The dates displayed for an article provide information on when various publication milestones were reached at the journal that has published the article activities on preceding journals at which the article was previously under consideration are not shown (for instance submission All content on this site: Copyright © 2025 Elsevier B.V., its licensors, and contributors. All rights are reserved, including those for text and data mining, AI training, and similar technologies. For all open access content, the relevant licensing terms apply. Henrietta, N.Y. — The smooth sounds of jazz took over Lovin' Cup at Park Point. World-renowned contemporary jazz band Cabo Frio celebrated 45 years of music success with a performance Thursday night. The band chose to perform in the Rochester area, the place of their humble beginnings. Cabo Frio band leader Curtis Kendrick says it's all because of the fans, and the band looks forward to celebrating now and for many years to come. ExplorationPetrobras drills fresh well at Brazil mega pre-salt blockBrazilian oil giant working to delineate oil find in Alto de Cabo Frio Central block September 16, 2023JPEG When European explorers first surveyed the coastline of what is now the state of Rio de Janeiro in the early 1500s and lush green mountains rising from the sea were unusually cool—so much so that the promontory in southeastern Brazil shown above was named Cabo Frio The upwelling is primarily caused by the prevailing winds. Strong northeasterly winds that blow along the coast for much of the year—especially in the spring and summer—push warm surface waters away from the shore. This allows cool waters from deeper in the ocean to rise to the surface. Upwelled water is typically rich in nutrients that fuel populations of phytoplankton which in turn nourish marine ecosystems and contribute to Cabo Frio’s productive fisheries NASA Earth Observatory images by Lauren Dauphin, using Landsat data from the U.S. Geological Survey and data from the Multiscale Ultrahigh Resolution (MUR) project. Story by Adam Voiland View this area in EO Explorer People have long noticed that the waters around Cabo Frio are unusually cool The signs of economic activity around this Brazilian city are easy to see from space Unusually cloud-free skies allowed satellites to observe colorful phenomenon taking shape in the region’s coastal waters cool waters and abundant sunlight provoked a widespread phytoplankton bloom Metrics details The quantitative assessment of the carbonate system represents one of the biggest challenges toward the "Sustainable Development Goals" defined by the United Nations in 2015 the present study investigated the Spatio-temporal dynamics of the carbonate system and the effects of the El Niño and La Niña phenomena over the Cabo Frio upwelling area The physical characterization of the site was carried out through data on wind speed and sea surface temperature Water samples were also collected during the oceanographic cruise onboard the Diadorim R/V (Research Vessel) the parameters of absolute and practical salinity The highest average concentration of bicarbonate in S1 (2018 µmol/kg) seems to contribute to the dissolved inorganic carbon values (2203 µmol/kg) and carbonate were higher on the surface of each station (calcite saturation state = 4.80–5.48; aragonite saturation state = 3.10–3.63 The mean values of pH were similar in the day/night samples (7.96/7.97) The whole carbonate system was calculated through thermodynamic modeling with the Marine Chemical Analysis (AQM) program loaded with the results of the following parameters: temperature This manuscript presents original data on the carbonate system and the "acidification" process influenced by the Cabo Frio upwelling which directly depends on the El Niño and La Niña phenomena oscillations in the sea surface temperature This is conditioned to the power of events that affect the tropical and subtropical cyclone and anticyclone systems changing the intensity of the winds nearby the upwelling region and leading to an increase in the SST The influence of these phenomena in the Cabo Frio upwelling region has not yet been fully understood nor have their implications for the carbonate saturation state This experiment is part of an extensive study on the feasibility of implementing a unified protocol in a monitoring program for the acidification of coastal and offshore areas of the Brazilian ocean The present investigation originally elucidates the space–time dynamics of the carbonate system in the Cabo Frio resurgence and assesses La Niña and El Niño in the resurgence phenomenon Study area. Sampling stations are represented by dots and respective numbers (S1, S2, S3, and S4). This map was generated with the ArcMap software v. 10.8.2 (https://www.esri.com/en-us/arcgis/about-arcgis/overview) The authors found that when the SASA shifts poleward the SAM was in a positive phase of La Niña the SAM was in a negative phase during El Niño The wind speeds observed across Brazil can also describe this shift in the SASA pattern The data series of SST weekly averages referred to the period between 1994 and 2016 (data from the Admiral Paulo Moreira Marine Research Institute—IEAPM) Trend curves were also obtained relating the average wind velocity with the SST Pearson's R2 coefficient was used to assess data correlation The sampling campaign involved a two-scale analysis. The spatial scale was held perpendicular to the coastline (S1–S4), Fig. 1 The ship was anchored in station 12 for 12 h for the temporal scale Both campaigns were performed on the same day water was sampled from the surface (~ 3 m) between 6:30 and 10:00 h (UTC) using a pump adapted to a hose without forming bubbles The other water samples below the surface were collected through a Niskin bottle of 10 L for the middle (half of the total depth) and bottom (~ 5 m above the seafloor) the surface water samples were collected hourly (12 samples total) while middle and bottom water samples were collected in alternate hours: 13 were performed with a CTD vessel (Midas Valeport) The AQM is a package of thermodynamic equations which can predict the complex composition of the marine carbonate system This package is based on measurements that can be relatively inexpensively (pH reducing the overall costs of ocean acidification monitoring programs The AQM program is available upon request to the corresponding author’s email Non-parametric Kruskal Wallis test was chosen for comparisons between groups All statistical tests were performed using the Statistica 7.0 software (TIBCO) with a significance level set at p < 0.05 A Thermo Scientific Orion Star potentiometer coupled to the Orion glass reference electrode cell model 8102BNUWP was used for potentiometric determinations The pH electrode was calibrated daily with "Tris" buffer (0.04 m) for sample readings (maximum 12 samples per day) Due to the reduced number of samples per day the short period of the oceanographic cruise and the constant working conditions (electricity source we chose to verify the electrode performance at the beginning and the end of the oceanographic cruise The electrode's percent efficiency ranged between 99.49 and 99.54% concerning the theoretical Nernst value (59 mV) More details are available in hydrogen potential (pH) The normalized total alkalinity (NTA) was obtained by the AQM program using the equation: NTA (µmol/kg) = TA (µmol/kg) × 35/Salinity (g/kg) where 35 was assumed to be the representative salinity of the water masses The total pH of the water samples collected during the cruise was determined in the "wet laboratory" as follows: pHT (= − log([H+] + [(HSO4−]/co) where co is the thermodynamic concentration (1 mol/kg-soln) The internal solution of the combined pH electrode was filled up with 0.7 m NaCl to reduce the potential liquid junction. The electrode's electromotive force (emf) was related to the molar concentration of the proton [H+], as shown in Eq. (2) ${lnk}_{B}^{*}$53 ${lnk}_{Si}^{*}$54 ${lnk}_{1}^{*}$(H3PO4)55 ${lnk}_{2}^{*}$ (${H}_{2}{PO}_{4}^{-}$)55 ${lnk}_{3}^{*}$ (${HPO}_{4}^{2-}$)55 ${lnk}_{2}^{*}$ (${CO}_{3}^{2-}$)56 The CO2 flux equation between oceans and the atmosphere is defined between aqueous CO2 and saturated CO2, defined as follows (Eq. 3): Temperature of the longitudinal samples from the surface, middle, and bottom of the water column. Salinity of the longitudinal samples from the surface, middle, and bottom of the water column. Dissolved oxygen in the longitudinal samples from the surface Wind velocity at quadrants SW and NE (blue line) with the respective variation of sea surface temperature (SST) at the Cabo Frio/RJ upwelling area (circle with a vertical bar in red), showing the average temperature and the standard deviation between 09/2006 and 12/2016, according to mild (Weak), and moderate to strong (Mod. to Str.) El Niño and La Niña events. Temperature Grid of the Sea Surface Temperature (SST) at the Cabo Frio upwelling obtained by Kriging the SST data (1995–2016) Blue spots (cold): longer-term and intensity of the upwelling phenomenon Red blots (hot): longer-term and intensity of temperature anomalies Ellipse: SST in the period correspondent to the sampling campaign Hachured rectangle: Str—increased wind magnitude period (from 2010 to 2016); Weak—absence of the events of a mild El Niño (from 2012 to 2013); and Mod To Str—moderate to strong winds (from 2006 to 2010) but on a larger time scale as the El Niño periods considering stronger winds responsible for changes in the resurgence process pattern generating reflexes in the resurgence process local The author also found that the Cabo Frio resurgence phenomenon is related to the frequency of the El Niño and La Niña events causing changes in