my community into other illnesses, partly because of my work here at Bionews One thing I’ve noticed is that my “island” was a figment of my imagination we’re a web of people who’ve all had similar experiences Since there are often overlapping symptoms with various conditions it’s good to have discussions about how they affect us day to day which isn’t very common in the Cushing’s community But my expanded community taught me to put ice on my neck But it’s not just symptoms that connect us. We all know what MRIs, CT scans, and ultrasounds are. We overlap on mobility aids, pain relief, and even reactions from family and friends I’m in the process of getting a new mobility aid thanks to one of my new chronically ill friends I still think that our various chronic illness communities are still too disconnected and we’d be stronger and have more support if we joined together If you’re having doubts about joining the conversation or different enough to put yourself out there and become part of this larger community by building a community for Cushing’s disease I highlight the stories of people with other illnesses and disabilities and share connections with people who feel lonely when someone with disabilities needs crowdfunding I’ve been able to crowdfund clothing and blanket donations, help people get diagnosed and connect with doctors Those of us with chronic illnesses and disabilities are both a community and a culture There’s so much beauty to be found in widespread understanding and acceptance I commit to expanding our community and connecting with others who share similar experiences You can also follow my journey on TikTok and YouTube Note: Cushing’s Disease News is strictly a news and information website about the disease. It does not provide medical advice, diagnosis, or treatment This content is not intended to be a substitute for professional medical advice Always seek the advice of your physician or other qualified health provider with any questions you may have regarding a medical condition Never disregard professional medical advice or delay in seeking it because of something you have read on this website The opinions expressed in this column are not those of Cushing’s Disease News or its parent company and are intended to spark discussion about issues pertaining to Cushing’s This site is strictly a news and information website about the disease the editor’s role is usurped by a rogue reporter who declares breaking news nonstop flooding the newsroom with bulletins and sending everyone into overdrive The newsroom—your body—responds with metabolic fluctuations Cushing’s Disease can cause lasting deterioration of the body: osteoporosis It’s a common disease and easier to detect in canines University of Georgia researchers are leveraging canine treatments to find new solutions to battle the condition in humans This collaboration between veterinary medicine and human health is just one example of how UGA uses a Precision One Health approach to find and tailor new medical treatments for people and animals Office of Research Office of Research Communications Contact us For Media Subscribe Please select what you would like included for printing: Copy the text below and then paste that into your favorite email application "A life well lived is a precious gift of hope and grace from someone who has made our world a brighter Kathleen Ruth Cushing passed away last week at the age of 93 after a long and courageous battle with illness and always more concerned with giving than receiving Kathleen lived a life defined not by wealth or status but by faith Born in 1931 in a small copper-mining town near Antofagasta Kathleen was raised amid sweeping landscapes and the traditions of the "gauchos" she so fondly remembered But her early years were also marked by loss and upheaval and World War II forced the family's return to the United States under the cover of blackout-aboard a ship navigating dangerous waters patrolled by German submarines Kathleen began working as a housekeeper at age 12 to help support her mother and brothers she carried with her a lifelong commitment to frugality "You have to understand," she would often say "there are people who have nothing." She graduated from Jefferson Township High School in Upland Jack Walz--a handsome athlete who won her heart (and shared his sandwich at lunch) seeking a drier climate to ease Kathleen's health issues Kathleen earned her nursing credentials and began a lifetime of service-working in clinics and hospitals she and Jack moved the family from a downtrodden trailer park and expanded a modest concrete house on Market Street into a home large enough for their growing family and her beloved mother "Grammy," who lived with them until her passing The family did most of the work sometimes at night under flood lamps Kathleen picked up extra shifts and private nursing jobs to send her children to St Kathleen reinvented her life once again--opening a teen hangout called "The Place" in Silver City It was there she met the great love of her life a big-hearted tradesman with an infectious laugh they moved to Houston during Kathleen's cancer treatment they bought an ice cream shop in Cedar Crest and turned it into Burger Boy-a quirky beloved institution that served up not just some of New Mexico's best green chile cheeseburgers Kathleen and Bill poured themselves into the business-cooking and never turning away anyone who couldn't pay The restaurant's walls told the story: governors and neighbors of all kinds proudly displayed in snapshots alongside a mural of "Green Chile Bill." Their partnership was a love story in every sense-one built on mutual respect Kathleen kept his spirit alive through Burger Boy and her service to the East Mountain community who left a successful nursing career to care for her mother and run the restaurant Kathleen made sure Burger Boy remained a warm and welcoming place for everyone Their efforts were recognized by KOB-TV's Pay It Forward they stepped up to feed firefighters and neighbors alike Kathleen and Barbara sold the Burger Boy to grandsons Eric and Ryne Walz-fulfilling Kathleen's wish to keep the restaurant in the family always worried people might think she was slacking off Kathleen loved nothing more than sitting on her porch in Cedar Crest chatting away as birds flitted to the feeder and the fountain gurgled in the background "I have been blessed." And so were all who knew her Kathleen is survived by four of her five children: a trial attorney and author also of Albuquerque who has argued more than 50 cases in the 10th Circuit Court of Appeals a certified legal nurse consultant who cared for Kathleen through her final years MBA and former insurance and financial planning professional She was preceded in death by her beloved daughter a decorated nurse and heart transplant specialist Kathleen spoke of her often and tenderly as "my Martha."  and 4 great-great-grandchildren: • Russell Walz (Tulsa NM) • Christopher Johnstad (Albuquerque • Brandon Walz and Jordan Walz (Albuquerque Kathleen's deep Catholic faith brought her strength in times of hardship She found great comfort in Father John Carney's friendship and spiritual guidance She was cherished by local sheriff's deputies self-taught pianist who played entirely by ear Her favorite songs-Back Home Again in Indiana and You'll Never Walk Alone-will echo in the memories of those who loved her followed by a liturgical service at 9:30 a.m. Enter your phone number above to have directions sent via text This site is protected by reCAPTCHA and the Google Privacy Policy and Terms of Service apply Service map data © OpenStreetMap contributors New York City FC announced today that the Club has parted company with Head Coach Nick Cushing. Cushing’s departure comes after guiding the team to a sixth-place finish and an Audi 2024 MLS Cup Playoffs Eastern Conference Semifinals appearance this season. “Whilst we are incredibly appreciative for all he has done for the Club, at this current time, we believe it’s best to move the team in a new direction as we plan for the 2025 season and beyond. We would like to sincerely thank Nick for his contributions and wish him and his family all the very best in their future endeavors.” Following Cushing’s departure from New York City FC, the Club will begin their search for a new Head Coach ahead of the start of the 2025 MLS season. Cushing was appointed as the Club’s Interim Head Coach in June 2022. In that role, he managed the ‘Boys in Blue’ to a third-place finish in the Eastern Conference and made a run to the Eastern Conference Finals of the Audi 2022 MLS Cup Playoffs. Cushing has been an important part of City Football Group for almost two decades, initially joining the organization in 2006. He progressed through the ranks as a coach in the Manchester City Academy before being appointed as the manager of Manchester City Women’s Team in 2013. Cushing quickly became one of the most decorated coaches in the women’s game, leading the team to an impressive six trophies. “Nick has created many wonderful memories for the Club, and our players and staff have benefited immensely from his guidance and experience. His passion for the game is infectious, and we have nothing but immense gratitude for Nick and the success he brought to the Club,” said New York City FC CEO Brad Sims. “I would like to take this opportunity to thank our fans for their unrivaled support throughout the year. We set ourselves the highest possible standards and targets each season, and we are already fully focused on preparations for the 2025 season.” Fourth-placed City needed to beat rivals Manchester United at Old Trafford to keep alive their hopes of European football next season, but drew 2-2 after leading 2-0 in the first half Cushing, who managed City from 2013-2020, took over on an interim basis until the end of the season following Gareth Taylor's sacking in March and was tasked with steering the club to a top-three finish in the Women's Super League it was about winning trophies and qualifying and we haven't been able to be able to deliver that," he said "We have been a team that has delivered trophies consistently over a seven-year period when I've been involved This team should always be delivering trophies and competing in the Champions League "The league position is far below what I expect Victory over third-placed United would have taken City to within one point of them in the table and set up an exciting finish to the race for European football on the final day of the season City host already-relegated Crystal Palace on 10 May Last year City pushed Chelsea all the way in an enthralling title race - coming second only on goal difference - but will end this season with no silverware and no European football They also went out of the FA Cup at the semi-final stage to United while Chelsea dumped them out of the Champions League quarter-finals and beat them in the League Cup final Their campaign has been blighted by injuries forward Vivianne Miedema and top goalscorer Khadija Shaw all enduring long stints on the sidelines "We're trying to build a puzzle here with a piece missing," added Cushing "We are forever trying to complete it but it has been tough with all the players injured." who has often played out of position this season because of the injury issues "Sometimes when there's obstacles we need to get together and not give up We will be better and we will be a winning team I'm sure." Man Utd comeback against Man City seals Europe spot What's gone wrong for Man City in trophyless season What are Man Utd's next steps after sealing European spot Dwelling outside of the Champions League places is unfamiliar territory for Cushing who led City to their first and only WSL title in 2016 along with four other major trophies "It's painful," he admitted this falls below the standards we set at the start of the season and what we expect but it's football and it's been a challenging moment." Whether the 40-year-old will remain at City beyond the end of this season remains to be seen, but the club have said they would be open to it The former New York City FC boss was brought back to Manchester to try to instil some stability and there were positive signs but ultimately he did not have enough time to turn things around "I will be involved in the review process because this team is engrained in me Unless told they don't want me involved I will be involved," added Cushing when asked about his City future "This team will be forever engrained in me It is a team I have followed throughout my time in America "There has been no conversations from myself either We have been concentrating on the challenges we have had and we have had many things to focus on." Head here to get involved Get the latest WSL news on our dedicated page To load Comments you need to enable JavaScript in your browser View comments | 49Top storiesLive Arsenal in Champions League training latest: Calafiori and Odegaard involved before PSG Stunning stats and 'Ronaldo behaviour' - is Yamal cut out to rival Messi Real seek to sign Alexander-Arnold for Club World Cup A gritty crime saga set in Liverpool starring Sean Bean Stacey Dooley explores Britain’s shoplifting epidemic Who has made Troy's Premier League team of the week Is the risk that Mercedes took with Antonelli paying off Trailblazer Zhao set to take snooker to 'another level' in China 'Calamity keeper' or 'human wall' - which Donnarumma will Arsenal face Zhao beats Williams in historic final - highlights VideoZhao beats Williams in historic final - highlights Alexander-Arnold leaves as modern Liverpool great - but fans will feel hurt 'Scheffler and DeChambeau wins further raise US PGA excitement levels' Match-fixing scandal to Crucible champion - fall and rise of Zhao 'We need to take a look at ourselves' - Arsenal stalling at wrong time Europa League 'papering over cracks' for Man Utd - Rooney VideoEuropa League 'papering over cracks' for Man Utd - Rooney Ask Me Anything the new BBC Sport service designed to serve you Bayern's 'James Bond' - how Kane clinched his first trophy Nine bolters with a shot of making the Lions squad How 'absolutely outstanding' Palmer 'destroyed' Liverpool VideoHow 'absolutely outstanding' Palmer 'destroyed' Liverpool Solskjaer on Besiktas Saints 'punch' favourites Leinster in game for the ages VideoVardy the best £1m ever spent - Shearer Poppy's tears Elton John & Happy Gilmore - McIlroy on Jimmy Fallon show Copyright © 2025 BBC. The BBC is not responsible for the content of external sites. Read about our approach to external linking. A new exhibit at Texas A&M University reveals the full range of Gorey’s creative legacy — marking the 100th anniversary of his birth Rare works from Edward Gorey’s personal collection are featured in “Ubiquitous Edward Gorey,” a retrospective on view at Texas A&M’s Cushing Memorial Library through September The Edward Gorey of “Mystery!” or “Dracula” or even the “Gashlycrumb Tinies” may be familiar artist and designer Edward Gorey (1925-2000) created work that has permeated both our commercial and cultural worlds “Ubiquitous Edward Gorey,” opens April 10 at Texas A&M University’s Cushing Memorial Library & Archives and runs through Sept The exhibition features more than 600 items including books from Cushing’s extensive Gorey holdings and biographic materials personal items and examples of Gorey’s creative output from the Miller Family Edward Gorey Collection On view will be largely unknown drawings and paintings from Gorey’s youth first editions of his early primary books and other rare materials.  “The exhibition honors the centenary of Gorey’s birth and also provides a biographical context to explore his wide range of work,” said Beth Kilmarx assistant university librarian for special collections and co-curator of the exhibit.   While his best-known creations include the illustrations for the animated introduction to PBS’ long-running “Mystery!” series and designs for the 1977 Broadway revival of “Dracula,” those are just two achievements Gorey authored and illustrated more than 100 of his own books and fully illustrated chose typography and designed hundreds of books by authors including T.S who wrote “The House with a Clock in its Walls.” But all these are still just a part of the enigmatic artist’s vast creative pursuits Gorey designed costumes and sets for the ballet and the opera; illustrated magazine stories and articles; and created advertising artwork throughout his long career Gorey appreciated the company of friends and family,” according to collector and co-curator Patrice Miller fun-loving person who left behind a vast trove of work to study and enjoy.”  Texas A&M affords a unique opportunity: to view the broadest range of Gorey’s work ever shown in one location outside of the Edward Gorey House Museum.  “Ubiquitous Edward Gorey” has been made possible through the cooperation of the Edward Gorey Charitable Trust.   Artists from around the world to attend event hosted by the College of Performance The degree will complement Visualization programs in the College of Performance The award recognizes Texas A&M University for bringing state-of-the-art technology to students in Bryan-College Station and Fort Worth watch videos and discover how Texas A&M University is shaping an innovative more secure future for the citizens of Texas and the world Cushing returns to women's soccer and to the exact job he held before becoming Ronny Deila's NYCFC assistant in 2020 at least if you're former New York City FC Head Coach Nick Cushing Cushing is returning to women's soccer and returning to the job he held before he became Ronny Deila's NYCFC assistant coach in 2020 Manchester City Women's Football Club today announced they'd fired Gareth Taylor the longtime manager of the Women's Super League team who will serve as interim manager through the end of the 2024-2025 season It's an interesting comeback for Cushing, as he was relieved of his duties as NYCFC Head Coach on November 26 three days after his team's season ended at the hands of the rival Red Bulls in the MLS Eastern Conference Semifinals Cushing ended his two-and-change seasons as Head Coach of New York City with a mixed record of 37 W-31 D-39 L in all competitions In the time since his firing, he's been busy on media duty. He appeared on talkSPORT in his native England forced to sit through a red-faced rant from Simon Jordan about MLS and its place in the sporting and world soccer pecking order Cushing also gave an exclusive interview to The Daily Mail in which he said of his NYCFC firing "I was a little bit disappointed that it was now after this season – just purely based on what we achieved this year – but it probably is a good time and the right time for me to take on a new challenge move forward and test myself at the highest level." The first post-NYCFC test for Cushing will be something of a make-up exam or maybe just a second test on the same material that he mastered once but hasn't looked at in five years That's how long it's been since Cushing last coached the Manchester City Women as Gareth Taylor held the role since May 2020 when he replaced a bound-for-MLS Cushing Cushing had a strong first spell with the City women leading the team for the first six incredibly successful seasons of its existence Cushing won trophies aplenty with the Man City women which included capturing both the WSL title and the FA WSL Manager of the Year award in 2016 The Man City website did a nice feature on Cushing's first tenure with the women's team right before he came to New York City which is worth checking out for a reminder of just how successful he was during his first stint in charge and Arsenal eventually settled on Renée Slegers as their manager it's a return to the warm embrace of City Football Group an organization he's worked with since he started coaching in the Manchester City youth academy in 2007 His return is happening because the success the women's squad enjoyed under Cushing has not lasted under Gareth Taylor The City Women currently sit in Fourth Place in the WSL with six league games left to play this season outside the places required to qualify for the UEFA Women's Champions League In the statement announcing Taylor's firing the objective for Cushing was laid out clearly by Charlotte O’Neill "We believe that a change of management will breathe fresh life into our bid to ensure qualification for the 2025/26 UEFA Women’s Champions League." Cushing is tasked with guiding Man City up the table but he's also got big cup matches to handle with the Man City Women will be in a cup final taking charge just in time for Manchester City to face Chelsea FC in the Women's League Cup Final this weekend What better way to kick off The Second Cushing Era than by lifting a trophy He did it during his last time serving as an interim coach helping his NYCFC team win the 2022 Campeones Cup – so now he'll look to duplicate his interim success while returning to where his head coaching journey started in earnest in 2014 (Update 3/11/25: According to a Manchester Evening News report Cushing "has no interest in taking the job full time past the summer as he looks for a permanent job in the men's game.") The loaned-out New York City FC midfielder needed surgery to correct "a complex right ankle injury involving a fractured fibula and torn medial collateral ligament." The coach who won MLS Cup 2021 with New York City FC and then left midseason in 2022 has made the move back to MLS and the Eastern Conference The longtime New York City FC defender publicly clashed with Luc Holtz head coach of the Luxembourg national team and appears to be done receiving international call-ups The former Golden Boot winner with New York City FC will be with the Argentina national team for two FIFA World Cup qualifiers in September Open Cup Digest #15: New York City FC face Pittsburgh Riverhounds on the road New York Red Bulls go west to play Colorado Springs Switchbacks in the Round of 32 The two San Diego FC attackers earned spots on our latest MLS Player of the Matchday ballot following the expansion team's huge 5-0 home win A lethal low strike from Julián Fernández and a strong showing from a shorthanded defense propelled New York City FC to a 1-0 win over FC Cincinnati at Citi Field The stalemate was almost broken by 14-year-old McKenna Whitham of Gotham FC but the game finished scoreless as Chicago Stars FC go home with a point Following the departure of Gareth Taylor earlier this week Nick Cushing has stepped into the dugout as Manchester City Women’s interim manager for the remainder of the season With just days to prepare, the Englishman’s first game in charge will be the League Cup final against Chelsea on Saturday — the first of four consecutive games against the reigning Women’s Super League champions over 12 days The 40-year-old will be at the helm for several season-defining matches: City are also into the FA Cup semi-finals and the last eight of the Women’s Champions League facing Chelsea over two legs in the latter Cushing left his role as head coach at MLS club New York City in November where the best of his three seasons was a third-place finish in the Eastern Conference in 2022 He returns to NYCFC’s sister club Manchester City where he cut his teeth first as an academy coach and then as manager of the women’s team from 2012 to 2020 “Coaching is about people and developing people It’s about supporting and challenging people,” Cushing says It’s a little more complex coming in mid-season I took the interim head coach role (midway through that 2022 season stepping up from an assistant position) and we got to a final I’m confident in my ability as a coach and when I look around the dressing room He enjoyed plenty of success in that first stint with City’s women guiding them to their only Women’s Super League (WSL) title to date But what should the fans expect from Cushing now and can he successfully steer the team to glory in the three cup competitions they are still in contention for this season Taylor’s exit was described as a “shock” by City defender Alex Greenwood though he seems to have paid the price for an inconsistent season City are fourth in the WSL table, one point off third-placed Arsenal, who currently occupy its final Champions League qualification spot but have played a game more than the north Londoners Leaders Chelsea are 12 points ahead of City who they beat to the title last season only on goal difference with the latter’s 2024-25 campaign having been marred by injuries to key players — winger Lauren Hemp summer signing Vivianne Miedema and defender Greenwood Recurring individual and team errors have also been an issue signed a new three-year contract extension last March despite a relatively modest trophy haul with the FA Cup in 2020 and the League Cup in 2022 his only major silverware during a four-and-a-half-year tenure Twice City finished second in the league under him but he was unable to emulate predecessor Cushing by winning the title Cushing’s history and emotional attachment to the club played a significant factor in his decision to rejoin them after almost five years with New York City but his long-term ambition remains to test himself at the highest levels of men’s football “One piece of advice I give coaches all the time is you never know what’s around the corner,” Cushing says reflecting on how each of his coaching stops have changed his view of what’s possible Cushing’s original spell as manager of City Women was the team’s most successful in recent seasons his faith in young players and for forging a strong While his first two seasons were a slow burn — City finished fifth and second in an eight-team WSL — victory in the 2014 League Cup final against Arsenal was a sign of what was to come City claimed a domestic double with the WSL and League Cup the title arriving via an unbeaten campaign in which they conceded four goals in total City added the FA Cup with a victory against Birmingham City and then won that competition again in 2018-19 Cushing’s City twice reached the Champions League semi-finals losing to eight-time winners Lyon on both occasions by aggregate scores of 3-2 and 1-0 the performances were significant given the French team’s European pedigree “It’s a good challenge because we’re playing against the best in the league playing in an amazing stadium with an opportunity to win,” Cushing said of the meeting with Chelsea at men’s Championship side Derby County’s 33,000-capacity Pride Park “I’ve always said in my career that this cup – which was my first trophy in 2014 – since then To have the opportunity to win another one for this group and organisation is enough motivation.” The obvious hope at City is that Cushing will be able to build a rapport with the players and oversee more trophy success in the latter stages of this season the WSL landscape has changed significantly in the five years his first spell in charge ended not least with five-time champions Chelsea’s hegemony of the league because I have a real emotional attachment to Manchester City women,” Cushing said my daughter was born on the day of the League Cup final in 2016 We were in this stadium here (that final was played at City’s academy stadium) and went to extra time and she was literally born five minutes after I got to the hospital after we lifted the trophy I don’t overlook things and overcomplicate things We’ve got to embrace that we’re a good team We’ve got to understand that although change sometimes brings instability confusion and a little bit of apprehension we’ve got to fall back on the fact that we are in all four competitions that we are in a Champions League quarter-final we are in a League Cup final and an FA Cup semi-final The desire and the hunger to get into the Champions League next year has to be the driving factor.” Another factor is Cushing’s goal of returning to men’s football following this interim period back in the women’s game The sentiment has not gone down well with some sections of the fanbase who viewed his original decision to leave the top job at City Women midway through their 2019-20 season to become an assistant in MLS as uninspiring Turning what could be viewed as a managerial disruption into a catalyst for the remainder of a season will be put to the test in Derby tomorrow and I think you have to deal with the people that you have in front of you and you have to make sure that you support and challenge and improve whoever you have in front of you.” Having risen through the City Football Group (CFG) ranks, Cushing prefers his sides to have high levels of possession, which he considers valuable in both attack and defence. However, speaking to The Coaches’ Voice in October Cushing emphasised his