We have the address for the funeral home & the family on file
If you're not happy with your card we'll send a replacement or refund your money
The family of Floris Austin Dunn created this Life Tributes page to make it easy to share your memories
© 2025 Davis-Struempf Funeral Home & Crematory
Made with love by funeralOne
1949 a daughter to the late Robert Whittemore and Floris (Bennett) Schell
She graduated from Warren High School in 1967 and from Jamestown Community College
She worked for the Warren YMCA pre-school and later for the WCSD as a Teachers Aide
PA and taught dance at Linda Dies Dance Studio for eighteen years
She loved dancing Zumba with her CA friends
Robin (Dave) Taydus and several nieces and nephews
A celebration of life will be held at alter date
Memorial donations may be made to UPMC Family Hospice
The Nelson Funeral Home & Cremation Services
Condolences to the family may be made at nelsonfuneralhome.net
Copyright © 2025 Ogden Newspapers of Pennsylvania
LLC | https://www.timesobserver.com | PO Box 188
Thanks for visiting
The use of software that blocks ads hinders our ability to serve you the content you came here to enjoy
We ask that you consider turning off your ad blocker so we can deliver you the best experience possible while you are here
In front of the new San Joaquin Delta College marquee a vigil was held for a person killed while walking their service dog in Stockton
was walking their service dog Thursday night on Pacific and Yokuts avenues on the sidewalk near the sign when they were struck by a vehicle
Floris was critically injured and their dog
had run off to Target in a nearby shopping center
The service dog had assisted Jay with periodic seizures they would face as a result of a work injury they suffered years ago
Stockton police officers responded to the area for reports of a vehicle collision involving a pedestrian
Delta College police officers were able to locate him
and booked into the San Joaquin County Jail
He is set to make his first court appearance on Monday
people could be seen walking from the Delta College parking lot to the scene where the hit-and-run took place carrying balloons
In the crowds of people walking to the area was Lillianna Herring
“She was the kind of person who literally brightened up a room when she walked in it," Herring said
"She always had a joke to tell … she was just always there for anybody that needed her.”
Some of Floris’s family members and friends were made aware of what happened to their loved one through a Facebook post
but they didn’t know who the victim was at the time
there was a post on Facebook about something happening to a young woman at Delta and her German Shepherd running off
trying to get ahold of the police station and I couldn’t get anybody,” Herring said
I called the hospital and was told she was there.”
had learned of what took place through a Facebook post
Reyes said she was at dinner with co-workers and they came across the post and began discussing it
On the road near where the vigil took place
tiny pieces of shattered glass still remained
as well as visible tire marks from the driver
One side of the Delta College marquee was destroyed
showcasing a visible pipe that was underneath the design
Herring said she was told that the driver was driving erratically and lost control
Just as the sun began to go down and the sky became dark
While some kept tiny candles in their hands and tears ran down their faces
others set their candle down near the marquette with flowers and a photo displayed of Jay
Herring laid down on the grass distraught with her sister's dog
Situated in the back was a crowd of Floris’s co-workers – Floris worked at the organization PREVAIL in Stockton as a crisis advocate
PREVAIL, previously known as Women’s Center Youth and Family Services
is a primary provider in San Joaquin County that gives free
The organization is specifically designed to meet the needs of homeless and runaway youth and victims of domestic violence
described Floris as a great child advocate and counselor
always there when we needed that extra hand,” Escudero said
Buck said since Floris and Mustang came as a pair she felt that they had lost two coworkers
A GoFundMe account was set up to assist with cremation costs. Donations can be made at https://www.gofundme.com/f/swd6z-help-us-lay-jay-to-rest
This website is using a security service to protect itself from online attacks
The action you just performed triggered the security solution
There are several actions that could trigger this block including submitting a certain word or phrase
You can email the site owner to let them know you were blocked
Please include what you were doing when this page came up and the Cloudflare Ray ID found at the bottom of this page
gives us a tour of the creative minds that have inspired his filmmaking career so far
Jim Phillips – Having ridden all types of boards in my life
and still at it (I surf several times a week and I’m building a mini-ramp in my backyard)
His Screaming Hand for Santa Cruz skateboards is iconic
and nobody’s giving Munch a hard time for it…
his ability to communicate distinctively without words
and the consistency in both visuals and concepts make him a painter beyond the usual.
A truly remarkable artist! Jim’s work shows advertising directors that you don’t need a 50-page deck to make an impact — just a screaming hand will do
Dixon (Steffen Berkhahn) – “Music is my first love and it will be my last…” – I hate that song
but the quote slaps! It pretty much sums up Blackmetaldeath. I’m constantly listening to music
switching from Ska to Slayer to Snoop to Sonic Youth faster than you can say “shuffle playlist.”
When I’m writing treatments, it’s all a bout techno
not that kind of techno — you know
You can actually see me doing fist-pumps behind my computer when shit goes down. Dixon is someone I keep on coming back to
and almost two decades in the game — dude’s a legend.
Can a DJ be considered a contemporary artist
or is he just a savvy entrepreneur? I think he deserves the benefit of the doubt because many great contemporaries walk that fine line
Edgar Wright – I’m a self-taught director and only found the "REC" button after getting a degree in Economics. I learned by watching a ton of movies & ads and hoping for the best
But if anyone’s got rhythm, it’s Edgar Wright
so I feel deeply connected to his choices and his uncontrollable need for rhythm
Groove in editing is something I can’t resist
Whether it’s comedic timing or visual
Whether through in-camera trickery or offbeat timing
let’s set the stage: to me great direction is about clear vision and making bold choices without being bold for bold sake
Bradford Young: Super
Tokyo 2020 – As you’re reading this on shots
I assume you’ve seen this ad more than once
next-level work from a director’s standpoint. The end result is emotional
Lionel Goldstein – The nihilist of adland
Like you are asking Sid and Nancy to shoot your ad
The paradox of them winning Lions at Cannes while not shooting many ads is beautiful
reflecting on the absurdity of advertising itself. They break all the “rules” and yet make brilliant ads
even though they probably wouldn’t want me to — and that’s precisely why they deserve it.
they always inspire me to second guess my treatment and keep on playing around in a world that doesn’t make sense.
Harold Einstein – His work is almost the opposite of Bradford Young’s
It’s not the number of choices that’s mind-blowing
it’s the extreme precision with which he makes them. Sure
his work may never win a director’s award because it looks so ridiculously simple
Harold Einstein is the Mondrian of adland.
Unlock full credits and more with a shots membership
Explore full credits, grab hi-res stills and more on shots Vault
you’re only as good as the teams around you — and thankfully
mine are brilliant (not just saying that because they might read this)
and enrich me (and my work). As I grow as a director
so does the quality of the talent I get to work with
Shooting in different countries allows me to collaborate with amazing people from all over the world
I’m actually surprised they want to work with me.
there’s the serious “focus” moment (pun intended)
but the rest is a playground of creativity.
I graduated in Economics and got a job as a producer at Amsterdam Television Network
If Ben Stiller can produce and direct a film
And here we are me writing an article in shots
Explore full credits, grab hi-res stills and more on shots Vault
but when an agency threw an IKEA script my way
they had no choice but to roll with it.
my way with words and music landed well as it has made me a two-faced Harvey Dent; Now I’m either doing comedy or artsy stuff.
A rockstar executive producer to filter the noise and guide you in the game of politics
They balance emotion and business with precision
keeping the process smooth while managing the client's and creatives' input
Good EPs are the key to making great ads.
the set would be like a free-for-all rave at 2 a.m
where all requests are played by the DJ but no one remembers them the next day.
Explore full credits, grab hi-res stills and more on shots Vault
A funeral attendee abducts the corpse after getting a whiff of his Lynx Blue Lavender body spray
I briefly directed a kids’ show before jumping into ads full-time
the stakes are higher — everything is pre-produced to perfection
The lower budget TV gigs taught me to improvise
Now I can shoot an ad with the precision of a Swiss watch
but still have that spontaneous edge.
I sponged a lot from all the great director’s surrounding me at various production companies but my drum teacher takes the crown
When I got to the choice to either apply for the conservatory to study drums or study economics he recommended the latter
might have been the only bad advice he ever gave me
Explore full credits, grab hi-res stills and more on shots Vault
Reasons why you’ll drive away happy every time
A lot has been written about the topic of AI. It’s inspiring and scary at the same time
What will happen to all those people surrounding me
Is there still the need of a storyboard artist
Do we still need a dolly if we can also render the camera movement
Do we still need to shoot at night if we can also render this lighting?
For me personally the obvious question arises: Can AI create a Floris Kingma style ad
Can you prompt “make it more Blackmetaldeath”?
more and more agency boards are created with AI
It becomes easier to visualise ideas for clients and this leaves less room for a director’s interpretation
It is exactly this interpretation in combination with the skill to tell a story that makes a director’s signature
I like to believe that it is this outspoken and distinct signature dish that we directors need to keep up with
As long as you have a clear and outspoken vision that requires multidisciplinary execution you can keep up with whatever development in AI.
I just got this message that there is a new tool to prompt that…
We speak with Kode Media director Michael Holyk about being a warhammer nerd
From Swedish pole vaulters to irreverent documentary series
MJZ's Niclas Larsson shares the people and art that have inspired his vibrant and varied career spanning acting
award-winning short filmmaking and commercial directing
is fascinated by brilliant people's obsessions
and is turning a childhood dream into a reality for his upcoming project
The Work Editorial editor talks us through the complex timelines
handy foot-coverings and romantic aliens that keep her creativity flowing
Click below to find out how to super-charge your shots Magazine experience with the world's most comprehensive advertising database
Fill out the form below to arrange a personalized demo and see how Shots can work for you..
