Volume 11 - 2024 | <a class="ArticleLayoutHeader__info__doi" href="https://doi.org/10.3389/fvets.2024.1371495">https://doi.org/10.3389/fvets.2024.1371495</a>
This article is part of the Research TopicWildlife-Domestic Animal Interface: Threat or Sentinel?<a class="Link Link--linkType Link--maincolor Link--medium Link--icon Link--chevronRight Link--right" aria-label="View all 9 articles" href="https://www.frontiersin.org/research-topics/56893/wildlife-domestic-animal-interface-threat-or-sentinel/magazine" target="_self" data-event="customLink-linkType-a_viewAll9Articles">View all 9 articles</a>
Schmallenberg virus (SBV) is an arthropod-borne virus that emerged recently in northwestern Europe in 2011 that affects domestic and wild ruminants and induces abortion
SBV has spread very rapidly to too many countries in the world
The overall serological investigation of SBV is needed to improve modeling predictions and assess the overall impact on ruminant animals
which helps to design interventions for control and prevention strategies
this study aimed to estimate the overall serological assay of SBV in both domestic and wild ruminants around the world
This systematic review was conducted as per the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines
International databases were employed To search for relevant articles
The pooled prevalence with a 95% confidence interval was calculated with a random effects model
and I2 were used to assess the sources of heterogeneity
The overall pooled proportion of SBV in domestic and wild ruminants was 49 and 26%
Substantial heterogeneity was observed in studies on domestic ruminants (I2 =&#x2009;99.7%; p&#x2009;&#x0003C;&#x2009;0.01) and studies on wild ruminants (I2 =&#x2009;97.9%; p&#x2009;&#x0003C;&#x2009;0.01)
The pooled prevalence of SBV was significantly associated with publication time
the highest pooled prevalence of SBV was reported in cattle (59%)
In addition to the subgroup analysis based on publication year
the pooled prevalence of SBV infection has become endemic since 2013 (49%) among domestic animals in the world
the highest anti-SBV antibodies (66%) were detected by a virus neutralization test
the major wild animals that were infected by SBV were red deer
The highest sub-pooled prevalence of SBV was found in roe deer (46%)
the prevalence of SBV was high in cattle among domestic ruminants and in roe deer among wild animals
According to the current information provided by this meta-analysis
evidence-based risk management measures should be established to restrict SBV spread in both domestic and wild ruminants
The diagnosis of SBV infection in living adult animals is difficult for veterinarians
A protocol targeting the S segment was later developed and showed higher sensitivity
the detection of anti-SBV antibodies present in the serum of infected animals can be performed by the indirect method of SBV infection diagnosis
The virus neutralization test (VNT) and enzyme-linked immunosorbent assay (ELISA) have been developed as tools for serological diagnosis
According to the European Food Safety Authority (EFSA)
SBV infection had also been confirmed in approximately 9,000 ruminant herds across Europe
and nearly half of them were reported in France
especially when virus shedding is only transient and the time frame is unknown since antibodies remain detectable for longer periods
This investigation was important for scientific evidence for the researchers and baseline survey collectors regarding the dairy herd reproductive infectious diseases
it supports intervention regarding the prevention and control of the virus
this systematic review and meta-analysis aimed to provide an overall estimate of the seroprevalence of SBV in both domestic and wild animals around the globe
The literature search was conducted from 12 August to 20 September 2023. A systematic assessment of published articles reporting the overall proportion of SBV was performed based on the PRISMA checklist (<a href="#ref33">33</a>) (Supplementary material 1)
The major working protocol was performed in seven key steps: study eligibility criteria
A comprehensive search strategy was made to identify all relevant studies
snowball searching from retrieved articles
and other manual methods were used for literature searches to select included studies by two authors (MD and AS) independently
The research question was &#x201C;What is the pooled prevalence of SBV in domestic and wild ruminants in the world?&#x201D;
The following Mesh terms were used in electronic database search: &#x201C;Schmallenbergvirus,&#x201D; &#x201C;SBV,&#x201D; &#x201C;PrevalenceofSchmallenberg virus&#x201D; &#x201C;epidemiology of Schmallenberg virus,&#x201D; &#x201C;Schmallenberg virus in cattle,&#x201D; &#x201C;Schmallenberg virus in sheep,&#x201D; &#x201C;Schmallenberg virus in goat,&#x201D; &#x201C;Schmallenberg virus in domestic ruminants,&#x201D; Schmallenberg virus in wild ruminants
&#x201C;Schmallenberg virus in wild animals,&#x201D; &#x201C;Schmallenberg virus in red deer,&#x201D; &#x201C;Schmallenberg virus in roe deer,&#x201D; &#x201C;Schmallenberg virus in wild goat,&#x201D; Schmallenberg virus in wild boar,&#x201D; Schmallenberg virus in bison
&#x201C;Schmallenberg virus in buffalo,&#x201D; &#x201C;Schmallenberg virus in fallow deer,&#x201D; and &#x201C;Schmallenberg virus in mouflon.&#x201D; Even we have searched articles based on the combination of these words with specific continents and countries as the context
All identified studies were imported to Medley software to remove duplicates and scientific citations from the references
The search was performed by three field experts (Microbiology
and Veterinary Clinical Medicine) to avoid authors&#x2019; bias
This meta-analysis includes all of the primary descriptive studies that have been published in the English language that document the occurrence of SBV in domestic and wild ruminants
The inclusion criteria included articles with a clear estimation of the prevalence of SBV
Study animals became domestic and wild ruminants around the globe at any year
Samples had to be collected from animals that had not been experimentally infected
Studies that do not have clear and detailed estimates of the proportion of SBV in the affected host were also excluded
Intervention studies that lacked baseline data on the association between animal exposure and disease were excluded from the meta-analysis
The literature search was conducted from August to September 2023
The included studies were reported from continents in any study year
The relevant data were extracted independently by two investigators (MD and AS)
Quantitative and qualitative data extraction from the included studies was performed and presented in the form of a table in an Excel spreadsheet
The extracted components encompassed the name of the primary author along with the year of publication
and all domestic and wild species of ruminants
the number of seropositive animals (primary outcome interest)
Disagreements were resolved by discussion and consultation with a third author
Quality assessment was performed to verify the methodological quality of this systematic review (MD and BD). The quality assessment of the included studies was assessed by the Appraisal tool for Cross-Sectional Studies (AXIS) quality tool (<a href="#ref34">34</a>)
This quality assessment tool includes different items including study design
In a logistic-normal random-effect regression model
the logit transformation was utilized to estimate the pooled proportions
and a mixed-effect logistic regression model was employed for the subgroup analysis
The Cochran&#x2019;s Q test (reported as the p-value), &#x03C4;2 (between-study variance), and inverse variance index (I2) were used to assess the sources of heterogeneity, which describes the percentage of observed total variation between studies that is due to heterogeneity rather than chance. As explained by Higgins and Thompson (<a href="#ref37">37</a>)
the I2 index was estimated to represent low
Heterogeneity was deemed to be statistically significant if the I2 value exceeded 50% and the Q test revealed a p-value of less than 0.10
The degree of study heterogeneity has been evaluated using a forest plot diagram
The forest plot diagram displayed the weights
and 95% confidence intervals for each study
To determine specific between-study variability
a subgroup analysis of the proportion of the SBV in ruminants was performed based on study year
Publication bias is usually evaluated through a funnel plot in which asymmetry can be assessed visually
publication bias was assessed using funnel plot diagrams and Egger&#x2019;s regression test
Sensitivity analysis of studies was performed to evaluate the effect of each study on the pooled result
The results showed that the studies were the prime determinants of the pooled result
As shown in the PRISMA 2020 flowchart (<a href="#fig1">Figure 1</a>)
a total of 929 articles in various electronic databases and other methods were searched
from which 8 were excluded after article duplication assessment (n&#x2009;=&#x2009;8)
30 records were marked as ineligible by automation tools (n&#x2009;=&#x2009;30)
and 41 records were removed for other reasons (n&#x2009;=&#x2009;41)
534 articles were excluded by article title and abstract screening
316 studies were reports searched for retrieval
and 233 articles were reports not retrieved
A total of 82 (n&#x2009;=&#x2009;82) articles were reports being evaluated for eligibility
and 41 (n&#x2009;=&#x2009;41) of them were excluded for various reasons
41 (n =&#x2009;41) studies were included for meta-analysis
A PRISMA flowchart for searched relevant articles
The characteristics of the studies about SBV are intricately described in a step-by-step manner
The study animals comprised of cattle which are of all ages
A total of 41 independent articles (domestic
n&#x2009;=&#x2009;17) were considered for the analysis of all pooled prevalence SBV in wild and domestic ruminants
A meta-analysis was carried out separately for the prevalence of SBV in domestic and wild ruminants
the included studies for this meta-analysis were conducted and published in different parts of the world between 2011 and 2022
We noticed that the same article was used multiple times due to different species of animals
and the types of samples were serum (blood) and brain tissue
it helps to reduce the variability between studies
In the meta-analysis of studies regarding SBV
a total of 41 independent articles were incorporated in both domestic and wild ruminants (domestic
it should be noted that certain articles were utilized multiple times due to their relevance in similar years but in different animal species
a total of 40 dependent and independent articles were included in the case of domestic ruminants
while 42 articles were included in wild ruminants
Forest plot plots with random-effects meta-analysis of SBV infection in domestic ruminants
Funnel plot plots the standard error by log odds of the proportion of SBV domestic ruminants
The regression test for funnel plot asymmetry was done using a mixed-effects meta-regression model and standard error as a predictor (Eger&#x2019;s test
b&#x2009;=&#x2009;&#x02212;0.2035 (CI: &#x02212;0.6588
The test for funnel plot asymmetry was also performed via rank correlation test for funnel plot asymmetry (Kendall&#x2019;s tau&#x2009;=&#x2009;&#x02212;0.0073
heterogeneity was explored through a subgroup analysis
Subgroup analyses were conducted based on study year
All of the subgroup analyses of exploratory outcomes showed considerable heterogeneity (I2 &#x0003E;&#x2009;98)
Significant statistical heterogeneity in the subgroup analysis reveals a likely interaction among exploratory variables
Based on the species of ruminant animals, the included studies were categorized into three groups: cattle (n&#x2009;=&#x2009;22), sheep (n&#x2009;=&#x2009;11), and goat (n&#x2009;=&#x2009;6). Significant discrepancies were found in the subgroup analysis of the most SBV prevalence by animal type. As shown in <a href="#fig4">Figure 4</a>
the subgroup analysis revealed that the pooled prevalence of SBV in cattle was 59% (95% CI: 43&#x2013;74%) and (I2&#x2009;=&#x2009;100%: &#x03C4;2 =&#x2009;2.5168=; p&#x2009;=&#x2009;0)
followed by sheep at 37% (95% CI: 20&#x2013;58%) and (I2&#x2009;=&#x2009;100%: &#x03C4;2 =&#x2009;1.9884; p&#x2009;=&#x2009;0.0) and goat at 18% (95% CI: 4&#x2013;52%) and (I2&#x2009;=&#x2009;99%: &#x03C4;2&#x2009;=&#x2009;4.0281; p&#x2009;&#x0003C;&#x2009;0.01)
Pooled prevalence of SBV by domestic ruminant species
In terms of the year of publication, as shown in <a href="#fig5">Figure 5</a>
the subgroup analysis found that the pooled prevalence of SBV virus in domestic ruminants was 27% (95% CI: 25&#x2013;56%) with 99% degree of heterogeneity (I2) and (&#x03C4;2&#x2009;=&#x2009;3.1833: p&#x2009;&#x0003C;&#x2009;0.01) in the up to or before 2013 group
49% (95% CI: 25&#x2013;56%) in the 2013 or later group with 98% degree of heterogeneity (I2)
Sub-pooled prevalence of SBV in domestic ruminants by publication year
In terms of the method of diagnosis, subgroup analysis of the method of diagnosis was carried out. The method of diagnosis was categorized into VNT, ELISA, and RT-qPCR. In this case, we also encountered considerable heterogeneity (I2 &#x0003E;&#x2009;50) in each group. The highest study heterogeneity (I2 =&#x2009;100) was revealed in the diagnosis of SBV by ELISA methods. The sub-pooled prevalence (66%, <a href="#fig6">Figure 6</a>) of SBV was highest in the diagnosis method of VNT
The subgroup difference test suggested that there was a statistically significant group effect (Q&#x2009;=&#x2009;23.49; DF&#x2009;=&#x2009;2; p&#x2009;&#x0003C;&#x2009;0.0001)
and rank correlation test revealed that there was no asymmetrical distribution of studies
indicating that smaller studies were not likely to be overlooked
Funnel plot plots the standard error by log odds of the proportion of SBV wild ruminants
a high level of variability was observed in studies focusing on fallow deer
with an I2 value of 98 and a p-value of &#x0003C;0.01
this is the first meta-analysis of the global prevalence of SBV infection in wild and domestic ruminants