preference for his teams to “press high and counter-press aggressively” he orchestrated a possession-based scheme while looking to generate direct attacks and force high turnovers New York allowed the fifth-shortest average possession time to its opponents (22.8 seconds) in the 29-team MLS only four teams saw a lower rate of their total possessions end in a shot than their 35 per cent rate suggesting there were chances left to be made and a lot of touches without productive intentionality New York were among the league’s lowest in set-piece goals per 100 attempts and set-piece goal share last season and also performed around the league average in terms of dropping points from winning positions while lingering just below average in points regained from losing ones He often cites his time with Manchester City as being essential to guiding his ideology It feels as though he’s finally doing the work to differentiate himself as a manager rather than a coaching cog in the CFG machine he was keen to play something that was more efficient than City men’s first-team manager Pep Guardiola’s ideology with a more direct approach (with the ball and without) than New York FC had played in previous seasons Cushing left that first stint with City for New York taking the assistant-manager role before becoming interim boss in June 2022 following Ronnie Deila’s move to Belgian club Standard Liege After leading New York to the final four of the 2022 MLS title play-offs he was named permanent coach in the November following a sixth-place finish in the 15-team Eastern Conference last season and a last-eight exit from the play-offs Cushing predominantly lined his team up in a 4-2-3-1 with his wingers playing more narrowly in the channels while his full-backs provided width closer to the touchlines his team were a chance-creation juggernaut racking up 2.7 xG in his last win as New York manager a 3-1 upset of FC Cincinnati during those play-offs His team’s best looks often involved a well-positioned centre-forward finishing off team sequences or his full-backs crossing towards the edge of the box with a late runner ready to reward that service with a well-taken attempt on goal  (Top photo: Andrew Katsampes/ISI Photos/Getty Images) The duo missed the first leg of the quarterfinal, which City won 2-0, as well as the league clash against Chelsea on Sunday after picking up muscular injuries in the Subway Cup final Obviously you can see after the game on Sunday But the medical team and the performance team are doing an incredible job working through the team," Cushing told a news conference on Wednesday "So the likes of Aoba and Bunny [Shaw] won't make the game but it wasn't ideal to take off some key players But we've worked really hard this week to make sure that the squad will be competitive for the game." City have contended well in their absence in this run of four games in 12 days against Chelsea. They condemned the west London side to their first loss in all competitions this season in the first leg of their Champions League quarterfinal, and were an injury-time Erin Cuthbert winner away from taking points off them in the league In Sunday's clash, Yui Hasegawa and captain Laia Aleixandri went off late with injuries They both returned to training on Wednesday but Cushing didn't confirm if Hasegawa who had to leave the Etihad Stadium on crutches will be back for the quarterfinal second leg Cushing believes his side's confidence in themselves remains unaffacted "And it's not been ideal over the last two weeks to lose Bunny Shaw and Aoba Fujino and it wasn't ideal on Sunday I thought we had an incredible threat in the game and I know we will tomorrow night I believe we can score in the game and that gives us an incredible chance of progressing So although we know that we're going to play a really I believe we've got a really special group here that actually believes and just wants to go play an attacking team." The loss in the first leg was Sonia Bompastor's first taste of defeat since taking over at Chelsea at the start of the season But she believes her side have the quality to overturn the 2-0 deficit at Stamford Bridge but we are ready to embrace the challenge," she told a news conference on Wednesday "I think this is what this squad and this club is about We have never been in that situation in this season before but we are ready and I just want my players at the end of the game to not have any regrets and this is what we want to go for." Please enable JS and disable any ad blocker OneFootball's home page Search Settings Sign In Sign InJoinCushing expects positive reaction to a season of near misses | OneFootballManchester City F.C Nick Cushing admits City have fallen short of our usual standards across 2024/25 but is confident there will be a response to that disappointment The Blues were held to a 2-2 draw against Manchester United at Old Trafford meaning we’re forced to settle for a fourth-placed WSL finish in 2024/25 City had raced into a two-goal lead thanks to strikes from Laia Aleixandri and Rebecca Knaak but the hosts responded to get the point they needed to secure the third and final Champions League spot It was a bitter pill to swallow for Cushing and his team who’d also been edged out in the FA Cup semi-finals by United and lost to Chelsea in the League Cup final earlier this season But our Interim Head Coach insists those margins are incredibly tight and that the Blues aren’t far away from competing for top honours again in the near future WATCH: We’ll keep giving everything for the fans, says Aleixandri we can do it tactically or with quality but also mentality and character “We’ve not been able to deliver that over the last six to eight games but the reality is the margin is really small “I was disappointed we fell the wrong side of the result in League Cup final I was disappointed we lost the Etihad game against Chelsea “I could sit here and say we’re not good enough or it’s this or that “You have to react to these moments and build a belief that no matter how the season looks The boss also confirmed that Leila Ouahabi’s injury which forced her off inside ten minutes of the contest was an ankle issue Ouahabi was involved in a heavy collision with United’s Celine Bizet early on at Old Trafford and Cushing admitted he’d have to wait for a more detailed assessment from the Club’s medical team before understanding the extent of the injury She couldn't carry on and will be with the medical team,” he added The game was very much the story of our season then ten players is the rollercoaster we’ve had Related NewsNico Williams fires Man Utd warning ahead of Europa League decider Premier League broadcasting change set to affect Manchester City and Etihad Stadium next season War of Words – What Kevin De Bruyne and Pep Guardiola have said in Manchester City contract dispute Man City injury update: Latest on Rodi, John Stones and More Crystal Palace v Man City FA Cup Final Ticket Information 24/25 4️⃣ things to look out for in the Champions League this week The Champions League returns with a bang this week as the finalists will be determined following some tense first leg action.Here is what to look out for...⚔️ Match of the... Tottenham get Europa League boost as Premier League confirm new Aston Villa fixture date 📽 Ten years ago: was this Messi’s most iconic goal? This article was translated into English by Artificial Intelligence. You can read the original version in 🇫🇷 here.And time stood still...There are goals that you forget, and then there are... '#' : location.hash;window._cf_chl_opt.cOgUQuery = location.search === '' && location.href.slice(0 location.href.length - window._cf_chl_opt.cOgUHash.length).indexOf('?') !== -1 '?' : location.search;if (window.history && window.history.replaceState) {var ogU = location.pathname + window._cf_chl_opt.cOgUQuery + window._cf_chl_opt.cOgUHash;history.replaceState(null "\/news\/womens\/man-united-v-man-city-wsl-nick-cushing-injury-update-63881787?__cf_chl_rt_tk=ErBhiwnLGJL10QxhnxF40rXBnO1RN6YbO0Fg6NvF.Co-1746530772-1.0.1.1-BWQbuQZEMzHdQ0wZ7YDNQIe8sz11dG8Dk3fu91qX8U8" + window._cf_chl_opt.cOgUHash);cpo.onload = function() {history.replaceState(null ogU);}}document.getElementsByTagName('head')[0].appendChild(cpo);}()); Jason was employed as a supervisor with NOVO Health Services in Ravenna and more recently was employed with Cleveland Steel Corporation was very outgoing and was always trying to make people laugh Louis Cardinals and will be deeply missed by all who knew and loved him He was preceded in death by his grandfather Roland Meiller He leaves his mother Lee Ann Cushing; fiancée Crystal Caskey; sons Benny and Ethan Levandowski; brother Marty (Tina) Reynolds; sister Chrissy Lang; grandmother Barbara Meiller and many nieces and nephews Jason will be cremated and a Celebration of Life will be held on Sunday memorial donations may be made to the Autism Society of Greater Akron Services in the care of Bissler and Sons Funeral Home and Crematory Metrics details Cushing’s syndrome is caused by an elevation of endogenous or pharmacologically administered glucocorticoids encoded by the gene diazepam binding inhibitor Dbi) stimulates food intake and lipo-anabolic reactions Here we found that plasma ACBP/DBI concentrations were elevated in patients and mice with Cushing’s syndrome We used several methods for ACBP/DBI inhibition in mice (2) injection of a neutralizing monoclonal antibody (3) body-wide or hepatocyte-specific knockout of the Dbi gene (4) mutation of the ACBP/DBI receptor Gabrg2 and (5) injections of triiodothyronine or (6) the thyroid hormone receptor-β agonist resmetirom to block Dbi transcription These six approaches abolished manifestations of Cushing’s syndrome such as increased food intake it appears that ACBP/DBI constitutes an actionable target that is causally involved in the development of Cushing’s syndrome Intrigued by the possibility that ACBP/DBI is (one of) the phylogenetically most ancient peptide hormone(s)29 we became interested in its (patho)physiological roles we used an in vitro screen to identify other neuroendocrine factors that regulate ACBP/DBI We found that glucocorticoid receptor activation stimulates the release of ACBP/DBI from cultured cells and increases plasma ACBP/DBI concentrations in mice thyroid hormone transcriptionally downregulates ACBP/DBI In a mouse model of iatrogenic Cushing’s syndrome antibody-mediated neutralization of ACBP/DBI or transcriptional downregulation of ACBI/DBI by thyroid hormone all prevent the metabolic consequences of chronic glucocorticoid administration Our observations suggest that important facets of Cushing’s syndrome are mediated by a surge in extracellular ACBP/DBI H4 cells expressing GFP–LC3 were treated with agonists and antagonists of neurotransmitter and hormone receptors (5 µM) Scaled ACBP fluorescence intensity and viability are depicted (a) together with representative images (b) Torin-1 (0.3 µM) and DMSO (control) were used as controls The plots show ACBP fluorescence (c) and GFP–LC3 puncta (d) (16 h; 0.01 HCS and T3 in dialysed foetal bovine serum (AU and ACBP mRNA levels were measured by qRT–PCR (RU Female C57BL/6J (8-week-old) mice (n = 5 per group) were treated with HCS (10 Plasma ACBP was measured by ELISA (g) and hepatic Acbp mRNA was assessed by qRT–PCR (h) LC3 conversion and p62 degradation were measured in liver tissue (representative blots in (i and quantifications of the ratios of the indicated proteins in j–l) (n = 3 per group)) Mice were fasted or received HCS (100 mg kg−1; i.p.) for 24 h combined with SAFit2 (40 mg kg−1; i.p.) or vehicle and plasma ACBP was measured by ELISA (n = 15 PBMCs were treated with HCS (0.5 μM) for 16–18 h Plasma ACBP levels were measured in dermatology patients receiving (n = 53) or not (n = 39) glucocorticoid treatment (o) The Wilcoxon test was used and P values were calculated according to a multivariate model including age and BMI Plasma ACBP was measured in ACTH-dependent patients with Cushing’s syndrome with hypercortisolaemia (n = 11) or in remission (n = 13); an unpaired t-test was used for analysis Plasma ACBP was plotted against BMI in the hypercortisolaemia group (n = 11) (r) and against daily HCS dose (in the case of corticotroph deficiency) in the remission group (n = 10) (s) One-way ANOVA with Dunnet correction (c–h and j–m) unpaired t-test (two tailed) (q and n) and Pearson correlation (r and s) were used for statistical analysis (P values are indicated) Source data our data indicate that corticosteroids reduce the cellular content of ACBP/DBI through its autophagy-associated release into the extracellular space while T3 downregulates ACBP/DBI expression at the mRNA level The experimental schedule of CORT administration in auto-immunized C57BL/6J female mice against ACBP/DBI Female C57BL/6J mice were treated with KLH–ACBP for autoimmunization or KLH alone both administered intraperitoneally for 4 weeks (n = 10 mice per group) mice received CORT (100 μg ml−1) or vehicle control (control) in drinking water orally (p.o.) for an additional 5 weeks (n = 10 mice per group) Plasma levels of ACBP were measured by ELISA Hepatic ACBP and NR3C1 were analysed by immunoblot Representative blots (c) and quantifications of the indicated protein ratios (d and e) are shown (n = 3 per group) The average food intake (n = 4 cages per group) (f) and body weight (n = 10 mice per group) (g) was monitored in the indicated groups The P value represents the comparison of areas under the curve Representative frontal and longitudinal photographs of one mouse of each group are shown (h) and facial angles were measured (i) at the end of week 5 (n = 3 mice per group) The lines indicate the measurement of the facial angle in mice The heatmap shows the standardized deviations (z scores) of tissue weights relative to body weight and the quantification of various biochemical parameters across the treatment groups (n = 10 per group) Statistical comparisons were performed by pairwise (two-tailed) Wilcoxon test with false discovery rate correction for multiple comparisons (P values are indicated) GTT (n = 10 mice per group) (k) and ITT (n = 10 mice per group) (m) were monitored in the indicated groups The P value represents the comparison of areas under the curve (GTT (l) and ITT (n)) The curves in f and g were longitudinally analysed with type II ANOVA and pairwise