Vincent Schaefer attends to an artificial snow cloud created in a cold chamber at General Electric Research Laboratory
courtesy of the AIP Emilio Segrè Visual Archives
In my doctoral research on the history of snowflake science
Vincent Schaefer plays an important role for his contributions to the field in the 1940s
His 1941 discovery of a method to preserve snow crystals indefinitely by fossilizing them in plastic garnered much attention both within the scientific community and outside of it
Grenander Special Collections and Archives
I was able to browse through dozens of letters from colleagues
and schoolchildren seeking advice on how to create their own snowflake fossils
another discovery—that dry ice can be used to induce snowfall in supercooled clouds—would cause the volume of incoming mail to balloon even more dramatically
with correspondents ranging from farmers to government agencies calling on his expertise in weather control
Many of these letters have also made it into his papers
alongside the numerous reports and depositions on the topic of experimental meteorology that he would produce over subsequent decades
Despite his meteoric rise from a General Electric surface chemist with no high school diploma to an internationally renowned meteorologist and weather-control expert
Schaefer maintained close relationships to his snowflake colleagues
One of these colleagues was Marcel de Quervain
He and Schaefer worked together on developing an international snow classification between 1948 and 1954
as well as exchanging research expertise between their countries
each hosting the other when they traveled between the US and Switzerland
Their collaboration was a microcosm of the cross-Atlantic exchange in snow and ice expertise during the postwar period
But Schaefer’s letters and journals also provide glimpses into the more personal and cultural aspects of their collaboration
my favorite was sent by De Quervain in late November 1948
after he had returned from a visit to the General Electric Research Lab in Schenectady
It hints at what it must have been like for a researcher working in a small Swiss mountain town to experience the US
and the immense buildings of American cities
there are homes as yours with beautiful family life was a result of our trip as important as the agreement on the snow classification.” As a researcher who also grew up in Switzerland
visiting the East Coast for the first time
I felt a moment of mutual understanding reading these words three-quarters of a century later
This report is reprinted from the Fall 2024 History Newsletter
For nearly 250 years, the Floris family has been operating out of the same storefront, located in the fashionable district of Piccadilly in the heart of London
both the eighth and ninth generations continue to ship fragrances and toiletries around the globe
Not only are they eagerly desired by members of the royal family
they are sought after by politicians and celebrities alike
In 1730, Juan Famenias Floris arrived in England from his native island of Menorca
(one of the Balearic Islands located in the Mediterranean Sea) with his wife Elizabeth to seek his fame and fortune in the Big Smoke
What began as a modest barber shop grew into a multi-million dollar industry shipping products around the globe
the Floris family would be granted their first Royal Warrant
an official decree that a business provides services or products to a member of the royal family
it was a smooth pointed comb fancied by King George IV
the Floris family would be granted no less than 19 more
including perfume warrants for Queen Elizabeth II
These Royal Warrants are on display in a mini-museum, along with a plethora of other objects that illustrate the company's prestige and significance within this Grade II listed building. Various displays are showcased in mahogany wooden cabinets that were initially purchased for the Great Exhibition, held at the Crystal Palace in Hyde Park in 1851
It includes a collection of products and paraphernalia associated with their world-renowned clientele
Florence Nightingale, Oscar Wilde, Winston Churchill
The museum is located at the back of the shop and is free to enter
This aromatherapy shop and mini-museum cofounded by the Sigur Rós frontman documents Icelandic history through scents
Nose around a unique collection of more than 300 natural aromas used to craft fragrances
Step back in time to explore 19th-century Appalachian life
this wine cellar is a time capsule underneath the Ministry of Defence
This museum and curiosity shop provides a glimpse into an often-overlooked past to show guests that there is beauty and wonder in the macabre
A collection of riverboats of the Spanish royal family in a quaint museum
The Spanish king's private bathroom embraced the idea of a porcelain throne
This innocuous-looking button may have been used to assassinate a king
SEARCHThe global authority in superyachting
Credit: Tom Van OossanenZeelander Yachts appoints new business development manager 17 January 2025 • by Gabrielle Lazaridis Dutch yard Zeelander Yachts has announced the appointment of Floris Koopmans as business development manager.
To continue reading... you need to register...
Gain FREE access to industry analysis, interviews with marine industry leaders and all the latest news as it happens.
SubscribeSign up to our newslettersSign up to BOAT International email newsletters to get the latest superyacht news
Boat International Media Ltd © 2008 - 2025
Content presented under the "BOAT Presents" logo is an advertising feature and Boat International Limited has been paid to include this content
A VMFA chef is a finalist in an international cooking competition
This article has been edited since it first appeared online
Chainey Kuykendall is executive chef at the Virginia Museum of Fine Arts
(Photo by Sandra Sellars © Virginia Museum of Fine Arts)
Afternoon tea at Floris (Photo by Monica Escamilla)
Chainey Kuykendall hasn’t been cooking for very long, but in just eight years, the ambitious executive chef — part of the team at the tearoom Floris
opened earlier this year at the Virginia Museum of Fine Arts — has landed herself on the global stage
Kuykendall participated in The Culinary Academy of France’s Best Chef Competition
for a chance to win Le Trophy Jean-Jacques Dietrich
sending her to France to participate with the first all-female USA & Canada Delegation
Drawn to science and eager for a degree with practical applications
Kuykendall began her education as a chemistry major
but she says she quickly realized it wasn’t the right fit
as the latchkey kid of a long-distance truck driver and a waitress
she would entertain herself by doctoring packets of ramen
coaxing original creations out of affordable ingredients
She decided to pursue a bachelor’s degree in culinary arts and made her way from her hometown of Mount Airy
where she attended Johnson & Wales University
working at a country club and a seasonally inspired bistro in Massachusetts
Kuykendall settled in Virginia to be closer to family
she felt drawn to the creative possibilities and secured a spot as the sous chef at the museum’s fine-dining restaurant
Kuykendall eagerly awaited the debut of Floris
she got the opportunity to create her vision on the tiered platters at the tearoom
“I think sometimes the afternoon tearoom concept can be a little constricting,” she says
it’s like an endless possibility to do a lot of little tiny bites of things and kind of warm people up to the idea of different kinds of cuisine that they haven’t had before.”
Now, at age 29, Kuykendall is back on the global stage as a regional finalist for the S.Pellegrino Young Chef Academy Competition
which is open to chefs under 30 who have been cooking professionally for at least one year
regional finalists were chosen by a team from ALMA
the International School of Italian Culinary Arts
who assessed the chefs’ signature dishes and backgrounds
called “My Mother’s Garden,” pays homage to the eponymous plot of land and to the chef’s culinary heritage
“The whole point of my dish is to represent my culture and my experience with the relationship of my mom and my grandmother,” Kuykendall says
“but it’s also about the seasonality and the locality of where I am now.” Kuykendall will represent Virginia through the inclusion of locally grown ingredients and by presenting her food on plates made by local potter Bear Ceramics
seasoned with dark soy and calamansi juice
a Filipino-style papaya pickle that represents the vibrant flowers in her mother’s garden
At its core are confit new potatoes and a creamy buttermilk velouté
which Kuykendall says are the heart of the dish
signify the relationship between her mother and grandmother
it was harvesting potatoes in the garden that brought the two women together
Kuykendall finishes her signature competition dish with annatto seed and carrot oil to mimic the bright orange fence that surrounds the garden
revealing a bit of the chef’s subtle humor
she serves a nest of chicken skin tuiles in homage to the neighborhood chickens that plague her mother’s produce
sprinkling the crispy skins over the dish for texture
Fellow chefs in the competition hail from restaurants such as New York’s Michelin-starred Eleven Madison Park
California’s pioneering The French Laundry and Chicago’s Indienne
VMFA Culinary Director and Senior Executive Chef Cody Dickey
where she’ll once again have the chance to represent the U.S
the chef will have five hours to complete 10 plates of her signature dish
which will be evaluated on technical skills
The judges will choose one Grand Finalist who will go on to compete at the Grand Finale in Milan in 2025
The scoreboard displayed a weather radar as evacuations were underway Sept
A lawsuit filed last Friday by Floris van Pallandt
the creator of the quiz used during the pregame period of the Michigan State University and University of Michigan game last year that depicted an image of Adolf Hitler two weeks after the Israel-Hamas war began
claims the university used his quiz without permission
who first posted the quiz on his Youtube channel
is suing MSU's Board of Trustees for copyright infringement and an invasion of privacy which placed him in a false light to the public
He is seeking at least $150,000 in damages
"This case arises out of Michigan State University’s unauthorized and intentional use of Plaintiffs' intellectual property at a sporting event."
The lawsuit also claims that once this theft was discovered attempts were then made to damage the reputation of Pallandt and his company
This initial broadcast was made by the athletic department
The question itself included an image of Hitler and was asking about his place of birth
the question was regarded with mostly negative attention
This then garnered media attention both nationally and internationally
Once the university chose to comment on the quiz question
its first response was to place blame on Pallandt and his company
"stating that the use of Hitler in the quiz was the fault of the company who created the quiz," Kennedy wrote
Pallandt believes the quiz should not have been broadcast at the game due to the context of current events
The lawsuit states if the university’s athletic department had reached out prior to the game
he would have created a quiz appropriate for the game
This incident also subjected Palladant and The Quiz Channel to ridicule and caused Palladant significant emotional distress
the company entered into an agreement with a third party which assigned two years of the revenue stream of quizzes to said party for a payment of $135,000
"Plaintiffs (Pallandt and Carilius Media) would not take any action that could impair the value of the revenue stream
nor would Plaintiff allow the value of the revenue stream to be impaired
nor would Plaintiff allow the Quiz Channel to be cast in a negative light," Kennedy wrote
Although this third party has not yet canceled the agreement
Pallandt remains concerned that this may occur
Palladant's legal counsel was not available for comment at this time
MSU spokesperson Mark Bullion said that the university has no comment at this time
Share and discuss “MSU sued by creator of quiz broadcast at football game containing image of Hitler” on social media
The 27-year-old man charged in the deadly hit-and-run of a woman last month in Stockton near San Joaquin Delta College was released on bail Monday
Jamaraqui Latice Burks is accused of killing 23-year-old Jazmine Floris on Oct
Burks did not appear in the jail custody log
a GPS monitor was to be installed prior to his release
Following the judge's decision to give the suspect bail
“He gets to be home for the holidays while our family is mourning the life he took,” Herring said
“We are angry and hurt that the justice system allows a man who took a life so recklessly and shows no remorse for doing so to be free.”
Stockton hit-and-run: Suspect charged with vehicular manslaughter, reckless driving
was walking their dog near Delta College moments before the fatal crash occurred
Prosecutors in the case alleged that Burks was speeding down Pacific Avenue near the college campus in a vehicle while attempting to swerve around another car
Burks struck the vehicle and began spinning off the roadway
At a vigil held by the victim's family following the death
shattered glass and pieces of the car were still visible at the scene
‘She’ll always be in our hearts’: Stockton mourns Jazmine Floris, killed in hit-and-run
Floris was critically injured and later died at a hospital from their injuries
“Jay (Jazmine) is missed by so many and our lives will never be the same,” Herring said
Burks allegedly fled the scene on foot and ran into the college campus where he was arrested by Delta College police officers
San Joaquin County Superior Judge Seth Hoyt denied the suspect bail because he had left the scene
Burks was charged with one count of vehicular manslaughter with gross negligence
a second count of reckless driving causing specified injury with infliction of great bodily injury
and another count of hit-and-run resulting in permanent injury or death
(This story has been updated to correct an inaccurate headline.)
A preliminary hearing has been scheduled for May in the case against a man accused of the fatal hit-and-run of a woman last October near San Joaquin Delta College in Stockton
Jamaraqui Latice Burks
is suspected of killing 23-year-old Jazmine Floris on Oct
Burks is being represented by private attorney Denise Pereira and entered a not guilty plea to all counts in February
Pereira did not respond to a request for comment on the case Friday
Burks was charged with vehicular manslaughter with gross negligence
hit and run resulting in permanent injury or death
and carrying a concealed firearm in a vehicle
including fleeing a crime scene and infliction of great bodily injury
the preliminary hearing was scheduled for May 7
The preliminary hearing is expected to begin at 8:30 a.m
San Joaquin Delta College: Nicaraguan asylum-seeker pursues passion for journalism
Stockton Police Department officers said they had responded to the area for reports of a vehicle collision involving a pedestrian
was found at the scene and taken to a hospital
Family members said Floris had been walking their dog near Delta College moments before the fatal crash occurred
Burks was released on a $100,000 bail and has continued to be out of custody with pretrial monitoring as well as a GPS monitor
said she and her family were told the bail setting was the judge’s decision
but they said they still feel devastated by the choice
“We are just doing our best to navigate it
It’s still devastating that the person who took someone we love from us gets to walk the streets and be with his family everyday,” Herring said
“We live in this community and we have our whole lives
so every day that he’s out and we’re out in the world
we run the risk of running into this person face to face in the common area.”
She said the thought of running into the person accused of her sister's death at a store is devastating to her
He has no repercussions right now,” Herring said
“His life gets to go on while ours is permanently stalled while this case drags out
The reality is that our lives can’t move on until this chapter is closed.”