although many investigations regarding the prevalence of SBV infection in ruminants in different countries have been conducted
The overall serological investigations of SBV are needed to improve modeling predictions and assess the overall impact of SBV in ruminant animals
Wildlife animals may be susceptible to multiple infectious agents of public health or veterinary relevance
thereby potentially forming a reservoir that bears the constant risk of re-introduction into the human or livestock population
A meta-analysis was performed to estimate the pooled prevalence of SBV infection in domestic and wild ruminants in the world
The current meta-analysis includes 34 articles
and it found that the overall pooled prevalence of SBV was 54 and 26% in domestic and wild ruminants
These differences may be related to the availability of vaccination
the clinical stage of the virus during sampling
and the density of the vector (culicoides)
environmental characteristics such as humidity and variation in temperature during the night and day affect the density of the vector
influencing the possible transmission and consequently the prevalence of SBV in both domestic and wild ruminants
This investigation presents compelling evidence of SBV infection in both domestic and wild ruminants worldwide
The findings of the present study appear to suggest an increase in the spread of SBV after the year 2013
our research also indicated a high distribution of SBV in both domestic and wild ruminants
while other countries have recently discovered the presence of the virus
where the SBV was detected around the year 2018
the current study revealed a lack of comprehensive information regarding the propagation of SBV in wild animals
the seroprevalence of SBV is significantly high
particularly about dairy cattle in African countries
This research also aids in enhancing our comprehension of the range of species susceptible to the virus and evaluating the effectiveness of current SBV serological assays in both wild and domestic ruminants
further investigation is required concerning the spread of the virus in wild animals
as well as the implementation of preventive and control measures
There are several limitations in our meta-analysis and included articles
our systematic review only includes published articles
the subgroup analysis was limited to only publication year
or detection method as moderators for investigation of the source of heterogeneity between studies
and the included studies did not cover all wild ruminants
the articles we found did not cover all regions of the world
as some countries had no published articles
The final limitation was that our review was not registered in the PROSPERO database
The current meta-analysis demonstrates the significant rate at which the overall prevalence of SBV was higher in domestic ruminants (49%) compared with wild ruminants (26%)
the present study reveals that the overall serological assay was greater in cattle in comparison with small ruminants
the roe deer exhibited the highest seropositivity
This investigation includes a substantial number of European studies
indicating a better comprehension or possibly a high distribution of the intermediate host (vectors)
Based on the available evidence regarding its emergence in 2011
we presume that the global coverage of the virus is extensive
this virus will exert a significant impact on dairy industries
it is imperative to pay close attention to this disease to counteract its rapid dissemination worldwide
certain countries should prioritize early diagnosis for both domestic and wild ruminants
The original contributions presented in the study are included in the article/<a href="#SM1">Supplementary material</a>
further inquiries can be directed to the corresponding author
The author(s) declare that no financial support was received for the research
We gratefully acknowledge the University of Gondar for providing some of the materials and important pieces of training
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations
Any product that may be evaluated in this article
or claim that may be made by its manufacturer
is not guaranteed or endorsed by the publisher
The Supplementary material for this article can be found online at: <a href="https://www.frontiersin.org/articles/10.3389/fvets.2024.1371495/full#supplementary-material">https://www.frontiersin.org/articles/10.3389/fvets.2024.1371495/full#supplementary-material</a>
First detection of Schmallenberg virus RNA in bovine semen
<a href="https://doi.org/10.1016/j.vetmic.2013.09.002" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=B+Hoffmann&#x00026;author=C+Schulz&#x00026;author=M+Beer&#x00026;publication_year=2013&#x00026;title=First+detection+of+Schmallenberg+virus+RNA+in+bovine+semen+Germany+2012&#x00026;journal=Vet+Microbiol&#x00026;volume=167&#x00026;pages=289-95" target="_blank">Google Scholar</a>
Schmallenberg virus infection among Red Deer
<a name="ref3" id="ref3"></a>3. OIE (2013). Technical Fact Sheet. Schmallenberg Virus. Available at: <a href="http://www.oie.int/fr/notre-expertise-scientifique/informations-specifiques-etrecommandations/virus-schmallenberg/">http://www.oie.int/fr/notre-expertise-scientifique/informations-specifiques-etrecommandations/virus-schmallenberg/</a>
<a href="http://scholar.google.com/scholar_lookup?publication_year=2013&#x00026;journal=Technical+Fact+Sheet.+Schmallenberg+Virus&#x00026;" target="_blank">Google Scholar</a>
Abortion in small ruminants in the Netherlands between 2006 and 2011
Evidence of seroconversion to SBV in camelids
<a href="https://doi.org/10.1136/vr.e3939" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=C+Jack&#x00026;author=O+Anstaett&#x00026;author=J+Adams&#x00026;author=R+Noad&#x00026;author=J+Brownlie&#x00026;author=P+Mertens&#x00026;publication_year=2012&#x00026;title=Evidence+of+seroconversion+to+SBV+in+camelids&#x00026;journal=Vet+Rec&#x00026;volume=170&#x00026;pages=603" target="_blank">Google Scholar</a>
Epizootic spread of Schmallenberg virus among wild Cervids
Spread of Schmallenberg virus infections in the ruminants in Poland between 2012 and 2013
<a href="https://doi.org/10.2478/bvip-2014-0026" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=M+Larska&#x00026;author=J+K&#x0119;sik-Maliszewska&#x00026;author=A+Kuta&#x00026;publication_year=2014&#x00026;title=Spread+of+Schmallenberg+virus+infections+in+the+ruminants+in+Poland+between+2012+and+2013&#x00026;journal=Bull+Vet+Inst+Pulawy&#x00026;volume=58&#x00026;pages=169-76" target="_blank">Google Scholar</a>
A broad spectrum screening of Schmallenberg virus antibodies in wildlife animals in Germany
Exposure of Asian elephants and other exotic ungulates to Schmallenberg virus
Blood extraction method by endocranial venous sinuses puncture in hunted wild ruminants
A review on Schmallenberg virus infection: a newly emerging disease of cattle
<a href="https://doi.org/10.17221/7083-VETMED" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=RVS+Pawaiya&#x00026;author=VK+Gupta&#x00026;publication_year=2013&#x00026;title=A+review+on+Schmallenberg+virus+infection:+a+newly+emerging+disease+of+cattle+sheep+and+goats&#x00026;journal=Vet+Med+(Praha)&#x00026;volume=58&#x00026;pages=516-26" target="_blank">Google Scholar</a>
molecular virology and diagnostics of Schmallenberg virus
Development of within-herd immunity and long-term persistence of antibodies against Schmallenberg virus in naturally infected cattle
&#x2018;Schmallenberg virus&#x2019; &#x2013; a novel orthobunyavirus emerging in Europe
<a href="https://doi.org/10.1017/S0950268812002245" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=M+Beer&#x00026;author=FJ+Conraths&#x00026;author=WHM+van+der+Poel&#x00026;publication_year=2013&#x00026;title=&#x2018;Schmallenberg+virus&#x2019;+&#x2013;+a+novel+orthobunyavirus+emerging+in+Europe&#x00026;journal=J+Hyg&#x00026;volume=141&#x00026;pages=1-8" target="_blank">Google Scholar</a>
<a href="https://doi.org/10.3201/eid1809.120716" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=GM+Marie&#x00026;author=C+Bayrou&#x00026;author=D+Kleijnen&#x00026;author=D+Cassart&#x00026;author=D+Desmecht&#x00026;publication_year=2012&#x00026;title=Schmallenberg+Virus+in+Domestic&#x00026;journal=Med+Vet+Entomol&#x00026;volume=18&#x00026;pages=7-9" target="_blank">Google Scholar</a>
Schmallenberg virus epidemic in the Netherlands: spatiotemporal introduction in 2011 and seroprevalence in ruminants
EFSA assesses current knowledge of Schmallenberg virus
<a href="https://doi.org/10.1136/vr.g3572" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?publication_year=2014&#x00026;title=EFSA+assesses+current+knowledge+of+Schmallenberg+virus&#x00026;journal=Vet+Rec&#x00026;volume=174&#x00026;pages=566" target="_blank">Google Scholar</a>
Antibodies to Schmallenberg virus in domestic livestock in Turkey
Preliminary serological evidence for Schmallenberg virus infection in China
Monitoring of Schmallenberg virus in Spanish wild artiodactyls
Atlas y Libro Rojo de los mam&#x000ED;feros terrestres de Espa&#x000F1;a
Madrid: Organismo Aut&#x000F3;nomo de Parques Nacionales
<a href="http://scholar.google.com/scholar_lookup?author=L.J.+Palomo&#x00026;author=J.+Gisbert&#x00026;author=J+Y+Blanco&#x00026;publication_year=2007&#x00026;journal=Atlas+y+Libro+Rojo+de+los+mam&#x000ED;feros+terrestres+de+Espa&#x000F1;a&#x00026;" target="_blank">Google Scholar</a>
Pathogen detection and disease diagnosis in wildlife: challenges and opportunities
Serosurvey for Schmallenberg Virus in Alpine Wild Ungulates
<a href="https://doi.org/10.1111/tbed.12158" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=M+Chiari&#x00026;author=E+Sozzi&#x00026;author=M+Zanoni&#x00026;author=LG+Alborali&#x00026;author=A+Lavazza&#x00026;author=P+Cordioli&#x00026;publication_year=2012&#x00026;title=Serosurvey+for+Schmallenberg+Virus+in+Alpine+Wild+Ungulates&#x00026;journal=Transbound+Emerg+Dis&#x00026;volume=2014&#x00026;pages=1-3" target="_blank">Google Scholar</a>
Detection of serum neutralizing antibodies to Simbu sero-group viruses in cattle in Tanzania
Acta Tropica Seroprevalence of Schmallenberg virus in dairy cattle in Ethiopia
<a href="https://doi.org/10.1016/j.actatropica.2017.10.024" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=B+Sibhat&#x00026;author=G+Ayelet&#x00026;author=EZ+Gebremedhin&#x00026;author=E+Skjerve&#x00026;publication_year=2018&#x00026;title=Acta+Tropica+Seroprevalence+of+Schmallenberg+virus+in+dairy+cattle+in+Ethiopia&#x00026;journal=Acta+Trop&#x00026;volume=178&#x00026;pages=61-7" target="_blank">Google Scholar</a>
Serological screening suggests presence of Schmallenberg virus in cattle
Schmallenberg virus &#x2013; is it present in South Africa
<a href="https://doi.org/10.4102/jsava.v84i1.535" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=R+Leask&#x00026;author=AM+Botha&#x00026;author=GF+Bath&#x00026;publication_year=2013&#x00026;title=Schmallenberg+virus+&#x2013;+is+it+present+in+South+Africa?&#x00026;journal=J+S+Afr+Vet+Assoc&#x00026;volume=84&#x00026;pages=1-5" target="_blank">Google Scholar</a>
Acta Tropica serological evidence of bovine herpesvirus-1
bovine viral diarrhea virus and Schmallenberg v irus infections in relation to reproductive disorders in dairy cattle in Ethiopia
present and future of wild ungulates in relation to changes in land use
Disease risks and overabundance of game species
<a href="https://doi.org/10.1007/s10344-005-0022-2" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=C+Gort&#x000E1;zar&#x00026;author=P+Acevedo&#x00026;author=F+Ruiz-Fons&#x00026;author=J+Vicente&#x00026;publication_year=2006&#x00026;title=Disease+risks+and+overabundance+of+game+species&#x00026;journal=Z+Jagdwiss&#x00026;volume=52&#x00026;pages=81-7" target="_blank">Google Scholar</a>
<a href="https://doi.org/10.1007/s11121-013-0377-7" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=M+Borenstein&#x00026;author=JPT+Higgins&#x00026;publication_year=2013&#x00026;title=Meta-analysis+and+subgroups&#x00026;journal=Prevent+Sci&#x00026;volume=14&#x00026;pages=134-43" target="_blank">Google Scholar</a>
The PRISMA 2020 statement: An updated guideline for reporting systematic reviews
<a href="https://doi.org/10.1186/s13643-021-01626-4" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=MJ+Page&#x00026;author=JE+Mckenzie&#x00026;author=PM+Bossuyt&#x00026;author=I+Boutron&#x00026;author=TC+Hoffmann&#x00026;author=CD+Mulrow&#x00026;publication_year=2021&#x00026;title=The+PRISMA+2020+statement:+An+updated+guideline+for+reporting+systematic+reviews&#x00026;journal=BMJ&#x00026;volume=88&#x00026;" target="_blank">Google Scholar</a>
Development of a critical appraisal tool to assess the quality of cross-sectional studies (AXIS)
<a href="https://doi.org/10.1136/bmjopen-2016-011458" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=MJ+Downes&#x00026;author=ML+Brennan&#x00026;author=HC+Williams&#x00026;author=RS+Dean&#x00026;publication_year=2016&#x00026;title=Development+of+a+critical+appraisal+tool+to+assess+the+quality+of+cross-sectional+studies+(AXIS)&#x00026;journal=BMJ+Open&#x00026;volume=6&#x00026;pages=1-7" target="_blank">Google Scholar</a>
How to perform a meta-analysis with R: a practical tutorial
<a href="https://doi.org/10.1136/ebmental-2019-300117" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=S+Balduzzi&#x00026;author=G+R&#x000FC;cker&#x00026;author=G+Schwarzer&#x00026;publication_year=2019&#x00026;title=How+to+perform+a+meta-analysis+with+R:+a+practical+tutorial&#x00026;journal=Evid+Based+Ment+Health&#x00026;volume=22&#x00026;pages=153-60" target="_blank">Google Scholar</a>
Conducting meta-analyses in R with the metafor package
<a href="http://scholar.google.com/scholar_lookup?author=W+Viechtbauer&#x00026;publication_year=2010&#x00026;title=Conducting+meta-analyses+in+R+with+the+metafor+package&#x00026;journal=J+Stat+Softw&#x00026;volume=36&#x00026;pages=1-48" target="_blank">Google Scholar</a>
Quantifying heterogeneity in a meta&#x2010;analysis
<a href="https://doi.org/10.1002/sim.1186" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=JPT+Higgins&#x00026;author=SG+Thompson&#x00026;publication_year=2002&#x00026;title=Quantifying+heterogeneity+in+a+meta&#x2010;analysis&#x00026;journal=Stat+Med&#x00026;volume=21&#x00026;pages=1539-58" target="_blank">Google Scholar</a>