comparisons l and n were analysed using one-way ANOVA with Tukey correction Source data autoantibodies neutralizing ACBP/DBI blunt major phenotypic and metabolic manifestations of Cushing’s syndrome including an increase in appetite Source data Source data it appears that genetic inhibition of the ACBP/DBI system can prevent weight gain and other metabolic manifestations of Cushing’s syndrome induced by CORT strongly suggesting that the results obtained with autoantibodies are due to on-target effects Source data Metabolic parameters in mice subjected to vehicle CORT or a combination of CORT and ACBP/DBI mAb (αACBP sum of the ambulatory and fine movements (XT + YT yielding counts (Ctns) and speed (h) were measured in metabolic cages Daily CORT exposure was adjusted to 500 µg The data are presented as standard box plots (the centre line represents the median box limits represent upper and lower quartiles and whiskers represent minimum and maximum values) of metabolic parameters (n = 2 Metabolic parameters are means evaluated over each 12 h period (night or day) and further averaged over every night and day period for each animal and for each week cumulative values over 12 h periods are used instead of means The P values were calculated by Fisher’s meta-analysis method Source data Source data This finding suggests that ACBP/DBI neutralization is reducing appetite only when ACBP/DBI is elevated in the circulation a mAb neutralizing ACBP/DBI phenocopies the effects of autoantibody-mediated or genetic inhibition of ACBP/DBI thus preventing the metabolic manifestations of Cushing’s syndrome Source data T3 as well as the selective THR-β agonist RES decreased Acbp/Dbi expression and reversed metabolic signs of Cushing’s syndrome mice treated with glucocorticoids showed an increase in circulating ACBP/DBI protein levels and patients under corticotherapy or with endogenous Cushing’s syndrome also exhibited elevated ACBP/DBI levels T3 reduced ACBP/DBI mRNA without autophagy and without increasing extracellular ACBP/DBI in cell cultures or in the plasma of mice T3 administration could block the corticotherapy-induced surge in ACBP/DBI plasma concentrations are completely different nosological entities these findings suggest that ACBP is necessary but not sufficient for the induction of Cushing’s syndrome it is not clear whether the anti-Cushing’s effects of T3 and RES are entirely due to ACBP/DBI downregulation or whether they involve additional effects mediated by THR-β in a heterogeneous population of individuals with overweight or obesity elevated plasma ACBP/DBI concentrations might constitute a biomarker that predicts sensitivity to ACBP/DBI inhibition this conjecture requires further scrutiny in suitable pre-clinical models and future clinical trials pair-feeding experiments in which caloric intake (and body weight) are kept constant indicate that glucocorticoids can induce signs of metabolic syndrome (such as dyslipidaemia and insulin resistance) in the absence of weight gain and that ACBP/DBI neutralization reverses such effects independently from its effects on food intake ACBP/DBI might have been placed under the control of these hormones during (pre-)vertebrate evolution While glucocorticoids increase circulating ACBP/DBI levels inhibition of ACBP/DBI does not affect the level of circulating endogenous glucocorticoids in unstressed mice indicating a clearly hierarchical relationship without feedback loops Future work must understand through which (direct or indirect) mechanisms ACBP/DBI controls other neuroendocrine factors including those involved in metabolic regulation (such as insulin and leptin) and when this control has been established during vertebrate evolution it appears that a glucocorticoid-induced increase in extracellular (plasma) ACBP/DBI levels is mechanistically involved in the phenotypic manifestation of several signs of Cushing’s syndrome including increased appetite These results obtained in a murine model of Cushing’s syndrome require future clinical validation All animal experimentation procedures applied to institutional rules and guidelines and were approved by the Gustave Roussy ethics committee (project numbers 2023_011_40501 ATCC) or stably expressing GFP–LC3 were cultured in Dulbecco’s modified Eagle medium (cat supplemented with 10% (v/v) foetal bovine serum (cat 100 U ml−1 penicillin and 100 μg ml−1 streptomycin (cat Thermo Fisher Scientific) at 37 °C in a humidified atmosphere with 5% CO2 Human hepatocellular carcinoma HepG2 cells wild type (cat ATCC) or stably expressing GFP–LC3 were cultured in Eagle’s Minimum Essential Medium (cat patients with ACTH-dependent Cushing’s syndrome (21 with ACTH-dependent pituitary Cushing’s syndrome and 3 with ectopic ACTH secretion due to a bronchial carcinoid) (median age 56.5 years range 22–73 years) were prospectively recruited from 2014 to 2017 at Marseille University Hospital The ‘active’ group consisted of 11 newly diagnosed patients The ‘remission’ group consisted of 13 patients in remission for at least 2 years and CORT concentration was adjusted to maintain an average daily CORT exposure of approximately 500 μg per mouse The control group received 0.66% vehicle in drinking water C57BL/6 Gabrg2tm1Wul/J Gabra flox mice came from the Jackson Laboratory All mice used for experimentation were female C57BL/6J Acbpfl/fl with loxP sites flanking Acbp exon 2 was generated by Ozgene at a dosage of 75 mg kg−1 body weight per mouse per day for five consecutive days Tamoxifen was diluted in 90% corn oil and 10% EtOH (v/v) at a concentration of 20 mg ml−1 and was agitated overnight at 37 °C mice underwent a washout period of at least 1 week before the commencement of treatments This knockout strategy was applied in combination with the expression of either a ubiquitous or hepatocyte-specific CRE recombinase (genotypes: UBC-cre-ERT2 or TTR-creTam mice were kept for at least a week before starting the treatment For the neutralization of DBI by anti-ACBP mAb experiments were conducted with 8-week-old female C57BL/6J mice Passive immunization was performed by semiweekly i.p injections of 5 mg kg−1 body weight anti-ACBP mAb (clone 7G4a MedChemExpress) was prepared in 10% dimethyl sulfoxide (DMSO) Merck) was 3.3 μg ml−1and was adjusted to maintain an average daily exposure of approximately 10 μg per mouse Lundbeck) was administered at a concentration of 0.15 mg ml−1 (diluted in water) body weight and food intake were measured semiweekly Experiments were conducted with 8-week-old female C57BL/6J mice Merck) was diluted in 10% DMSO and 90% corn oil (v/v) and administered i.p Merck) was diluted in drinking water containing 1% carboxymethyl cellulose (cat Merck) (v/v) and administered by oral gavage (120 mg kg−1 body weight) Mifepristone was administered from day 7 to day 14 HY102080 MedChemExpress) was solubilized in vehicle (4% EtOH and 5% PEG400 (v/v) in 0.9% saline (Veh-1)) to a final EtOH concentration of 0.66% (Veh-2) Fasting was performed by removing food for 24 h and CORT (500 µg per mouse) was given by oral gavage Daily CORT exposure was adjusted to approximately 500 µg per mouse C57BL/6J female mice were housed under standard conditions with a 12 h light–dark cycle and ad libitum access to water Mice were randomly assigned to four treatment groups: vehicle anti-ACBP/DBI antibody and CORT plus anti-ACBP/DBI antibody baseline body weights and food consumption were measured over a 3-day period to establish average intake The vehicle-treated group served as the control for food intake The average daily food intake of the vehicle-treated group was calculated and used to determine the amount of food provided to the other groups anti-ACBP/DBI antibody and CORT plus anti-ACBP/DBI antibody groups were given the same amount of food consumed by the control group on the previous day Food intake and body weights were recorded daily to ensure precise matching of food quantities across groups Adjustments in food allocation were made on the basis of the control groups’ consumption Indirect calorimetry was conducted using automated metabolic cages (Labmaster in which mice were individually housed for consecutive 7-day periods over 4 weeks and mice were provided unrestricted access to food and water Food and water consumption was continuously monitored Measurements included oxygen (O2) consumption the respiratory exchange rate (RER = VCO2/VO2) and heat production including ambulatory and fine movements as well as speed was tracked using an infrared light beam-based system O2 and CO2 volumes were assessed at the inlet ports of each cage and periodically calibrated against a reference empty cage All measurements were conducted at 4-min intervals throughout the experiment ensuring continuous recording during both light and dark phases mice were placed in a vertical glass cylinder filled with water and behaviour was observed for 5 min Distinct phases of active swimming and immobility were documented The time spent immobile during the test was considered an indicator of behavioural despair less time spent immobile suggested potential antidepressant effects Mice were anaesthetized and placed on a scaled matrix with a protractor Bird’s-eye-view images were taken and then analysed to measure the angle between the edges of the two cheeks considering the tip of the nose as the vertex cells were washed twice with with PBS and collected in radioimmunoprecipitation assay buffer (cat subjected to ultrasonication for three pulses of 10 s on ice and then centrifuged for 10 min at 13,000g Analogously 30 μg liver tissues and 60 μg adipose tissue were collected in Precellys lysing kits (cat Bertin Technologies) with radioimmunoprecipitation assay buffer and protease/phosphatase inhibitors (cat followed by two cycles of homogenization for 20 s at 5,500 rpm using a Precellys homogenizer (Bertin Technologies) samples were centrifuged at 13,000g for 30 min and supernatants were collected The Bio-Rad BCA assay (DC Protein Assay Kit II Bio-Rad) was used for protein concentration assessment Thermo Fisher Scientific) were added before denaturation (100 °C for 15 min) After SDS–PAGE and electrotransfer to polyvinylidene fluoride membranes unspecific binding sites were blocked for 1–2 h with 5% BSA at RT followed by overnight incubation at 4 °C with primary anti-human ACBP/DBI antibody (1:500; cat anti-mouse ACBP/DBI antibody (1:1,000; cat anti-glucocorticoid receptor (D6H2L) XP antibody (1:1,000; cat Cell Signaling Technology) or horseradish peroxidase (HRP)-coupled anti-β-actin antibody (1:2,000; cat Membranes were washed and processed by incubation with HRP-coupled secondary antibody (1:2,000; cat Imaging and quantification were conducted by using an ImageQuant LAS4000 and ImageJ software Cells were treated and culture supernatants were collected centrifuged at 500g for 5 min and stored at −80 °C until analysis mouse plasma was collected with lithium heparin separator (cat and ACBP/DBI levels were measured by ELISA MyBioSource) and murine anti-ACBP/DBI capture antibodies (cat Abcam) diluted 1 µg ml−1 in PBS were used for coating high-binding 96-well plates (Corning) with 100 μl per well overnight at 4 °C plates were washed twice with washing solution (0.05% Tween 20 (v/v) in PBS) and unspecific binding was blocked with 100 μl sterile blocking buffer (1% BSA and 0.05% Tween 20 (v/v) in PBS) for 2 h at RT 100 μl per well of either sample or standard (human serum at 1:50–1:75 murine plasma at 1:20 and cell culture supernatant at 1:4 dilution with the flexibility to adjust as dictated by experimental requirements) was incubated for 2 h at RT and subsequently rinsed 3× with washing buffer Then 100 μl per well human anti-ACBP/DBI (LS-C299614 Lifespan Biosciences) and murine anti-ACBP/DBI detection antibodies (cat MyBioSource) diluted 1 µg ml−1 in PBS were added for 1 h at RT followed by 3× rinsing with washing buffer plates were incubated 30 min at RT with 100 μl of HRP-coupled avidin diluted in PBS (1/5,000 for human and 1/1,000 for murine samples) Subsequently plates were rinsed 4× with washing buffer 100 μl of 1-Step Ultra TMB-ELISA substrate solution (cat Thermo Fisher Scientific) was added and incubated 10–30 min at RT in the dark 50 μl of stop solution (2 N H2SO4) was added and absorbance was measured at 450 nm using a FLUOstar OPTIMA microplate reader Small interfering RNAs (siRNAs) were purchased from Horizon Discovery (ON-TARGETplus GE Healthcare Dharmacon) and used following the manufacturer’s protocol and employing the following siRNA oligos: ELISA kits were used for detecting biochemical indices Plasma CORT samples were collected during the first hour of light at 8:00 and the collection process was performed under general anaesthesia using isoflurane inhalation All procedures strictly followed the manufacturer’s protocol plasma was collected in an EDTA anti-coagulant collecting tube with additional dipeptidyl peptidase IV inhibitor aprotinin and serine protease inhibitor (Merck) then centrifuged for 10 min at 1,000g within 30 min of collection Mouse hormones were detected by using the mouse metabolic hormone magnetic bead panel (cat Merck) by Luminex following the manufacturer’s protocol Mice were trained for tail pinch adaptation 1 week in advance Animals were fasted for 6 h to perform a GTT Blood for glycaemia measurement was collected from tail vein incisions 0 90 and 120 min after the injection of d-glucose (2 g kg−1 body weight animals were fasted 2–4 h before injection of insulin (NovoRapid and glucose was measured using a precision glucometer (Accu-Chek Performa) and hypoglycaemic shock was avoided by administration of 20% glucose solution The HOMA-IR is calculated using the following formula: fasting plasma glucose (measured after 16 h of fasting in millimolar) multiplied by fasting plasma insulin (measured after 16 h of fasting Fresh tissue was collected and fixed in 4% paraformaldehyde (or 10% formalin) for a maximum of 24 h at RT then processed by serial paraffin embedment Ten-micrometre-thick slices were obtained with a microtome Standard haematoxylin–eosin staining was performed and slides were scanned by a semi-automatic slide scanner (Nanozoomer 2.0 HT Hamamatsu) equipped with 20× and 40× objectives The images were analysed and quantified using Fiji software About 25–30 mg of tissue was collected in lysis buffer (Buffer RLT Plus) The tissue was