Herring and her family still have many questions about the loss of their family member
they don’t feel they will ever get their questions answered
Why was he allowed bail when he not only left the scene of a fatal accident
but ran from the police as well?” Herring said
The Stockton Police Department has not indicated that drugs or alcohol were factors in the crash
Herring said although she and her family have continually attended the hearings
“Attending the hearings … it’s hard,” she said
“It’s like opening the wound over and over and over and over every time.”
Some family members decided to skip last month's hearing in order to celebrate Floris’s 24th birthday in Las Vegas
Herring said her sister had a bucket list of places they wanted to go and things they wanted to do
The family is trying to check off some of the places on their list
Herring said that she and her family are aware that the court process will be long
but they will continue seeking justice for Floris
“Our family is not going to stop until there is some kind of justice for Jay.”
Postdoctoral researcher David Stupski and Assistant Professor Floris van Breugel in front of the wind tunnel where they conducted their optogenetic experiment
Why do flies buzz around in circles when the air is still
2024 by the scientific journal Current Biology
Reno Assistant Professor Floris van Breugel and Postdoctoral Researcher S
David Stupski respond to this up-until-now unanswered question
And that answer could hold a key to public safety — specifically
how to better train robotic systems to track chemical leaks
“We don’t currently have robotic systems to track odor or chemical plumes,” van Breugel said
“We don’t know how to efficiently find the source of a wind-borne chemical
But insects are remarkably good at tracking chemical plumes
and if we really understood how they do it
maybe we could train inexpensive drones to use a similar process to find the source of chemicals and chemical leaks.”
A fundamental challenge in understanding how insects track chemical plumes — basically
how does the fly find the banana in your kitchen
— is that wind and odors can’t be independently manipulated
van Breugel and Stupski used a new approach that makes it possible to remotely control neurons—specifically the “smell” neurons— on the antennae of flying fruit flies by genetically introducing light-sensitive proteins
part of a $450,000 project funded through the Air Force Office of Scientific Research
made it possible to give flies identical virtual smell experiences in different wind conditions
What van Breugel and Stupski wanted to know: how do flies find an odor when there’s no wind to carry it
likely the wind experience of a fly looking for a banana in your kitchen
The answer is in the Current Biology article
“Wind Gates Olfaction Driven Search States in Free Flight.” The print version will appear in the Sept
Flies use environmental cues to detect and respond to air currents and wind direction to find their food sources
those cues trigger an automatic “cast and surge” behavior
in which the fly surges into the wind after encountering a chemical plume (indicating food) and then casts — moves side to side — when it loses the scent
Cast-and-surge behavior long has been understood by scientists but
it was fundamentally unknown how insects searched for a scent in still air
van Breugel and Stupski uncovered another automatic behavior
which involves lowering altitude and repetitive
Flies perform this innate movement consistently and repetitively
the most exciting aspect of this discovery is that it shows flying flies are clearly able to assess the conditions of the wind—its presence
and direction—before deploying a strategy that works well under these conditions
The fact that they can do this is actually quite surprising—can you tell if there is a gentle breeze if you stick your head out of the window of a moving car
Flies aren’t just reacting to an odor with the same preprogrammed response every time like a simple robot
they are responding in context-appropriate manner
This knowledge potentially could be applied to train more sophisticated algorithms for scent-detecting drones to find the source of chemical leaks
the next time you try to swat a fly in your home
consider the fact that flies might actually be a little more aware of some of their natural surroundings than you are
And maybe just open a window to let it out
Leading with safety: professor of microbiology and immunology recognized for displaying excellence in lab safety
and research team voted recipient of 2025 Excellence in Laboratory Safety Award
Engineering faculty developing wearable tech that could treat depression
Electrical & Biomedical Engineering Assistant Professor Jihwan Yoon’s device would deliver radiofrequency pulses to brain regions involved in mood regulation and cognitive function
Honoring faculty through awards and fellowships
Doctoral student and professor selected for prestigious International Science Education Institute
chosen to participate in the 2025 Abell Institute
2025 Three-Minute Thesis competition finalists announced
A peek into Nevada Woman Filmmaker of the Year’s newest documentary
Reynolds School of Journalism students awarded over $184,000 in scholarships
More than 60 students were honored at the annual Savitt Awards Banquet
Neighborhood ‘ambassadors’ needed to help prepare communities for wildfire
Reno and the Nevada Division of Forestry holding informational meeting May 7
Giving Day: The Wolf Pack Way raises over $750,000
Extension offers Home Horticulture Certificate Program
Program provides information for home gardeners and those interested in becoming Master Gardeners
College of Education & Human Development hosts first-ever Student Teaching Welcome Celebration
Students discover where they will be student teaching in Fall 2025
Sanford Center for Aging impacts older adults in northern Nevada
Sanford Center shares data and programs in the community
College of Business celebrates student success and research excellence
Annual banquet honors outstanding students
Reno programs offer locally grown plants to support local horticulture programs
Receive emails when new obituariesare published to our website
When you have experienced the loss of a loved one
you can trust us to guide you through the arrangements necessary to create a meaningful ceremony that celebrates the unique life being honored
Our staff is committed to providing your family with the highest quality care and service in your time of need
and we take pride in our responsibility to lighten your burden as you take the first steps toward healing.
Your browser may not work with certain site. Upgrade now.
Boutique Hotelier
Bankside Hotel has announced the appointment of Floris Kouijzer to the position of general manager
Kouijzer will oversee all aspects of hotel operations
managing the team and driving profitability
He will also be tasked with ensuring that guest satisfaction and visitation figures are retained
Kouijzer joins Bankside Hotel from London’s One Hundred Shoreditch
where he served as general manager from March 2023 until November last year
He also led other Lore Group properties across his eight-year tenure with the group, including serving as hotel manager of Sea Containers London and Hotel Pulitzer in Amsterdam
an Autograph Collection by Marriott property
is part of the Cycas Hospitality portfolio
Kouijzer commented: “It is a real privilege to join the Bankside Hotel team
a property dedicated to providing unbeatable guest experiences
showing a commitment to the local South Bank community and championing sustainability initiatives
I look forward to continuing shaping the development of this unique hotel and ensuring every guest not only enjoys their stay but remembers their experience for life.”
Kouijzer’s appointment follows the promotion of Philip Steiner
who stepped into the role of chief operating officer at Cycas Hospitality in February
Steiner said: “We are delighted to welcome Floris Kouijzer as the new general manager of Bankside Hotel
His extensive experience and passion for hospitality align perfectly with Cycas Hospitality’s commitment to delivering exceptional guest experiences
Bankside Hotel is renowned for its creativity and community-driven spirit
and we are confident that under Floris’ leadership
the hotel will continue to thrive as a vibrant destination in London.”
the six-storey Bankside Hotel comprises 161 bedrooms
the hotel also boasts multiple meeting and events spaces
Since prehistoric times, the urge to play has been a fundamental aspect of human nature. Playing with games and toys
offering an escape from the mundane confines of daily life
Floris Hovers has tapped into this intrinsic need with a series of toys designed for the Dutch brand IKONIC
merging functionality with whimsy to make this routine action one that is more joyful and conscious
These ‘playable design objects’ are distinguished from other toys on the market by the designer’s unique artistic vision
Hovers’ creations range from a DIY kit that transforms an old shampoo bottle into a delightful toy boat
to a set of architectural blocks that invite endless creativity
The collection also features a modern take on the nativity scene
and a limited edition mechanical crane fitted with a clothes peg
Each piece embodies a playful spirit while reflecting Hovers’ practical design philosophy
but artful objects that elevate everyday moments
Archiblocks | all images courtesy of IKONIC
professional designers were involved in their design
from the Bauhaus block set and chess game (1923)
to the elephants by Charles and Ray Eames for Vitra. Of more recent date is the Puppy by Eero Aarnio for Magis
whose goal was to make a dog in the way children illustrate their beloved pets
name: Playful Design designer: Floris Hovers
brand: IKONIC
designboom has received this project from our DIY submissions feature, where we welcome our readers to submit their own work for publication. see more project submissions from our readers here.
happening now! partnering with antonio citterio, AXOR presents three bathroom concepts that are not merely places of function, but destinations in themselves — sanctuaries of style, context, and personal expression.
from Caltech in 2014 in control and dynamical systems under the support of NSF and Hertz graduate fellowships while working with Michael H
He subsequently went to the University of Washington to work with Jeff Riffell and J Nathan Kutz as a postdoc to work on insect search strategies and machine learning approaches to system identification of complex systems
supported by a Sackler Fellowship in Biophysics and a Moore-Sloan-WRF Fellowship in DataScience
of Mechanical Engineering at the University of Nevada
I am currently hiring motivated undergraduates and Ph.D
students with interest in data-driven robotics and control
multi-modal sensory integration in insects
Learn more about our graduate programs
We study insects for inspiration in designing robust and novel control systems for robots
and virtual reality to study freely moving animals
aided by modern machine learning tools and control theory
and implement the principles on robotic systems
we use genetic tools available in the fruit fly to gain insight into how brains function
Luxury fragrance house Floris London has teamed up with Irish travel retail agency TR Partners as it seeks to bolster its global presence
Floris London is now available in travel retail with leading airport and cruise retailers
The brand will make its TFWA World Exhibition debut in Cannes at the TR Partners stand (Yellow Village
Founded in 1730 by Menorca-born Juan Famenias Floris in St
the fragrance house continues to be managed by his descendants
with the original shop remaining a key part of the business
Boasting notable figures such as Winston Churchill and Marilyn Monroe as historic admirers
Floris carries on its tradition of crafting premium fragrances for women
The popular women’s perfume range includes Night Scented Jasmine
complemented by a range of moisturising bath and shower products
Men’s offerings include signature colognes such as Elite and No
89 along with a collection of grooming and shaving essentials
Floris London is focused on building a strong presence within the competitive travel retail space
This strategic move reflects the brand’s core values of luxury
where the brand’s rich heritage is deeply rooted but it has also experienced exponential growth in the Middle East
the brand has partnered with Harding+ to present its offerings on all ships in the Cunard Fleet
including Queen Anne as well as other key fleets Seven Seas Grandeur
Floris London has also launched its collection within Avolta’s Haute Perfumerie concept at Zurich Airport
The brand will also be featured in Avolta locations at Kos
TR Partners Limited Managing Director Vincent McDermott said: “We are delighted to associate ourselves with Floris London
knowing the deep heritage and tradition of the brand in the luxury fragrance segment
Retailers in the travel segment are looking to elevate and differentiate their value proposition in luxury fragrance.”