Prevalence and distribution of exposure to Schmallenberg virus in Irish cattle during October 2012 to November 2013
Evidence of Schmallenberg virus circulation in ruminants in Greece
Schmallenberg virus in CulicoidesBiting midges in the Netherlands in 2012
Paper Schmallenberg virus: A seroprevalence survey in cattle and sheep
Seroprevalence of Schmallenberg virus in the United Kingdom and the Republic of Ireland: 2011 &#x2013; 2013
<a href="https://doi.org/10.1016/j.vetmic.2015.07.025" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=B+King&#x00026;author=TOS+Brown&#x00026;author=R+Tarlinton&#x00026;author=JM+Daly&#x00026;publication_year=2015&#x00026;title=Seroprevalence+of+Schmallenberg+virus+in+the+United+Kingdom+and+the+Republic+of+Ireland:+2011+&#x2013;+2013&#x00026;journal=Vet+Microbiol&#x00026;volume=180&#x00026;pages=36-40" target="_blank">Google Scholar</a>
Neutralizing antibodies against Simbu serogroup viruses in cattle and sheep
<a href="https://doi.org/10.1186/s12917-018-1605-y" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=D+Oluwayelu&#x00026;author=K+Wernike&#x00026;author=A+Adebiyi&#x00026;author=S+Cadmus&#x00026;author=M+Beer&#x00026;publication_year=2018&#x00026;title=Neutralizing+antibodies+against+Simbu+serogroup+viruses+in+cattle+and+sheep+Nigeria+2012&#x2013;2014&#x00026;journal=Vet+Res&#x00026;volume=14&#x00026;pages=1-7" target="_blank">Google Scholar</a>
PT both authors contributed equally to this work SC
<a href="http://scholar.google.com/scholar_lookup?author=C+Sohier&#x00026;author=R+Michiels&#x00026;author=E+Kapps&#x00026;author=E+Van&#x00026;author=C+Quinet&#x00026;author=AB+Cay&#x00026;publication_year=2017&#x00026;title=PT+both+authors+contributed+equally+to+this+work+SC&#x00026;journal=Res+Vet+Sci&#x00026;" target="_blank">Google Scholar</a>
Follow-up of the Schmallenberg virus Seroprevalence in Belgian cattle
<a href="http://scholar.google.com/scholar_lookup?author=A+Meroc&#x00026;author=Loo+H+Van&#x00026;author=Driessche+E+Van&#x00026;author=G+Czaplicki&#x00026;author=C+Quinet&#x00026;author=F+Riocreux&#x00026;publication_year=2015&#x00026;journal=Follow-up+of+the+Schmallenberg+virus+Seroprevalence+in+Belgian+cattle&#x00026;volume=116&#x00026;pages=350-359" target="_blank">Google Scholar</a>
Ruminant abortions and foetal death in Austria in 2012/2013
<a href="https://doi.org/10.1016/j.prevetmed.2014.03.006" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=A+Steinrigl&#x00026;author=P+Schiefer&#x00026;author=C+Schleicher&#x00026;author=W+Peinhopf&#x00026;author=E+Wodak&#x00026;author=Z+Bag&#x000F3;&#x00026;publication_year=2014&#x00026;title=Ruminant+abortions+and+foetal+death+in+Austria+in+2012/2013&#x00026;journal=Prev+Vet+Med&#x00026;" target="_blank">Google Scholar</a>
Occurrence of emerging ruminant viruses in goats in Poland
<a href="https://pubmed.ncbi.nlm.nih.gov/36961274" target="_blank">PubMed Abstract</a> | <a href="https://doi.org/10.24425/pjvs.2023.145015" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=M+Larska&#x00026;author=W+Socha&#x00026;author=J+Rola&#x00026;publication_year=2023&#x00026;title=Occurrence+of+emerging+ruminant+viruses+in+goats+in+Poland&#x00026;journal=Pol+J+Vet+Sci&#x00026;volume=26&#x00026;pages=137-42" target="_blank">Google Scholar</a>
First detection of Schmallenberg virus antibody in cattle population of eastern Iran
<a href="https://doi.org/10.30466/vrf.2021.135144.3032" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=M+Rasekh&#x00026;author=A+Sarani&#x00026;author=A+Jafari&#x00026;publication_year=2022&#x00026;title=First+detection+of+Schmallenberg+virus+antibody+in+cattle+population+of+eastern+Iran&#x00026;journal=Vet+Res+Forum&#x00026;volume=13&#x00026;pages=443-6" target="_blank">Google Scholar</a>
First evidence of Schmallenberg virus infection in southern Italy
<a href="https://doi.org/10.1186/s12917-023-03666-5" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=G+Ferrara&#x00026;author=K+Wernike&#x00026;author=G+Iovane&#x00026;author=U+Pagnini&#x00026;author=S+Montagnaro&#x00026;publication_year=2023&#x00026;title=First+evidence+of+Schmallenberg+virus+infection+in+southern+Italy&#x00026;journal=BMC+Vet+Res+[Internet]&#x00026;volume=19&#x00026;pages=1-9" target="_blank">Google Scholar</a>
Prevalance of Schmallenberg orthobunyavirus (SBV) infection in sampled ruminants in Turkey&#x2019;s eastern Mediterranean region between 2015 and 2017
Seroprevalence of Schmallenberg virus and other Simbu group viruses among the Lebanese sheep
<a href="http://scholar.google.com/scholar_lookup?author=A+Abi-Rizk&#x00026;author=T+Kanaan&#x00026;author=HJ+El&#x00026;publication_year=2017&#x00026;title=Seroprevalence+of+Schmallenberg+virus+and+other+Simbu+group+viruses+among+the+Lebanese+sheep&#x00026;journal=Open+Vet+J&#x00026;volume=7&#x00026;pages=290-3" target="_blank">Google Scholar</a>
Schmallenberg virus in Poland endemic or re-emerging
Schmallenberg virus circulation in High Mountain ecosystem
Cross-sectional study of Schmallenberg virus seroprevalence in wild ruminants in Poland at the end of the vector season of 2013
Serological confirmation of SBV infection in wild British deer
<a href="https://doi.org/10.1136/vr.f2438" target="_blank">Crossref Full Text</a> | <a href="http://scholar.google.com/scholar_lookup?author=A+Barlow&#x00026;author=TB+Peter+Green&#x00026;author=N+Healy&#x00026;publication_year=2013&#x00026;title=Serological+confirmation+of+SBV+infection+in+wild+British+deer&#x00026;journal=Vet+Rec&#x00026;volume=172&#x00026;pages=429" target="_blank">Google Scholar</a>
Serological testing of Schmallenberg virus in Swedish wild cervids from 2012 to 2016
Exposure of wildlife to the Schmallenberg virus in France (2011-2014): higher
Detection of antibodies against Schmallenberg virus in wild boars
In Proceedings of the 31th Congress of the International Union of Game Biologists
<a href="http://scholar.google.com/scholar_lookup?author=D.+Desmecht&#x00026;author=M.M.+Garigliany&#x00026;author=M.+Beer&#x00026;author=H.+Schirrmeier&#x00026;author=J.+Paternostre&#x00026;author=R.+Volpe&#x00026;publication_year=2013&#x00026;title=Detection+of+antibodies+against+Schmallenberg+virus+in+wild+boars+Belgium+2010&#x2013;2012&#x00026;" target="_blank">Google Scholar</a>
Occurrence of Borrelia and Borreliella species in Ixodes ricinus collected from roe deer in northwestern Spain
Seroprevalence of Schmallenberg virus antibodies among dairy cattle
Epidemic potential of an emerging vector borne disease in a marginal environment: Schmallenberg in Scotland
Assessing the risk of bluetongue to UK livestock: uncertainty and sensitivity analyses of a temperature-dependent model for the basic reproduction number
Veterinary medicine: A textbook of the diseases of cattle
<a href="http://scholar.google.com/scholar_lookup?author=PD+Constable&#x00026;author=KW+Hinchcliff&#x00026;author=SH+Done&#x00026;publication_year=2017&#x00026;journal=African+horse+sickness.+Veterinary+medicine:+A+textbook+of+the+diseases+of+cattle+horses+sheep+pigs+and+goats&#x00026;" target="_blank">Google Scholar</a>
Assesses current knowledge of Schmallenberg virus 2012 (2012)
<a href="http://scholar.google.com/scholar_lookup?publication_year=2012&#x00026;journal=Assesses+current+knowledge+of+Schmallenberg+virus+2012&#x00026;pages=3681" target="_blank">Google Scholar</a>
Risk factors for malformations and impact on reproductive performance and mortality rates of Schmallenberg virus in sheep flocks in the Netherlands
National BTV vector surveillance Programme 2007&#x2013;2009
<a href="http://scholar.google.com/scholar_lookup?author=TK+McCarthy&#x00026;author=A+Bateman&#x00026;author=AL+Nowak&#x00026;journal=National+BTV+vector+surveillance+Programme+2007&#x2013;2009&#x00026;" target="_blank">Google Scholar</a>
Microclimatic temperatures at Danish cattle farms
2000-2016: quantifying the temporal and spatial variation in the transmission potential of Schmallenberg virus
Bluetongue disease in Germany (2007-2008): monitoring of entomological aspects
Schmallenberg virus: predicting within-herd seroprevalence using bulk-tank milk antibody titres and exploring individual animal antibody titres using empirical distribution functions (EDF)
Survey of Schmallenberg virus (SBV) infection in German goat flocks
<a href="http://scholar.google.com/scholar_lookup?author=C+Helmer&#x00026;author=R+Eibach&#x00026;author=PC+Tegtmeyer&#x00026;publication_year=2013&#x00026;title=Survey+of+Schmallenberg+virus+(SBV)+infection+in+German+goat+flocks&#x00026;journal=Epidemiology+&#x00026;+Infection&#x00026;pages=2335-2345" target="_blank">Google Scholar</a>
Validation of a commercially available indirect Elisa using a Nucleocapside recombinant protein for detection of Schmallenberg virus antibodies
Solomon A and Dagnew B (2024) Serological prevalence of the Schmallenberg virus in domestic and wild hosts worldwide: a systematic review and meta-analysis
Received: 16 January 2024; Accepted: 29 February 2024; Published: 28 March 2024
Copyright &#x000A9; 2024 Dagnaw, Solomon and Dagnew. This is an open-access article distributed under the terms of the <a rel="license" href="http://creativecommons.org/licenses/by/4.0/" target="_blank">Creative Commons Attribution License (CC BY)</a>
distribution or reproduction in other forums is permitted
provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited
in accordance with accepted academic practice
distribution or reproduction is permitted which does not comply with these terms
&#x0002A;Correspondence: Melkie Dagnaw, <a id="encmail">bWVsa2llZGFnbmF3MzUyOEBnbWFpbC5jb20=</a>
Disclaimer:  All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations
Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher
94% of researchers rate our articles as excellent or goodLearn more about the work of our research integrity team to safeguard the quality of each article we publish
First identified in Ireland in October 2012
Schmallenberg still remains a threat to Irish sheep flocks and cattle herds
As part of a recent <a href="https://www.teagasc.ie/letstalksheep/">Let&rsquo;s Talk Sheep Webinar</a>, Audrey Jenkinson, a Superintending Veterinary Inspector with the National Disease Control Centre at the Department of Agriculture, Food and the Marine, provided an insight into <a href="https://www.teagasc.ie/news--events/daily/beef/bluetongue-what-are-the-risks-for-irish-cattle-farmers-and-what-can-we-do-about-it.php">Bluetongue</a> and Schmallenberg disease
Presenting information provided by her colleagues in the Regional Veterinary Laboratories, Audrey Jenkinson noted that there was evidence that the <a href="https://www.teagasc.ie/news--events/daily/dairy/rvls-identify-schmallenberg-antibody-positives-in-some-dairy-herds.php">Schmallenberg virus was circulating in Ireland</a> in mid to late 2024
as the population&rsquo;s immunity generally wanes after 5-7 years and no vaccine is currently available
&ldquo;The trouble with Schmallenberg is that it can cause birth deformities
but by the time those lambs or calves are then born
the detectable traces of the virus could be long gone,&rdquo; she noted
it is known to cause abortion and deformed lambs
The congenital deformities which occur include: twisted neck
maybe also &lsquo;locked&rsquo;; limbs bent and locked; shortened lower jaws; and abnormalities with excess fluid in the brain
On the likelihood of the disease occurring this spring
Audrey Jenkinson said: &ldquo;Our lab colleagues expect that there could well be significant Schmallenberg related losses on some farms this spring.&rdquo;
she noted that estimates of up to 15% losses have been reported in the past
The Superintending Veterinary Inspector urged farmers to vigilant for birth abnormalities
Extra care is also required in terms cleanliness
as evidence from France and the Netherlands suggests that some calves and lambs can be born perfectly normal
She added: &ldquo;Don&rsquo;t assume an abnormality or abortion issue is Schmallenberg because there is so many other diseases that can cause these things.&rdquo; And
she urged farmers to continue to submit samples to their local Regional Veterinary Lab
ideally fresh carcasses with afterbirths and maternal bloods
in order to have the best chance of getting a diagnosis
the full recording of the Let&rsquo;s Talk Sheep Webinar is available to view below:
Early lambing flocks across the UK have been impacted by Schmallenberg virus
with reports of deformities in newborn lambs and higher abortion rates
with some regions seeing cases for the first time
National Sheep Association (NSA) chief executive Phil Stocker confirmed that the virus has been present for about a month
with “some fairly serious reports” coming in from affected areas
See also: <a href="https://www.fwi.co.uk/livestock/several-bluetongue-restrictions-lifted-but-zones-to-remain">Several bluetongue restrictions lifted but zones to remain</a>
He noted that Schmallenberg typically fades as the lambing season progresses
with early lambing flocks typically most vulnerable
Mr Stocker suggested that shifting towards later lambing could help because the first part of the pregnancy cycle for early lambers (in the autumn) coincides with peak midge activity
Schmallenberg virus poses a significant risk to the sheep sector due to the lack of a vaccine in the UK
Mr Stocker stressed the importance of testing to distinguish Schmallenberg from bluetongue
The Animal and Plant Health Agency (Apha) is offering free Schmallenberg testing in England and Wales
and the NFU has confirmed the virus remains a regional issue for now
A farm in Dumfries and Galloway was particularly hard-hit
with many born alive but severely deformed
said Schmallenberg was just one of the pathological agents that can cause high barren rates
“It is also important to remember that we do not yet know the full extent of the effects that bluetongue virus has had on fertility and calves and lambs that are being born around now,” he said
“This is why it is very important to report poorer than expected fertility results
as well as the arrival of deformed or neurologically affected neonates to your vet so that testing may be carried out.”