homogenized in two cycles using a Precellys homogenizer (Bertin Technologies) for 20 s at 5,500 rpm The lysate was centrifuged and subjected to further purification procedures as described by the manufacturer About 1 μg total RNA was reversed transcribed using the Maxima First Strand cDNA Synthesis Kit (cat Quantitative real-time PCR (qRT–PCR) was conducted by using PowerUp SYBR Green Master Mix (cat Thermo Fisher Scientific) with a StepOnePlus Real-Time PCR System (Applied Biosystems The 2−ΔΔCT method was used for the analysis of real-time PCR data with the following primers (Eurofins Scientific): ACBP/DBI forward primer: CAGAGGAGGTTAGGCACCTTA; ACBP/DBI reverse primer: TATGTCGCCCACAGTTGCTTG; GAPDH forward primer: TGTGGGCATCAATGGATTTGG; GAPDH reverse primer: ACACCATGTATTCCGGGTCAAT; Acbp/Dbi forward primer: GCTTTCGGCATCCGTATCAC; Acbp/Dbi reverse primer: ACATCGCCCACAGTAGCTTG; Gapdh forward primer: CGACTTCAACAGCAACTCCCACTCTTCC; Gapdh reverse primer: TGGGTGGTCCAGGGTTTCTTACTCCTT The gene background was defined using all sequenced genes Data analysis and visualization were performed using AreaQCorrLog2Cen in R (version 4.2.1) All other statistical analyses were performed using GraphPad Prism 9 or R software Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article Diagnosis and differential diagnosis of Cushing’s syndrome Complications of Cushing’s syndrome: state of the art The effect of endogenous Cushing syndrome on all-cause and cause-specific mortality High plasma concentrations of acyl-coenzyme A binding protein (ACBP) predispose to cardiovascular disease: evidence for a phylogenetically conserved proaging function of ACBP Qiu, S. & Zeng, B. Advances in understanding the acyl-CoA-binding protein in plants, mammals, yeast, and filamentous fungi. J. Fungi https://doi.org/10.3390/jof6010034 (2020) Acyl-CoA binding protein regulates nutrient-dependent autophagy From benzodiazepines to fatty acids and beyond: revisiting the role of ACBP/DBI Diazepam binding inhibitor promotes stem cell expansion controlling environment-dependent neurogenesis An obesogenic feedforward loop involving PPARγ acyl-CoA binding protein and GABAA receptor Glial endozepines and energy balance: old peptides with new tricks Pregnenolone sulfate and cortisol induce secretion of acyl-CoA-binding protein and its conversion into endozepines from astrocytes Acyl-CoA-binding protein is a lipogenic factor that triggers food intake and obesity Unconventional secretion of Pichia pastoris Acb1 is dependent on GRASP protein Biogenesis of a novel compartment for autophagosome-mediated unconventional protein secretion Acyl-CoA-binding protein (ACBP): a phylogenetically conserved appetite stimulator Acyl-CoA binding protein for the experimental treatment of anorexia Motino, O. et al. Cardio-, hepato- and pneumoprotective effects of autophagy checkpoint inhibition by targeting DBI/ACBP. Autophagy https://doi.org/10.1080/15548627.2022.2131241 (2022) Biological functions of autophagy genes: a disease perspective Proteomics reveals novel oxidative and glycolytic mechanisms in type 1 diabetic patients’ skin which are normalized by kidney–pancreas transplantation Metabolic and psychiatric effects of acyl coenzyme A binding protein (ACBP)/diazepam binding inhibitor (DBI) Effects of acyl-coenzyme A binding protein (ACBP)/diazepam-binding inhibitor (DBI) on body mass index Distinct plasma concentrations of acyl-CoA-binding protein (ACBP) in HIV progressors and elite controllers Renal function is a major predictor of circulating acyl-CoA-binding protein/diazepam-binding inhibitor Genome-wide screen in Saccharomyces cerevisiae identifies vacuolar protein sorting and tRNA methylation genes involved in life span regulation HIF-1-dependent regulation of lifespan in Caenorhabditis elegans by the acyl-CoA-binding protein MAA-1 Acyl coenzyme A binding protein (ACBP): an aging- and disease-relevant ‘autophagy checkpoint’ Evolution of vertebrate hormones and their receptors: insights from non-osteichthyan genomes Quantification of intracellular ACBP/DBI levels Stress-primed secretory autophagy promotes extracellular BDNF maturation by enhancing MMP9 secretion Immunization of mice with the self-peptide ACBP coupled to keyhole limpet hemocyanin Chronic hypercortisolism causes more persistent visceral adiposity than HFD-induced obesity The central effects of thyroid hormones on appetite Agonist ligands selective for the thyroid receptor beta1 controlled trial of resmetirom in NASH with liver fibrosis Distinct diagnostic and prognostic values of gamma-aminobutyric acid type A receptor family genes in patients with colon adenocarcinoma Glucocorticoid-induced apoptosis in the thymus An updated view of hypothalamic-vascular-pituitary unit function and plasticity Dexamethasone-induced autophagy mediates muscle atrophy through mitochondrial clearance CB1 receptor mediates the effects of glucocorticoids on AMPK activity in the hypothalamus Anorexia nervosa and adrenal hormones: a systematic review and meta-analysis Effects of the glucocorticoid antagonist RU 486 on pituitary-adrenal function in patients with anorexia nervosa and healthy volunteers: enhancement of plasma ACTH and cortisol secretion in underweight patients Endocrinologic and psychological effects of short-term dexamethasone in anorexia nervosa Neuroendocrinology of protochordates: insights from Ciona genomics Mechanisms for the evolution of a derived function in the ancestral glucocorticoid receptor Quantification of cellular viability by automated microscopy and flow cytometry clusterProfiler 4.0: a universal enrichment tool for interpreting omics data The intracellular metabolome of starving cells Download references we appreciate the technical support from H Xia from the National Key Laboratory of Immunity and Inflammation Chinese Academy of Medical Sciences and Peking Union Medical College the Imaging and Cytometry platform of the Gustave Roussy Institute and G Zadigue from the CEF platform of the Centre de Recherche des Cordeliers for technical support Boedec from platform of Biochemistry and Biophysics of the Institut de Psychiatrie et Neurosciences de Paris Parts of the figures have been created with licensed version of BioRender.com receives funding by Association pour la recherche sur le cancer (ARC) and Institut National du Cancer (INCa) is supported by the Ligue contre le Cancer (équipe labellisée); Agence National de la Recherche (ANR) – Projets blancs; AMMICa US23/CNRS UMS3655; ARC; Cancéropôle Ile-de-France; Fondation pour la Recherche Médicale (FRM); a donation by Elior; Equipex Onco-Pheno-Screen (ANR 21-ESRE-0028); European Joint Programme on Rare Diseases (EJPRD); European Research Council Advanced Investigator Award (ERC-2021-ADG European Union Horizon 2020 Projects Oncobiome 101016923); Fondation Carrefour; INCa; Institut Universitaire de France; LabEx Immuno-Oncology (ANR-18-IDEX-0001); a Cancer Research ASPIRE Award from the Mark Foundation; the RHU Immunolife; Seerave Foundation; SIRIC Stratified Oncology Cell DNA Repair and Tumor Immune Elimination (SOCRATE); and SIRIC Cancer Research and Personalized Medicine (CARPEM) were supported by the China Scholarship Council (CSC is supported by Science and Technology Innovation 2030 Major Project (STI2030-Major Projects 2022ZD0205700) Natural Science Foundation of China (NSFC; grant no CAMS Innovation Fund for Medical Sciences (CIFMS; 2021-I2M-1-074 National special support plan for high-level talents Suzhou Municipal Key Laboratory (SZS2023005) and the NCTIB Fund for R&D Platform for Cell and Gene Therapy is supported by grants from the National Key R&D Program of China (2019YFE0113300) These authors contributed equally: Hui Pan Equipe labellisée par la Ligue contre le cancer National Key Laboratory of Immunity and Inflammation Platform for Neurobehavioral and Metabolism Department of Respiratory and Critical Care Medicine Huazhong University of Science and Technology West China Hospital/West China School of Medicine Jiangsu Key Laboratory of Molecular Biology for Skin Diseases and STIs Institute of Dermatology and Hospital for Skin Diseases performed most of the in vitro and in vivo experiments together with A.-L.T. performed ELISAs to measure human or mouse ACBP/DBI performed cellular and histological image analyses performed the swim test and metabolic cage monitoring performed MS metabolomics analysis and constructed heat maps performed bioinformatics gene expression analyses and constructed heat maps collected serum samples from patients under or without corticotherapy and performed ACBP/DBI ELISA assays provided samples from patients with Cushing’s syndrome supervised the study and wrote the paper with input from all other authors is a scientific co-founder of Samsara Therapeutics has been holding research contracts with Daiichi Sankyo is on the Board of Directors of the Bristol Myers Squibb Foundation France Samsara Therapeutics and Therafast Bio; is in the scientific advisory boards of Hevolution Longevity Vision Funds and Rejuveron Life Sciences; and is the inventor of patents covering therapeutic targeting of ageing ‘Methods for weight reduction’ (US11905330B1) was an employee of Sanofi and now consults for Boehringer-Ingelheim was on the on the Board of Directors of Transgene is a co-founder of everImmune and holds patents covering the treatment of cancer and the therapeutic manipulation of the microbiota The funders had no role in the design of the study in the writing of the manuscript or in the decision to publish the results The other authors declare no competing interests Nature Metabolism thanks Ashley Barry Grossman and the other reviewer(s) for their contribution to the peer review of this work Editor recognition statement: Revati Dewal in collaboration with the Nature Metabolism team Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations (a-c) H4 cells were treated with dexamethasone (DEX) or corticosterone (CORT) (1 μM) for 6 h with/without bafilomycin A1 (BafA1 Representative immunoblots of LC3 conversion are shown in (a) and quantifications in (b) (n=3/group) (c) Cells were transfected with siRNA targeting ATG5 and ATG7 or control siRNA (siCtrl) and then treated as indicated (n=3/group; RU (d-g) Cells were transfected with siRNA targeting NR3C1 or siCtrl (d) Representative immunoblots show NR3C1 and ACBP levels in NR3C1 knockdowns with/without DEX (1 μM (e-f) Scatter plot shows the ratio of NR3C1/β-actin (e) and ACBP/β-actin (f) with the indicated treatments (g) ACBP release from cells with the indicated treatments is shown in (d) (RU; n=3; One-way ANOVA; P-values are indicated) (h) Scheme shows the schedule of hydrocortisone (HCS i.p.) administration to female C57BL/6J mice (n=5/group) (i) Percentage of mouse thymus relative to body weight following HCS treatment at the specified doses (n=5/group) k) Representative immunoblot (j) showing ACBP levels in WAT treated with HCS at different dose (n=5/group) Scatter plot (k) shows the ratio of ACBP/β-actin (k) (l) Scheme shows the schedule of hydrocortisone (HCS i.p.) administration to female C57BL/6J mice for the indicated duration (m) Percentage of mouse thymus relative to body weight following HCS treatment at various time points (n=5/time point) (n) Plasma ACBP level under HCS treatments at various time points (n=5/time point) (o) Representative immunoblots show hepatic ACBP upon treatment with HCS at various time points (n=5/group) Scatter plots show the ratio of ACBP/β-actin (p) (h) Scheme shows the schedule of mifepristone (Mif i.g.) administration and fasting in female C57BL/6J mice for 24 h r) Scheme of the experiment (q) and plasma ACBP levels (r) upon Mif treatment and fasting for 24 h One-way ANOVA with Dunnett correction was used for statistical analysis (i,k,m,n,p,r) Data in b,c,e,f,g were analyzed using two-way ANOVA with Tukey correction Source data (a-d) Cells were treated with siRNA targeting the thyroid hormone receptor (THR) α and β genes or control siRNA (siCtrl) and then cultured in the presence of triiodothyronine (T3) Then cells were subjected to the quantification of the mRNA coding for THRα (e) Scheme of T3 administration to female C57BL/6 mice for 16 h (f) Plasma ACBP was assessed by ELISA after T3 treatment at different doses (n=6/group) (h) Representative immunoblot of ACBP after T3 treatment (n=3/group) (i) Scatter plot showing the ACBP/β-actin ratio One-way ANOVA with Tukey correction was used for statistical analysis (P-values are indicated) Source data (a) Representative hematoxylin and eosin stains of liver and interscapular brown adipose tissue (iBAT) of female C57BL/6J mice treated with corticosterone (CORT; 100 μg/mL or vehicle control (Ctrl) in drinking water p.o.) for 5 weeks together with KLH-ACBP for autoimmunization or KLH alone both administered i.p iBAT and hepatocytes was assessed in the indicated groups (n=4-5 mice tissue sections/condition) Source data and interscapular brown adipose tissue (iBAT) of female C57BL/6J mice treated with corticosterone (CORT) (100 μg/mL p.o.) with or without αACBP (5 mg/kg body weight Source data Female C57BL/6J mice were treated with corticosterone (CORT) (100 μg/mL Abundance of plasma hormones was assessed by Luminex multiplex assay (n=10,10,9,10/group) The heatmap displays z-scores of the indicated metabolic hormones in the indicated treatment groups Statistical comparisons were performed by pairwise (two tailed) Wilcoxon test with FDR correction for multiple comparisons Source data (a) At the end of the corticosterone (CORT) and anti-ACBP/DBI (αACBP) mAb experiment liver tissue was collected for RNAseq analysis (n=5/group) Genes with a differential expression P-value ≤ 0.05 (Wald test) and abs (fold change) ≥ 2 were selected in (a) (b) Volcano plot of differential genes between isotype + CORT and isotype + Ctrl groups (c) Volcano plot of differential genes between αACBP + CORT and isotype + CORT groups (d,e) Venn diagrams illustrate overlaps of the transcriptomic CORT effects on isotype and αACBP mAb neutralization (f) GO enrichment analysis of the genes obtained from the overlap in (d) (58 genes) (g) GO enrichment analysis of the genes obtained from the overlap in (e) (442 genes) Data were analyzed using R software with the DESeq2 package Source data Source data (a) Male C57BL/6J mice were treated with CORT (100 μg/mL) in drinking water (p.o.) for 5 weeks (n=10/group) (b) Plasma