Floris London Perfume Director Edward Bodenham added: “Floris London has forged a strategic alliance with TR Partners
to elevate its presence and engage with discerning travellers worldwide
“This collaboration marks an exciting chapter in Floris’ illustrious history
extending its reach to a vast network of international airports and luxury travel destinations
With TR Partners’ extensive expertise in the travel retail landscape
Floris London aims to captivate a global audience with its exquisite fragrances and timeless heritage.” ✈
Subscribe to our newsletter for critical marketing information delivered to your inbox
The Moodie Davitt Report is delighted to present the results of the inaugural TREX Awards
A trailblazing celebration of the finest travel retail-exclusive products and other initiatives
the TREX Awards recognise the critical need for differentiation within travel retail
shining a spotlight on innovations that deliver unique value to travellers
The highly regarded Mette Engell is charged with elevating the travel retail experience for beauty lovers
She replaces the much-respected Guilhem Souche
President and Chief Executive Officer Stéphane de la Faverie says
“Travel retail declined -28% organically [in Q3]
and it continues to shrink as a percentage of our business towards the low teens.” Worse is to come in Q4
he adds but lower base comparisons and a “strategic reset” underway will help in fiscal 26
Copyright © The Moodie Davitt Report | Website by Yellowball
We use cookies to ensure that we give you the best experience on our website
Please click on one of the buttons below to accept
We use cookies to help you navigate efficiently and perform certain functions
You will find detailed information about all cookies under each consent category below
The cookies that are categorized as "Necessary" are stored on your browser as they are essential for enabling the basic functionalities of the site
We also use third-party cookies that help us analyze how you use this website
and provide the content and advertisements that are relevant to you
These cookies will only be stored in your browser with your prior consent
You can choose to enable or disable some or all of these cookies but disabling some of them may affect your browsing experience
Necessary cookies are required to enable the basic features of this site
such as providing secure log-in or adjusting your consent preferences
These cookies do not store any personally identifiable data
Functional cookies help perform certain functionalities like sharing the content of the website on social media platforms
Analytical cookies are used to understand how visitors interact with the website
These cookies help provide information on metrics such as the number of visitors
Performance cookies are used to understand and analyze the key performance indexes of the website which helps in delivering a better user experience for the visitors
Advertisement cookies are used to provide visitors with customized advertisements based on the pages you visited previously and to analyze the effectiveness of the ad campaigns
' + scriptOptions._localizedStrings.webview_notification_text + '
" + scriptOptions._localizedStrings.redirect_overlay_title + "
" + scriptOptions._localizedStrings.redirect_overlay_text + "
Cinnamoroll is living his best life in this dreamy collage of adventures
From cuddling a teddy bear to floating with a balloon shaped like a cinnamon roll
What colors will you use to bring this nighttime wonderland to life
This page is perfect for children who love creating vibrant stories with their crayons
discover even more dreamy scenes on the Kleur-v-Kind website
This adorable coloring page shows Cinnamoroll surrounded by hearts and sparkling stars
It’s a great opportunity to experiment with glitter pens or bright colors to make the stars and hearts shine
What will you imagine in this twinkling scene
don’t forget to check out the Kleur-v-Kind website for more heartfelt Cinnamoroll pages
Hop on for a fun bike ride with Cinnamoroll
What colors will you choose for his bike and hat
This page is perfect for children who love imagining outdoor adventures while coloring
why not explore more of Cinnamoroll’s exciting journeys on the Kleur-v-Kind website
Enjoy these delightful scenes and let your creativity sparkle! Remember, the magical world of Cinnamoroll is just a click away at Kleur-v-Kind (Opens in a new window)
Van de Werken will make his Olympic debut in Marseille this summer
having enjoyed a dream campaign since Tokyo
Joining forces with Bart Lambriex in the men’s 49er
the Dutch pair have secured a hat-trick of world titles and will enter Paris 2024 as one of the favourites for gold
But where his partner is the son of a pair of elite sailors
with Bart’s dad Huub having competed in the Tornado at LA 1984
Van de Werken is the first of his family to excel in the sport
Growing up in a farming family in Holland’s rural north
but sailing was at most a passing interest
it was clear that it was the only sport for him
“My parents had a cruising yacht so we did sail on holidays
on the North Sea but that was an exception
my parents had to explore everything in the sailing world because they were not sailing parents
“They didn’t know they had to travel around Europe with their kids
It was a lot more work than they thought it was!”
While Van de Werken has been sailing at a high level for more than a decade
as British pair Dylan Fletcher-Scott and Stuart Bithell claimed gold
A post shared by TeamNL 🧡 (@teamnlinsta)
Lambriex decided he wanted to try something new in Paris
and when he got in touch with Van de Werken about the possibility of working together
Van de Werken recalled: “A month after the Olympics
Bart decided to do another campaign with someone else
He gave me a call and I didn’t have to think too long about it
“It was more luck at that moment than actual because we felt we lacked in a lot of areas
we feel like we have a much wider skillset which we can bring to the Olympics
That gives us good confidence going into the Olympics.”
This Olympic cycle has seen something of a changing of the guard in the 49er fleet
with all three pairs from the podium in Tokyo stepping away from the sport
New Zealand duo Peter Burling and Blair Tuke have turned their attentions to the America’s Cup
having won six world titles and three Olympic medals in a stellar 49er career
Lambriex and Van de Werken have filled the void
with that gold backed up in Canada and then on home waters in The Hague last summer
A post shared by Floris van de Werken (@florisvdwerken)
And while Van de Werken admitted that initially their success was based on a very specific strength
it is clear that they have become one of the strongest all-round duos in the fleet
He explained: “We are a lot of better in a wider range of conditions than we were in the first regatta
“That has changed over the years and what is nice now is that no matter the conditions
we are quite confident that we can win races
That was not the case when we had just started
We really grew into it and three years gives you time to grow as a team mentally.”
A post shared by Bart Lambriex (@bartlambriex)
Lambriex and Van de Werken saw their reign ended in Lanzarote in March
as French pair Erwan Fischer and Clément Pequin pipped them to gold
the Dutch duo have been the most successful crew in the fleet in this campaign are the team to beat in Marseille
even if they do not necessarily see it that way
Van de Werken said: “For me it has always been a dream to even compete at an Olympics and to be in a position where we can actually do something at an Olympics is a special feeling
A post shared by Floris van de Werken (@florisvdwerken)
we try to look at it as just another regatta
There is a lot of potential but I think we can say that both Bart and I are not too sensitive to pressure moments
“People around us might say that (we are favourites)
But we will never take the three world titles for granted
They have all been exceptionally good regattas for us
We’ve also been fourth or fifth or sixth at other World Cup regattas
If we reach the highest level we can reach
but the fleet is also strong enough to punish you very hard if you don’t reach the level that you can and make too many mistakes
The level of the fleet is too high for us to say we have won three Worlds so we are very confident that we can win the Olympics
“We’re very confident that if we reach our level
the Uruguayans are very good in the light stuff
So if we get a week of breeze or a week of light stuff
we’ll probably be in the mix but it’s not so clear who is going to win.”
We use Cookies to keep our website safe and secure, to enhance your website experience, to provide social media features and to help us analyse our site. To learn more about the cookies we use and to learn how to manage your cookie preferences, please see the Cookie Policy section of our Privacy Policy
What on earth is that man doing with his tie
Statement jackets and the latest sneakers are always going to be top of men's lust lists
A foundation on which flashier styles are built
Most people say it's your footwear that is the first thing people fix their eyes on - but we'd argue,..
We independently evaluate all recommended products and services
Any products or services put forward appear in no particular order
— it’s likely you’ve already got your appearance pretty down pat
But it’ll all be for naught if you don’t smell good
“Manners and a good cologne is what transforms the man into a gentleman,” said Tom Ford
which goes a long way to explaining why we fuss so much about picking the right one
that some of the most best-dressed gents of all time have used a signature scent to take their style game to the next level
They have the ‘knowledge’ and you can too with this whistle-stop tour of the finest fragrances to grace the bodies of your favourite style icons
The word ‘creed’ refers to a system of religious beliefs
which explains the legions of disciples who have worshipped every scent to come out of this perfume house since 1760
The brand’s story started with a pair of scented gloves that were sent to George III by the then London tailoring company. Its regal fragrances have since caught the nostrils of the reigning king of British menswear, David Beckham
who (as well as his own concoctions) is known to wear Erolfa and Aventus
The most popular Creed fragrance among the elite
which is a favourite of Hollywood royalty and permanently well-dressed gents like Robert Redford and Richard Gere
it’s an expectedly verdant smell with zingy
floral notes of lemon verbena and violet leaves
Floris can officially lay claim to being the oldest British seller of good smelling stuff
the brand still holds a store on London’s Jermyn Street where it all started nearly 300 years ago
Bond wasn’t the only British icon partial to the brand. Starman David Bowie wore Floris Elite
a markedly aromatic scent that leans heavy on top notes of grapefruit
best-known for his role playing British institution Sherlock Holmes
and fragrance – the French are undisputed world beaters
The luxury French perfume house has been honing its scents for nearly two centuries but didn’t create its first fragrance for men until 1959
The result was Guerlain Vetiver, a blast of freshness that is as evergreen as the bottle it comes in. Opening with a fruity trio of mandarin, lemon, and neroli
it’s long-lasting thanks to a smoky vetiver heart backed up by a strong tobacco base
All that smokiness has attracted many fine gentlemen including Indiana Jones himself, Harrison Ford, and one of our primary sources of inspiration for ‘60s-style tailoring
Acqua Di Parma, often referred to as ADP by those in the know, has become a bathroom status symbol, helped along by its Instagram-baiting bottles and aromas that purr with class
During the 1950s, the Italian perfume house from the town of the same name could count on silver screen legends Cary Grant and Gregory Peck as devotees
Both wore the signature Acqua di Parma Colonia
the very first scent it bottled which later became the definitive fragrance of Hollywood’s golden age
jasmine and light musk combines to create what you’d imagine an Italian garden to smell like and has now been adopted by the new guard of Tinseltown including Bradley Cooper who wore the ADP Barbiere range at the 2019 Oscars
It’s no exaggeration that Aramis broke new ground when it became the first men’s fragrance to be sold at department stores
and it’s still a game-changer more than half a century on
The scent was first released in 1964 and is characterised as a chypre (sheep-ra)
a special grouping of scents widely regarded as the most sophisticated and alluring of fragrance families
It therefore makes sense to find that the coolest cat in The Rat Pack, Sammy Davis Jr (sorry Frank), would lather it on daily. With a masculine blend of spicy cinnamon and vetiver bedded by that distinguishable leather base
who could blame the Candyman hit-maker for his olfactory obsession
The legend of Eight & Bob began one night in 1937 when Parisien amateur perfume concocter Albert Fouquet struck up a conversation with an exceedingly stylish American student who took a liking to Fouquet’s scent. That preppy dresser was none other than John F
Kennedy who on his return to the States asked if the fragrance connoisseur could send him eight samples of his perfumes
That’s the story of how the 35th president of the United States gave life to one of the most enduring fragrance brands of modern times
It wasn’t long before Fouquet was fielding requests from the creme de la creme of Hollywood’s leading men
The main note of Eight & Bob is kept firmly hush-hush but is believed to come from a rare plant Fouquet discovered on a trip to Chile
The smell is French sophistication bottled up – light
a little bit woody and supremely seductive with its botanic notes of violet
Another fabled fragrance house in the canon of French perfume history
Caron was founded in 1903 by Ernest Daltroff: a man with no formal perfume training
just an exceptional nose with which he could put together some of the best scents known to man
the first eau de toilette specifically marketed towards men on its release in 1934
but charmingly effective blend of lavender and vanilla
Among the multitude of fans Caron acquired down the years was Hollywood cultural cornerstone and owner of the best Harrington jacket there’s ever been
while French lounge lizard Serge Gainsbourg liked it so much
Fragrances by Carolina Herrera have been a by-word for elegance ever since the Venezuelan fashion designer was hanging out with Andy Warhol and Mick Jagger at New York’s Studio 54
In the early nineties
the label launched its first men’s fragrance
and it’s still the leader of the pack with a classic medley of bergamot and rosemary as the top notes
followed by sweet and spicy cloves in the middle and one of the best tobacco bases around to finish the scent off
It’s not a fragrance you’d immediately peg to the scumbro stylings of Justin Bieber
but the hitmaker is a loyal wearer of the enduring aroma
might have had a little something to do with that
Men's Watches
Men's Fashion
Men's Grooming
Copyright © 2025 Solid Ventures, Inc. All Rights Reserved.