NFU chief livestock adviser John Royle added that the situation may worsen
with bluetongue virus potentially contributing to higher barren rates and deformed calves and lambs
“This may be the tip of the iceberg as we see the virus overwinter resulting in emergence much earlier,” he warned
Visit our <a href="/know-how">Know How</a> centre for practical farming advice
A total of 63 cases of the Schmallenberg virus (SBV) were identified in the UK last winter
This page provides key information on the virus
including useful guidance and advice if you spot cases on farm
The Schmallenberg virus (SBV) is an insect borne viral disease
It can affect all ruminants (such as sheep
goats and deer) and camelids (such as llama and alpaca)
and can also be the cause of late abortion or birth defects in new born cattle
It does not affect humans or food safety; meat and milk from infected animals are also safe to eat and drink
The virus often spreads very quickly – disease can last between 2-7 days
There is no vaccine available for SBV and no plans for production of a new vaccine
Farmers should remain vigilant for signs of disease and <a title="Find contact details for reporting animal health and welfare concerns to APHA." href="https://www.gov.uk/guidance/contact-apha#animal-health-and-welfare" data-anchor="#animal-health-and-welfare">report any suspicions to APHA</a> or their private vet
The last wave of Schmallenberg occurred between 2016-17
where over 200 cases were confirmed by APHA across sheep and cattle holdings in Great Britain
<a href="#menu" class="btn btn-info">Return to top</a>
Cases of Schmallenberg rose across the UK in autumn 2023
a total of 63 cases were confirmed to APHA
The majority of cases were found in stillborn lambs
meaning that positive cases do not need to be reported to Defra
Therefore it is difficult to say with accuracy the total number of cases seen across the autumn and winter
There are no plans for Defra to compensate farms that are affected by SBV
As SBV often presents itself in late abortion or birth defects
infection often goes unnoticed until the gestation period has passed
The acute disease usually lasts between 2-7 days in adult animals
before they begin to develop robust immunity
herd milk is found to drop on average between 0.3 and 1kg per cow
clinical signs of SPV are often mild or absent
Not all birth defects are due to SBV – for example
Some bulls can persistently intermittently excrete SBV in semen for up to 3 months post infection
SBV can cause deformities as the virus crosses the placenta and replicates in the central nervous system tissue
It also causes the maternal recognition of pregnancy
Often birthing ruminants infected with SBV require a caesarean or fetotomy to deliver to avoid trauma to the dam
meaning that its circulation is very much weather dependent
so we tend to see midge numbers peaking in the summer
Flocks or herds that are mating in the summer or early autumn are the worst affected
The length of gestation is also important; we expect to see clinical signs in sheep first
It is likely that SBV last circulated during the 2017/18 mating season
we are on the edge of the SPV endemic zone
where we tend to see explosive outbreaks every couple of years
reflecting a cycle of every 3-5 years when we have naïve animals exposed to circulating virus
there were no plans to cull infected animals
as SBV is likely to be transmitted by insects such as midges
making culling an ineffective means of stopping disease spread
There is also evidence that once an animal is infected with SBV
they quickly develop immunity and are not likely to remain infectious
There were no movement restrictions in place for the 2023-2024 winter
and is it unlikely for Defra to take future restrictive action against the disease
This is because SBV cases that are being detected in new born animals are likely to be as a result of infection in the summer/autumn
movement restrictions would likely be ineffective as SBV may already have been transmitted by insects across the country
If you are in need of help or support in the aftermath of a Schmallenberg infection on farm
there are a number of farming organisations that can help
NFU CallFirst is also available for help and advice on farming, legal or technical issues on <a title="Call NFU CallFirst." href="tel:03708458458">0370 845 8458</a>
This page was first published on 31 January 2024
Once you have submitted your query someone from NFU CallFirst will contact you
your query will then be passed to the appropriate NFU policy team
The information you provide will be used for the purpose of recording and responding to your query. It will be processed in accordance with the provisions of UK GDPR and the Data Protection Act 2018 and the NFU's <a href="https://www.nfuonline.com/nfu-privacy-notice/" target="_blank">Privacy Notice</a>
This site is protected by reCAPTCHA and the Google <a href='https://policies.google.com/privacy'>Privacy Policy</a> and <a href='https://policies.google.com/terms'>Terms of Service</a> apply
We use cookies to ensure you get the best experience when using our website. <a href='https://www.nfuonline.com/media/qhfn4us0/nfu-cookie-policy.pdf' target='_blank' rel='noopener noreferrer nofollow'>Read our cookie policy to learn more</a>
Strictly necessary: Strictly necessary cookies serve critical purposes
While you have the option to adjust your browser settings to disable these cookies
keep in mind that doing so might impact the website’s functionality
Functionality cookies: Functionality cookies are cookies that help enhance a website’s performance and functionality
functionality cookies can be used to allow video playback or remember a user’s region
Analytical/performance cookies: All data gathered through analytical cookies is anonymous and used solely to improve our website’s performance and your user experience
Analytical cookies help us understand how you use our website
They tell us which pages you visit most frequently
They help us create a better user experience for you and all our NFU members
Your cookie preferences can be managed in your browser settings
disabling analytical cookies may limit your ability to access certain features or receive personalised content
Targeting cookies: Our targeting cookies monitor your interactions with websites
Horse breeding from planning through foal care
Prevention and treatment for problems of the equine foot
Discussions about the welfare of our equine friends
How to care for the basic health needs of horses
All aspects of caring for performance horses
Design and maintain a healthy horse operation
News and issues for equine health professionals
What does it take to optimize the equine immune response and fight off disease
<a href="https://thehorse.com/edcchealthwatch" target="_blank" rel="noopener">EDCC Health Watch</a>
<a href="https://thehorse.com/topics/aaep-convention-2024/" target="_blank" rel="noopener">2024 AAEP Convention</a>
<a href="https://thehorse.com/topics/2024-equisummit/" target="_blank" rel="noopener">2024 EquiSUMMIT</a>
<a href="https://thehorse.com/topics/2024-olympics/" target="_blank" rel="noopener">2024 Olympics</a>
Our animal behavior experts field your questions about why your horse does XYZ
Equine nutritionists respond to queries about forage
Veterinarians and researchers tackle questions about equine athletes
The Horse&#8217;s experts answer your questions during a monthly live audio event
Join us as we interview leading equine researchers from the University of Kentucky
Checklists and identification forms for horse owners
Please <a href="https://thehorse.com/login/?redirect_to=https://thehorse.com/164586/study-schmallenberg-virus-might-infect-horses/">login</a> to access
None of the antibody-positive horses showed clinical signs of disease
Rasehk said it’s possible that the disease had run its course by the time the horses were tested and the antibodies were still present in the system
or it’s feasible that horses just don’t develop clinical disease despite infection
A recently discovered virus known to infect ruminants in parts of Europe might infect horses
as well: Researchers have just identified antibodies to the Schmallenberg virus
They are the first horses worldwide to test positive for these antibodies
TheHorse.com is home to thousands of free articles about horse health care
In order to access some of our exclusive free content
Stay on top of the most recent Horse Health news with
Seek the advice of a qualified veterinarian before proceeding with any diagnosis
Don&#8217;t have an account? Register for a FREE account <a href="/register/" target="_blank" rel="noopener">here</a>
This website uses cookies so that we can provide you with the best user experience possible
Cookie information is stored in your browser and performs functions such as recognising you when you return to our website and helping our team to understand which sections of the website you find most interesting and useful
Strictly Necessary Cookie should be enabled at all times so that we can save your preferences for cookie settings
we will not be able to save your preferences
This means that every time you visit this website you will need to enable or disable cookies again
<a href="/articles/10.1186/s13071-020-04522-3/metrics" data-track="click" data-track-action="view metrics" data-track-label="link" rel="nofollow">Metrics details</a>
recurrent epizootics of bluetongue virus and Schmallenberg virus have been reported in the western Palearctic region
goats and wild ruminants and are transmitted by native hematophagous midges of the genus Culicoides (Diptera: Ceratopogonidae)
Culicoides dispersal is known to be stratified
due to a combination of dispersal processes occurring actively at short distances and passively or semi-actively at long distances
allowing individuals to jump hundreds of kilometers
we aim to identify the environmental factors that promote or limit gene flow of Culicoides obsoletus
an abundant and widespread vector species in Europe
using an innovative framework integrating spatial
population genetics and statistical approaches
A total of 348 individuals were sampled in 46 sites in France and were genotyped using 13 newly designed microsatellite markers
We found low genetic differentiation and a weak population structure for C
Using three complementary inter-individual genetic distances
we did not detect any significant isolation by distance
but did detect significant anisotropic isolation by distance on a north-south axis
We employed a multiple regression on distance matrices approach to investigate the correlation between genetic and environmental distances
Among all the environmental factors that were tested
only cattle density seems to have an impact on C
obsoletus over land found in the present study calls for a re-evaluation of the impact of Culicoides on virus dispersal
and highlights the urgent need to better integrate molecular
spatial and statistical information to guide vector-borne disease control
and little attempt has been made to link the former to environmental factors
Given the high dispersal capacity and the stratified dispersal pattern of Culicoides
it is crucial to determine inland connectivity among populations and to identify the potential environmental factors that promote or limit gene flows between them
Mapping averaged pairwise information (MAPI) allows the visual comparison of genetic dissimilarity with some environmental factors
and also the development of working hypotheses
it is also necessary to use statistical analyses of genetic and environmental distances as a complement to MAPI
The aims of the present study are to determine the inland connectivity of populations of a main vector species at large geographical scales and to identify the environmental factors that promote or limit gene flows between Culicoides populations in France
we characterized 13 microsatellite markers dedicated to C
We propose a complementary framework integrating multiple approaches which can be applied more generally to the study of gene flow and its links with environmental factors
In order to estimate unbiased gene flow of C
only individuals identified as such were used for further analyses
we selected 3135 primer pairs flanking dinucleotide SSR motifs with a minimum of 12 repeats and amplifying fragments between 150 and 300&nbsp;bp in length and a half-denaturation temperature close to 55 °C
We screened a set of 30 primer pairs and optimized both polymerase chain reaction (PCR) and multiplex PCR conditions
followed by a final elongation of 5 min at 72&nbsp;°C
Fragments were separated on an Applied Biosystems 3500xL Genetic Analyzer
Allelic size allocations for all individuals and microsatellite markers were performed using the program GeneMapper version 5 (Applied Biosystems
Life Technologies) with double blind reading to limit the potential interpretation bias from the reader
This ∆K value is a way to determine the inflection in the [ln P(D)] curve
The clustering resulting from the Bayesian inference was transposed into percentages of assignment of each individual to the K inferred clusters and plotted on a map
GENELAND also uses a Bayesian algorithm to infer population genetic clusters while taking into account the spatial position of individuals
making it a spatially explicit clustering method
The most probable number of clusters was also determined by running the algorithm with K ranging from 1 to 10
The analysis was based on 1,000,000 MCMC iterations with a thinning of 1000
maximum rate of the Poisson process fixed to 100
maximum number of nuclei in the Poisson-Voronoi tessellation fixed to 300 and a burn-in of 100
We used the R package graphics to produce a distribution map of genetic structure resulting from STRUCTURE and GENELAND analyses
geo-referenced grids of environmental values) either treated as potential resistance (R) or conductance (C) factors:
The projected distance matrix was calculated for each angle between all sampling sites
When calculating the projected geographical distance as a function of the angle between populations
dAB is the geographical distance between population A and B and aAB is the angle between populations A and B.&nbsp;
</a>Genetic clustering and genetic differentiation of Culicoides obsoletus
Results of the genetic clustering analyses performed with GENELAND (a) and STRUCTURE (b)
as well as smoothing of pairwise measures performed with mapping averaged pairwise information (MAPI) and based on (c) Rousset’s (aR) and (d) factorial correspondence analysis (FCA) inter-individual genetic distances
A specific color has been assigned to each genetic cluster in a and b
d Genetic dissimilarity is represented by a color scale ranging from red (lower genetic dissimilarity) to blue (higher genetic dissimilarity)
The black circles indicate the sampling sites
no significant association was found between LKC genetic distance and the environmental distances (Q values always &lt; 0)
Although our method of analysis seems complementary and coherent for the detection of genetic structure
obsoletus is not genetically or geographically structured at the scale of France
The most genetically dissimilar individuals were mainly from the southernmost populations of the sampling area
Multiple non-exclusive lines of argument might explain the significant anisotropic isolation by distance observed on a north–south axis in France
Population sampling at the same scale could allow comparison and estimation of genetic diversity
anisotropic isolation by distance may be due to an artifact of the sampling methods used
if the extent of the sampling varies depending on direction
the distances projected from the angles may represent different distance distributions and lead to the over-representation of the values of strong genetic metrics in the direction of the scatter plot and the hit of positive correlation signals
the absence of correlation does not necessarily mean more gene flow but an absence of isolation by distance
which can also result from a strong drift and thus less gene flow; a drift which depends on both dispersion and population sizes
It is therefore essential to use as a complement—as we have done here and with which we have achieved a similar result—an approach that weights the geographical distances between populations according to their orientation with respect to a given angle axis passing through the barycenter
This type of study would make it possible to estimate the effective size of the populations
the use of high-throughput sequencing approaches using markers such as double-digest restriction-site associated DNA sequencing can provide greater resolution in view of the large number of single nucleotide polymorphisms (SNPs) revealed at a local scale
and improve our understanding of the active and passive dispersal of Culicoides
It could also be relevant to include more microsatellite markers or SNPs to improve genetic resolution and observe the matching and assignment of each individual
this study provides the first complete landscape genetic analysis of C
a major vector species of animal viruses in Europe
This study shows that the genetic structure of populations at the scale of a country can become homogeneous through large-scale dispersion