SST and the wind dynamics throughout the seasons affecting the nutrient transport and dispersion from the sea bottom to the surface in the upwelling vicinity Quantile–Quantile plot (QQ-plot) displaying the SST and Wind Velocity data distribution from 2006 to 2016 in the Cabo Frio upwelling area Greenline: NE wind intensity trend curve; blue line: SW wind intensity trend curve pH and Alkalinity of the longitudinal samples from the surface Calcite saturation state (ΩCalcite) and carbonate concentration (µmol/kg) of the longitudinal samples from the water column's surface characterizing the effects of the intense El Niño on the Cabo Frio upwelling system Temporal sampling. Temperature (°C), salinity (psu), aragonite, and calcite saturation state. X-axis: hour–day. Y-axis: coordinates of stations. Z-axis: Depth-m. Data sampled from 1:00 p.m. to 1:00 a.m. on the 20th and 21st of January 2016. Dissolved Oxygen (µmol/kg) and Carbon Dioxide Partial Pressure (atm) All these authors suggested the corrosive effect of upwelled waters (pH < 7.75 and ΩAr < 1.0) The El Niño Southern Oscillation might affect the upwelling intensity by raising the SST This climate phenomenon influences the carbonate system since these parameters are affected by SACW Calcium carbonate seems responsible for the increased values of TA in all studied stations DIC was influenced by bicarbonate concentrations from upwelled waters the effect of sunlight on the carbonate system parameters over 12 h was not observed the results of our study emphasize the importance of ENOS phenomena and the nodal cycle should be considered in studies of acidification of the oceans in resurgence areas Interdisciplinary studies with the implementation of a specific protocol for temporal and seasonal scales are necessary to understand the effects on biota and support climate change models The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request Inventory of water masses and carbonate system from Brazilian’s northeast coast: Monitoring ocean acidification Variability and transport of inorganic carbon dioxide in a tropical estuary Chester, R. Marine Geochemistry (Academic Division of Unwin Hyman Ltd, 1990). https://doi.org/10.1007/978-94-010-9488-7 Acidification of subsurface coastal waters enhanced by eutrophication Evidence for upwelling of corrosive ‘acidified’ water onto the continental shelf Fassbender, A. J., Sabine, C. L. & Feifel, K. M. Consideration of coastal carbonate chemistry in understanding biological calcification. Geophys. Res. Lett. https://doi.org/10.1002/2016GL068860 (2016) Predominance of heavily calcified coccolithophores at low CaCO3 saturation during winter in the Bay of Biscay Hofmann, G. E. et al. The effect of Ocean acidification on calcifying organisms in marine ecosystems: An organism-to-ecosystem perspective. Annu. Rev. Ecol. Evol. Syst. https://doi.org/10.1146/annurev.ecolsys.110308.120227 (2010) Watson, S. A. Giant clams and rising CO2: Light may ameliorate effects of ocean acidification on a solar-powered animal. PLoS ONE https://doi.org/10.1371/journal.pone.0128405 (2015) United Nations Summit on Sustainable Development 2015: Informal summary in 70th Session of the General Assembly 1–10 (2015) Data management strategy to improve global use of ocean acidification data and information Core principles of the California current acidification network: Linking chemistry Acidificação dos oceanos em um sopro: Prática educacional para construção de conhecimento das mudanças globais The impact of organic and intensive farming on the tropical estuary Lübbecke, J. F., Burls, N. J., Reason, C. J. C. & Mcphaden, M. J. Variability in the South Atlantic anticyclone and the Atlantic Niño mode. J. Clim. https://doi.org/10.1175/JCLI-D-14-00202.1 (2014) Estudo Das Massas D’água e da Circulação Geostrófica na Região Sudeste da Bacia Do Brasil COPPE/UFRJ (Universidade Federal do Rio de Janeiro Valentin, J. L. Analyse des paramètres hydrobiologiques dans la remontée de Cabo Frio (Brésil). Mar. Biol. https://doi.org/10.1007/BF00392407 (1984) Dereczynski, C. P. & Menezes, W. F. Meteorologia da bacia de campos. in Meteorologia e Oceanografia 1–54 (Elsevier, 2015). https://doi.org/10.1016/B978-85-352-6208-7.50008-8 The South Atlantic subtropical anticyclone: Present and future climate Position of the South Atlantic anticyclone and its impact on surface conditions across Brazil OCO-2 advances photosynthesis observation from space via solar-induced chlorophyll fluorescence Trends in the Southern Annular Mode from observations and reanalyses Niño/Southern Oscillation behaviour since 1871 as diagnosed in an extended multivariate ENSO index (MEI.ext) A corrente do Brasil ao largo da costa leste brasileira The shelf and coastal waters off southern Brazil Negative ocean-atmosphere feedback in the South Atlantic Convergence Zone Variação sazonal da estrutura de massas de água na plataforma continental do Amazonas e área oceânica adjacente On the water masses and mean circulation of the South Atlantic Ocean Shelf break upwelling driven by Brazil Current Cyclonic Meanders Estimativa da produção primária e biomassa fitoplanctônica através de sensoriamento remoto da cor do oceano e dados in situ na costa sudeste brasileira Physical oceanography of the western Atlantic continental shelf located between 4 N and 34 S Ritmo climático e extração de sal em Cabo Frio dois microclimas distintos a um curto intervalo espacial Isaaks, E. H. & Srivastava, R. M. Spatial continuity measures for probabilistic and deterministic geostatistics. Math. Geol. https://doi.org/10.1007/BF00892982 (1988) Methods for statistical data analysis of multivariate observations NOAA. GeoPlatform. NOAA Climate. https://noaa.maps.arcgis.com/home/group.html?id=b4e31886df6740b68f35953cfe15079f#overview (2019) Handbook of methods for the analysis of the various parameters of the carbon dioxide system in sea water; version 2 Measurement of pHT values of Tris buffers in artificial seawater at varying mole ratios of Tris: Tris·HCl Determination of alkalinities of estuarine waters by a two-point potentiometric titration Reference material for oceanic CO2 measurements Batch 104 (Bottled on June 11 Hunter, K. A. The temperature dependence of pH in surface seawater. Deep. Res. Part I Oceanogr. Res. Pap. https://doi.org/10.1016/S0967-0637(98)00047-8 (1998) Solubility of siderite (FeCO3) in NaCl solutions A precise and rapid analytical procedure for alkalinity determination Millero, F. J. et al. The use of buffers to measure the pH of seawater. Mar. Chem. https://doi.org/10.1016/0304-4203(93)90199-X (1993) Clayton, T. D. & Byrne, R. H. Spectrophotometric seawater pH measurements: total hydrogen ion concentration scale calibration of m-cresol purple and at-sea results. Deep. Res. Part I. https://doi.org/10.1016/0967-0637(93)90048-8 (1993) Thermodynamics of the carbon dioxide system in the oceans Ocean pCO2 calculated from dissolved inorganic carbon and equations for K1 and K2: Validation based on laboratory measurements of CO2 in gas and seawater at equilibrium Thermodynamics of the dissociation of boric acid in synthetic seawater from 273.15 to 318.15 K The chemistry of the anoxic waters in the Framvaren Fjord The dissociation constants of carbonic acid in seawater at salinities 5 to 45 and temperatures 0 to 45 °C Dissociation constants of carbonic acid in seawater as a function of salinity and temperature On the parameters influencing air–water gas exchange Measurement of the diffusion coefficients of sparingly soluble gases in water Relationship between wind speed and gas exchange over the ocean Variabilidade Interanual da Ressurgência de Cabo Frio UFRJ (Universidade Federal do Rio de Janeiro Impact of the astronomical lunar 18.6-y tidal cycle on El-Niño and Southern Oscillation Integrating hierarchical bioavailability and population distribution into potential eco-risk assessment of heavy metals in road dust: A case study in Xiandao District Aragonite saturation state in a monsoonal upwelling system off Java Biophysical interactions in the cabo frio upwelling system Guenther, M. et al. Plankton trophic structure and particulate organic carbon production during a coastal downwelling-upwelling cycle. Mar. Ecol. Prog. Ser. https://doi.org/10.3354/meps07458 (2008) Allemand, D., Tambutté, É., Zoccola, D. & Tambutté, S. Coral calcification, cells to reefs. in Coral Reefs: An Ecosystem in Transition 119–150 (Springer Netherlands, 2011). https://doi.org/10.1007/978-94-007-0114-4_9 The Omega myth: What really drives lower calcification rates in an acidifying ocean Proton channels in algae: Reasons to be excited Ocean acidification as a multiple driver: How interactions between changing seawater carbonate parameters affect marine life Calcium carbonate saturation state: On myths and this or that stories An inter-laboratory comparison assessing the quality of seawater carbon dioxide measurements Component-specific dynamics of riverine mangrove CO2 efflux in the Florida coastal Everglades Seasonal variability of the effect of coral reefs on seawater CO2 and air-sea CO2Exchange The partial pressure of carbon dioxide and air–sea fluxes in the northern South China Sea in spring On the seasonal variation of air–sea CO2 fluxes in the outer Changjiang (Yangtze River) Estuary Variability of the gas transfer velocity of CO2 in a macrotidal estuary (the Scheldt) Observations of pCO2 in the coastal upwelling off Chile: Spatial and temporal extrapolation using satellite data Download references or other support were received during the preparation of this manuscript All authors certify that they have no affiliations with or involvement in any organization or entity with any financial interest or non-financial interest in the subject matter or materials discussed in this manuscript Postgraduate Program in Dynamics of Oceans and Earth Thaise Machado Senez Mello & Nicole Silva Caliman Monteiro Anderson Araújo Rocha & Raimundo Nonato Damasceno Sedimentary and Environmental Processes Laboratory (LAPSA) Admiral Paulo Moreira Marine Research Institute Ricardo Coutinho & Lohengrin Dias de Almeida Fernandes Ecosystems and Global Change Laboratory (LEMG) International Laboratory of Global Change (LINCGlobal) All authors commented on previous versions of the manuscript All authors read and approved the final manuscript The authors declare no competing interests Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations Download citation DOI: https://doi.org/10.1038/s41598-023-31479-x Anyone you share the following link with will be able to read this content: Sorry, a shareable link is not currently available for this article. Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily. Volume 9 - 2022 | https://doi.org/10.3389/fmars.2022.867554 Symbiotic scyphozoan jellyfish are poorly understood in terms of their symbionts and traits as well as the ecological significance of this association Dinoflagellate symbionts of the medusae Cotylorhiza tuberculata and Cassiopea xamachana collected in the Mediterranean Sea and Cabo Frio (Rio de Janeiro Brazil) were phylogenetically identified based on 28S rDNA and ITS2 haplotypes The studied medusae harbour only one phylotype of symbionts in a time but scyphozoan jellyfishes can associate with several types of symbionts This study confirmed that the main symbionts of investigated scyphozoans belong to the genera Symbiodinium The associations between dinoflagellate symbionts and Cotylorhiza tuberculata changed from year to year hosting Philozoon one year and Breviolum another Invasive species in the Mediterranean Sea Phyllorhiza punctata harboured dinoflagellate symbionts of genus Symbiodinium as in the native areal Pigment analysis of two shallow-water symbiont species Breviolum sp and Philozoon medusarum revealed characteristic profiles for each genus horizontally transmitted symbionts are translocated into the host in each generation we used a phylogenetic approach using nuclear 28S rDNA and ITS2 markers to identify symbionts in Cotylorhiza tuberculata and Phyllorhiza punctata from the Mediterranean Sea during blooming period and Cassiopea xamachana collected at Cabo Frio (Rio de Janeiro symbionts were isolated from Cotylorhiza tuberculata and Cassiopea xamachana and cultivated symbiotic cells were used in cloning experiment to reveal the diversity of the ITS2 region of the dinoflagellate cells within individual host medusa Photosynthetic pigments of two different genera of symbionts from Cotylorhiza tuberculata were characterised Symbionts were isolated from live medusae by scraping cells from the subumbrella and oral arms immediately after collection Part of sample was stored for pigment analysis and another part was stored in cryotubes in 96% ethanol and kept at -80°C for DNA extraction Figure 1 Sampling sites of Cotylorhiza tuberculata and Phylorhiza punctata in the Mediterranean Sea and the sampling site of Cassiopea xamachana from the coast of Cabo Frio (Rio de Janeiro washing of about 200 to 300 cells with fresh sterile medium was continued twice a day for three days The strains grew best between 20°C and 25°C with a 12 h/12 h light/dark cycle 28S rDNA and ITS2 markers were amplified from the cultures of the symbionts and used for phylogenetic analysis DNA was extracted from scrapings of symbionts living in the oral arms and subumbrella of Cotylorhiza tuberculata Phyllorhiza punctata and Cassiopea xamachana as well as from cultured symbionts isolated from Cotylorhiza tuberculata and Cassiopea xamachana USA) was used for DNA extraction according to the protocol The symbiont cells removed from the host were stored at -80°C thawed on ice and ethanol evaporated in a vacuum concentrator before DNA extraction The 28S rDNA of the symbionts was amplified with dinoflagellate-specific primers (28Forward: 5’- CCC GCTGAATTTAAGCATATAAGTAAGCGG -3’ and 28Reverse: 5’- GTTAGACTCCTTGGTCCGTGT TTCAAGA -3’) designed by Zardoya and colleagues (Zardoya et al., 1995) at position 26 onward and reverse primers at position 741 containing the variable domain D1 and D2 The length of the amplified 28S rDNA fragments was approximately 630 base pairs The major components of the PCR mixture were added at the following concentrations: 0.625 unit TopTaq polymerase (Qiagen) 0.05 µg µL-1 bovine serum albumin The thermal profile included an initial denaturation at 94°C and an annealing temperature of 57°C for a total of 30 amplification cycles Due to the low amplification efficiency of some samples re-amplification with a further 25 cycles at an annealing temperature of 60°C was required; 5 µL of the PCR products were used as template and the final reagent concentrations were the same as for the previous PCR Amplification of ITS2 from symbionts was performed using a dinoflagellate-specific primer (ITSintfor2 5’ GAATTGCAGAACTCCGTG-3’), which annealed to a conserved region of the 5.8S rDNA, and the Chlorophyta-specific reverse primer (ITSreverse 5’- GGGATCCATA TGCTTAAGTTCAGCGGGT -3), as described by LaJeunesse (2002) The length of the amplified fragments was between 300 and 330 base pairs The optimal concentrations for PCR were 0.625 units of GoTaq polymerase (Promega and up to 10 ng of DNA in a volume of 20 µL The thermal profile of the touch-up PCR began with an initial denaturation step followed by annealing at a starting temperature of 52°C for 40 seconds with subsequent annealing at this temperature for a further 20 cycles 5 µL of the PCR mixture was transferred to a new tube to which the PCR reagents were added at the same concentration as the first PCR and amplified at an annealing temperature of 54°C for a further 30 cycles Sanger sequencing was performed at the commercial supplier Macrogen (The Netherlands) using the same primer pairs as the PCR Our aim was to reveal the diversity of the ITS2 region within the ribosomal operon of the symbiont harboured by Cotylorhiza tuberculata collected in November 2009 from the Mar Menor Lagoon (Balearic Sea) to verify mixed or homogeneous infection by symbionts in individual medusa DNA extraction and ITS2 amplification were performed as described above The PCR product (fragment length 330 base pairs) was cloned into chemically competent One Shot Top 10 cells from the TA Cloning Kit (Invitrogen USA) according to the manufacturer’s instructions A total of 273 transformants were screened of which 184 white transformants were transferred to Luria-Bertani medium with 10% glycerol and allowed to grow overnight before plasmid extraction and Sanger sequencing Samples of the isolated endosymbionts were extracted by sonication in 90% acetone and centrifuged at 4 000 rpm for 10 min to remove particles A mixture (1:1) of clarified extract and 1 mol L-1 ammonium acetate was injected into the HPLC system (1260 Infinity Agilent Technologies) equipped with a 3 µm C18 reversed-phase column (Pecosphere Perkin Elmer) to determine the composition of photosynthetic pigments (chlorophylls and carotenoids) in the endosymbionts Chlorophylls and carotenoids were detected by absorbance at 440 nm using a Diode Array Detector (DAD; Agilent Technologies Strains T1 and T5 are available in the Collection of Sea Microorganisms (CoSMi) at the Istituto Nazionale di Oceanografia e di Geofisica Sperimentale under strain numbers 1062 and 1065 Figure 2 Bayesian inference based on 28S rDNA sequences of symbionts from Cotylorhiza tuberculata and Cassiopea xamachana under the TIM3+I+G model Numbers at the nodes indicate posterior probabilities and sampling site; sequences from this study are in bold The ITS2 sequences of symbionts from Cotylorhiza tuberculata samples collected in the Vlicho Bay Lefkada (Ionian Sea) and the Adriatic Sea (Gulf of Trieste and Lake Mljet) belong to Philozoon medusarum and the Breviolum group symbionts collected in samples of Cotylorhiza tuberculata from the Mar Menor pertain only to the Breviolum group Several symbionts were found in medusae of Cotylorhiza tuberculata from the Gulf of Trieste the most common being members of genus Breviolum (type B2) though members of genus Philozoon were also found in 2010 and 2011 Symbionts from Phyllorhiza punctata (KP015090 and KP015089) collected in the Ionian Sea were identified as Symbiodinium sp The symbionts of Cassiopea xamachana were identified as Breviolum sp. We found that Philozoon medusarum forms a symbiosis with Cotylorhiza tuberculata and anthozoan Cladocora caespitosa (MG991827 Members of this large group can form symbioses with various hosts around the Mediterranean Sea The same group also includes the ITS2 sequences of symbionts from the anthozoan Paranemonia cinerea (Contarini 1775) from the Balearic Sea and the Algerian Basin Table 1 Contribution of four different pigments (chlorophyll c2 and β,β-carotene) with and without chlorophyll a This means that we could overlooked other types of symbionts we would like to emphasise that the identity of isolated strains and symbionts taken from the host prior the cultivation were confirmed by phylogenetic analysis during study But no distinctive features at light microscopic level could be found for the isolated strains For additional morphological information a careful examination at ultrastructural level (SEM) of the different clades and species is indicated as an important completion of the genetic The optimisation of photosynthesis is a clear example of these constraints The dilemma between optimal light exposure and low UV radiation requires balancing and adaptations by both partners their high metabolic activity and their