ACBP was quantified by ELISA (n=10/group) (c) Average food intake (n=3 cages/group) and (d) body weight (n=10 mice/group) were monitored (e) The heatmap shows the standardized deviations (z-scores) of tissue weights relative to body weight and the quantification of various biochemical parameters across the treatment groups (n=10 mice/group) (f-i) Glucose tolerance tests (GTT) (n=10 mice/group) (f) and insulin tolerance tests (ITT) (n=10 mice/group) (h) were performed in the indicated groups P-value refer to the comparison of areas under the curve (g,i) Statistical comparisons were performed by pairwise Wilcoxon tests with FDR correction for multiple comparison in the heatmaps All curves were longitudinally analyzed with type II ANOVA and pairwise comparisons (c,d) One-way ANOVA with Tukey correction was used for statistical analysis (P-values are indicated) (d,g,i) Source data (a) Scheme showing the experimental schedule of triiodothyronine (T3; i.p.) administration to female C57BL/6J mice treated with corticosterone (CORT) for 5 weeks Liver (b) and WAT (c) Acbp mRNA levels (n=6/group; RU (d) Representative immunoblot shows ACBP level treated with different doses of T3 (n=3/group) Scatter plots show the ratio of ACBP/β-actin in liver (e) and in WAT (f) (g) Plasma ACBP were assessed by ELISA (n=10/group) (h) Average food intake (n=3 cages/group) and (i) body weight (n=10 mice/group) were monitored (j) The heatmap shows the standardized deviations (z-scores) of tissue weights relative to body weight and the quantification of various biochemical parameters (n=10 mice/group) Statistical comparisons were performed by pairwise Wilcoxon tests with FDR correction for multiple comparison in the heatmaps (P-values are indicated) All curves were longitudinally analyzed with type II ANOVA and pairwise comparisons (h,i) One-way ANOVA with Tukey correction was used for statistical analysis (P-values are indicated) (b,c,e-g) Source data 1–15 and Source data of immunoblots included in supplementary figures Download citation DOI: https://doi.org/10.1038/s42255-024-01170-0 Anyone you share the following link with will be able to read this content: a shareable link is not currently available for this article Sign up for the Nature Briefing: Translational Research newsletter — top stories in biotechnology The US Food and Drug Administration (FDA) has approved a new indication for osilodrostat (Isturisa Recordati) as second-line treatment of endogenous hypercortisolemia in adults with Cushing syndrome Endogenous Cushing syndrome is a condition of excess cortisol that can result in complications such as weight gain Osilodrostat, an oral cortisol synthesis inhibitor, was previously approved for treating adults with Cushing disease a subtype of Cushing syndrome in which the hypercortisolemia is due to pituitary overstimulation Both indications are for people who can’t undergo surgery or who have had surgery that wasn’t curative The new indication was supported by an “extensive clinical development program” involving more than 350 adults with Cushing syndrome The most common side effects of osilodrostat are adrenal insufficiency and swelling of the legs and ankles or other signs of edema Its efficacy and safety in children isn’t known Tucker is a freelance journalist based in the Washington DC area She is a regular contributor to Medscape Medical News with other work appearing in the Washington Post She is on X @MiriamETucker and BlueSky @miriametucker.bsky.social Send comments and news tips to news@medscape.net "\/citytv\/womens\/nick-cushing-post-man-united-man-city-interview-wsl-63881964?__cf_chl_rt_tk=oZNDCKdH8spEzXPody4vsgY6RIqNrk8yDsoTgdG0CrM-1746530789-1.0.1.1-2kLq0tXEsPO2pB8Xm4JPFyPADRY9jSwWKpk2FcmJDx8" + window._cf_chl_opt.cOgUHash);cpo.onload = function() {history.replaceState(null Manchester City boss Nick Cushing has said he expects Vivianne Miedema to miss the rest of the season through injury Miedema went off with a hamstring issue in Netherlands' Nations League clash against Austria earlier this week Dutch national coach Andreas Jonker said he was "extremely disappointed" about her injury setback and did not foresee a speedy return to action Cushing shared Jonker's pessimism about Miedema's injury "We've lost Viv and that's something the medical team are ongoing with She's positive but it's not looking good in the sense of being able to imminently impact any of our games," he told a news conference on Friday "It's hugely disappointing for Viv because of the role she's played on the pitch and for me personally because she's been so pivotal in the results I've got with this team "She's played a huge role in dragging this team up and she's done the same today in the meeting room and on the training pitch Vivianne Miedema picked up a hamstring injury while on international duty. Getty"She's positive and concentrating on rehab now and we'll give her all the support she needs to be back out there as quick as possible." The forward, who joined City in the summer on a free transfer, has already missed three months of the season after undergoing another operation on her knee in October last year Miedema's latest setback comes just as she has started to hit her stride at City -- she won the club's player of the month award in March for her six goal involvements, including a brace against Chelsea in the first leg of the Champions League quarterfinal She also got on the scoresheet for her country in the ill-fated game against Austria and now faces a race to get fit in time for the Women's Euros this summer Information from ESPN Netherlands contributed to this report New York City FC have parted ways with head coach Nick Cushing initially as interim head coach before getting the permanent role in November 2022 He posted a 40W-40L-27D record across all competitions Cushing guided NYCFC to the Audi MLS Cup Playoffs in two of three seasons, including a 2022 Eastern Conference Final run. This year, NYCFC finished sixth in the Eastern Conference (50 points) before losing in the Eastern Conference Semifinals, 2-0, to rivals New York Red Bulls on Saturday night "Whilst we are incredibly appreciative for all [Cushing] has done for the club we believe it’s best to move the team in a new direction as we plan for the 2025 season and beyond," said sporting director David Lee "We would like to sincerely thank Nick for his contributions and wish him and his family all the very best in their future endeavors." Cushing has been part of City Football Group for almost two decades He progressed from the Manchester City Academy to leading the Manchester City women’s team in 2013 The England native then joined NYCFC in 2020, first as an assistant under former manager Ronny Deila. Cushing was part of NYCFC's MLS Cup 2021-winning staff, and led the Cityzens to the 2022 Campeones Cup title "Nick has created many wonderful memories for the club and our players and staff have benefited immensely from his guidance and experience and we have nothing but immense gratitude for Nick and the success he brought to the club," said CEO Brad Sims “I would like to take this opportunity to thank our fans for their unrivaled support throughout the year We set ourselves the highest possible standards and targets each season and we are already fully focused on preparations for the 2025 season."   Calendar   |   Contact Us who served as a priest for nearly seven decades Patrick Parish and attended the parochial school He then completed his seminary training at St Kearney at Rochester’s Sacred Heart Cathedral His first assignment was at Holy Cross Parish in Charlotte where he served as assistant pastor from 1956-62 Father Cushing left the parish and became chaplain at St an all-girls school operated by the Sisters of St He served at the Rochester school until 1979 This assignment was significant to Father Cushing for several reasons Not only did the assignment mark Father Cushing’s first — and only — pastorate but the priest was just the second pastor in the Irondequoit parish’s history Cecilia Parish had been founded in 1949 by Father Bernard Newcomb Patrick Parish in Corning when Father Cushing was a child “I think (Father Cushing) was inspired by Father Newcomb and he stayed there until he retired,” Father Leone said The parishioners of St. Cecilia and later St. Kateri were quite fond of Father Cushing, according to Father Leone, who served at St. Cecilia from 2008-11. “They really loved him. He was so dedicated to them. He was there for them, said Mass faithfully, administered the sacraments,” Father Leone said. “He was a very dedicated priest. He was a good man.” While the bulk of Father Cushing’s priesthood was devoted to his three assignments at Holy Cross, St. Agnes High School and St. Cecilia, he also served for a time as chaplain at the Monroe County Jail and as assistant director of the Diocese of Rochester’s Family Life Bureau, which coordinated marriage-preparation courses and other diocesan functions. In his free time, Father Cushing loved photography, working with audio-visual equipment and watching the New York Yankees, Father Leone said. Father Cushing was predeceased by his parents, Thurza and Walter; and his sister, Sharon Scott. He is survived by his nephews, David (Lois) Scott, Ronald (Sue) Scott and Timothy (Jill) Scott; nieces, Bonnie (Larry) Folden, Sheryl (Harold) Luckner, Kathleen Ross (John) and Kimberly (Matthew) Eiffert; and caregiver and family friend, Doug Crooker.  Visitation for Father Cushing will take place March 14, 2025, at 10 a.m. at St. Cecilia Church, 2732 Culver Road in Irondequoit. Immediately after the visitation, Father Cushing’s funeral liturgy will begin at 11 a.m.  Choose from news (Monday), leisure (Thursday) or worship (Saturday) — or get all three! rewritten or otherwise distributed including by such means as framing or other digital copying and/or distribution methods leisure (Thursday) or worship (Saturday) — or get all three No, Thanks playThiago Martins' header doubles NYCFC's lead (0:35)Thiago Martins is at the right place at the right time to head NYCFC into a two-goal lead over FC Cincinnati New York City FC head coach Nick Cushing confirmed he will remain with the club in 2025, dispelling rumors linking him to the managerial role at the Arsenal women's team Though Cushing quickly emerged as a potential candidate to take over Arsenal following the departure of former manager Jonas Eidevall in October, the MLS coach insists there has been no contact from the English club once last week if there's been contact and then about the story still living," he told ESPN but from within myself and within here [at the organization] "I just confirmed I will be here next year Cushing first joined City Football Group in 2006, boasting a junior role at Manchester City Women before earning the managerial position in 2013 He led the team to lift the 2014 FA Women's League Cup and 2016 Women's Super League title during his seven-year spell Cushing moved away from Manchester City Women to become the assistant coach to Ronny Deila at New York City FC aiding the team during the 2021 MLS Cup-winning season prior to replacing Deila as interim manager in 2022 and permanent coach in 2023 Nick Cushing confirmed he will extend his contract with New York City FC. Tom Horak-USA TODAY SportsDespite the speculation his focus remains on leading NYCFC to the MLS Cup once again "Hopefully we can take this team far this year Ultimately the reality is my focus now is on playoffs and my team beyond the playoffs My focus is how do we get this team from seven to four where I believe we are going to get from three to one," he said "Developing the style and the identity that we've got now because it's the way I see the game I want to go on attack teams and be on the front foot Developing that has been probably my favorite part of the training programme and the team now." New York City FC concluded the 2024 MLS campaign in sixth place on the Eastern Conference table with 50 points, and now heads into the third match of the Round 1 best-of-three series against FC Cincinnati forcing Cushing to earn a victory during Saturday's game at TQL Stadium in order to advance to the Conference semifinals Nick Cushing confirmed his players and staff are excited to return to action at home this weekend New York City FC hosts FC Cincinnati on Saturday at Citi Field for Game 2 of the Round One Best-of-3 Series City must secure a win to extend their postseason run Cushing shared that his players are excited to be back home and eager to deliver a victory for the Club's supporters “We love playing at home in front of our people,” he explained “I said post-game - irrelevant of what happened in Cincinnati - we're now playing in front of our people and that is where we play our best football They have a huge desire to win this football game and to make sure that we win the game with our people I can always go back to the Miami game [this season] “It was actually interesting because the Miami game at Yankee Stadium was an amazing game in front of our fans but the last playoff game I did at Citi Field was also against Miami “That was an incredible atmosphere and a good performance from the team We know that if we play well and we start well we get our people behind us “We aim to make sure that we deliver for our fans so that together we can create an incredible atmosphere City have been busy on the training field this week as they seek to secure a victory against Pat Noonan’s side Head Coach Cushing and his players have closely analyzed Monday's game Cushing emphasized the importance of character as they head into Saturday's match “This week has been all about showing our character,” Cushing said the character that we have shown on multiple occasions this year in big football games “Now we have to deliver it from the first whistle in front of our people at Citi field it's about the crowd and the energy and our fans “They feed off the energy that we give them and the character that we show as a team I've been really clear with the team this week that it is a must from the first whistle.” You can purchase tickets to Saturday's game by clicking here. Erin Cuthbert scored a stoppage-time winner for the visitors at the Etihad Stadium after Aggie Beever-Jones' strike cancelled out Kerolin's opener City could have been 2-0 up in the first half had referee Kirsty Dowle