a very high inland dispersal and vectorization capacity
which has to be taken into consideration in further work on vector competence and epidemiological modeling of disease transmission
Wind direction could be a key factor in the dispersal of many insect vector species
Futures studies should increase their geographical extent to cover the entire area of species distribution and enable a better understanding of the limits of Culicoides gene flow
In addition to the biological information presented here
this study highlights several important areas for the improvement of methodologies that may currently limit the inclusion of wind direction in landscape genetic analyses
All data generated or analyzed during this study are included in this article and its additional files
The newly generated sequences have been submitted to the GenBank database under accession numbers MT828832-MT828844
All the cytochrome c oxidase subunit 1 sequences are available on request
A new individual-based spatial approach for identifying genetic discontinuities in natural populations
Bluetongue and Douglas virus activity in New South Wales in 1989: further evidence for long-distance dispersal of the biting midge Culicoides brevitarsis
Culicoides and the emergence of bluetongue virus in northern Europe
Real-time quantitative reverse transcription-PCR assays specifically detecting bluetongue virus serotypes 1
First occurrence of Culicoides obsoletus-transmitted bluetongue virus epidemic in Central Europe
Bionomics of temperate and tropical Culicoides midges: knowledge gaps and consequences for transmission of Culicoides-borne viruses
Modelling the effects of past and future climate on the risk of bluetongue emergence in Europe
Climate change and the recent emergence of bluetongue in Europe
Bluetongue virus spread in Europe is a consequence of climatic
landscape and vertebrate host factors as revealed by phylogeographic inference
Modelling the monthly abundance of Culicoides biting midges in nine European countries using random forests machine learning
Effect of temperature on the transmission of orbiviruses by the biting midge
An assessment of Culicoides surveillance techniques in northern Europe: have we underestimated a potential bluetongue virus vector
Evaluation of housing as a means to protect cattle from Culicoides biting midges
Bluetongue in the United Kingdom and northern Europe in 2007 and key issues for 2008
Local dispersal of Palaearctic Culicoides biting midges estimated by mark-release-recapture
The dispersal of Culicoides mohave (Diptera
Ceratopogonidae) in the desert of southern California
Local dispersal of the biting-midge Culicoides-Brevitarsis Kieffer (Diptera
Ceratopogonidae) in southeastern Australia
Evaluation of long-distance dispersal of Culicoides midges into northern Australia using a migration model
A wind density model to quantify the airborne spread of Culicoides species during north-western Europe bluetongue epidemic
Quantifying the wind dispersal of Culicoides species in Greece and Bulgaria
Possible introduction of bluetongue into the Balearic Islands
in continental France likely due to rare wind-transport events
Quantification of within- and between-farm dispersal of Culicoides biting midges using an immunomarking technique
Delineation of the population genetic structure of Culicoides imicola in East and South Africa
Spatio-temporal genetic variation of the biting midge vector species Culicoides imicola (Ceratopogonidae) Kieffer in France
Hypothetical route of the introduction of Schmallenberg virus into Ireland using two complementary analyses
Combining dispersion modelling with synoptic patterns to understand the wind-borne transport into the UK of the bluetongue disease vector
Long-distance aerial dispersal modelling of Culicoides biting midges: case studies of incursions into Australia
Sellers’ revisited: a big data reassessment of historical outbreaks of bluetongue and African horse sickness due to the long-distance wind dispersion of Culicoides midges
Possible means of introduction of bluetongue virus serotype 8 (BTV-8) to Sweden in August 2008: comparison of results from two models for atmospheric transport of the Culicoides vector
The possible route of introduction of bluetongue virus serotype 3 into Sicily by windborne transportation of infected Culicoides spp
Devenish B: The UK Met Office’s Next-Generation Atmospheric Dispersion Model
In: Air pollution modeling and its application XVII: 2007; Boston
Investigating incursions of bluetongue virus using a model of long-distance Culicoides biting midge dispersal
Colonization of the Mediterranean Basin by the vector biting midge species Culicoides imicola: an old story
A comparison of individual-based genetic distance metrics for landscape genetics
Relationships between migration rates and landscape resistance assessed using individual-based simulations
Using spatial Bayesian methods to determine the genetic structure of a continuously distributed population: clusters or isolation by distance
Mapping averaged pairwise information (MAPI): a new exploratory tool to uncover spatial structure
The tree that hides the forest: cryptic diversity and phylogenetic relationships in the Palaearctic vector Obsoletus/Scoticus complex (Diptera: Ceratopogonidae) at the European level
Delecolle JC: Nouvelle contribution à l’étude systématique et iconographique des espèces du genre Culicoides
(Diptéra) : (Cératopogonidae) du nord-est de la France
Towards the PCR-based identification of Palaearctic Culicoides biting midges (Diptera: Ceratopogonidae): results from an international ring trial targeting four species of the subgenus Avaritia
MUSCLE: multiple sequence alignment with high accuracy and high throughput
Characterization of microsatellites identified by next-generation sequencing in the Neotropical tree Handroanthus billbergii (Bignoniaceae)
ABySS: a parallel assembler for short read sequence data
MISA-web: a web server for microsatellite prediction
ggplot2: elegant graphics for data analysis
Poppr: an R package for genetic analysis of populations with clonal
MMOD: an R library for the calculation of population differentiation statistics
Short allele dominance as a source of heterozygote deficiency at microsatellite loci: experimental evidence at the dinucleotide locus Gv1CT in Gracilaria gracilis (Rhodophyta)
Detecting Wahlund effects together with amplification problems: cryptic species
null alleles and short allele dominance in Glossina pallidipes populations from Tanzania
PopGenReport: simplifying basic population genetic analyses in R
Estimating F-statistics for the analysis of population structure
Inference of population structure using multilocus genotype data
GENELAND: a computer package for landscape genetics
Inferring weak population structure with the assistance of sample group information
Evanno G, Regnaut S, Goudet J. Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Mol Ecol. 2005;14(8):2611–2620. <a href="https://doi.org/10.1111/j.1365-294X.2005.02553.x" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="10.1111/j.1365-294X.2005.02553.x">https://doi.org/10.1111/j.1365-294X.2005.02553.x</a>
STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method
Belkhir K. Genetix 4.05, logiciel sous Windows TM pour la genetique des populations. 2004. <a href="http://www.genetix.univ-montp2.fr/genetix/genetix.htm" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="http://www.genetix.univ-montp2.fr/genetix/genetix.htm">http://www.genetix.univ-montp2.fr/genetix/genetix.htm</a>
The ecodist package for dissimilarity-based analysis of ecological data
Beyond the landscape: resistance modelling infers physical and behavioural gene flow barriers to a mobile carnivore across a metropolitan area
Genetic differentiation between individuals
SPAGEDi: a versatile computer program to analyse spatial genetic structure at the individual or population levels
Spatial genetic-structure of a tropical understory shrub
Estimation of pairwise relatedness between individuals and characterization of isolation-by-distance processes using dominant genetic markers
The detection of disease clustering and a generalized regression approach
Circuitscape: a tool for landscape ecology
A first attempt at modelling roe deer (Capreolus capreolus) distributions over Europe
et al: Global cattle distribution in 2010 (5 minutes of arc)
Evaluation of the global multi-resolution terrain elevation data 2010 (GMTED2010) using ICESat geodetic control
In: International Symposium on Lidar and Radar Mapping 2011: Technologies and Applications
New refinements and validation of the collection-6 MODIS land-surface temperature/emissivity product
edit and include wind data in ecological and evolutionary analysis
Examples of the use of elements for clarifying regression analyses
An R package to compute commonality coefficients in the multiple regression case: an introduction to the package and a practical example
Landscape genetic analyses of Cervus elaphus and Sus scrofa: comparative study and analytical developments
Regression commonality analyses on hierarchical genetic distances
Anisotropic isolation by distance: the main orientations of human genetic differentiation
Assessment of population genetic structure in the arbovirus vector midge
Culicoides brevitarsis (Diptera: Ceratopogonidae)
Genetic diversity of Culicoides stellifer (Diptera: Ceratopogonidae) in the southeastern United States compared with sequences from Ontario
Relative performance of Bayesian clustering software for inferring population substructure and individual assignment at low levels of population differentiation
FLOCK provides reliable solutions to the “number of populations” problem
Optimizing the trade-off between spatial and genetic sampling efforts in patchy populations: towards a better assessment of functional connectivity using an individual-based sampling scheme
Environmental factors influencing the velocity of bluetongue virus serotype 8 epizootic wave in France
Host preferences of Palaearctic Culicoides biting midges: implications for transmission of orbiviruses
Field observations during the bluetongue serotype 8 epidemic in 2006
case fatality and clinical recovery in sheep and cattle in the Netherlands
Re-emergence of bluetongue virus serotype 8 in France
Biotic and abiotic factors shape the microbiota of wild-caught populations of the arbovirus vector Culicoides imicola
Culicoides (Diptera: Ceratopogonidae) host preferences and biting rates in the Netherlands: comparing cattle
(Diptera: Ceratopogonidae) on cattle and sheep in northeast Germany
Culicoides chiopterus as a potential vector of bluetongue virus in Europe
A new algorithm quantifies the roles of wind and midge flight activity in the bluetongue epizootic in northwest Europe
Characteristics of wind-infective farms of the 2006 bluetongue serotype 8 epidemic in northern Europe
Founding events in species invasions: genetic variation
Comparison of four species-delimitation methods applied to a DNA barcode data set of insect larvae for use in routine bioassessment
What we still don’t know about invasion genetics
Inferring population decline and expansion from microsatellite data: a simulation-based evaluation of the Msvar method
<a data-track="click" data-track-action="download citation references" data-track-label="link" rel="nofollow" href="https://citation-needed.springer.com/v2/references/10.1186/s13071-020-04522-3?format=refman&amp;flavour=references">Download references</a>
SD and MG are supported by the Fonds National de la Recherche Scientifique (Belgium)
AM and MJ have been awarded fellowships from the H2020-727393 PALE-Blu project funded by the EU
Ronan Rivallan and Xavier Argout at the Grand plateau technique regional de génotypage in Montpellier
France for their help in the development of the microsatellite markers and Aurore Manez for her help in the genotyping
Karine Berthier and Marie-Pierre Chapuis for constructive exchanges which helped to improve the relevance of our conclusions
The authors are grateful to all the partners who assisted in the Culicoides sampling and shipping
We thank William Wint (University of Oxford
PALE-Blu partner) for his continued support in extracting and preparing meteorological data
This study was partially funded by EU grant H2020-727393 PALE-Blu and by the VectorNet project (OC/EFSA/AHAW/2013/02-FWC1) funded by the European Centre for Disease Prevention and Control (ECDC) and the European Food Safety Authority (EFSA)
The contents of this publication are the sole responsibility of the authors and do not necessarily reflect the views of the European Commission
Ignace Rakotoarivony &amp; Maïa de Wavrechin
Institut Agronomique et Vétérinaire Hassan II
TB contributed to the collection of Culicoides samples
and IR and MD contributed to the identification of Culicoides
and MW performed the molecular biology manipulations
SD and MJ developed the techniques and workflow for the landscape genetics analysis
the first draft of which was written by AM
All the authors read and approved the final manuscript
The authors declare that they have no competing interests
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations
 Sampling sites and associated genetic diversity
 Reference sequences used for specific assignation
 Origin and numbers of individuals used to build up the DNA library necessary for the development of the microsatellite markers
 Primers of the 13 microsatellite markers used to genotype C
TFm half denaturation temperature in degrees
 Environmental variables tested as potential factors that could impact inter-individual genetic differentiation of C
obsoletus in France (raster cell resolution: 0.04 arcmin)
 Map of wind direction averaged from 2000 to 2010
Sampling sites are represented by black points
The color scale represents the wind direction from 0 to 360 ° from north
The arrowheads indicate the exact wind direction of each raster pixel
 Isolation by distance analyses: density plots
Mantel tests and linear regressions performed with each inter-individual genetic distance considered in this study
 Identification of the optimal number of genetic clusters (K) inferred by STRUCTURE using the δ(K) and L’(K) methods
 Population genetic structure results by clustering analyses performed STRUCTURE
A specific color has been assigned to each inferred genetic cluster
 Results of univariate analyses: determination coefficients (R2) estimated from univariate regressions between genetic and environmental distances
[C] indicates that the considered environmental raster was treated as a conductance factor for the computation of environmental distances with circuit theory
[R] indicates that the considered environmental raster was treated as a resistance factor for the computation of environmental distances with circuit theory
Q Difference between environmental multiple regression on distance matrices (MRDM) R2 and null raster MRDM R2
The results for K = 10 are not shown as they were non-significant
 Bar plots of population genetic structure results by clustering analyses performed by STRUCTURE for K = 2 and K = 4
unless otherwise stated in a credit line to the data
<a data-test="citation-link" data-track="click" data-track-action="download article citation" data-track-label="link" data-track-external="" rel="nofollow" href="https://citation-needed.springer.com/v2/references/10.1186/s13071-020-04522-3?format=refman&amp;flavour=citation">Download citation</a>
DOI: https://doi.org/10.1186/s13071-020-04522-3
Anyone you share the following link with will be able to read this content:
a shareable link is not currently available for this article
Testing undertaken by the Regional Veterinary Laboratories (RVLs)
and prompted after the receipt of a number of reports of milk drop syndrome in dairy herds this summer
has confirmed the circulation of Schmallenberg virus (SBV) in some herds
A statement released by the National Disease Control Centre of the Department of Agriculture
Food and the Marine on September 25 read: &ldquo;The RVLs have received a number of reports of milk drop syndrome in dairy herds this summer
A high rate of seropositivity to Schmallenberg virus (SBV) has been found in the samples submitted from some of these herds.&rdquo;
it notes that some of the clinical signs included milk drop
pyrexia (raised temperature) and apparent pregnancy loss
although not all clinical signs were present in all affected animals
The National Disease Control Centre also confirmed that many of the positive animals had been born since 2018
which is when the virus is thought to have most recently circulated in Ireland and indicates more recent re-emergence of the virus
It urged care when interpreting single serology (blood test) results
the virus itself has been detected or very recent infection has been diagnosed using paired serology tests around the same time the clinical signs occurred
suggesting that SBV was responsible&rdquo;
the National Disease Control Centre offered the following: &ldquo;Animal keepers should be vigilant for the clinical signs described and consult their veterinary practitioner for advice if they are seen.&rdquo;