All products featured on FashionBeans are independently selected by our editors. However, when you buy something through our retail links, we may earn an affiliate commission. As an Amazon Associate FashionBeans earns from qualifying purchases. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Solid Ventures, Inc.
This website uses cookies so that we can provide you with the best user experience possible. Cookie information is stored in your browser and performs functions such as recognising you when you return to our website and helping our team to understand which sections of the website you find most interesting and useful.
Strictly Necessary Cookie should be enabled at all times so that we can save your preferences for cookie settings.
If you disable this cookie, we will not be able to save your preferences. This means that every time you visit this website you will need to enable or disable cookies again.
Volume 16 - 2022 | https://doi.org/10.3389/fnbeh.2022.893835
Gamma-aminobutyric acid type B receptor (GABABR) has been extensively involved in alcohol use disorders; however
the mechanisms by which this receptor modulates alcohol drinking behavior remain murky
we investigate alcohol consumption and preference in mice lacking functional GABABR using the 2-bottle choice paradigm
and heterozygous (HZ) mice drank higher amounts of an alcoholic solution
and reached higher blood alcohol concentrations (BACs) compared to wild-type (WT) littermates
The GABABR agonist GHB significantly reduced alcohol consumption in the GABAB(1) HZ and WT but not in the KO mice
because of a functional crosstalk between GABABR and δ-containing GABAA receptor (δ-GABAAR)
we profiled δ subunit mRNA expression levels in brain regions in which the crosstalk was characterized
We found a loss of the alcohol-sensitive GABAAR δ subunit in the hippocampus of the GABAB(1) KO alcohol-naïve mice that was associated with increased ɣ2 subunit abundance
Electrophysiological recordings revealed that these molecular changes were associated with increased phasic inhibition
suggesting a potential gain of synaptic GABAAR responsiveness to alcohol that has been previously described in an animal model of excessive alcohol drinking
voluntary alcohol consumption did not revert the dramatic loss of hippocampal δ-GABAAR occurring in the GABAB(1) KO mice but rather exacerbated this condition
we profiled hippocampal neuroactive steroids levels following acute alcohols administration in the GABAB(1) KO and WT mice because of previous involvement of GABABR in the regulation of cerebral levels of these compounds
We found that systemic administration of alcohol (1.5 g/kg) did not produce alcohol-induced neurosteroid response in the GABAB(1) KO mice but elicited an expected increase in the hippocampal level of progesterone and 3α,5α-THP in the WT controls
we show that genetic ablation of the GABAB(1) subunit results in increased alcohol consumption and preference that were associated with functional changes in hippocampal GABAAR
suggesting a potential mechanism by which preference for alcohol consumption is maintained in the GABAB(1) KO mice
we documented that GABAB(1) deficiency results in lack of alcohol-induced neurosteroids
and we discussed the potential implications of this finding in the context of alcohol drinking and dependence
there is also considerable evidence supporting the involvement of metabotropic GABABR in alcohol-drinking behaviors and dependence
the mechanisms by which GABABR modulates alcohol drinking behaviors and favor alcohol dependence remain unclear
These findings raise the possibility that some effects of GABABR agonists on alcohol drinking and related behaviors might be mediated
we profiled hippocampal neuroactive steroids levels following acute alcohol administration in GABAB(1) knockout (KO) and wild-type (WT) mice
Balb/c GABAB(1) KO mice were generously provided by Dr. Martin Gassmann of University of Basel, Switzerland, and have been previously characterized by Schuler et al. (2001). Over the years, the mouse colony was back-crossed every 20 generations (F20) with a Friend Virus B (FVB) NIH Jackson mouse strain to obviate genetic drift (Fattuoni et al., 2020)
All the subjects were kept in our animal facility with an artificial 12:12 light/dark cycle and constant temperature (23°C) and humidity (65%); food and water were provided ad libitum
litters were weaned and genotyped by polymerase chain reaction (PCR) using specific primers and thermocycler conditions as follow: primer 1 targeting exon 10 (forward) 5′AGCTGACCAGACCTTGGTCAT ′3; primer 2 targeting exon 11 (reverse) 5′ AACTGGCTTCTCCCTATGTGG ′3; primer 3 NeoStart (reverse) 5′ATGGGATCGGCCATTGAACAA ′3; initial incubation at 95°C for 5 min
35 cycles of (denaturation at 95°C for 1 min
Only male subjects were used in all the experiments
experimental subjects were group-housed in standard propylene mouse cages (from 3 to 6 subjects/cage) and kept in a dedicated room away from the mating area
All the mice were euthanized (in the dark if needed)
This study was performed in accordance with the recommendations of the “Guidelines for Care and Use of Experimental Animals” issued by the Italian Ministry of Health (D.L
26/2014) and the European Union (2010/63/UE)
and the “Guide for Care and Use of Laboratory Animals” adopted by NIH
The University of Cagliari “Committee of Animal Use and Care” read and approved the experimental protocol
Absolute ethanol (alcohol) was purchased from Carlo Erba Reagents SRL (Milano
Alcohol solutions were prepared with filtered water; alcohol was dissolved in a sterile saline solution (sodium chloride 0.9%) for intraperitoneal (IP) injection
GHB sodium salt was purchased from Sigma-Aldrich (St
United States) and dissolved in the same sterile saline solution for IP injection
The dose of GHB in all the experiments was 100 mg/kg
while the dose of alcohol for IP injection was 1.5 mg/kg
GHB was injected at a volume of 10 ml/kg 15 min prior to beginning the test; alcohol was injected at a volume of 10 ml/kg 60 min before euthanasia and neuroactive steroids measurement
Control mice in all the experiments received an equivalent volume of saline solution
Limited access 2-bottle choice (2BC) drinking paradigm to study alcohol intake
and HZ mice during the total period (4 weeks) of 2BC exposition (WT
(B) Alcohol preference to water during the 4 weeks of 2BC; (WT
(C) Total fluid consumption recorded in GABAB(1) WT
and HZ during the 2BC drinking paradigm; (WT
and HZ mice was determined at the end of the last drinking session (WT
Post hoc test (**p < 0.01; *p < 0.05)
(E) Schematic representation of experimental timeline
All data are expressed as mean ± SEM
We performed an independent experiment using the same 2 h limited access 2BC drinking paradigm described above
Following the 8 days of habituation period
we divided the subjects for each genotype in two experimental groups (GHB and saline)
we treated the mice daily with GHB or saline 15 min before the beginning of the drinking session
Drinking behaviors were evaluated for 10 consecutive days
Spontaneous locomotors activity was performed as we have previously described in Sanna et al. (2011)
the mice were exposed to the experimental room for 2 h prior the beginning of the experiment and then received an IP injection of GHB or saline 15 min before beginning the test
Spontaneous locomotor activity was assessed by placing the subjects in the center of the 25 cm × 25 cm square arena of an infrared Actimeter (Harvard Apparatus
The subjects were left undisturbed to freely move for a total time of 60 min
the arena was thoroughly cleaned with 70% alcohol
Immediately after decapitation, blood samples (140 μl) were collected from the trunk with two heparinized capillary tubes, transferred to 1.5-ml test tubes containing 10 μl heparin, and mixed; 100 μl aliquots of blood was then subjected to BAC analysis by static headspace capillary gas chromatography/mass spectrometry following the same protocol that we previously described in Follesa et al. (2015)
The primer assay “QuantiTect” from Qiagen (Hilden
Germany) was used for measuring the following GABAAR subunits and housekeeping genes: GABAAR α4 (product number 249900
Brain slice preparation and whole-cell patch-clamp recordings were performed as previously described (Sanna et al., 2011)
recordings were made from neurons held at –65 mV using borosilicate glass pipettes (resistance
2.5–4.5 MΩ) that were pulled with a Flaming/Brown micropipette puller (Sutter Instruments
United States) and containing the following (in mM): 150 CsCl
pH 7.25–7.30 (osmolarity∼298 mOsm)
GABA-evoked Cl- currents were recorded by adding kynurenic acid (3 mM) to the extracellular aCSF recording solution
Voltage-clamp was performed with an Axopatch 200-B amplifier (Axon Instruments
Recordings were discarded if the access resistance was over 25 MΩ or changed by more than 20%
Data were filtered at 2 kHz and digitized at 5 kHz
Spontaneous inhibitory postsynaptic current (sIPSC) amplitude
and decay time were acquired using the pClamp 9.2 software (Molecular Devices
Tonic currents were recorded after 6 min of GABAAR δ partial agonist 4,5,6,7-tetrahydroisoxazolo[5,4-c]pyridin-3-ol (THIP
bicuculline (20 μM) was further added for blocking both phasic and tonic currents
To evaluate the tonic components of GABAergic inhibition
control) caused by drug perfusion were evaluated
All the reagents and drugs used were purchased from Sigma-Aldrich (St
All data are presented as mean ± SEM and were analyzed by appropriate one- or two-way analysis of variance (ANOVA) or Student’s t-test as described in the Section “Results.” The GraphPad Prism 9.0 software was used for all the statistical analyses
Significant main effects and interactions (p < 0.05) in the ANOVA were followed by post hoc test analysis
For all the behavioral and molecular experiments
Tukey’s multiple comparisons post hoc test was conducted with the exception of the GHB and neurosteroid experiments that were analyzed by Šídák′s multiple comparisons test
The two-way ANOVA revealed a main effect of genotype [F(2,63) = 12.44
p < 0.0001] and treatment [F(1,63) = 5.675
but there was no interaction between these two factors
Limited access 2-bottle choice (2BC) drinking paradigm to study the effect of GHB treatment on alcohol consumption in GABAB(1) WT
and HZ mice during the total period of 2BC exposition and GHB or saline treatment (n = 5/group)
(B) Spontaneous locomotor activity was recorded in GABAB(1) WT
and HZ mice; total distance traveled is expressed in cm/1h (WT saline
All mice in panels (A,B) received GHB (100 mg/kg) or an equivalent volume of saline 15 min prior to the test
Post hoc test (****p < 0.0001; **p < 0.01; *p < 0.05)
GABAA receptor s measurement in different brain areas revealed a homeostatic change in the hippocampus of GABAB(1) KO
mRNA level of the delta (A) and alpha4 (B) subunits in the hippocampus of GABAB(1) WT
Post hoc test (***p < 0.001; **p < 0.01) (n = 7/group)
Effect of genetic ablation of GABAB(1) on GABAergic tonic and phasic currents in granule cells of the dentate gyrus
(A) Representative traces of whole-cell mode recording of GABAergic tonic currents from GABAB(1) WT (left) and KO (right) mice
the application of 3 μM THIP increased tonic currents that were blocked by the application of 20 μM bicuculline (Bic)
Panel (B) shows the negative shift in the holding current following THIP application (WT
n = 10) and panel (C) shows the increase in noise variance compared to the baseline following THIP application (WT
All GABAergic currents in panels (B,C) were blocked by bicuculline
(D) Bar graphs represent the analysis of GABAergic spontaneous IPSCs (sIPSCs)
summarizing the changes in sIPSC amplitude expressed in picoampere (pA); decay time is expressed in milliseconds (ms)
(E) Representative trace of sIPSC amplitude highlighting the difference between GABAB(1) WT and KO mice
(F) mRNA level of the Gamma2 subunit in the hippocampus of alcohol-naïve GABAB(1) WT and KO mice
Unpaired t-test (*p < 0.05) (n = 3/group)
Effect of voluntary alcohol consumption on GABAA receptor gene expression
(A) Delta subunit mRNA level in the hippocampus of GABAB(1) WT
and HZ and mice at the end of the last drinking session of 2BC
(B) Bar graphs represent the analysis of alpha4 subunit mRNA level in the hippocampus of GABAB(1) WT
and HZ mice at the end of the last drinking session of 2BC
All data are expressed as mean ± SEM; (n = 10/group)
Post hoc test (*p < 0.05; **p < 0.01; ****p < 0.0001)
Effect of systemic alcohol administration on brain level of progesterone
3α,5α-TH-PROG (allopregnanolone
and 3α,5α-tetrahydrodeoxy corticosterone (THDOC)
(A) Levels of progesterone in the hippocampus of WT and KO mice 60 min after systemic alcohol or saline administration
Post hoc test (**p < 0.01) (WT saline
(B) Levels of AP in the hippocampus of WT and KO mice 60 min after systemic alcohol or saline administration
Genotype × treatment interaction is indicated with solid lines (#p < 0.05); unpaired t-test is indicated with dashed lines (*p < 0.05) (WT saline
(C) Levels of THDOC in the hippocampus of WT and KO mice 60 min after systemic alcohol or saline administration (WT saline
the natural proclivity of certain mouse strains to consume larger amounts of alcohol may account for this difference
We also ruled out the possibility that the reduction in alcohol intake was due to secondary effects (i.e.