sinuous folding This study also reveal that the endosymbionts revealed no significant differences in size neither chlorophyll a concentration within the oral arms and the umbrella Figure 3 Contribution of five different pigments (chlorophyll a ββ car) in the symbionts identified as Breviolum sp Balearic Sea; October 2010) and Philozoon medusarum (Gulf of Trieste August 2011) isolated from Cotylorhiza tuberculata Symbionts in medusae of Cotylorhiza tuberculata and Cassiopea xamachana collected in the Mediterranean Sea and from the coast of Cabo Frio (Rio de Janeiro Brazil) were identified by haplotypes of 28S rDNA and ITS2 We confirmed that the predominant symbionts in the investigated scyphozoan jellyfishes Cotylorhiza tuberculata belong to genera Breviolum and Philozoon while non-indigenous species Phyllorhiza punctata harbour Symbiodinium Cassiopea xamachana hosted Breviolum and Cladocopium symbiotic dinoflagellates The individual medusae studied harbour only one phylotype of symbionts at a time as confirmed with detailed analysis of the ITS2 region within the ribosomal operon of the symbiont although symbionts in zooxanthellate jellyfish can be different between years as we confirmed in Cotylorhiza tuberculata from the eastern Mediterranean Sea The population of medusae from Mar Menor hosted only symbionts of Breviolum while Breviolum and Philozoon were present in medusae from the Adriatic Sea the possession of zooxanthellae is a unique feature of scyphozoans jellyfish that allows them to occupy several niches compared to non-zooxanthellate species due to mixotrophic way of nutrition Haplotypes from this study are deposited in GeneBank under accession numbers listed in Tables S2, S3 in the Supplementary Material All authors contributed to the article and approved the submitted version Flander-Putrle was funded by the ARRS Research Program P1-0237 (Marine Coastal Research) and by the bilateral cooperation between Slovenia and Brazil (agreements BI-BR /10-12-005) and project RI-SI-2 LifeWatch financed by Ministry of Education Science and Sport of Slovenia and the European Regional Development Fund Raspor Dall’Olio was funded by the ARRS grant for young researchers (MR -33223) The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher who kindly provided samples for this study The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fmars.2022.867554/full#supplementary-material Morphologic and Genetic Variability in the Marine Planktonic Ciliate Laboea Strobila Lohmann 1908 (Ciliophora doi: 10.1111/j.1550-7408.2004.tb00567.x Ecological Aspects of Early Life Stages of Cotylorhiza Tuberculata (Scyphozoa: Rhizostomae) Affecting its Pelagic Population Success CrossRef Full Text | Google Scholar Flexibility and Specificity in Coral-Algal Symbiosis: Diversity doi: 10.1146/annurev.ecolsys.34.011802.132417 CrossRef Full Text | Google Scholar Molecular Diversity of Dinoflagellate Symbionts of Cnidaria: The psbA Minicircle of Symbiodinium Pigment Signatures of the Phytoplankton Composition in the Northeastern Atlantic During the 1990 Spring Bloom “Sea State: Recent Progress in the Context of Climate Change In Coastal Ecosystems in Transition,” in A Comparative Analysis of the Northern Adriatic and Chesapeake Bay Prevalent Endosymbiont Zonation Shapes the Depth Distributions of Scleractinian Coral Species Symbiodinium Diversity in Mesophotic Coral Communities on the Great Barrier Reef: A First Assessment Casado-Amezúa P. New Insights Into the Genetic Diversity of Zooxanthellae in Mediterranean Anthozoans CrossRef Full Text | Google Scholar “Cassiopea and its zooxanthellae.” In The Cnidaria Present and Future: The World of Medusa and Her Sisters (eBook) (Switzerland: Springer International Publishing AG) Google Scholar Differences of Ammonia Metabolism in Symbiotic and Aposymbiotic Condylactus and Cassiopea Spp CrossRef Full Text | Google Scholar Environmental Populations of Symbiotic Dinoflagellates in the Genus Symbiodinium can Initiate Symbioses With Reef Cnidarians Genetic Diversity of Symbiotic Dinoflagellates in the Genus Symbiodinium PubMed Abstract | CrossRef Full Text | Google Scholar Collins A. G., Jarms G., Morandini A. C. (2021) World List of Scyphozoa. Cotylorhiza Tuberculata (Macri 1778). Available at: https://www.marinespecies.org/aphia.php?p=taxdetails&id=135297on2021-12-26 Google Scholar Understanding Diversity in Coral-Algal Symbiosis: A Cluster-Based Approach to Interpreting Fine-Scale Genetic Variation in the Genus Symbiodinium CrossRef Full Text | Google Scholar CrossRef Full Text | Google Scholar CrossRef Full Text | Google Scholar Enrique-Navarro A. Living Inside a Jellyfish: The Symbiosis Case Study of Host-Specialized Dinoflagellates and the Scyphozoan Cotylorhiza Tuberculata Transmission Mode Predicts Specificity and Interaction Patterns in Coral-Symbiodinium Networks Phyllorhiza Punctata Von Lendenfeld 1884 (Scyphozoa: Rhizostomeae: Mastigiidae) Reappeared Off the Mediterranean Coast of Israel CrossRef Full Text | Google Scholar The Scyphomedusae of the Mediterranean Coast of Israel Including Two Lessepsian Migrants New to the Mediterranean Google Scholar Garcia-Cuetos L. Molecular Evidence for Host–Symbiont Specificity in Soritid Foraminifera Associations Within the Family Aiptasiidae a Monophyletic Lineage of Symbiotic of Sea Anemones (Cnidaria Effects of Island Mass: Water Flow and Plankton Pattern Around a Reef in the Great Barrier Reef Lagoon CrossRef Full Text | Google Scholar Nov.: A “Free-Living” Dinoflagellate From Tenerife (Northeast-Atlantic Ocean) 1 doi: 10.1111/j.1529-8817.2008.00621.x Carbon Metabolism and Strobilation in Cassiopea Andromeda (Cnidaria: Scyphozoa): Significance of Endosymbiotic Dinoflagellates CrossRef Full Text | Google Scholar The Genetic and Physiological Characteristics of the Symbiodinium Spp In the Endemic Anemone Anthopleura Aureoradiata Australia: Victoria University of Wellington) Google Scholar Structure and Evolution of the rDNA Internal Transcribed Spacer (ITS) Region 2 in the Symbiotic Dinoflagellates (Symbiodinium doi: 10.1111/j.1529-8817.2006.00309.x MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability Cotylorhiza Tuberculata (Cnidaria: Scyphozoa) - Life History of a Stationary Population.Mar doi: 10.1111/j.1439-0485.1992.tb00359.x CrossRef Full Text | Google Scholar and Phylogeny of Endosymbiotic Dinoflagellates in the Genus Symbiodinium Using the ITS Region: In Search of a “Species” Level Marker doi: 10.1046/j.1529-8817.2001.01031.x Diversity and Community Structure of Symbiotic Dinoflagellates From Caribbean Coral Reefs CrossRef Full Text | Google Scholar PubMed Abstract | CrossRef Full Text | Google Scholar Differ in Relative Dominance in Coral Reef Host Communities Across Environmental Do Introduced Endosymbiotic Dinoflagellates “Take” to New Hosts CrossRef Full Text | Google Scholar Low Symbiont Diversity in Southern Great Barrier Reef Corals Systematic Revision of Symbiodiniaceae Highlights the Antiquity and Diversity of Coral Endosymbionts A Genetics–Based Description ofSymbiodinium Minutum Sp Two Dinoflagellates Symbiotic With Cnidaria doi: 10.1111/j.1529-8817.2012.01217.x High Diversity and Host Specificity Observed Among Symbiotic Dinoflagellates in Reef Coral Communities From Hawaii Revival of Philozoon Geddes for Host-Specialized Dinoflagellates in Animals From Coastal Temperate Zones of Northern and Southern Hemispheres ““Cassiopea and its Zooxanthellae.”,” in The Cnidaria Present and Future: The World of Medusa and Her Sisters Google Scholar a Dinoflagellate Common to Indo-Pacific Giant Clams and a Revised Morphological Description of Symbiodinium Microadriaticum Freudenthal Use of Antibiotics for Maintenance of Axenic Cultures of Amphidinium Carterae for the Analysis of Translation CrossRef Full Text | Google Scholar Diversity of Symbiodinium Dinoflagellate Symbionts From the Indo-Pacific Sea Slug Pteraeolidia Ianthina (Gastropoda: Mollusca) High Photosynthetic Plasticity may Reinforce Invasiveness of Upside-Down Zooxanthellate Jellyfish in Mediterranean Coastal Waters "The Rapid Determination of Algal Chlorophyll and Carotenoid Pigments and Their Breakdown Products in Natural Waters by Reverse-Phase High-Performance Liquid Chromatography." Variation in Symbiont Uptake in the Early Ontogeny of the Upside-Down Jellyfish Changes in Coral Microbial Communities in Response to a Natural pH Gradient “On Dinoflagellate Phylogeny and Classification,” in Unravelling the Algae: The Past CrossRef Full Text | Google Scholar Acquisition and Proliferation of Algal Symbionts in Bleached Polyps of the Upside-Down Jellyfish Upside-Down But Headed in the Right Direction: Review of the Highly VersatileCassiopea Xamachana System Pérez-Ruzafa A. Evidence of a Planktonic Food Web Response to Changes in Nutrient Input Dynamics in the Mar Menor Coastal Lagoon Pestorić B. Scyphomedusae and Ctenophora of the Eastern Adriatic: Historical Overview and New Data Contrasting Contributions to Inorganic Nutrient Recycling by the Co-Occuring Jellyfishes Catostylus Mosaicus and Phyllorhiza Punctata (Scyphozoa A New Symbiodinium Clade (Dinophyceae) From Soritid Foraminifera in Hawai’i Environmental Control of Phase Transition and Polyp Survival of a Massive-Outbreaker Jellyfish Rambaut A. (2014) FigTree V1.4.2, A Graphical Viewer of Phylogenetic Trees. Available at: https://github.com/rambaut/figtree/releases Google Scholar Posterior Summarisation in Bayesian Phylogenetics Using Tracer 1.7 Raspor Dall’Olio L. (2016). Symbiosis Ecology of Selected Scyphozoa (Nova Gorica: Doctoral dissertation, University of Nova Gorica). Available at: https://repozitorij.ung.si/IzpisGradiva.php?id=2622&lang=eng&prip=rup:9058647:d4 Google Scholar Rodriguez-Lanetty M. Latitudinal