<a href="/articles/srep42500/metrics" data-track="click" data-track-action="view metrics" data-track-label="link" rel="nofollow">Metrics details</a>
Schmallenberg virus (SBV) is transmitted by insect vectors
and therefore vaccination is one of the most important tools of disease control
novel subunit vaccines on the basis of an amino-terminal domain of SBV Gc of 234 amino acids (“Gc Amino”) first were tested and selected using a lethal small animal challenge model and then the best performing formulations also were tested in cattle
coli expressed nor the reduced form of “Gc Amino” protected from SBV infection
immunization with “Gc Amino”-encoding DNA plasmids and “Gc-amino” expressed in a mammalian system
conferred protection in up to 66% of the animals
the best performance was achieved with a multivalent antigen containing the covalently linked Gc domains of both
All vaccinated cattle and mice were fully protected against SBV challenge infection
in the absence of antibodies against the viral N-protein
differentiation between vaccinated and field-infected animals allows an SBV marker vaccination concept
the presented vaccine design also could be tested for other members of the Simbu serogroup and might allow the inclusion of additional immunogenic domains
This has been discussed as a possible basis of effective vaccines against SBV as well as against related orthobunyaviruses by using the corresponding genomic regions
such a domain further represents a promising subunit marker vaccine candidate since antibodies against the N protein would be induced by an SBV field infection and not by vaccination with the Gc domain
and several validated commercial N-based ELISA tests are available which could be used as companion test system
until now it is not known how the domain must be presented or expressed in order to correctly present the key immunogenic domains
different approaches were selected: (I) DNA immunization; (II) protein expression in E
coli and a mammalian expression system to examine the influence of glycosylation and other posttranslational modifications; (III) immunization with the non-reduced and the reduced form of the protein to evaluate the influence of disulfide bonds; and (IV) the influence of additionally attached domains and thereby potential use as multivalent vaccines
The Phusion HF DNA polymerase used for the PCR and the enzymes applied for cloning were obtained from New England Biolabs (Frankfurt am Main
A PCR product using the plasmid encoding for SBV-Gc Amino as template was generated with the oligonucleotides AATTATTCCATGGGTATCAACTGCAAGAACATCCAGAGCACC (restriction sites in bold) and TAATAACTCGAGAATCAGGCTCAGGGTGGTCAGGGTC and subsequently digested with NcoI and XhoI and ligated to the plasmid pGRS-79_Ulm (Roman-Sosa
unpublished) which was also treated with these enzymes
The plasmid was checked by sequencing with the oligonucleotides T7 promoter (TAATACGACTCACTATAGGG) and T7 terminator (GCTAGTTATTGCTCAGCGG)
SBV-Gc Amino was used without affinity tag
A PCR product was generated with the oligonucleotides AATTATTGCTAGCGCCACCATGGAGACAGACACAC and ATAAAtctagaCTAAATCAGGCTCAGGGTGGTCAG and the plasmid encoding for SBV-Gc Amino as a template
Subsequently the PCR product was restriction digested with NheI/XbaI before being ligated to the pCI Mammalian Expression Vector (Promega
Germany) also processed with these enzymes
The plasmid was checked by sequencing with the primers pCI-fwrd (CCTTTCTCTCCACAGGTGTCCACTCC) and pCI-rev-A (AGCATTTTTT TCACTGCATT CTAGTTG)
the plasmid was digested with HindIII and XbaI and the fragment was ligated to the plasmid pEXPR-IBA-103 (IBA
which was also processed with the same enzymes
A PCR product was generated with the oligonucleotides ttattaaCATATGGATGCTCAGGTCGGGCCGG and AATTATTTCTAGAGCCACCATGGAGACAGACACAC using the plasmid encoding for AKA-Gc Amino as template
The DNA fragment was digested with NheI and XbaI and ligated to the plasmid pSignalSeq also processed with these enzymes
the plasmid was digested with XbaI and KpnI and the fragment was ligated to pGRS-19 (Roman-Sosa
unpublished) which also was restriction digested with these enzymes
The plasmids for the constructs AKA-Gc Amino and AKA-Gc Amino-SBV-Gc Amino were controlled by sequencing with the primers pEXPR-fwrd (GAGAACCCACTGCTTACTGGC) and pEXPR-rev (TAGAAGGCACAGTCGAGG)
To generate the vaccine SBV-Gc Amino red the protein SBV-Gc Amino was treated with 10 mM DTT and 0.2% Triton X-100 (v/v) in buffer W (100 mM Tris-HCl pH 8.0
and the cysteines were alkylated with 10 mg/ml iodoacetamide for 15 min at 37 °C
All protein concentrations were determined using Bradford reagent (BioRad
and aliquots were stored at −80 °C until use
the N-terminal 234 residues of SBV Gc were ligated to the pCI Mammalian Expression Vector (Promega
Germany) and used directly for immunization of mice (SBV-Gc Amino (DNA))
For immunization of mice with proteins GERBU ADJUVANT MM (GERBU Biotechnik GmbH, Heidelberg, Germany) and for immunization of cattle POLYGEN™ (MVP Technologies, Omaha, USA) were used as adjuvants. All vaccines are listed in <a data-track="click" data-track-label="link" data-track-action="table anchor" href="/articles/srep42500#Tab1">Table 1</a>
The results were expressed as the percentage of the sample OD relative to the positive control OD (S/P*100)
Micro-neutralization tests against SBV or AKAV were performed as described previously<a data-track="click" data-track-action="reference anchor" data-track-label="link" data-test="citation-ref" aria-label="Reference 19" title="Wernike, K. et al. Oral exposure, reinfection and cellular immunity to Schmallenberg virus in cattle. Veterinary microbiology 165, 155–159, doi: 10.1016/j.vetmic.2013.01.040 (2013)." href="/articles/srep42500#ref-CR19" id="ref-link-section-d451724203e899">19</a>
Evaluation was done by assessment of the cytopathic effect after 3 days
All samples were tested in quadruplicate and the antibody titers were calculated as ND50 according to Behrens and Kaerber
The nitrocellulose membranes were incubated with cattle sera diluted 1/100 in PBS-Tween (0.1% Tween20) overnight at 4 °C followed by an incubation with a horseradish peroxidase-conjugated anti-bovine antibody (Dianova
Germany; diluted 1/20 000 in PBS-Tween) for 1 hour at RT
Beta Actin was detected using an anti-Beta Actin monoclonal antibody (1/10 000
Germany) and a peroxidase-conjugated anti-mouse antibody (1/10 000
Proteins were visualized using the Super Signal West Pico Chemiluminescent substrate (Thermo Scientific
Germany) and analyzed by the Intas ChemoCam System (Intas Science Imaging Instruments GmbH
The experimental protocols were reviewed by the responsible state ethics commission and were approved by the competent authority (State Office for Agriculture
Food Safety and Fisheries of Mecklenburg-Vorpommern
All experiments were performed in accordance with relevant guidelines and regulations
This SBV strain represents the most suitable challenge material for the used small animal model
since it turned out to be of very high virulence for IFNAR −/− mice
the copy number per mg of the corresponding organ sample was calculated
Blood samples taken at autopsy were additionally analyzed by in-house ELISAs
The animals were euthanized four weeks after challenge infection
rectal body temperatures were measured daily and the animals were examined for clinical signs by veterinarians
Two animals each of groups C01 and C03 and three cattle of groups C02 and C04 suffered from trichophytia and were treated with TRICHOVAC LTF 130 (IDT Biologika Animal Health
and 3× group C04) received antibiotics (Baxyl LA 200 [Veyx-Pharma GmbH
Germany] and Metapyrin [Serumwerk Bernburg AG
Sera were taken at weekly intervals throughout the study and analyzed by a microneutralization test against SBV isolate BH80/11
a commercially available N-based ELISA (ID Screen® Schmallenberg virus Competition
and in-house ELISAs against the proteins used for immunization
Sera from unvaccinated control animals were tested against all proteins used for immunization of the other animal groups
and against AKA-Gc Amino in in-house ELISAs
Sera of group C03 (AKA-Gc Animo-SBV-Gc Amino) taken on the days of vaccination and three weeks after the second immunization were analyzed additionally by a standard microneutralization test against AKAV and sera obtained 4 weeks after challenge infection from cattle of groups C01
mandibular and mesenteric lymph nodes and analyzed by real-time PCR
</a>Body weight after challenge infection of mice with SBV and real-time PCR results of blood samples taken 2 and 7 days after infection
Sera taken from the control animals (pCI-vector and environmental control mice) were tested against all three antigens; with the exception of the only mouse of group M08 which survived the challenge infection, no reaction to any of the antigens was observed (<a data-track="click" data-track-label="link" data-track-action="supplementary material anchor" href="/articles/srep42500#MOESM92">Supplementary Fig. 3</a>)
All sera of group C03 (vaccine AKA-Gc Amino-SBV-Gc Amino) taken on the day of the first vaccination scored negative in the neutralization test against AKAV
On the day of the second immunization two animals tested negative and two positive (neutralizing titers 1/10 and 1/7) and three weeks after the second vaccination neutralizing antibodies against AKAV were detectable in all four cattle (titers 1/17
None of the cattle showed any relevant SBV-specific clinical signs during the entire study
</a>The results of individual animals in each group are depicted in different colors; the identical colors are used in the corresponding panels of <a data-track="click" data-track-label="link" data-track-action="figure anchor" href="/articles/srep42500#Fig2">Figs 2</a> and <a data-track="click" data-track-label="link" data-track-action="figure anchor" href="/articles/srep42500#Fig3">3</a>
In all animals without detectable viraemia also the organ samples tested negative by real-time PCR
whereas in every viraemic cattle SBV genome was found in at least one organ sample (Ct values ranging from 30.4 to 40.5)
none of the established SBV vaccines enables differentiation of vaccinated from field-infected animals (DIVA)
coli expression system was included in the present study
mice vaccinated with proteins expressed in E.coli did not develop a detectable immune response and were not protected against virulent virus challenge
This indicates that correct glycosylation is of vital importance for the antigenicity and immunogenicity of the SBV-Gc-Amino domain
rendering E.coli an unsuitable expression system
which in the present study resulted in a similar performance of the HEK-cell expressed Gc-domain and the DNA-mediated vaccine in immunized mice
indicating correct presentation of the antigen in both delivery systems
as demonstrated by the loss of immunogenicity upon reduction
the maintenance of disulfide bonds within the Gc-Amino domain seems to be crucial for correct presentation of the antigen
it must be anticipated that in the present study the key immunogens
most likely the aminoterminal domain of Gc
were not completely accessible using the SBV-Gn-L-Gc construct
There might be a negative interaction with the Gn component of this construct
the sterile protection conferred by the AKA-Gc Amino-SBV-Gc Amino construct is most likely exclusively caused by the immunogenic SBV domain Gc-Amino and its optimized presentation or stabilization by the linked AKAV domain
The suitability of the IFNAR −/− mouse model for SBV vaccination studies was demonstrated in direct comparison with cattle
showing equal results in both animals species
partial protection by SBV-Gc-Amino and SBV-Gn-L-Gc expressed in mammalian cells
and complete sterile immunity conferred by AKA-Gc Amino-SBV-Gc Amino in cattle and in mice
This makes the selected mouse model a handy and versatile tool for SBV vaccine research
Especially as vaccination and challenge experiments in ruminants are complicated due to the need of adequate high containment housing
the mouse model facilitates direct comparison of different vaccine delivering systems and/or expression systems
the double-construct AKA-Gc Amino-SBV-Gc Amino completely prevented viremia in all vaccinated cattle and mice after subsequent challenge infection with virulent SBV
making it an efficient and safe candidate vaccine
it enables differentiation between vaccinated and field-infected animals using the detection of the SBV-N-protein by commercial antibody ELISAs
The approach of this study additionally demonstrated that novel safe and efficient vaccines can be produced very quickly without the necessity to handle the infectious virus during the production process which is an advantage compared to the currently available inactivated or live attenuated vaccines
The identification of key immunogenic domains and their crucial structural components enables the selection of a suitable expression system as well as a rapid and relatively inexpensive production of potent and safe vaccines
The N-terminal domain of Schmallenberg virus envelope protein Gc is highly immunogenic and can provide protection from infection
Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations
classification and taxonomy of viruses in the family Bunyaviridae in Bunyaviridae (eds Elliot
Schmallenberg virus-two years of experiences
doi: 10.1016/j.prevetmed.2014.03.021 (2014)
Schmallenberg Virus beyond Latitude 65 degrees N
Schmallenberg virus circulation in high mountain ecosystem
Detection and partial sequencing of Schmallenberg virus in cattle and sheep in Turkey
Schmallenberg virus cases identified in Ireland
Schmallenberg virus detected in sheep in England
Inactivated Schmallenberg virus prototype vaccines
Deletion mutants of Schmallenberg virus are avirulent and protect from virus challenge
VMD authorises SBV vaccine for use in the UK
Overview of marker vaccine and differential diagnostic test technology
doi: 10.1016/j.biologicals.2005.08.006 (2005)
Recent advances in the molecular and cellular biology of bunyaviruses
Analysis of the humoral immune response against the envelope glycoprotein Gc of Schmallenberg virus reveals a domain located at the amino terminus targeted by mAbs with neutralizing activity
Schmallenberg virus infection of adult type I interferon receptor knock-out mice
Sequence analysis of the medium RNA segment of three Simbu serogroup viruses
reinfection and cellular immunity to Schmallenberg virus in cattle
A novel panel of monoclonal antibodies against Schmallenberg virus nucleoprotein and glycoprotein Gc allows specific orthobunyavirus detection and reveals antigenic differences
Organ distribution of Schmallenberg virus RNA in malformed newborns
Schmallenberg virus challenge models in cattle: infectious serum or culture-grown virus
Orthobunyaviruses: recent genetic and structural insights
Fever with thrombocytopenia associated with a novel bunyavirus in China
Discovery of a unique novel clade of mosquito-associated bunyaviruses
Malformations Caused by Shuni Virus in Ruminants
causing Schmallenberg virus-like clinical signs in Northern Jordan
Recent developments in veterinary vaccinology
Reversion to virulence of chicken-passaged infectious bronchitis vaccine virus
African Horse Sickness Caused by Genome Reassortment and Reversion to Virulence of Live
Protein production from the structural genomics perspective: achievements and future needs
Getting the glycosylation right: implications for the biotechnology industry
Glycoprotein structural genomics: solving the glycosylation problem
Production of active eukaryotic proteins through bacterial expression systems: a review of the existing biotechnology strategies
Comparative Study on Different Expression Hosts for Alkaline Phytase Engineered in Escherichia coli
DNA vaccines: an historical perspective and view to the future
doi: 10.1111/j.1600-065X.2010.00980.x (2011)
Strategies for improving DNA vaccine performance
A Recombinant Rift Valley Fever Virus Glycoprotein Subunit Vaccine Confers Full Protection against Rift Valley Fever Challenge in Sheep
Evaluating the protective efficacy of a trivalent vaccine containing Akabane virus
Aino virus and Chuzan virus against Schmallenberg virus infection
Correlates of protection induced by vaccination
Development of inactivated trivalent vaccine for the teratogenic Aino
doi: 10.1016/j.biologicals.2011.02.004 (2011)
Development of inactivated vaccine for Akabane disease
National Institute of Animal Health quarterly 18
<a data-track="click" data-track-action="download citation references" data-track-label="link" rel="nofollow" href="https://citation-needed.springer.com/v2/references/10.1038/srep42500?format=refman&amp;flavour=references">Download references</a>
We thank Kristin Trippler and Susanne Zahnow for technical assistance and Axel Karger for the mass spectrometric confirmation of protein identity
The dedicated animal care by the staff of the isolation unit of the FLI is gratefully acknowledged
This work was in part financially supported by the Zoonoses Anticipation and Preparedness Initiative (ZAPI
115760) within the Innovative Medicines Initiative (IMI Call 11 - IMI-JU-11-2013-04)
Conceived and designed the experiments: K.W.