because a corresponding dose of GHB did not reduce spontaneous locomotor activity in an independent cohort of mice
Site-specific loss of function studies targeting the hippocampus may help to address this important point
lack of GABABR may affect GABAAR exposition in the membrane
irrespective of subunit availability and abundance
future studies should consider profiling neuroactive steroids following acute and/or chronic alcohol drinking to better understand how steroidogenic pathways affect voluntary alcohol consumption in GABAB(1) KO mice
irrespective of these potential limitations
our study underscores the role of GABABR in alcohol drinking behaviors
highlighting the molecular and functional changes occurring in the hippocampus of GABAB(1) KO mice and offering a plausible mechanism by which preference for alcohol consumption is maintained in these mice
the lack of alcohol-induced steroidogenic activity in the GABAB(1) KO mice suggests that functional interactions among GABABR
and GABAAR may be more complex and intertwined than previously appreciated
The original contributions presented in the study are included in the article/supplementary materials
further inquiries can be directed to the corresponding authors
The animal study was reviewed and approved by the “Committee of Animal Use and Care” of University of Cagliari
GF and PF designed the experiments and wrote the manuscript
MS contributed to the design of the experiments
and supervised the experiment execution with PF
All authors contributed to data interpretation
This study was supported by Fondazione Banco di Sardegna
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations
Any product that may be evaluated in this article
or claim that may be made by its manufacturer
is not guaranteed or endorsed by the publisher
We are thankful to Daniela Isola and Angela Letizia Cappai for their valuable support during the behavioral experiments
Dose-response effect of baclofen in reducing daily alcohol intake in alcohol dependence: secondary analysis of a randomized
Novel therapeutic strategies for alcohol and drug addiction: focus on GABA
ion channels and transcranial magnetic stimulation
GABAB receptor ligands for the treatment of alcohol use disorder: preclinical and clinical evidence
Baclofen for the treatment of alcohol use disorder: the Cagliari Statement
Absence of association between delta and gamma2 subunits in native GABA(A) receptors from rat brain
CrossRef Full Text | Google Scholar
Recent Advances in the Potential of Positive Allosteric Modulators of the GABAB Receptor to Treat Alcohol Use Disorder
Hetero-oligomerization between GABAA and GABAB receptors regulates GABAB receptor trafficking
GABA(B) receptor-mediated increase of neurosteroids by gamma-hydroxybutyric acid
Time-dependent changes in rat brain neuroactive steroid concentrations and GABAA receptor function after acute stress
Molecular structure and physiological functions of GABA(B) receptors
Suppression of voluntary alcohol intake in rats and alcoholics by gamma-hydroxybutyric acid: a non-GABAergic mechanism
Withdrawal from chronic intermittent ethanol treatment changes subunit composition
and decreases behavioral responses to positive allosteric modulators of GABAA receptors
Gamma hydroxybutyric acid (GHB) for the treatment of alcohol dependence: a review
Relative abuse liability of GHB in humans: a comparison of psychomotor
and cognitive effects of supratherapeutic doses of triazolam
Neurosteroid Structure-Activity Relationships for Functional Activation of Extrasynaptic δGABA(A) Receptors
Mesial temporal lobe epilepsy: a pathological replay of developmental mechanisms
CrossRef Full Text | Google Scholar
Suppressing Effect of Baclofen on Multiple Alcohol-Related Behaviors in Laboratory Animals
Suppression by γ-Hydroxybutyric Acid of “Alcohol Deprivation Effect” in Rats: preclinical Evidence of its anti-Relapse Properties
The GABA(B) receptor agonists baclofen and CGP 44532 prevent acquisition of alcohol drinking behaviour in alcohol-preferring rats
GABAB Receptors Regulate Extrasynaptic GABAA Receptors
The complexity of alcohol drinking: studies in rodent genetic models
Don’t worry ‘B’ happy!: a role for GABA(B) receptors in anxiety and depression
The role of GABAA receptors in mediating the effects of alcohol in the central nervous system
PubMed Abstract | Google Scholar
Repeated intermittent alcohol exposure during the third trimester-equivalent increases expression of the GABA(A) receptor δ subunit in cerebellar granule neurons and delays motor development in rats
The role of GABA(A) receptors in the development of alcoholism
PubMed Abstract | CrossRef Full Text | Google Scholar
Two Genes Involved in Modulation of GABA Synaptic Transmission
Influence Risk for Alcoholism: results from Three Ethnically Diverse Populations
GABAergic gene expression in postmortem hippocampus from alcoholics and cocaine addicts; corresponding findings in alcohol-naïve P and NP rats
Metabolomic Analysis of Plasma from GABAB(1) Knock-Out Mice Reveals Decreased Levels of ElaidicTrans-Fatty Acid
GABAB receptors as a therapeutic strategy in substance use disorders: focus on positive allosteric modulators
Sex differences in the effect of ethanol injection and consumption on brain allopregnanolone levels in C57BL/6 mice
Chronic Intermittent Ethanol Regulates Hippocampal GABA(A) Receptor Delta Subunit Gene Expression
Site-specific microinjection of Gaboxadol into the infralimbic cortex modulates ethanol intake in male C57BL/6J mice
Allopregnanolone does not influence ethanol-induced conditioned place preference in DBA/2J mice
gamma-Hydroxybutyric acid in the treatment of alcohol dependence: a double-blind study
GBD 2016 Alcohol and Drug Use Collaborators
The global burden of disease attributable to alcohol and drug use in 195 countries and territories
1990-2016: a systematic analysis for the Global Burden of Disease Study 2016
CrossRef Full Text | Google Scholar
Which GABA(A) receptor subunits are necessary for tonic inhibition in the hippocampus
Effect of spontaneous seizures on GABAA receptor α4 subunit expression in an animal model of temporal lobe epilepsy
Intensity and duration of chronic ethanol exposure is critical for subsequent escalation of voluntary ethanol drinking in mice
Voluntary ethanol drinking in mice and ethanol concentrations in the nucleus accumbens
Behavioral action of ethanol in Porsolt’s forced swim test: modulation by 3 alpha-hydroxy-5 alpha-pregnan-20-one
Evaluation of GABAergic neuroactive steroid 3alpha-hydroxy-5alpha-pregnane-20-one as a neurobiological substrate for the anti-anxiety effect of ethanol in rats
Ethanol withdrawal-induced dysregulation of neurosteroid levels in plasma
and hippocampus in genetic animal models of high and low withdrawal
GABA transporter-1 (GAT1)-deficient mice: differential tonic activation of GABAA versus GABAB receptors in the hippocampus
Ethanol modulates synaptic and extrasynaptic GABAA receptors in the thalamus
Selective Changes of GABA(A) Channel Subunit mRNAs in the Hippocampus and Orbitofrontal Cortex but not in Prefrontal Cortex of Human Alcoholics
Specific gamma-hydroxybutyrate-binding sites but loss of pharmacological effects of gamma-hydroxybutyrate in GABA(B)(1)-deficient mice
Mechanisms of GABAB receptor enhancement of extrasynaptic GABAA receptor currents in cerebellar granule cells
Neuroactive steroid 3 alpha-hydroxy-5 alpha-pregnan-20-one modulates ethanol-induced loss of righting reflex in rats
PubMed Abstract | CrossRef Full Text | Google Scholar
The role of GABA(A) receptors in the acute and chronic effects of ethanol: a decade of progress
Effects of drugs of abuse on hippocampal plasticity and hippocampus-dependent learning and memory: contributions to development and maintenance of addiction
Enhanced macroscopic desensitization shapes the response of alpha4 subtype-containing GABAA receptors to synaptic and extrasynaptic GABA
Altered gamma-aminobutyric acid type B receptor subunit 1 splicing in alcoholics
Mechanisms of reversible GABAA receptor plasticity after ethanol intoxication
Chronic intermittent ethanol-induced switch of ethanol actions from extrasynaptic to synaptic hippocampal GABAA receptors
Chronic alcohol drinking persistently suppresses thalamostriatal excitation of cholinergic neurons to impair cognitive flexibility
Assembly rules for GABAA receptor complexes in the brain
Interneuronal δ-GABAA receptors regulate binge drinking and are necessary for the behavioral effects of early withdrawal
GABA(A)-receptor delta subunit knockout mice have multiple defects in behavioral responses to ethanol
Altered response to benzodiazepine anxiolytics in mice lacking GABA B(1) receptors
Morphine administration alters the profile of hippocampal postsynaptic density-associated proteins: a proteomics study focusing on endocytic proteins
Hypothalamic-pituitary-adrenal axis modulation of GABAergic neuroactive steroids influences ethanol sensitivity and drinking behavior
The role of GABAergic neuroactive steroids in ethanol action
Extrasynaptic alphabeta subunit GABAA receptors on rat hippocampal pyramidal neurons
Long-term use of benzodiazepines in participants with comorbid anxiety and alcohol use disorders
Extrasynaptic delta-containing GABAA receptors in the nucleus accumbens dorsomedial shell contribute to alcohol intake
Selective modulation of tonic and phasic inhibitions in dentate gyrus granule cells
Role of GABAA receptors in alcohol use disorders suggested by chronic intermittent ethanol (CIE) rodent model
Subtypes of gamma-aminobutyric acid(A) receptors: classification on the basis of subunit composition
Altered expression of the delta subunit of the GABAA receptor in a mouse model of temporal lobe epilepsy
Allopregnanolone (1938-2019): a trajectory of 80 years of outstanding scientific achievements
Divergent neuroactive steroid responses to stress and ethanol in rat and mouse strains: relevance for human studies
Differential effects of ethanol on serum GABAergic 3alpha,5alpha/3alpha,5beta neuroactive steroids in mice
Radioimmunoassay of 3 alpha-hydroxy-5 alpha-pregnan-20-one in rat and human plasma
Receptors with low affinity for neurosteroids and GABA contribute to tonic inhibition of granule cells in epileptic animals
Alteration of ethanol drinking in mice via modulation of the GABA(A) receptor with ganaxolone
Neurosteroids: endogenous role in the human brain and therapeutic potentials
Progesterone 5 alpha-reductase in mouse brain
CrossRef Full Text | Google Scholar
Escalation of intake under intermittent ethanol access in diverse mouse genotypes
Voluntary Ethanol Consumption Induced by Social Isolation Reverses the Increase of α(4)/δ GABA(A) Receptor Gene Expression and Function in the Hippocampus of C57BL/6J Mice
and loss of pre- and postsynaptic GABA(B) responses in mice lacking GABA(B(1))
Social isolation-induced increase in alpha and delta subunit gene expression is associated with a greater efficacy of ethanol on steroidogenesis and GABA receptor function
Social isolation-induced decreases in both the abundance of neuroactive steroids and GABA(A) receptor function in rat brain
Plasticity of GABAA receptors after ethanol pre-exposure in cultured hippocampal neurons
Two novel GABAA receptor subunits exist in distinct neuronal subpopulations
Receptors with different affinities mediate phasic and tonic GABA(A) conductances in hippocampal neurons
Neuroactive steroids reduce neuronal excitability by selectively enhancing tonic inhibition mediated by delta subunit-containing GABAA receptors
Diminished neurosteroid sensitivity of synaptic inhibition and altered location of the alpha4 subunit of GABA(A) receptors in an animal model of epilepsy
Sundstrom-Poromaa
Hormonally regulated alpha(4)beta(2)delta GABA(A) receptors are a target for alcohol
Preferential coassembly of alpha4 and delta subunits of the gamma-aminobutyric acidA receptor in rat thalamus
Postsynaptic GABAB receptors enhance extrasynaptic GABAA receptor function in dentate gyrus granule cells
Neuroactive steroid 3alpha-hydroxy-5alpha-pregnan-20-one modulates electrophysiological and behavioral actions of ethanol
Roles of GABAB receptor subtypes in presynaptic auto- and heteroreceptor function regulating GABA and glutamate release