Variability in Symbiont Specificity Within the Widespread Scleractinian Coral Plesiastrea Versipora CrossRef Full Text | Google Scholar MRBAYES 3: Bayesian Phylogenetic Inference Under Mixed Models PubMed Abstract | CrossRef Full Text | Google Scholar A Molecular Genetic Classification of Zooxanthellae and the Evolution of Animal-Algal Symbioses A Shift to Parasitism in the Jellyfish Symbiont Symbiodinium Microadriaticum doi: 10.1146/annurev.mi.31.100177.000543 Cohesive Molecular Genetic Data Delineate Species Diversity in the Dinoflagellate Genus Symbiodinium doi: 10.1111/j.1365-294X.2008.04037.x Genetic Comparisons of Freshly Isolated Versus Cultured Symbiotic Dinoflagellates: Implications for Extrapolating to the Intact Symbiosis doi: 10.1046/j.1529-8817.2001.00194.x Molecular Phylogeny of Symbiotic Dinoflagellates Inferred From Partial Chloroplast Large Subunit (23S)-rDNA Sequences Molecular Diversity of Symbiotic Algae at the Latitudinal Margins of Their Distribution: Dinoflagellates of the GenusSymbiodinium in Corals and Sea Anemones Specificity is Rarely Absolute in Coral-Algal Symbiosis: Implications for Coral Response to Climate Change The Evolutionary History of Symbiodinium and Scleractinian Hosts—Symbiosis Functional Diversity in Coral-Dinoflagellate Symbiosis CrossRef Full Text | Google Scholar Photosynthesis and Production of Hydrogen Peroxide by Symbiodinium (Pyrrhophyta) Phylotypes With Different Thermal Tolerances doi: 10.1111/j.1529-8817.2008.00537.x Natural Infections of Aposymbiotic Cassiopea Xamachana Scyphistomae From Environmental Pools of Symbiodinium Correspondence Between Cold Tolerance and Temperate Biogeography in a Western Atlantic Symbiodinium (Dinophyta) Lineage doi: 10.1111/j.1529-8817.2008.00567.x Mode of Zooxanthella Transmission Does Not Affect Zooxanthella Diversity in Acroporid Corals CrossRef Full Text | Google Scholar CrossRef Full Text | Google Scholar and Photophysiology of the Mangrove Jellyfish Cassiopea Xamachana Symbiotic With Zooxanthellae: Effect of Jellyfish Size and Season Molecular Diversity of Symbiotic Algae of the Genus Symbiodinium (Zooxanthellae) in Cnidarians of the Mediterranean Sea CrossRef Full Text | Google Scholar DAMBE5: A Comprehensive Software Package for Data Analysis in Molecular Biology and Evolution PubMed Abstract | CrossRef Full Text | Google Scholar Revised Dinoflagellate Phylogeny Inferred From Molecular Analysis of Large-Subunit Ribosomal RNA Gene Sequences Malej A and Ramšak A (2022) Diversity of Dinoflagellate Symbionts in Scyphozoan Hosts From Shallow Environments: The Mediterranean Sea and Cabo Frio (Rio de Janeiro Received: 01 February 2022; Accepted: 12 April 2022;Published: 13 May 2022 Copyright © 2022 Dall’Olio, Beran, Flander-Putrle, Malej and Ramšak. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) distribution or reproduction in other forums is permitted provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited in accordance with accepted academic practice distribution or reproduction is permitted which does not comply with these terms *Correspondence: Andreja Ramšak, YW5kcmVqYS5yYW1zYWtAbmliLnNp Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher 94% of researchers rate our articles as excellent or goodLearn more about the work of our research integrity team to safeguard the quality of each article we publish RIO DE JANEIRO, Brazil — Petrobras has completed a drillstem test (DST) on its recent 1-BRSA-1383A-RJS discovery (Alto de Cabo Frio Central Noroeste) in the presalt southern Campos Basin off Brazil The find is 230 km offshore Rio de Janeiro in a water depth of 1,833 m The DST assessed a thick interval of presalt carbonate reservoir rocks Collected oil samples will undergo laboratory analyses Petrobras credited the discovery on the strategy to apply new solutions and to maximize the use of the data including real-time processing during acquisition The partners plan further appraisal of the accumulation The Alto de Cabo Frio Central Block was awarded in October 2017 under the ANP’s third bidding round production sharing regime Beachgoers congregate on Fort Beach in Cabo Frio a cryptocurrency investment firm founded by Glaidson Acacio dos Santos a former waiter-turned-multimillionaire who is the central figure in what is alleged to be one of Brazil’s biggest-ever pyramid schemes was based in the beach town dos Santos called home Bathers dive into the waters of Fort Beach in Cabo Frio Brazil became one of the first countries in the world to approve Bitcoin exchange-traded funds where some had seen their friends and neighbors reap rewards by investing their life savings in the cryptocurrency investment firm G.A.S Consulting & Technology many began to fear the cost of missing out Mayor Jose Bonifacio listens during an interview in his City Hall office of Cabo Frio Bonifacio acknowledges his city found itself under a spell “The talk of the town was to know how much [bitcoin] was at A view of the luxury condominium where former waiter-turned-multimillionaire Glaidson Acacio dos Santos had a home in Cabo Frio the founder of G.A.S Consulting & Technology is the central figure in what is alleged to be one of Brazil’s biggest-ever pyramid schemes an alleged victim of the G.A.S Consulting & Technology walks off after an interview in Iguaba Grande Federal and state police and prosecutors accuse the firm of running a sophisticated racket defrauding thousands of small-scale investors who believed they were getting rich off bitcoin’s steep appreciation Do Carmo watched in horror as the seizures and arrests unfolded; he had invested the rest of his savings in the company just weeks earlier As revenues rose for the cryptocurrency investment firm G.A.S Consulting & Technology came to be known as the “New Egypt” and as the town’s top dog dos Santos was the “Bitcoin Pharaoh.” (AP Photo/Bruna Prado) during an interview in Sao Pedro da Aldeia a lawyer representing victims of G.A.S Consulting & Technology a cryptocurrency investment firm founded by a former waiter-turned-multimillionaire who has become the central figure in what is alleged to be one of Brazil’s biggest-ever pyramid schemes Brazil’s federal police stormed the helipad of a boutique seaside hotel in Rio de Janeiro state where they busted two men and a woman loading a chopper with 7 million reais ($1.3 million) in neatly packed bills The detainees told police they worked for G.A.S a cryptocurrency investment firm founded by a former waiter-turned-multimillionaire who is the central figure in what is alleged to be one of Brazil’s biggest-ever pyramid schemes Police say the company owned by 38-year-old Glaidson Acácio dos Santos had total transactions worth at least $7 billion ($38 billion reais) from 2015 through mid-2021 as part of a Bitcoin-based Ponzi scheme that promised investors 10% monthly returns In hundreds of pages of documents obtained by The Associated Press federal and state police and prosecutors accuse dos Santos and his associates of running a sophisticated racket defrauding thousands of small-scale investors who believed they were getting rich off Bitcoin’s steep appreciation He is now in a Rio jail awaiting trial on charges including racketeering financial crimes and ordering the murder and attempted murder of two business competitors He remains under investigation in the attempted murder of a third competitor dos Santos has repeatedly asserted his innocence His lawyers didn’t reply to AP requests for comment dos Santos represents an unlikely hero to his fervent supporters Many view him as a modest Black man whose unorthodox Bitcoin business made them wealthy by gaming a financial system they believe is rigged by wealthy white elites The case also underscores the fast-growing appetite for cryptocurrencies in Brazil where years of economic and political crises have made digital currencies an attractive shield against depreciation of the Brazilian real and double-digit inflation Bitcoin fervor was particularly keen in Cabo Frio A wave of cryptocurrency-related violence soon followed Cabo Frio came to be known as the “New Egypt.” And as the town’s top dog dos Santos was dubbed the “Bitcoin Pharaoh.” Police say dos Santos began trading in Bitcoin after leaving his job as a waiter in 2014 A one-time evangelical preacher in training he enlisted clients from the Universal Church of the Kingdom of God who earned a referral fee for bringing in fresh recruits and kicking back money to G.A.S. a cryptofinance researcher at Sao Paulo’s Getulio Vargas Foundation said religious groups are often targeted by pyramid schemers “It’s through contacts that you increase the base of the pyramid,” he said the Universal Church said it was cooperating with authorities and accused dos Santos of “harassing and recruiting” pastors and their flocks to join his company dos Santos was starting to make serious money — and attract authorities’ attention That year his company’s transactions totaled nearly 10 million reais ($1.8 million) 15 times higher than the previous year as money siphoned in and out of his bank accounts from all over Brazil The country’s financial intelligence unit also noticed the company — at the time registered as a restaurant — was regularly trading cryptocurrency on online exchange platforms according to prosecutors: Dos Santos would instruct clients to deposit their money – in cash to avoid further scrutiny – into bank accounts run by managing partners The money would then be transferred to dos Santos or his Venezuelan wife use it to buy bitcoins and other cryptocurrencies as well as traditional financial assets Clients were promised a 10% monthly return on their investments over 12- to 48-month contract periods but did not own the bitcoins they were told G.A.S it was