Contributed reagents/materials/analysis tools: K.W.
All authors read and approved the final manuscript
The authors declare no competing financial interests
<a data-test="citation-link" data-track="click" data-track-action="download article citation" data-track-label="link" data-track-external="" rel="nofollow" href="https://citation-needed.springer.com/v2/references/10.1038/srep42500?format=refman&amp;flavour=citation">Download citation</a>
Sign up for the Nature Briefing: Microbiology newsletter — what matters in microbiology research
<a href="/articles/s41598-020-73424-2/metrics" data-track="click" data-track-action="view metrics" data-track-label="link" rel="nofollow">Metrics details</a>
an arthropod-transmitted pathogenic bunyavirus
continues to be a threat to the European livestock industry
causing morbidity and mortality among young ruminant livestock
based on bacterially expressed SBV nucleoprotein (SBV-N) administered with a veterinary-grade Saponin adjuvant
SBV-N with Saponin induced strong non-neutralizing broadly virus-reactive antibodies
Vaccination assays also suggest that this level of immune protection is cell mediated
as evidenced by the lack of neutralizing antibodies
as well as interferon-γ secretion observed in vitro
co-administered with veterinary-grade Saponin adjuvant may serve as a promising economical alternative to current SBV vaccines
and warrant further evaluation in large ruminant animal models
we propose that this strategy may be applicable to other bunyaviruses
where only 20% of UK livestock producers reported previously using SBV vaccines
but 80% would consider doing so if SBV vaccines were priced at 1 (British) pound per dose
the idea of a simpler and more cost-effective SBV subunit vaccine has yet to be explored
It is with these financial constraints in mind that we propose to generate a more economical SBV vaccine
based on our previous findings that SBV nucleoprotein does have immunoprotective properties based on a potent CD8+-T-cell response
recombinantly expressed SBV-N can augment a cell-mediated immunological response against virulent SBV infection
The ability of these vaccines to protect against virulent SBV has been evaluated using interferon α/β (IFNAR) knockout mice
a small-animal model that has previously been shown to validate SBV vaccine candidates
Correlates of protection can be observed through increased broadly virus-reactive titers
decreased clinical signs and near undetectable levels of viremia
These results suggest that a more cost-efficient subunit vaccine can be generated
which would be of practical interest to livestock producers
</a>taken from IFNAR-/- A129 mice following two vaccinations
Each point indicates the mean value of each group at 450 nm
The one-sided error bars at each point represent the standard deviation
Each of the diluition shows statistical significance as determined using a one-way ANOVA test
In order to assess the degree of humoral immunity induced by the different vaccine candidates
the above mentioned sera were also titered for broadly virus-reactive neutralizing antibodies
no serum from any experimental group exhibited any detectable levels of neutralizing titers (data not shown)
</a>Dot plot measuring the change in weight of all six vaccinated groups following challenge with virulent SBV
The histograms show the mean weight of each group with the error bar as the standard deviation from the mean and symbols (black circle
triangle etc.) the individual weight measurements within each group
The green horizontal line denotes the average weight of each group prior to SBV challenge (day 0)
Although no statistical significance was found in weight changes after vaccination in each group
three out of the four control groups experienced the death of at least one mouse
Red crosses (†) denote the death of a mouse at a given timepoint
</a>Viremia of A129 mice following viral challenge with virulent SBV. Blood from each vaccinated mouse was taken at 3, 6, 10 and 13 dpi. RNA was extracted from 100 µl of blood, and eluted in the same volume using the extraction technique described in the “<a data-track="click" data-track-label="link" data-track-action="section anchor" href="/articles/s41598-020-73424-2#Sec10">Materials and methods</a>” section
Values presented are the number of SBV genome copies/ml
Error bars are presented as the standard deviation from the mean
</a>Cellular proliferation of splenocytes from vaccinated IFNAR-/- A129 mice. Splenocytes were extracted from mice vaccinated with one of the following: 1) SBV N; 2) SBV N + Saponin; 3) GFP, or; 4) GFP + Saponin. Splenocytes from each mouse were then incubated with CFSE (see “<a data-track="click" data-track-label="link" data-track-action="section anchor" href="/articles/s41598-020-73424-2#Sec10">Materials and methods</a>” section) and stimulated with inactivated SBV for 3 days
The cells were then fixed and incubated with either CD4 (a) or CD8-specifc (b) antibodies and the proliferation index (average number of divisions of just the responding cells) quantified by flow cytometry
The cell proliferation index is presented as the value of stimulated splenocytes (i.e
in the presence of antigen) minus that of splenocytes under non-stimulating conditions
</a>Secreted IFN-γ from splenocytes of vaccinated IFNAR-/- A129 mice
Splenocytes were extracted from mice vaccinated with one of the following: 1) SBV N; 2) SBV N + Saponin; 3) GFP
The cells were then isolated and stimulated ex vivo using inactivated SBV
Detection of secreted IFN-γ was measured using ELISA and measured using a spectrophotometer at 450 nm
its lack of putative N-linked glycoproteins suggests that most of its biological properties could be retained when recombinantly expressed in bacteria
morbidity and mortality upon BH619/12 challenge were not reliable indicators of vaccine efficacy
viremia assessment offered a more accurate estimation of the protective capabilities of these vaccines
since: (a) it could also be readily expressed in bacteria
and; (b) it had a similar molecular weight to SBV-N
we measured the presence of broadly virus-reactive antibodies from the serum of all vaccinated animals
Although mice in the SBV-N group were able to induce a high-level of broadly virus-reactive antibodies
the SBV-N + Saponin group was able to induce a higher level of SBV-antibody titers
IgG isotyping of the vaccinated mice also showed that in SBV-N (with or without Saponin)
generated primarily IgG1 immunoglobulins; these results would be consistent with a Th1 response
the contribution of Saponin in increasing the immunogenicity of SBV-N was confirmed through cell-proliferation assays
where the SBV-N + Saponin group displayed greater CD4 + and CD8 + T-cell proliferation relative to the SBV-N group (and the GFP negative control groups)
the results were not able to reach statistical significance
Other factors may have also contributed to this which include the lack of optimized in vitro cell proliferation conditions
as well as the possibility that the stimulated T-cells were located outside the spleen (i.e
both the SBV-N and SBV-N + Saponin were capable of inducing IFN- γ secretion; however
as in the case of the cell-proliferation assay
the small sample size prevented the data from being statistically significant
we looked for clinical signs normally associated with SBV infection in IFNAR-/- mice (i.e
we found that unprotected mice showed a decrease in weight of approximately 5% within 7 days when challenged with SBV 80/11-4 strain
when using the more virulent SBV BH619/12 strain
no statistically significant changes in weight loss were observed in any groups
These findings were further confirmed when viremia was measured following SBV challenge
Mice in the SBV-N + Saponin group showed significantly less presence of SBV
with an undetectable presence of the virus at days 10 and 13
in combination with a veterinary grade Saponin
can be an efficient vaccine candidate against SBV infection
These findings are consistent with results from our previous study
where DNA vaccines were designed based on ORFs of the SBV genome
While we found two candidates (SBV-N and SBV-Gc ecto-1)
we decided to pursue using SBV-N as a subunit vaccine
based on its ability to be readily expressed in E
where large-scale production can be used to produce a more economically practical vaccine candidate
and we have determined that for our experiments in mice
each experimental dose costed approximately 0.07 €
were found to have CD8 + T-cells that could secrete IFN-γ years after infection (by ELISpot in response to peptide stimulation)
thereby confirming the role that these cells have in the host immune response
Based on our results with bacterially-expressed SBV nucleoprotein
we hypothesize that other recombinant bunyaviral nucleoproteins may have immunoprotective properties
when administered with an appropriate adjuvant
to definitively evaluate SBV nucleoprotein’s ability to confer protection against viral challenge and to validate the efficacy of SBV nucleoprotein when co-administered with Saponin further vaccination studies are required using large ruminant animal models
The Schmallenberg virus strain BH619/12 (7th culture passage) was provided by the Friedrich-Loeffler-Institute (FLI) through the European Virus Archive (EVA)
and dilutions of the virus stock were used directly for all subsequent mouse experiments
The mice used in the vaccination experiments were A129 IFNAR α/β-/- (B &amp; K Universal Ltd
All animal experiments using SBV were performed at the BSL3 animal facilities of NEIKER Institute (Derio
Spain) or the BSL3 + animal facilities at CISA/INIA (Madrid
with all proposed experiments (including containment vaccination
viral challenge and euthanasia) adhering to the ethical guidelines for animal care and experimentation and having received institutional approval (see below)
the GFP was excised from the aforementioned vector
and the cDNA of SBV nucleoprotein (Genbank accession number H2AM13) was ligated into the vector through the AgeI/XhoI restriction sites
Subunit vaccine candidates were expressed in E.coli BL21
with colonies being selected on LB-Kanamycin plates at 37 °C
Individual colonies were then cultured in LB broth with Kanamycin (50 µg/mL)
and induced with 1 mM IPTG for 12 h at 30 °C
Each clarified cell lysate in non-denaturating and non-reducing conditions [1X phosphate-buffered saline (PBS) buffer with EDTA-free protease inhibitor cocktail] was incubated with Ni-NTA resin (ThermoFischer) in batch mode at 4 °C for two hours
Then protein-bound resin was eluted with 1X PBS buffer supplemented with 500 mM imidazole (Sigma-Aldrich)
Eluted proteins were then further purified through an additional step of size-exclusion gel-filtration chromatography using a HiLoad 16/60 Superdex 200 pg column (GE Healthcare) pre-equilibrated in 1 X PBS for the SBV-N and a Superdex 16/60 75 pg column (GE Healthcare) for the GFP
The changes in weights (as well as all hereafter generated data) were analyzed for statistical significance using a one-way ANOVA test (see below)
was added starting at a 1:1 × 103 dilution and serially diluted to 1:2048 × 103
The plates were incubated for 1 h at 37 °C
The plates were washed 3 times with PBS/0.1% Tween 20 and incubated with HRP-conjugated anti-mouse IgG (Sigma
Following another three washes with PBS / 0.1% Tween
the plates were developed with 1-Step Ultra TMB substrate solution (Fisher Scientific
then stopped with one volume of 2 M sulfuric acid and the absorbance measured at a 450 nm
ELISA plates were coated for 2 h with 5 µg/mL previously purified SBV nucleoprotein at room temperature and blocked with PBS/0.1% Tween 20 2% BSA overnight at 4 °C
Heat inactivated sera samples harvested two weeks after the last vaccination from mice belonging to the groups 1
2 and 6 were added on duplicates serially diluted at 1:10 and 1:100
After 1 h incubation at 20 °C the plates were washed 4 times with PBS / 0.1% Tween 20 and incubated with HRP-conjugated secondary goat anti-mouse IgG1
Following another 4 washes with PBS/0.1% Tween and one wash with PBS
the reaction was stopped with one volume of 2 M sulfuric acid and the absorbance measured at a 450 nm
sera collected from vaccinated mice were serially diluted
The mixtures were added to BHK-21 cells in a 96-well plate
and monitored for cytopathogenic effect (CPE) after 4 days
control sera from both SBV-convalescing sheep
as well as uninfected sheep were used as positive and negative controls
respectively (with both sera being a kind gift from Dr
During the SBV viral challenge 100 µl of blood was collected at 3
RNA was extracted using the Paramagnetic Beads RNA extraction kit (Life River
China) according to the manufacturer’s instructions
The presence of SBV RNA was detected using the SBV dtec-RT-qPCR kit (Genetic PCR Solutions
Spain) using 5 µl of the extracted RNA samples
Real-time PCR was performed on an Agilent 3005 P Real-time PCR system
and the HEX channel to measure the internal controls provided by the manufacturer
The thermal profile used was as follows: 50 °C for 10 min
followed by 40 cycles of the following: 95 °C for 10 s and 60 °C for 60 s
Phytohaemagglutinin (PHA) was used as a positive control at 5 µg/mL
whereas the negative control used was medium without antigen
The plates were incubated for 3 days at 37 °C at 5% CO2
immunostained for CD8 and CD4 (PE-anti-CD8a and APC-anti-CD4
Data were acquired using FACScalibur (BD Bioscience
USA) and analyzed using FlowJo v10.6.1 software
This software enables for the evaluation of the green fluorescence of the CFSE
was used to determine the proportion of dividing cells within each CD4 + and CD8 + cell population
Splenocytes from the cellular proliferation assay also served to quantify secreted IFN-γ
inactivated SBV) used were identical to the conditions used for the cell proliferation assays
96-well High Binding Costar 3590 were coated with 2 µg/ml of anti- IFN- γ capture antibody AG-18/RA-6A2 (BD Pharmingen)
the wells were washed two times with PBS/0.05% Tween 20 and blocked with PBS/0.05% Tween/0.1% BSA for 1 h at 37 °C
50 ul of supernatant was added to each well and incubated for 1 h at 37 °C
The plates were then washed with PBS / 0.05% Tween and incubated with 1 mg/ml of anti- IFN- γ biotinylated mAb R46A2 (BD Pharmingen) for 1 h at 37 °C
plates were washed with PBS / 0.05% Tween and 50 µl of peroxidase-labeled streptavidin at a 1/500 dilution in PBS added to each well and incubated at 37 °C for 1 h
and the TMB substrate (Sigma-Aldrich) was added for 10 min
followed by one volume of stopping solution (0.5 M sulfuric acid)
The one-way analysis of variance (ANOVA) was used to assess whether there are any statistically significant differences between the resulting means of the different experiments when more than two groups were considered
When analysis was performed across two groups only [eg
SBV-N versus PBS (control)] then the unpaired t-test with Welch’s correction was used to take into account the unequal variance and possible sample sizes
To this end we used GraphPad PRISM version 8.4.2
The study was approved by the Diputacíon Foral de Bizkaia 12/2018 for experiments carried out at the NEIKER-Basque Institute for Agricultural Research and Development and by the Comunidad de Madrid permit PROEX 108/15 for research performed at the Animal Health Research Center (INIA-CISA)
All experiments were monitored by staff veterinarians and animals that exhibited severe signs of morbidity were euthanized by cervical dislocation
Generation of recombinant oropouche viruses lacking the nonstructural protein NSm or NSs
Schmallenberg virus: a novel viral disease in northern Europe
Natural intrauterine infection with Schmallenberg virus in malformed newborn calves
The emergence of Schmallenberg virus across Culicoides communities and ecosystems in Europe
First detection of Schmallenberg virus in elk (Alces alces) indicating infection of wildlife in Bialowieza National Park in Poland
Detection of the Schmallenberg virus in nulliparous Culicoides obsoletus/scoticus complex and C
punctatus—the possibility of transovarial virus transmission in the midge population and of a new vector
First report of Schmallenberg virus infection in cattle and midges in Poland
Larska, M., Krzysiak, M. K., Kesik-Maliszewska, J. &amp; Rola, J. Cross-sectional study of Schmallenberg virus seroprevalence in wild ruminants in Poland at the end of the vector season of 2013. BMC Vet. Res. <a href="https://doi.org/10.1186/s12917-014-0307-3" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="10.1186/s12917-014-0307-3">https://doi.org/10.1186/s12917-014-0307-3</a> (2014)
Mouchantat, S. et al. A broad spectrum screening of Schmallenberg virus antibodies in wildlife animals in Germany. Vet. Res. <a href="https://doi.org/10.1186/s13567-015-0232-x" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="10.1186/s13567-015-0232-x">https://doi.org/10.1186/s13567-015-0232-x</a> (2015)
Spatial and temporal patterns of Schmallenberg virus in France in 2016
Schmallenberg virus: on its way out or due for a comeback?