Ethanol enhances alpha 4 beta 3 delta and alpha 6 beta 3 delta gamma-aminobutyric acid type A receptors at low concentrations known to affect humans
Low ethanol concentrations selectively augment the tonic inhibition mediated by delta subunit-containing GABAA receptors in hippocampal neurons
Neuroadaptations in the dorsal hippocampus underlie cocaine seeking during prolonged abstinence
Voluntary ethanol consumption in 22 inbred mouse strains
Altered localization of GABA(A) receptor subunits on dentate granule cell dendrites influences tonic and phasic inhibition in a mouse model of epilepsy
Serra M and Follesa P (2022) Increased Voluntary Alcohol Consumption in Mice Lacking GABAB(1) Is Associated With Functional Changes in Hippocampal GABAA Receptors
Copyright © 2022 Floris, Asuni, Talani, Biggio, Pisu, Zanda, Contu, Maciocco, Serra and Follesa. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY)
distribution or reproduction in other forums is permitted
provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited
in accordance with accepted academic practice
distribution or reproduction is permitted which does not comply with these terms
*Correspondence: Gabriele Floris, Z2FicmllbGUuZmxvcmlzODFAZ21haWwuY29t; Paolo Follesa, Zm9sbGVzYUB1bmljYS5pdA==
Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations
Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher
94% of researchers rate our articles as excellent or goodLearn more about the work of our research integrity team to safeguard the quality of each article we publish
Time Out Abu Dhabi
Sign up to our newsletter for the latest and greatest from your city and beyond
Home » News » Got early entry tickets to Coldplay in Abu Dhabi
Are you the proud owner of an Enhanced Experience Coldplay ticket
You may want to check the T&C’s as some of them allow you to get into the venue before the rest of the mere mortals
Yep, that’s right. Doors for the Coldplay’s Abu Dhabi concerts may officially open at 5pm
Take note – if you have one of these two tickets
you can secure your spot inside before the rest of the Coldplayers
you can enter the venue and head to the fanzones from 3pm
The Floris Early Entry Experience was the cheapest out of all the Enhanced Experience tickets
it gives you one general admission standing ticket plus early entry so you can secure a good spot
You’ll also get a Coldplay gift item plus a wristband
the Ultimate Spheres Experience was the most expensive out of the lot
exclusive merch and early entry to the venue
How long do Coldplay concerts last?Here’s how long the magic will last
Have a Coldplay Enhanced Experience ticket? Here’s what you’re in forHere’s what you need to know
Missed out on Coldplay tickets? This Coldplay brunch may be the next best thingA Coldplay extravaganza
An exceptional café where desserts are as dramatic as they are delicious
A hidden jazz bar made specifically for dessert-lovers
Lebanese-leaning seafood spot with views of the sea
Unexpected spot that serves up the best Vietnamese bowls in the city
Subscribe to Time Out Abu Dhabi’s newsletter to get expert
Log in via email
All your bookmarks will be available across all your devices
Password must be 8 characters long including one capital letter
Please confirm your email address and we’ll send you a link to reset your password
Single account access for STIRworld.com,STIRpad.com and exclusive STIRfri content
Verification link sent to check your inbox or spam folder to complete sign up process
or opt for the best experience by closing this banner
For more detailed information please read our Privacy Policy
A solo exhibition by The Netherlands-based artist at The Future Perfect Gallery in New York features a range of furniture designs and sculptures crafted from clay
by Mrinmayee BhootPublished on : May 24
The machines Wubben works with allow him to pressure-extrude large slabs of wet clay into diverse forms
the calibration and how one moves the instrument that is used presenting a clever balance between the handmade and machine aspects of the work
where the modules emulate the hollowed-out profiles of bricks
The juxtaposition of different modules that make up each piece also adds to their artisanal quality and uniqueness
the collection attempts to reconcile the material architectural heritage of New York—literally cemented in Dutch brick—and that of The Netherlands
Through the use of the ordinary brick as the material guide
the playful quality of the designs as expressed in his signature style adds to the distinctiveness of the collection and the earnestness of the work
and some of the last remaining giraffes in Central Africa
However, even at the time of UNESCO recognition, Manovo-Gounda St. Floris National Park was threatened by poaching of these charismatic species and by illegal transhumance (the practice of moving livestock from one grazing ground to another in a seasonal cycle)
the park was added to the List of World Heritage in Danger in 1997 due to combined effects of poaching
Sites are included on this list when they face serious threats to their OUV and serves as a call to action for the international community to take measures to protect and preserve these important natural landmarks
a Joint Reactive Monitoring Mission of the United Nations Educational
and Cultural Organization (UNESCO) and the International Union for Conservation of Nature (IUCN) requested by the World Heritage Committee concluded that Manovo-Gounda St
Floris National Park’s OUV had significantly degraded and suggested recommendations and corrective measures
including improving wildlife law enforcement and conducting a wildlife inventory
and it could not be ruled out that its OUV had already been irreversibly lost
it was impossible to confirm the irreversible loss of the property or to comment on the possibility of its regeneration
the mission accorded a five-year period from 2019–2024 to evaluate if an effective management system could be established
and if this would help to secure and restore the site’s OUV
With the above mentioned management agreement in place
an operational park management plan has been developed to address major threats to the site
the government has upgraded its security presence around the site reducing levels of security threats
To address poaching and all illegal activities at the site
The rangers have contributed significantly to the fight against poaching and supported overall conservation efforts at the site
Their commitment and achievements serve as an inspiration and a beacon of hope for the future of the site
Illegal transhumance and illegal grazing are major causes of conflict in the park
since they damage vegetation and compete with wildlife for food and water
This often leads to conflict between park rangers and pastoralists
who may also resent restrictions on their traditional grazing practices
The tango system serves to guide herders along designated corridors around the park to avoid incursions that harm biodiversity at the site
transhumance activities have successfully been rerouted outside of protected areas
decreasing illegal transhumance in the park to less than 3% of its initial value
Herders now seek the advice of tango guards on where to graze their livestock to ensure they are following the law
WCS reports that when the crisis broke out in neighboring Sudan in April 2023
some Sudanese herders who were unable to return to Sudan sought advice from these guards on where to settle with their livestock
These developments highlight the trust and credibility that the guards have gained within the community
By demonstrating that traditional transhumance practices can be effectively reconciled with nature conservation goals
the tango guard system provides a blueprint for other protected areas across Africa to adopt similar approaches
This approach not only mitigates the negative impacts of transhumance on biodiversity but also fosters a sense of stewardship among local communities
ensuring the long-term sustainability of conservation efforts
See related: How climate change could push African rhinos to extinction
In addition, a strong biomonitoring program has also been developed by recruiting, training, and deploying 32 ecological monitors (‘eco-monitors’) who survey wildlife populations at the site. Direct observation and indirect signs collected during biomonitoring patrols indicate the enduring presence of elephants and other charismatic species
By involving community members as ecological monitors
a sense of ownership and responsibility is fostered
creating a deeper connection between the people and the park
Large camera trap surveys were also recently planned
At the onset of conservation activities in 2019
local communities displayed a sense of resistance towards conservation-related initiatives taking place in the area
through persistent and ongoing awareness raising efforts
communities have now embraced the importance of conservation and actively collaborate with various stakeholders to safeguard the property
The process of sensitization involved engaging with the local communities and raising awareness on the significance of preserving the park’s unique biodiversity and the vital role it plays in maintaining ecological balance
By fostering a sense of ownership and instilling a deeper understanding of the long-term benefits that conservation efforts bring
the park management is bridging the initial gap between the communities and the conservation initiatives
Recently there were plans for construction of a road through the park
raising concerns about the potential negative impact on the park’s delicate ecosystem
in a commendable display of environmental consciousness
the CAR government made a pivotal decision to redirect construction of the road around the southern periphery of the park instead
This will ensure the economic and social development of villages there
as well as the protection of the park and adjacent wildlife reserves
While conservation efforts have changed the narrative and an operational management system has been established
The dedication and hard work of multiple conservation actors have led to the comeback of Manovo-Gounda St Floris National Park
there is still much work to be done in order to secure its future
The provision of financial support and expertise by the international community can play a vital role in achieving this
we can ensure that this unique and precious ecosystem is protected for future generations
Support should continue to be provided to the park management and regular monitoring missions should be carried out by UNESCO and IUCN to assess the progress of conservation efforts
in line with the desired state of conservation
toward the removal of this site from the List of World Heritage in Danger
The authors would like to pay tribute to Florent Zowoya
He dedicated most of his life to working for the preservation of this ecosystem
We express our deepest condolences to his family and the conservation community
Incentivizing conservation shows success against wildlife hunting in Cameroon
The “fortress conservation” model is under pressure in East Africa
as protected areas become battlegrounds over history
and global efforts to halt biodiversity loss
Mongabay’s Special Issue goes beyond the region’s world-renowned safaris to examine how rural communities and governments are reckoning with conservation’s colonial origins
and trying to forge a path forward […]
You are viewing your 1 free article this month
The Scottish indie Floris Books has acquired Azerbaijani-British author Fidan Meikle’s debut middle-grade novel
Editorial director Sally Polson bought world rights in a two-book deal with the author
The book will be published in the UK in spring 2025
The book will sit within Floris Books’ Kelpies imprint
The book was inspired by the true stories of young refugees and the author pitched the opening chapters at the Scottish BPOC Writers Network conference where Floris Books "recognised the story’s potential"
The synopsis says: "Thirteen-year-old Samim is a loyal friend
he makes a dangerous journey from Afghanistan to the UK
But even then his safety isn’t guaranteed: Samim must tell his story to convince the authorities to let him stay for good
facing bigoted bullies and trying to make new friends
Will Samim be granted asylum and allowed to stay in his new home?"