risk-free: They would get their entire initial investment back at the end of the contract dos Santos was fast becoming a celebrity in Cabo Frio The chubby young man in thick-rimmed glasses was also gaining a taste for the high life Dos Santos bought expensive jewelry and a swanky apartment as contracts poured in from elsewhere in Latin America and as far away as the U.S. Brazil’s lenient laws regulating cryptocurrency helped fuel dos Santos’ rise Brazil’s securities regulator was making digital currencies more attractive: It authorized the country’s investment funds to invest in cryptocurrencies in 2018 Brazil approved Bitcoin exchange-traded funds only the second country in the world to do so And Rio de Janeiro has recently said it wants to offer incentives to those paying city property taxes using bitcoins trades in Brazilian reais on the world’s largest cryptocurrency exchange jumped to nearly $8.5 billion in the fourth quarter of 2021 from just $152 million over the same period a year earlier where residents had seen their neighbors reap rewards by investing their life savings in G.A.S. After catching COVID-19 and struggling to get back to work he was forced to tap his retirement savings to make ends meet Then his therapist told him he sold his house to invest in G.A.S. and had been receiving 10% monthly returns for a year Do Carmo invested 40,000 reais ($7,000) — just over half the money left in his retirement fund dos Santos’ success inspired other budding entrepreneurs to follow in his footsteps — not to mention those of Charles Ponzi who died nearby in a Rio de Janeiro hospital charity ward in 1949 The Italian immigrant who engineered one of the largest scams in U.S history in the 1920s was buried in a public Rio cemetery with his last $75 Some competitors promised even higher returns than G.A.S Cabo Frio Mayor José Bonifácio acknowledged his city found itself under a spell “The talk of the town was to know how much (Bitcoin) was at he discussed with associates how rivals were encroaching on his turf according to WhatsApp messages intercepted by federal police I can’t let that happen,” dos Santos wrote who advertised himself on social media as a cryptocurrency trader Police accuse dos Santos of ordering the hit Rio state police have also linked two attempted killings to dos Santos and what they called his “extermination team.” On March 20 a trader known as Nilsinho was shot while driving his BMW through Cabo Frio Three months later another firm’s operator was targeted his car hit by 40 bullets; he also survived Things came to a head on April 28 when Rio federal police seized the 7 million reais at the helipad of the Insolito Boutique Hotel in Buzios A monthslong investigation into dos Santos’ business followed alerted that dos Santos was planning to flee Brazil federal police raided more than a dozen locations linked to G.A.S. including dos Santos’ home where he was found with 13.8 million reais ($2.5 million) and taken into custody Agents also found hard drives containing 10 times that amount in Bitcoin including a white Porsche Panamera and an electric blue BMW Z4 convertible Sixteen other associates were also charged who left the country weeks before the raid and is believed to be in Florida They say she withdrew more than 4,300 bitcoins worth $185 million (1 billion reais) AP attempts to locate her were unsuccessful your entire life wash away from one moment to the next.” investors who had been receiving regular monthly payments refused to believe dos Santos did anything illegal a crowd gathered outside broadcaster TV Globo in Rio de Janeiro to protest coverage of the alleged racket scores of supporters blocked the street outside a federal courthouse in Rio said the company offered an attractive alternative to a banking sector that “only charges you fees.” offered investors a chance to “take part in the profit,” Brandão said “‘Instead of giving you a crumb of the cake he blamed the authorities for freezing G.A.S assets and “prohibiting me from paying you.” Brazilian law enforcement is still trying to uncover the true size of dos Santos’ empire Prosecutors have identified at least 27,000 G.A.S with operations in at least 13 Brazilian states and seven other countries He said one of his clients enlisted her husband investing a total 822,000 reais (about $150,000) “It’s hard to have a conversation with anyone in Cabo Frio who doesn’t know someone who invested,” he said Petrobras announced that it has discovered oil in the pre-salt in the Campos Basin’s southern portion in a wildcat well within the Alto de Cabo Frio Central block The well 1-BRSA-1383A-RJS (Alto de Cabo Frio Central Noroeste) is located 230 km from the city of Rio de Janeiro-RJ The consortium will continue to drill to the final planned depth to evaluate the dimensions of the new accumulation and to characterize the quality of the fluids and reservoirs found This discovery came as a result of a successful strategy of the consortium based on maximum use of data and on the application of new technological solutions in Big Data and Artificial Intelligence (AI) Petrobras acquired the Alto de Cabo Frio Central block in October 2017 during the third bid round offered by the National Agency for Petroleum with Pré-Sal Petróleo SA (PPSA) as manager Petrobras has operatorship of the block with a 50% stake in partnership with bp Energy do Brasil Ltda Fatma Ahmed is a staff writer with six years’ experience in Journalism She is working in the field of oil and gas for four years She also worked in the field of economic journalism for 2 years Fatma has a Bachelor Degree in Mass Communication Get all latest content delivered to your email a few times a month Learn how to describe the purpose of the image (opens in a new tab) Leave empty if the image is purely decorative ' + scriptOptions._localizedStrings.webview_notification_text + ' " + scriptOptions._localizedStrings.redirect_overlay_title + " " + scriptOptions._localizedStrings.redirect_overlay_text + " Parece que a página que você está procurando não está disponível Nossos serviços estão apresentando instabilidade no momento Algumas informações podem não estar disponíveis 2022 10h00 AM | Last Updated: November 01 “Negro entoou/ Um canto de revolta pelos ares/ No Quilombo dos Palmares/ Onde se refugiou” (A black man sang/ a revolt song out loud/ At Palmares Quilombo where he had found shelter”) The iconic song entitled “Canto das Três Raças (Three Race Song),” by Mauro Duarte and Paulo César Pinheiro in an unforgettable interpretation by Clara Nunes ballroom of the Mario Joaquina Quilombo on August 17th the community welcomed IBGE representatives teams from institutions such as the Land and Cartography Institute of Rio de Janeiro State (ITERJ) and the National Coordination of Rural Quilombola Communities (Conaq) and community residents on the Mobilization Day for the Quilombola Census very close to the place called Armação de Búzios and about 170 km far from the state capital the quilombo was one of the sites chosen for the official opening of the nationwide quilombola census in 20220 On this ocassion the IBGE presented the methodology of the census operation in those areas in order to encourage participation by the quilombola population the IBGE will have specific results for those territories “That will be important for the establishment of public policies aimed at this population segment,” says the technical manager for the Census The residents of such localities will have the opportunity to self-identify as quilombolas by answering the question “do you see yourself as a quilombola?” which is part of the questionnaire adminstered in these communities only the system will ask a second question: “What is the name of your community?” The 2022 Census application has a list of pre-registered communities but it will be possible to add quilombola comunities not previously listed Maria Joaquina expects to have a one-month long data collection period Mixed-breed dogs playing in non-paved streets represent a simple landscape but one that is marked by a history of fight and resistance The quilombola community is part of a huge territory which also encompasses the neighboring quilombolas of Rasa and Baía Formosa It is believed that farm owners received slaves even after slave trade had been abolished The territorial dispute dates back to the settlement period: the quilombolas claimed to have received tha area as a donation from Jesuit priests who were expelled from the place The community was named Maria Joaquina after a slave trader In “Social Cartography of QUIPEA (Quilombos in the Environmental Education Project)” which presents the history and geography of the community the territory “incorporates the history of enslaved ancestors by adopting the name of an ancient slave trader in order to represent resistance in their fight for freedom.” IBGE enumerator in the community and a resident of the José Gonçalves neighborhood estimates that the data collection work for the 2022 in Maria Joaquina will last about a month And he says he is happy for the warm welcoming of residents “I have already eunmerated some housing units and they were very kind to me.” The enumerators snd other members of the 2022 Census team who work in quilombola territories went through a specific day of training besides the methodology adopted in questionnaires Specific approach guides and a manual or the enumerator were also distributed to the agents who will work in these communities In order to guarantee data collection quality to speak with local communities and have a meeting with them to explain what the 2022 Census is they request help from community leaders and memebers in order to collect data enumerator João Gabriel will be helped by