played the advantage after Kerolin was fouled on the edge of the area Dowle's decision to prematurely blow her whistle for a free-kick meant Park's effort on the follow-up did not count opening the door for Chelsea to mount their comeback "The officials admit they got it wrong and should have played on," Cushing said after the match "The frustrating thing is after the [Laura] Coombs foul earlier on because we were so dangerous on the counter attack when the whistle was blown on Coombs I asked her to play advantage Chelsea boss Sonia Bompastor sympathised with Cushing's frustrations but praised her side for their tenacity in the second half even when the ball was not going into the goal so I think she made the right decision and it's difficult after when you see the result," she said "If I was the City manager I would probably be in the same place I don't think it changed our belief going into the second half Internet trolls partly aided doctors in diagnosing Amy Schumer with Cushing syndrome but patients can go years without a diagnosis Schumer opened up about her February 2024 diagnosis on the “Call Her Daddy” podcast Wednesday crediting online criticism about her swollen face – a telltale sign of the hormonal disorder Cushing syndrome is an uncommon condition when the body has too much cortisol medical director of the pituitary center at the Cleveland Clinic known as the "stress hormone," influences how the body handles stress and plays a vital in keeping the body healthy keeps our energy steady throughout the day and dips in the evening so that we can sleep," she said Cushing syndrome can be difficult to diagnose because providers don’t immediately think of the condition when a patient comes into the office reporting fatigue and weight gain It's also often confused with polycystic ovary syndrome Medical mystery solved: Why do some people develop Huntington's earlier than others? it can take years to figure out what's going on," she said "The average diagnostic delay in Cushing's syndrome is approximately two to three years." are also at increased risk of developing Cushing syndrome Schumer said her diagnosis was the result of steroid injections from her breast reduction and Cesarean section after her first child affecting up to 70 out of a million people each year About 70% of people with Cushing syndrome are women or people assigned female at birth, according to the Cleveland Clinic People between 25 and 50 are most likely to be affected by the condition round face; easy bruising and poor wound healing; high blood pressure; excessive hair growth in the face breast or thighs; purple stretch marks over the abdomen; a fat pad between shoulders; general weakness or tiredness; blurry vision and dizziness; weakened muscles; thinner arms and legs; and libido changes the Cleveland Clinic said high cortisol levels could lead to other health problems such as infections To determine if a patient has Cushing syndrome doctors conduct tests to find out if the body is making too much cortisol They can also check for another hormone called ACTH which is made by the pituitary gland when the body is stressed Most cases are caused by either a medication or tumor If a patient is taking medication that could lead to Cushing syndrome the doctor will lower the dosage or prescribe a non-glucocorticoid medication which can reduce inflammation without steroids the doctor will order scans to see if there might be a tumor causing Cushing syndrome Tumors in the adrenal gland account for up to 20% of Cushing syndrome cases Adrianna Rodriguez can be reached at adrodriguez@usatoday.com Nick Cushing has left New York City FC. Andrew Katsampes/ISI Photos/Getty ImagesNew York City FC have dismissed head coach Nick Cushing The decision comes after NYCFC finished sixth in the MLS Eastern Conference this season and were knocked out in the MLS Cup Playoffs Eastern Conference semifinals "Whilst we are incredibly appreciative for all he has done for the club we believe it's best to move the team in a new direction as we plan for the 2025 season and beyond," sporting director David Lee said Cushing was an assistant at the club before taking over as interim head coach in June 2022 he led NYCFC to the Eastern Conference finals of the Audi 2022 MLS Cup Playoffs and we have nothing but immense gratitude for Nick and the success he brought to the club," CEO Brad Sims said The club said they are now looking for a replacements ahead of the 2025 season Nick Cushing is keen for his side to maintain the momentum generated from their unbeaten run as they prepare for Decision Day New York City FC will travel to Canada on Decision Day to take on CF Montréal The Boys in Blue are already guaranteed a place in the playoffs but they can still secure home advantage with the right results on Saturday City are currently on a three-game unbeaten run and while speaking with the media on Thursday Cushing emphasized the need for his team to maintain their momentum heading to postseason “The preparation is fairly similar in the sense of the intensity that we've trained at,” he said “The buy-in and the focus of the team is very similar to last year The difference is we're fighting for a totally different opportunity and that was the aim and the goal at the start of the year to be in a position to finish in the top four We've got a really good feeling among the group and that has to continue going into the postseason fourth place is our target and our eyes are on that.” We don't achieve anything in the sense of finishing in fourth place if we don't win the game We've reviewed the Nashville game and there was some really good bits and some bits that we know we have to improve on “The game isn't finished until that referee blows the whistle so we will believe we can get something from the game in every moment of the game.” Reflecting on the challenge Montréal will represent on Saturday Cushing praised his opposite number Laurent Courtois “I think the first challenge will be that they have to get a result to get in [to the playoffs],” Cushing said They're at home in front of a sellout crowd It’s a great opportunity for them to improve on last season which is the mindset that we've been in all year They can have long periods of possession with the ball and create chances “They have a number nine in Joseph Martinez We know that this game is going to be difficult We're going to have to be incredibly focused throughout the game "\/citytv\/womens\/press-conference-202425-nick-cushing-manchester-united-manchester-city-63881787?__cf_chl_rt_tk=BT4rYqEy8pUhsOmujn4.WvwgnbSSRHExHQmkBCxGusQ-1746530820-1.0.1.1-E4Put9n6GvMRAdxjF46DDFpG8TNgoFxYA1t5IUj.CGM" + window._cf_chl_opt.cOgUHash);cpo.onload = function() {history.replaceState(null Lee served in the United States Army during the Korean Conflict He was a member of Marshfield Assembly of God He loved spending time with his grandchildren and great-grandchildren He is preceded in death by his parents; his wife Randy and Michele Cushing of Marshfield; fourteen grandchildren Interment will follow in Marshfield Cemetery Memorial contributions may be made to the family and may be left in the care of Fraker Funeral Home website by Online Masterminds NYCFC have fired head coach Nick Cushing Cushing took over on an interim basis in July 2022 for former head coach Ronny Deila and was brought on board permanently at the end of that season having led the club to the Eastern Conference finals Cushing compiled a 40-27-40 record in all competitions across his time in New York NYCFC were eliminated from the MLS Cup playoffs last week after a disappointing 2-0 home loss to crosstown rivals New York Red Bulls “We would like to thank Nick for his incredible dedication to the club and this city,” sporting director David Lee said in the club’s statement playing an important role in delivering the Club’s first MLS Cup as an assistant coach and then leading the team as interim head coach to a Campeones Cup victory in 2022.” Lee added: “Whilst we are incredibly appreciative for all he has done for the club we believe it’s best to move the team in a new direction as we plan for the 2025 season and beyond.” — New York City FC (@newyorkcityfc) November 26, 2024 Before working in MLS Cushing was manager of Manchester City’s women’s team from 2013 to 2020 The 40-year-old has been considered a potential candidate for the head coaching vacancy at Arsenal’s women’s side following the departure of their previous head coach Cushing himself rebuffed reports of Arsenal’s interest some three weeks ago during a news conference “The whole story is news to me,” Cushing told the assembled media “There has been no contact from anybody outside this organisation with myself New York City FC's new stadium to be called Etihad Park (Andrew Katsampes / ISI Photos / Getty Images) Nick Cushing has encouraged his players to play their football and dig deep as they pursue victory in Cincinnati this week New York City FC travels to TQL Stadium this Saturday to face FC Cincinnati in the decisive third game of a best-of-three series A win would secure City a spot in the next round of the Audi MLS Playoffs and set up a showdown with the Red Bulls Cushing discussed how his side can harness the momentum generated from their 3-1 victory last time out “It’s about trying to show our players how much our fans enjoy seeing that type of performance from our players,” he said but the guts and the fight and the desire to ensure that we are the team that goes through the next game right “The performance at Citi Field had everything Not only did we play well and create chances as was the desire to make sure that we didn't give the second goal away.” “We've got to make sure that we play the football that our fans deserve and that we know we can play We’ve just got to make sure that we go prepared and we deliver everything that we've got.” and Santiago Rodríguez secured City a 3-1 win in their last meeting on Saturday The win set up a decisive third game in Cincinnati with Cushing expressing confidence that his players are prepared for the challenge awaiting them in Ohio “This is going to be a tough game,” Cushing said “With regards to it [the game] swinging both ways I think that's natural in playoff football “You’ve got to be prepared to absorb the pressure and you’ve got to make sure that you capitalize on the moments that you get “I was pleased that in the game at Citi Field we were putting the pressure in the second half that we have to go through to look at how we minimize the amount of pressure that we absorb and how we control Cincinnati in the moments where they become strong This will be the sixth matchup between New York and Cincinnati in 2024 the teams faced each other in both the Leagues Cup and the MLS Regular Season Cushing acknowledged the sense of familiarity that exists between the two teams while discussing his focus on crafting a strategy to help his side deal with the pressure they expect to experience on Saturday It's unique for us in the sense of the three-game series but it is actually going to be the sixth time that we've played this team because we played them in Leagues Cup and twice in the regular season “You become really familiar with each other There are going to be elements of all the games that we've played present in this upcoming game “You have to be prepared to compete in the game This is more like the playoff football I’ve known since 2020 “You win and you go through you lose and you're out There are some considerations that I'm making in the sense of changes If you go back to the first league game there thought we competed really well in a different way “We’re trying to work through some small stuff now to make sure we have a strategy during the difficult moments and you’ve got to be ready to go and compete.” Zurich North America appointed Tobias “Toby” Cushing to the newly created role of deputy chief underwriting officer Cushing previously served as casualty technical director Cushing is responsible for supporting Zurich North America’s underwriters across all lines of business who is based out of Zurich’s New York City Offices joined Zurich as head of construction Casualty in 2022 he has held several underwriting leadership roles of increasing responsibility Cushing held a variety of roles at The Hartford including serving as head of construction for middle and large commercial Earlier in his career Cushing practiced law as an insurance coverage litigator and advisor for complex insurance transactions Zurick North America is headquartered in Schaumburg Please tell us what we can do to improve this article Get the insurance industry's trusted newsletter Δdocument.getElementById( "ak_js_1" ).setAttribute( "value" American Parkinson Disease AssociationP.O. Box 61420, Staten Island NY 10306Tel: 1-800-223-2732Email: apda@apdaparkinson.orgWeb: https://www.apdaparkinson.org Amy Schumer is opening up further about how internet commenters led her to a revealing medical diagnosis The comedian, during an appearance on the "Call Her Daddy" podcast Wednesday said she originally ignored criticism about her swollen face until doctors jumped in the chat According to Mayo Clinic, Cushing syndrome "happens when the body has too much of the hormone cortisol for a long time." The syndrome can cause "moon face," or a puffy appearance Schumer said her diagnosis was the result of steroid injections from her breast reduction and Cesarean section after her first child Schumer has opened up a number of times about her health conditions including her happenstance Cushing syndrome diagnosis What is cortisol face? TikTok keeps talking about moon face, hormones. Last year, the comedian spoke candidly to journalist Jessica Yellin about her health journey in the News Not Noise column on Substack "I was also in MRI machines four hours at a time having my veins shut down from the amount of blood drawn and thinking I may not be around to see my son grow up So finding out I have the kind of Cushing that will just work itself out and I'm healthy was the greatest news imaginable," Schumer said in the interview with Yellen Schumer said she felt "reborn" while sharing the news amid the criticism she received The "Trainwreck" star had previously called out the critics "Thank you so much for everyone's input about my face I've enjoyed feedback and deliberation about my appearance as all