Polson said: "My Name is Samim is the heartbreaking yet hopeful story of a child refugee striving for a safe home and a better future
Young readers will be moved and inspired by Samim’s courage and resilience."
Sign up for our daily Newsletter and stay up to date with all the latest news
You are receiving this pop-up because this is the first time you are visiting our site
You are using software which is blocking our advertisements (adblocker)
we are relying on revenues from our banners
So please disable your adblocker and reload the page to continue using this site.Thanks
The changes in the field of crop protection (read: fewer and fewer agents are authorized) are going to have consequences in the short term
That is the prediction made by Floris Berghout of Viemose DGS
As a specialist in systems for growing on water
he sees the current market developments as an opportunity to use the promising technology much more widely than is already the case in Europe
Lettuce growing on water has been done for years
the market here is still somewhat reluctant
There are all kinds of explanations for this European reluctance
The vertical farming debacle of recent times
"Regular cultivation of water also suffers from this
and regular horticulture also notices this."
the CEO of the originally Danish company also notes that investors from the vertical farming market
have started to look more towards a greenhouse
or a hybrid cultivation system with greenhouse and multilayer cultivation again
So it doesn't always have to be entirely negative either
Floris Berghout (left) followed in Søren Kristensen's footsteps as the new CEO of Viemose DGS this summer
European slam market is lockedNow Floris is not negative anyway
but rather enthusiastic about the market opportunities and potential
Anyone who starts growing lettuce on water will have to make substantial investments
As long as there is still plenty of lettuce available from less capital-intensive crops
this makes the market for lettuce cultivation on water 'fairly locked up' so far
a grower really pushes his product to retail himself
The European grower mainly grows what the retail demands." At the same time
especially at a time when lettuce availability is coming under pressure as outdoor growers face climate extremes and a declining resource package
"And there are also considerable challenges in the greenhouse with a soil-based crop." Floris mentions Fusarium
"Growers can steam as long as they can bear the gas cost for this with a good gas contract
that already becomes a lot more difficult."
Who will be the parties that react first in case of tightness is the question
The Dutchman knows that covered lettuce cultivation on the water is being looked at by livestock farmers
"The advantage is that these kinds of large farmers are already used to high investments
is that they do not yet have cultivation knowledge."
Floris also started talking to supermarket buyers
"One already told me that he foresees big problems
large outdoor lettuce growers in particular will find it difficult
that is what the Dutchman foresees and predicts
the years 2025-2026 are going to be a turning point
That is why he is now busy making the 'gospel of hydroponics sing around'
He stresses that he is therefore certainly not talking only out of Viemose's interests
which has supplied systems for more than 700 hectares since the 1980s
but one also benefits from an overall development of the market
"There is more than enough market for everyone if we also get the market going," he says
one of the reasons that specifically in the Netherlands
where horticulture is often at the forefront of technical innovations anyway
lettuce growing on water has not yet taken over the entire market is the "good distribution" here
Logistics make it possible to get lettuce fresh and quickly to the right places
The availability of good growing areas for outdoor cultivation is decreasing
and so is the amount of product you can harvest per hectare because of challenges with climate and plant protection products
where a lot of arugula comes from outdoor cultivation
where Floris also visited the crop up close
growers are increasingly bothered by insects
Because they have fewer pest control options
they cannot grow as good produce or the number of kilos decreases
Joining forcesThe Dutchman hopes for a chain reaction
like earlier in the cannabis market and vertical farming
"Now the chain in Europe is still short and there is always lettuce to be had somewhere
We're not all going to wait until it's too late
His colleagues in engineering are calling on Floris to join forces
The systems for growing lettuce on water are already in place
Now the business case needs to be further optimized
Floris feels that the business case has long been looked at as being too rosy
"Maximum prices were only looked at at maximum production
at the opening of a new greenhouse with lettuce cultivation on water in Poland this winter
Good example leads the wayThe Dutchman sees plenty of opportunities for clustering technical knowledge
we are all sort of married to each other anyway
we have to complete the picture for growing on water." One challenge
is that Floris says there is still some reluctance in lettuce cultivation when it comes to sharing data
Possibly that explains the fear of competition
"If we pull in a few percent of outdoor cultivation
A good example of such a forward-thinking outdoor grower who has moved into lettuce growing on water
It is Smart Vegetable Innovations from Zdunów
"This grower has several thousand hectares of outdoor fields across Europe for all kinds of crops
who recently opened phase 2 which includes a Moving Gutter System from Viemose DGS
can gain experience and understand market dynamics
stresses that lettuce cultivation on water does not directly replace outdoor cultivation
"Outdoor cultivation will remain an essential part of our sourcing strategy for the foreseeable future
Our investment and growth in lettuce cultivation on water enables us to expand into new product categories
These products align with changing consumer preferences and sustainable growing practices
reinforcing our role as a diversified and innovative grower."
Floris advises other growers to take a step like the Polish grower did too
"Start small with lettuce cultivation on water
For almost every grower who dares to start growing from the ground
you can soon grow much more product than in open ground
That also intesting from an financial perspective."
In the greenhouse at Smart Vegetable Innovations
For more information:Floris BerghoutViemose DGS[email protected]www.viemose.nu
FreshPublishers © 2005-2025 HortiDaily.com
Thanks for visiting
Contact us: news@app.com.pk
Copyright © Associated Press of Pakistan
I run an interdisciplinary lab at the intersection of neuroscience
We focus on studying insects to learn how brains integrate information from different types of sensors across space and time to make complex sequences of decisions
and virtual reality to study freely moving flies
because of the powerful genetic tools available that make it possible to probe the brain during active behavior
and implement the principles on robotic systems to verify that they actually work
One area of particular interest is how insects use odor
and wind information to track chemical plumes
Floris van Breugel earned his PhD from Caltech in 2014 in Control and Dynamical Systems under the support of NSF and Hertz graduate fellowships while working with Michael H Dickinson on insect flight biomechanics
He subsequently went to the University of Washington to work with Jeff Riffell and J Nathan Kutz as a Postdoc to work on insect search strategies and machine learning approaches to system identification of complex systems
of Mechanical Engineering at UNR in January 2019
and is a member of the Integrative Neuroscience Program
Dutch designer Floris Wubben extrudes the common building brick into new applications – benches
The exhibition – 9 May to 21 June 2024 – reveals a series of sculptural furnishings in which the experimental talent had reinterpreted and pushed the limits of the ubiquitous building component
Rather than just work with the modular block as it is
decades-long-perfected extrusion technique to create an entirely new typology of elongated rectilinear and undulating forms
Self-built devices that resemble and riff on tried and true craft production processes are Wubben’s speciality
It's an approach perhaps best – previously – exemplified in the ‘Pressed’
‘Bunker’ and ‘Killing My Darlings’ collections
Lower Manhattan is cemented in Dutch bricks
'[The “Brick” project] celebrates the creativity and craftsmanship that defined this connection,' Wubben says
With this new architecturally inspired body of work
Wubben pays homage to the 400-year anniversary of Dutch settlers
primarily Belgian Walloon and French Huguenots
arriving in what is now Governor’s Island
the territory that would be codified as The Netherlands became the main supplier of the bricks responsible for New York’s rapid expansion
If that level of site responsivity and historical sensitivity weren’t enough
he worked with clay extracted from the Dollar Polder (a quintessentially Dutch concept defined as land reclaimed from the sea) not far from The Northern
Though it’s not directly linked to New York
Wubben chose to work with a pattern of brick directly associated with the town
'What makes each object distinct is the custom profile I introduce into these machines,' Wubben says
'It’s the thing that defines everything.'
the designer was able to arrive at a consistency and finish that was as close to the original as possible
but that could also be formed into elongated and sinuous shapes – combined as chandeliers
Playing with how this material can be curved
he also created large mirror frames and wall sculptures
escapism and design stories from around the world direct to your inbox
'I love this collection from Floris because you can really feel the connection to his cultural heritage come through,' said David Alhadeff
'The pieces are very utilitarian and are a departure from what we usually see from him.'
thefutureperfect.com
floriswubben.com
he’s held editorial positions at The Architect’s Newspaper
while also contributing to publications such as Architectural Digest
He helped write the Vincenzo De Cotiis: Interiors monograph
With degrees from the Design Academy Eindhoven and Parsons School of Design
Adrian is particularly focused on topics that exemplify the best in craft-led experimentation and sustainability
all created by a coalition between the hands and a machine
Studio Floris Wubben, Pressed from Studio Floris Wubben on Vimeo
thereby allowing him to extrude different (and endless) profiles that
combined with the way he moves the presser
The products romanticize old techniques in a new way
while emphasizing the meaning of human actions in creating objects
A beautiful range of unique “semi-manufactured goods,” Floris Wubben’s Pressed Objects bring back the human touch
See more of Floris Wubben’s designs on his website here
By providing your email address, you agree to our Terms of Use and Privacy Policy
Comment * document.getElementById("comment").setAttribute( "id"
"a2f36c3d1e439b94e218005dcf633a76" );document.getElementById("d57a537edf").setAttribute( "id"
and website in this browser for the next time I comment
By providing your email address, you agree to our Terms of Use and Privacy Policy
Let us know what you are looking for and we’ll help you find the home of your dreams
We’ll provide current market comps and connect you with a trusted expert
By providing your email address, you agree to our Terms of Use and Privacy Policy.You can unsubscribe at any time
By
Floris-Moore, MD, MS will deliver the lecture in honor of Adaora A. Adimora, MD, MPH. Adimora was slated to deliver the 2023 lecture, which was postponed in September 2023. Adimora passed away this past winter
“I’m deeply humbled to have been invited to give the Berryhill Lecture in honor of Dr
Adimora was a luminary in the field of Infectious Diseases and made exceptional contributions to HIV epidemiology and clinical care
It was a true privilege to call Ada my colleague and friend
and I will be forever grateful for her generous and forthright mentorship
The event will take place on Thursday, June 20, at 5:30 p.m. It will be held at the Roper Hall Active Learning Theater. Registration for the general public to attend this event will open on in late May and will be streamed on the Norma Berryhill Distinguished Lecture website for all to watch
Floris-Moore is an infectious diseases physician and clinician researcher with expertise in prospective cohort investigations of the impact of HIV-related inflammation on aging and cardio-metabolic risk
She provides outpatient care for HIV-infected adults in the UNC ID Clinic and inpatient care for adults with general infectious diseases and HIV on the ID Consult Service
She is an associate professor of medicine and former program director of the UNC Infectious Diseases Training Program
was a Sarah Graham Kenan Distinguished Professor of Medicine in the UNC School of Medicine and professor of epidemiology at the UNC Gillings School of Global Public Health
The Norma Berryhill Distinguished Lecture began in 1985. Established to honor the medical school’s “most able scientists and scholars,” the lectureship is named after the late Norma Berryhill, whose late husband, Walter Reece Berryhill, was dean of the school from 1941 to 1964. Click here to read more
Have a question? Need to reach the UNC Health News Team
Call: (984) 974-1140
UNC Health Social Media Terms of Use
Site Map