Clara Oliveira a manicurist who will work as his guide in the locality The work of a guide in the 2022 Census is to help in the enumerator’s safe visiting of all the housing units the most appropriate times for visits and the behavior codes they should follow “The community has open arms for the Census main leader of the community and a coordinator for Conaq adds: “The quilombo will welcome the Census with a sincerely open heart It is so important for us to be enumerated!” During the vaccination against Covod-19 we had a lot of difficulty having access to the vaccine and in knowing how many we were.” sanitation and health are reasons for maria Joaquina to eagerly await the survey results “The Census will reveal our true story and evidence the lack of public policies here It will show the portrait of a population that fights more and more for policies every day And the real conditions of quilombola life in Brazil will be known,” Ms She says the survey may help the quilombo obtain the awaited document granted by the National Institute for Colonization and Agrarian Reform (Incra) Maria Joaquina has been recognized by Palmares Foundation but its territorial status has not been regulated by Incra The legal action started in 2013 and its latest update was in July 2021 Challenges to cartography in quilombola areas One of the main challenges faced by the iBGE was to map the quilombola population “Além dos territórios quilombolas oficialmente delimitados informação que recebemos do Incra e dos institutos estaduais de terra procuramos retratar também todas as comunidades quilombolas fora desses territórios e todas as localidades onde pode haver população quilombola residindo” coordenadora do Censo em Povos e Comunidades Tradicionais A total of 5,972 quilombolas localities and 2,308 settlements will be enumerated They are part of 3,542 enumeration areas defined by the IBGE’s cartography department The officially delimitated territories will answer so that it is possible to present information as detailed as possible with data on education and more information that is part of this questionnaire only a geographer at eh and member of the Work Group of Traditional Communities and Peoples for the 2022 Census spoke about all the preparation phases for the census operation in quilombla areas She highlights that the IBGE followed the WTO’ Convention 169 which deals with the necessity of traditional peoples being consulted before being subject to administrative measures that have a direct impact on their lives “Consultation to local and regional leaders and to other bodies that work with quilombolas took place four times Having a partnership with them was very important,” she adds Vilanova says that both the construction of the question and all the work to be done counted on the help of other leaders “And Maria Joaquina was one of the communities chosen for the rehearsal in 2017 It is a very important locality in this process.” Conaq expects that the results released after the 2022 Census will strengthen quilombola communities in the process of granting rights to public policies helping the institution obtain from institutions the inclusion of quilombolas in governmental practices According to the executive director of Conaq ministry or body has a different data set on the quilombola population He hopes the 2022 Census will help unify these figures “This proposal of obtaining information is extremely necessary because there is no high quality or enough amount of information on the quilombola population in Brazil When the state acknowledges the existence of this population undoubtedly that will be the basis for the elaboratio of public policies,” Mr “The release of results will also be discussed in the post-census step in order to reach the best formats to help the quilombola population.” other communities took part in the Day o Mobilization of the Quilombola Census in the five Major Regions of Brazil: Muquém Quilombola Community (AL) Forte Príncipe da Beira Quilombola Community (RO) Alpes Quilombola Territory (RS) All the communities are being visited by enumerators wearing uniforms - an IBGE vest The information provided by informants will be kept secret and can be used for statistical purposes only Quilombolas living out of the territories can speak to the enumerator but who live outside the communities or territories not identified in the previous mapping can speak to the enumerator about their condition the IBGE will also have undercounting estimates of the quilombola population © 2018 IBGE - Instituto Brasileiro de Geografia e Estatística Nós utilizamos cookies para melhorar sua experiência de navegação no portal. Para saber mais sobre como tratamos os dados pessoais, consulte nossa Política de Privacidade. Cody Rego was a member of the North Run crew which had strong performances competing at the Tryon Fall 5 Rego and Cabo Frio DV Z won the Platinum Performance/USEF Talent Search 2 Class During the WIHS Equitation Jumper Phase Class the pair finished 4th competing in the WIHS Equitation Hunter Phase Class and Rego and Cabo Frio DV Z finished third in the WIHS Overall Class #Equestrian Category: All, Sports Documents from the Royal Society reveal the debate between State and Science, sparked by a shipwreck in Brazil National Library of Australia Painting Death of a ship This is the only known image of the shipNational Library of Australia Royal Museums Greenwich Painter and sailor John Christian Schetky described, in Salvage of Stores and Treasures from HMS Thetis at Cape Frio, Brazil, 1833, the recovery of the treasure.Royal Museums Greenwich Royal Museums Greenwich Captain DickinsonRoyal Museums Greenwich Dickinson constructed two diving bells from water tanks he had taken from the ship reinforcing them and installing glass windows to illuminate the interior He also prepared an air pump to supply oxygen given the backwardness of native workers,” the Royal Society document observes The Thetis had sunk in the center of the inlet Dickinson planned to string cables from one cliff to another in order to let the bell down “The captain said he had tremendous difficulties because of the arduous nature of the work exposure to the weather in their thatched huts and the dangers of the dives into the sea—a combination of terrors that the author is convinced could be overcome only by English sailors,” the summary found at the British institution recalls Dickinson also reports that the sailors had seen “five tigers on the beach.” Armed with rifles the Englishmen fired into the shadows and found that these were sea-pigs The “visit” by reptiles of frightening size a man “who would never be afraid of foolish things,” but the serpent did indeed “unnerve the strongest of them,” the English commander wrote It took several dives and a few deaths before the fortune in the Thetis could begin to be brought up from the bottom of the sea They lived in huts in a settlement they dubbed “St Thomas,” and where the captain fulfilled the obligations of an Englishman who worshiped his country He celebrated dates such as the Battle of Trafalgar This was one of the reasons why he had dismissed a group of Brazilians the “half-breeds” who had joined him at the beginning of the salvage operation the sailors invented codes for use between those who were on the bottom and those on the surface so as to advise each other whether or not the captain was around They worked 12-hour shifts without food or rest They had to remove the detritus that covered the wreck including bodies and spoiled food from the frigate The toxic gas almost killed a group of salvagers At the same time as Dickinson was using his bell in extremely rough seas was hailing as “a marvel” a similar operation that he was conducting in Portsmouth,” Martins observes The salvage of the Thetis was also one of the first occasions on which drawings of the seabed were made more was invested in the story of its salvage than in the report of its loss the event was a tribute to human perseverance in the presence of the devastating power of nature,” say Driver and Martins “Imperial eyes saw in this procedure a more or less coherent network through which information circulated until finally it was translated into established knowledge,” the researchers observe Royal Societya drawing of the diving bell drawn by his rival “The State and scientists changed their focus from the colonial positions on land to the vast unexplored areas of the oceans an intellectual space that teemed with commercial and imperial significance they elevated the status of the recently-defined ‘scientist.’ Just as they regulated and manipulated the ocean on paper the English Admiralty used the physical ocean to transport troops and British culture to ends of the earth,” observes American historian Michael Reidy author of Tides of History: Ocean Science and Her Majesty’s Navy (University of Chicago) British naval domination was the result of close collaboration between the Admiralty and the scientific elite they transformed the unclaimed immensity of the ocean into an organized network the modern scientist: one of the important links in that connection “Science broke down the limits of parsimonious support by the State in order to gain a much more generous and comprehensive financing for their research projects,” the historian explains Cases like the Thetis forced the system to improve its network of knowledge and showed that when the subject was the sea the more extensive the relationship between the State and science The scientists involved in the imperial project knew that studies about the sea were very costly to finance and that only a powerful country like England was able to sustain it “The ocean became the most fertile territory for research with funding from the State and an international group of scientists It was the interest in the ocean that turned science into a global task that depended heavily on support and participation by the government This totally changed the way of conducting and thinking about science,” Reidy notes The empire was subtly transformed by science; in turn the modern scientist was molded by the military demand for intelligence and control over the oceans “The interest in the fate of the Thetis on the part of the Royal Society fellows should be viewed in the context of those contemporaneous efforts to demonstrate the practical utility of scientific thought There was no better example of that than the science of navigation,” says Driver In his Preliminary Discourse on the Study of Natural Philosophy (1830) astronomer John Hershel portrayed the ideal scientific observer as a well-trained naval officer the route of a ship was like a kind of hypothesis based on meticulous astronomical observations and mathematic calculations that would be tested against the experience of a safe arrival at its destination If the ship was the instrument of the experiment its captain was the exemplary man of science the ‘experience’ of navigating in the absence of points of reference failed with catastrophic consequences for the captain and his crew the attribution of cause and effect was inseparable from that of responsibility and blame,” Driver and Martins observe it was necessary to explain what had happened in a scientific way One of the answers was directly connected to a debate that had taken place in the 1820s and 1830s when experts in the earth’s magnetism warned of the magnetic effects on ships’ compasses caused by the “local attraction.” “Iron ships were witnesses to the power that science played in the British domination of magnetic and oceanic currents But the fate of that industry was at stake because of the navigational problems that arose with the use of iron in shipbuilding because the hulls of ships caused changes in the compasses that left them rather unreliable,” says historian Alison Winter of the University of Chicago author of Compasses All Awry: the Iron Ship and the Ambiguities of Cultural Authority in Victorian Britain “When ships began to be lost because of their compasses the absence of a reliable means of correcting them threatened to sink scientists’ credibility in the eyes of the public.” According to Winter the subject of the disoriented compasses of lost ships was used to describe spiritual and intellectual uncertainty and the absence of clear “The same magnetic forces used in navigation were used to portray the way leaders exercised their power,” the historian explains The mixture of politics and science that dominated the Victorian period was already latent at the time of the Thetis That explains why the Admiralty invested more than £ 500 in research by Peter Barlow a professor of mathematics at the Royal Military Academy and member of the Royal Society “every ship carries within it an insidious disease,” i.e. In his 1831 exposition to the Royal Society Barlow used as example “the sad wreck of His Majesty’s ship the Thetis,” to debate that “fundamental question” and suggested that it was the cause of the disaster a large amount of iron had been used in its construction “Since precautions were not taken to correct the distortions of the local attraction I will not hesitate to state that this omission was sufficient to cause the accident,” he told the Royal Society audience “If science can be introduced to facilitate progress in navigation and help make it safer we cannot allow it to be disregarded in the British Navy,” Barlow added The scientific community’s interest in the Thetis was not limited to the causes of the shipwreck reports of Dickinson’s salvage operations were read at the Royal Society his successor in dealing with the ship’s remains and the first to submit a report to the Society’s fellows in 1833 According to the summary available at the institution “what was left of that poor ship was subjected to heavy pressure from the sea as if it were a hammer; the result was that a single mass was formed “on one occasion we were visited by an enormous whale that came very close to the diving bell The change of command happened against Dickinson’s will as he found himself pushed aside after all his efforts both men realized that the opportunistic order came from the commander of the British squadron in Rio who wanted the laurels and profits for himself This did not prevent a dispute from breaking out between them within the Royal Society while seeking recognition for the scientifically unprecedented salvage operation Dickinson also complained that in addition to suffering physical infirmities he had been forced to handle political issues in dealings with the Brazilians “I was always afraid of the envy of the Brazilian government about our remaining on the island I was accused of obstructing the activities of fishermen and later the city authorities of Cabo Frio went to investigate what the group of Englishmen were doing at St they were dumbfounded on seeing a town with comfortable houses None of them spoke a word of English and after filling me with more ‘Your Excellencies’ than I could stand they told me they had come to see with whether this was an invading force.” Dickinson boasting of having learned Portuguese to such a point that he couldn’t be beat in terms of number of “Your Excellencies,” showed the officials his “fortification,” a term he used sarcastically The Brazilians were frightened by what they took to be a cannon shot and the Englishman had fun describing his difficulty in making them understand that the noise came from the air jet of the diving bell’s pump everyone drank to the health of William IV the island had been a fishing station that had grown steadily since the 16th century And so Dickinson’s remarks that it was thanks to the English that the town had grown are not valid Nor is it surprising that a military force camped out for 18 months had worried the Brazilian government,” Driver and Martins observe there was no reason to pay for lumber and other materials because everything on the island “was available and could not be considered anyone’s property,” reminders of the myths about tropical abundance But they ended up having to pay rent for use of the space a small price to pay for redemption of the failure implicit in the wreck of the Thetis Although even today it is not known what caused the end of the frigate it was on a Brazilian island that science was able to recoup the self esteem of the British naval empire © Revista Pesquisa FAPESP - All rights reserved Rio de Janeiro is looking for investors to join its new Sustainable Development Hub which will sit in a 2 million sqm area near the local seaport and airport São Paulo – The Economic Development Secretariat in Cabo Frio Rio de Janeiro is seeking investors for its Sustainable Development Hub project The goal is to diversify the economy away from tourism and royalties from oil exploration but we want to move beyond that to create more jobs and development for the city,” the Secretariat’s Employment and Income superintendent João Marcello Neves told ANBA Project design is expected to be completed by the end of the year The allotted 2 million sqm area sits next to the Cabo Frio Airport and near Porto do Forno the seaport in neighboring Arraial do Cabo the Secretariat is seeking out investment abroad which is reassuring when it comes to shuttling material in and out We are open to any kinds of projects and we are willing to listen to any company that’s looking to join in We do have a preference for sustainable economy for projects that will not harm the environment since this is an area of beaches and [environmental] reserves adding that 90% of the hub’s area is still available with the use of technologies to add value and increase output as well as corporate skill-building programs and handicraft The Cabo Frio City Hall is also planning to build a convention center in which to host trade shows and business events The hub will be managed by the Cabo Frio Development Company (Codescaf) a semi-public enterprise whose creation was approved this year The City Hall retains a 51% stake,” Neves explained Companies joining the Hub will get tax breaks the City Hall may award land on a right-to-use basis how many jobs and revenue they will generate the Estaleiro Vera Cruz shipyard will repay us with a crafts school where 20 professionals will graduate each year and most will be taken in by the shipyard itself,” he said referring to one of the companies already slated to join the Hub There is also a startup incubator and accelerator for ocean-related businesses the initiative will get support from educational institutions including the Federal Universit of Rio de Janeiro (UFRJ) to streamline the paperwork requirements involved in starting a business so we will work with startups that relate to sustainable marine economics and technology They will all work with these accredited educational institutions which will act as incubators and accelerators while the City Hall will facilitate the process of starting new businesses.” For additional information please refer to the Cabo Frio Economic Development Secretariat website The Gulf country has deposited its instrument of acceptance of the World Trade Organisation (WTO) Agreement on Fisheries Subsidies which is aimed at curbing harmful subsidies that contribute to overfishing and promoting the sustainable management of global marine resources The Brazil-Arab News Agency (ANBA) is the news website of the Arab Brazilian Chamber of Commerce Its goal is to promote communication between Brazilians and Arabs.