women do for almost 20 years And you're right it is puffier than normal right now," Schumer said in February The actress added that "there are some medical and hormonal things going on in my world right now but I’m okay." She has also previously opened up about having endometriosis a condition in which tissue that resembles cells found in the lining of a uterus grows outside of the organ There are many signs and symptoms of Cushing syndrome Cortisol is a hormone that helps the body respond to stress and is important for other body functions such as controlling blood pressure and blood sugar helping the body use food for energy and helping the heart and blood vessels work correctly visited A&M's sci-fi and fantasy collection featuring the repository of the author who imagined her Texas A&M Class of 1998 teaching his wife actress Lena Headey how to Gig ’em at Cushing Library on Nov Texas A&M University, the Texas A&M Foundation, and the College of Performance, Visualization and Fine Arts welcomed former student to College Station this past weekend for a multi-site visit around campus We chatted with Menchaca earlier this year and he told us about his marriage to Headey, who played the infamous Queen Cersei Lannister on the hit HBO series “Game of Thrones.” He also mentioned they were up for a campus visit and a stop at the world-renowned Cushing Memorial Library & Archives seemed fitting for the queen Cushing houses the personal collection of author George R.R who wrote the book series “A Song of Ice and Fire” upon which the “Game of Thrones” series as well as HBO’s current series “House of the Dragon,” are based Tolkien’s 1937 classic “The Hobbit,” illustrated by Tolkien himself For those unfamiliar with “Game of Thrones,” Headey’s character is a series legend, as it was her who sat on the most coveted throne for much of the series. Spoiler alert: Cersei Lannister indisputably loses “the game” in the end. Headey herself, though, won the hearts of fans worldwide with her portrayal of the complex character 30; Headey and Menchaca were joined by family members Menchaca studied English at Texas A&M and has gone on to dozens of series and film roles including the role of Russ Langmore in the hit Netflix show “Ozark.” curator of the sci-fi and fantasy collection pulling pieces from the Martin collection and a few other rare finds who has extraordinary knowledge and a healthy sense of humor was sure to gather Lannister swords for the start of our tour “We’re in House Lannister today,” he told us quite seriously Next, we traveled to the historic Kelsey Reading Room; its ceiling was originally hand-painted by Aggie architecture students in the early 1930s Brett told the stories behind some of the items from the Martin collection including original manuscripts and artwork that feature the author’s handwritten notes we asked the couple how they were enjoying their stay in Aggieland and Headey said she’d taken in her first Yell Practice the evening prior Menchaca said he was “a little anxious” bringing his British family members to Kyle Field the largest stadium in the Southeastern Conference and one of the largest in the U.S. What has he brought me to?’ It was really very exciting it was a bit like going to King’s Landing.” The endowment is the first of its kind at Cushing and supports a range of sci-fi and fantasy initiatives If you would like to support the collection, visit the Texas A&M Foundation website The couple also attended a lunch hosted by College of Performance, Visualization and Fine Arts Dean Tim McLaughlin, during which Menchaca met with Rayna Middleton Dexter, interim program director for the new theatre degree College officials say they hope to bring him back in the spring to meet with students To support programs in the College of Performance, Visualization and Fine Arts, visit pvfa.tamu.edu/about/giving Spring graduations will be celebrated May 8-10 across nine ceremonies at Reed Arena The annual awards recognize individual staff members teams and student employees for their contributions to the university community The Friars honor their beloved dachshunds and support Texas A&M’s veterinary hospital through a heartfelt gift that reflects their love for animals and the Aggie Spirit Manchester City women’s interim head coach Nick Cushing says he is not thinking about his long-term future beyond the end of the season but “you never know what is around the corner” On Monday, Cushing was named as the women’s team’s new interim boss for the rest of the 2024-2025 season following the dismissal of Gareth Taylor five days before the Subway Cup final The move marks his return to the women’s side five years after he left for New York City FC “It is definitely until the end of the season,” Cushing said on his interim position “It would be crazy to look any further than the end of the season based on the games we’ve got coming up One thing I’ve been really clear on since I came out of New York is that my development in this organisation (City Football Group) has been the one thing that has continued to give me the hunger and desire to keep improving football players “I went from (City) boys’ academy to the women’s team from the women’s team to New York as the assistant coach and then as head coach Those conversations for me are about continuing my experiences To have new experiences as coaches is something that will continue to develop here.” Cushing spent seven years as Manchester City head coach, before joining Major League Soccer (MLS) side NYCFC initially as assistant to Ronny Deila, before stepping into the head coach role in 2022. He was sacked in November 2024 The 40-year-old did not state that he would definitely return to the men’s game following his interim spell at City I was working (with) under 12 and under 13 (teams) as an assistant coach and I never thought I would coach in the women’s game,” he said “Then when I was winning trophies in the women’s game I didn’t even know any teams in MLS and I landed in MLS So one piece of advice I give coaches all the time is you never know what’s around the corner City face Chelsea on Saturday in the Subway Cup final in what is their first of four consecutive games across three different competitions against the reigning Women’s Super League (WSL) champions (Andrew Katsampes/ISI Photos/Getty Images) Charlotte Harpur is a football writer covering Manchester United and women's football for The Athletic UK. Follow Charlotte on Twitter @charlotteharpur in a recent episode of the 'Call Her Daddy' podcast This website is using a security service to protect itself from online attacks The action you just performed triggered the security solution There are several actions that could trigger this block including submitting a certain word or phrase You can email the site owner to let them know you were blocked Please include what you were doing when this page came up and the Cloudflare Ray ID found at the bottom of this page The "Kinda Pregnant" star said doctors began commenting on her swollen appearance which led her to seek a diagnosis for her swollen face Todd Owyoung/NBC/Getty; Karwai Tang/Getty  Amy Schumer shared a selfie that she labeled "no filter" and "no filler" on Instagram Jan three days after giving insight into her Cushing syndrome diagnosis Amy Schumer is feeling pretty The Kinda Pregnant star shared a candid photo of herself that she labeled "no filter, no filler," days after revealing that comments about her appearance online last year led to her Cushing's syndrome diagnosis Amy reposted the selfie onto her grid, writing "What can I say It was a good night." The 43-year-old's post came three days after explaining that comments on social media about her "puffier" face weren't all ill-intentioned and the internet really came for me after doing a bunch of press relax,'" she told host Alex Cooper on the Jan "But then doctors were chiming in in the comments." Amy went on to explain that she noticed medical professionals expressing genuine concern your face looks so crazy and we think something's up.'" The Trainwreck actress—who shares son Gene with husband Chris Fischer—recalled how these doctors she had never met were accurate in their hypotheses about her health I'm getting trolled by doctors?" Amy said 'We think you have something called Cushing and it's like When the comedian learned that Cushing syndrome can be caused from high-dose steroid injections—which she had been getting to treat scars from a breast reduction and her C-section—she realized they were onto something Their suspicions were confirmed when Amy was diagnosed with Cushing last February right before she started filming Kinda Pregnant in March "Right before we started rolling was when I learned I had this condition," she explained "and that I had something called moon face." While she was initially scared she had the version of Cushing where "you could die," which led her to be "really down" on herself during that time she ultimately learned that she had a type that she could overcome Those sentiments echoed what she said when she initially shared the news of her diagnosis with the public a year ago "Finding out I have the kind of Cushing that will just work itself out and I'm healthy," Amy said at the time "was the greatest news imaginable." 2025—The National Ski Areas Association (NSAA) has named two longtime ski industry leaders as the recipients of two of its most prestigious awards Chris Cushing and Chip PerfectResort planner Chris Cushing is the 2025 NSAA Industry Impact Award honoree and Perfect North Slopes (Ind.) owner Chip Perfect is the recipient of the 2025 NSAA Lifetime Achievement Award working on a total of more than 200 ski area projects on five continents He’s been involved in such major resort revitalizations and expansions as Deer Valley Cushing comes from a strong background of resort planning in the 1960s and is widely considered an originator of modern mountain planning “For those of us who have been in the business this long “NSAA has been a big part of my life,” he continued “To be honored with this award from the people with whom I’ve shared my career it’s the ultimate confirmation that whatever we all did Read Cushing’s full bio on NSAA’s website Perfect grew up on his family’s farm in southern Indiana A college student approached the family about turning a portion of the property into a ski area and Perfect North Slopes became a reality in 1980 with two handle tows Perfect has grown the ski area into one of the most successful operations in the Midwest The ski area was an early adopter of high-capacity snowmaking allowing Perfect North to capitalize on short windows of opportunity to make a lot of snow Perfect also pioneered innovative ticketing and lesson options for guests to get the most bang for their buck joining the NSAA board of directors in 2004 becoming part of the NSAA executive committee in 2007 and being elected as the first board chair from the Midwest in 2012 Perfect was honored by the Midwest Ski Areas Association in 2018 with the Jim VanderKelen Lifetime Achievement Award He now owns and operates three ski areas—Perfect North Slopes In addition to these ventures and being an Indiana State Senator from 2014-2023 Perfect is involved in a variety of other businesses Read Perfect’s full bio on NSAA’s website Cushing and Perfect will be formally honored at the 2025 NSAA National Convention Ski Area Management - SAM |  P.O. Box 644 Woodbury, CT 06798 |  Tel. (203) 263-0888 | Fax (203) 266-0452 |  Email news@saminfo.com Copyright © 2023. All Rights Reserved. Ski Resort Websites and Marketing by nxtConcepts Metrics details Research siloes slow the translation of scientific discovery to patient care and limit progress in improving treatments for Cushing disease to incremental advances Facilitating collaborative efforts that study the complexity of pituitary neuroendocrine tumours would advance the development of targeted treatments for patients who experience a low quality of life for years owing to this rare and understudied disease Prices may be subject to local taxes which are calculated during checkout Research reported in this publication was supported by the National Institute of Diabetes and Digestive And Kidney Diseases (NIDDK) of the National Institutes of Health (NIH) under award number RC2DK140838 The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health Department of Interdisciplinary Biomedical Sciences The author declares no competing interests Download citation DOI: https://doi.org/10.1038/s41574-024-01080-x Sign up for the Nature Briefing newsletter — what matters in science Amy Schumer has shared how she was diagnosed with Cushing syndrome after people pointed out to her a noticeable change in her appearance Amy Schumer is looking back at how her followers helped her reach a medical diagnosis Nearly one year after sharing her diagnosis of Cushing's syndrome a disorder that occurs when your body makes too much of the hormone cortisol the comedian detailed how comments about her "puffier" face—especially from doctors—led to finally getting to the bottom of what was going on with her body It was that concern that led to her seeing the comments through a different lens I'm getting trolled by doctors?" she noted Flash forward to last February when the I Feel Pretty actress confirmed that she had been diagnosed with Cushing syndrome caused from high-dose steroid injections "I was like, wait, I have been getting steroid injections for my scars," the Trainwreck actress said on Call Her Daddy. "I had a breast reduction, you know, C-section with husband Chris Fischer—confirmed she received her diagnosis not long before she started filming her upcoming Netflix comedy movie Schumer said she initially feared the worst "There are two kinds of Cushing and [with] one of them So I was feeling really down on myself before I started filming this movie." If you’re concerned you have a “cortisol face” or “moon face,” it’s best to talk with your doctor Most people who are concerned about this do not have Cushing syndrome but it’s possible you have a different underlying condition Oregon Health & Science University. Cushing Disease/Cushing Syndrome National Institute of Diabetes and Digestive and Kidney Diseases. Cushing’s syndrome National Library of Medicine: MedlinePlus. Cushing disease Johns Hopkins Diabetes Guide. Cushing syndrome