How is Europe positioned for a re-emergence of Schmallenberg virus?
Survey to determine the farm-level impact of Schmallenberg virus during the 2016–2017 United Kingdom lambing season
Viruses versus vaccines: the economics of herd immunity
British Society of Immunology (BSI): Newsletter (2018)
DNA vaccination regimes against Schmallenberg virus infection in IFNAR(-/-) mice suggest two targets for immunization
N-terminal domain of Schmallenberg virus envelope protein Gc delivered by recombinant equine herpesvirus type 1 and modified vaccinia virus Ankara: immunogenicity and protective efficacy in cattle
Crystal structure of Schmallenberg orthobunyavirus nucleoprotein-RNA complex reveals a novel RNA sequestration mechanism
Structure of Schmallenberg orthobunyavirus nucleoprotein suggests a novel mechanism of genome encapsidation
Nucleocapsid protein structures from orthobunyaviruses reveal insight into ribonucleoprotein architecture and RNA polymerization
Elucidating the mechanisms of action of saponin-derived adjuvants
Wernike, K., Eschbaumer, M., Breithaupt, A., Hoffmann, B. &amp; Beer, M. Schmallenberg virus challenge models in cattle: infectious serum or culture-grown virus?. Vet. Res. <a href="https://doi.org/10.1186/1297-9716-43-84" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="10.1186/1297-9716-43-84">https://doi.org/10.1186/1297-9716-43-84</a> (2012)
Adjuvants enhancing cross-presentation by dendritic cells: the key to more effective vaccines?
Rift valley fever: recent insights into pathogenesis and prevention
A DNA vaccine encoding ubiquitinated Rift Valley fever virus nucleoprotein provides consistent immunity and protects IFNAR(-/-) mice upon lethal virus challenge
Long-lived CD8+ T cell responses following Crimean-Congo haemorrhagic fever virus infection
Comparison of SUMO fusion technology with traditional gene fusion systems: enhanced expression and solubility with SUMO
Protection against lethal Rift Valley fever virus (RVFV) infection in transgenic IFNAR(-/-) mice induced by different DNA vaccination regimens
<a data-track="click" data-track-action="download citation references" data-track-label="link" rel="nofollow" href="https://citation-needed.springer.com/v2/references/10.1038/s41598-020-73424-2?format=refman&amp;flavour=references">Download references</a>
We would like to thank the European Virus Archive (EVAg) <a href="https://www.european-virus-archive.com/evag-portal">https://www.european-virus-archive.com/evag-portal</a> and the laboratory of Dr
Martin Beer for providing us with the FLI Schmallenberg virus strain BH 619/12 and the control sera
Belén Borrego (CISA-INIA) for her assistance
This work was supported by the Marie Sklodowska Curie Actions programme number MSCAIF-EF-ST-660155 (H.B
Innovación y Universidades RTI2018-095700-B-I00 (N.G.A.A.)
the Basque Departamento de Desarrollo Económico e Infraestructura 37-2017-00036 (N.G.A.A.) and “La Caixa” Foundation (ID 100010434) INPhINIT “La Caixa” fellowship LCF/BQ/DI19/11730041 (G.S.G
MICINN is also thanked for the Severo Ochoa Excellence Accreditation to the CIC bioGUNE (SEV-2016-0644)
Fundamental and Applied Research for Animals &amp; Health (FARAH)
Center for Cooperative Research in Biosciences (CIC bioGUNE)
Basque Research and Technology Alliance (BRTA)
NEIKER-Basque Institute for Agricultural Research and Development
Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd)
performed diagnostic work together with I.S.
and generated purified Schmallenberg virus
produced recombinant proteins with help from D.C.; G.L
performed the cell proliferation and cytokine assays with help from S.M.; A.B.
prepared the manuscript with contributions from all authors
The authors declare no competing interests
<a data-test="citation-link" data-track="click" data-track-action="download article citation" data-track-label="link" data-track-external="" rel="nofollow" href="https://citation-needed.springer.com/v2/references/10.1038/s41598-020-73424-2?format=refman&amp;flavour=citation">Download citation</a>
DOI: https://doi.org/10.1038/s41598-020-73424-2
<a href="/articles/srep03361/metrics" data-track="click" data-track-action="view metrics" data-track-label="link" rel="nofollow">Metrics details</a>
A model previously developed for the wind-borne spread by midges of bluetongue virus in NW Europe in 2006 is here modified and applied to the spread of Schmallenberg virus in 2011
The model estimates that pregnant animals were infected 113 days before producing malformed young
the commonest symptom of reported infection and explains the spatial and temporal pattern of infection in 70% of the 3,487 affected farms
most of which were infected by midges arriving through downwind movement (62% of explained infections)
or a mixture of downwind and random movements (38% of explained infections)
dusk) when these insects are known to be most active
The main difference with Bluetongue is the higher rate of spread of SBV
which has important implications for disease control
</a>Spatial distribution of SBV from 2011 to 2012 (a single SBV infection in southern Spain is not shown) and of BTV-8 in 2006
the data shown are for the first 121 days of both outbreaks (the full extent of the BTV epizootic in 2006)
The inset shows the details of the BTV-8 area
but horizontal (direct animal to animal) transmission is unknown
strongly implying that midges respond to the smell of their hosts by flying upwind to find them
the modal distance covered in farm-to-farm infections was no more than 1 km31 and upwind infections were associated with shorter average distances between infectious and infected farms than downwind ones
Here we present a modified version of BTV-SWOTS<a data-track="click" data-track-action="reference anchor" data-track-label="link" data-test="citation-ref" aria-label="Reference 31" title="Sedda, L. et al. A new algorithm quantifies the roles of wind and midge flight activity in the bluetongue epizootic in northwest Europe. Proceedings. Biological sciences/The Royal Society 279, 2354–2362 (2012)." href="/articles/srep03361#ref-CR31" id="ref-link-section-d449157719e1801">31</a> to analyse
understand and simulate the spread of SBV in Europe in 2011–2012 (SBV-SWOTS)
The results of BTV-SWOTS and SBV-SWOTS are compared in order to detect and explain similarities and differences between these two diseases
Following previous practice<a data-track="click" data-track-action="reference anchor" data-track-label="link" data-test="citation-ref" aria-label="Reference 31" title="Sedda, L. et al. A new algorithm quantifies the roles of wind and midge flight activity in the bluetongue epizootic in northwest Europe. Proceedings. Biological sciences/The Royal Society 279, 2354–2362 (2012)." href="/articles/srep03361#ref-CR31" id="ref-link-section-d449157719e1808">31</a>
we here use the term ‘vector’ only in its mathematical sense and the term ‘midges’ to describe both the insects and their role as carriers of both BTV and SBV
The term ‘midge vector’ therefore refers to a mathematical description of the distance and direction of midge flight
Both BTV-SWOTS and SBV-SWOTS were implemented using a high threshold probability (a ratio &gt; = 0.95 of the number of trajectories connecting a particular infectious farm A to a newly infected farm B over the total number of infectious trajectories reaching farm B in the same interval of time)
indicating that any particular farm had been infected from one particular previously-infected farm
Farms that did not reach this threshold were considered as unlikely to have been infected by any putative ‘source farm’ within the dataset
This high threshold excluded very few farms in the BTV-SWOTS analysis (8%) strongly indicating that a network of (modelled and quantified) infection routes linked most farms in the dataset
This relatively high certainty of the infection network probably arose because of the relatively short distances (many less than 1 km) between the BTV-infected farms in the landscape
the same high probability threshold excludes 30% of SBV-infected farms
probably because these farms were farther apart (the average distance between all infected farms in the dataset is 461 km with standard deviation = 255 km) and so less likely to fall within the plumes of infected midges arising from previously infected farms
the SBV simulation model successfully connected 70% of all infected farms
This figure rises as the threshold probability is lowered from 0.95 but reaches a maximum of 89% only when the threshold is lowered to 0.13
SBV-SWOTS is still unable to explain 11% of all infections
</a>Classification of the SBV infected farms according to the type of midge movement involved
55% of the infected farms in the dataset were predicted by the model to be ‘dead ends’ (i.e
so that less than half of all farms were involved in infecting other farms
There was no significant change during the post 100-day period in either the average or maximum distance between infected farms
Nuances of midge behaviour that are likely to increase the chance of locally contacting the next host for a blood meal appear to be constrained by the envelope of the prevailing winds at the time of day
Thus if a farm reported an SBV- malformed newborn lamb on the 14th December 2011 (the first case in our dataset)
the infectious bite would have occurred on about the 24th August 2011
If SBV is similar in this respect to Akabane then cattle would be susceptible to SBV over a range of DA from 100 to 190 days: more than half of this period would therefore be covered by the SBV-SWOTS allowed maximum value of 155 days
is likely to be more difficult to explain with SBV-SWOTS
The present results suggest that disease events that happen a long time before their recorded outcome are amenable to the same sort of analysis as was previously applied to BTV with a much shorter time between cause and effect
We stress that all values of DA between 0 and 155 days were explored by the SBV model which
selected a rather precise value of 113 days as the most likely time of infection before the recorded outcome which
Midge mobility revealed by the example of SBV and analysed by SBV-SWOTS suggests that Control and Protection Zones need to be considerably bigger
making the control of midge borne diseases that much more difficult
latitude (GPS co-ordinates) and date of the report of the infection at each farm were used in the analysis
SBV was declared notifiable in Germany and the Netherlands only from the end of March 2012 but in fact Germany had been contributing SBV case Reports to the OIE since the start of the outbreak and the number of new cases reported there from the end of March shows little change from those reported before this time (thus 2% of all of the 1376 cases from Germany between December 2011 and May 2012 were reported in December 2011
seems to show a distinct effect of the notification order
The Dutch reports in May 2012 (173 cases) will have contributed in only a minor way to the parameter estimates in SBV-SWOTS (which were based on all of the 3,487 case reports) and none of them was explained in the simulation part of the SBV-SWOTS analysis
were not included because they occurred outside the period analysed (see above)
Both databases undoubtedly suffer from missing data
but there are relatively minor differences between them
Thus differences between the management of the BTV-8 and SBV outbreaks (movement restrictions were never imposed for SBV) are slight and the datasets can be directly compared
11% of the data used in this analysis were of SBV cases not associated with foetal abnormalities
35% as foetal abnormalities in cattle and almost 2% as foetal abnormalities in goats (only one case was reported from deer)
DT = days travelled by the midges between infectious and infected farms
Unlike time-dependent differential models of epidemic spread (where identification of the location and timing of the index case is often crucial)
SWOTS adopts more of a ‘mass action’ approach; estimated (averaged) parameter values apply to the entire dataset over the entire course of the outbreak and each disease report makes a more or less equal contribution to the parameter estimates
The parameters and variables to be optimised by the SBV-SWOTS are the day of infection after fertilisation of the vertebrate host (see below)
the number of days of midge travel from farm to farm (days travelled
DT) and the time of day (TOD) associated with the largest correlation between infection and midge vectors (in nature
SBV-SWOTS then simulates the outbreak by re-calculating the midge vectors according to the optimised parameters and a stochastic wind field
assuming pre-defined distributions for wind angle and speed centred on their modelled mean values
Sampling from distributions of both wind speed and direction is necessary because the wind can show considerable variation in these variables within a few hours
Wind trajectories were recalculated 1,000 times
with values of speed and direction drawn from their respective mathematical distributions
Hence each infected farm in each interval in SBV-SWOTS is associated with many different possible infected midge trajectories going from it
Some of these trajectories will end up on uninfected farms and eventually infect them
SBV-SWOTS examines the associations between these calculated midge vectors and the calculated (farm to farm) infection vectors for the same time period and identifies the most likely (highest correlation between midge and infection vectors) source and route of infection to each susceptible farm
Because the midge vectors allowed a variety of combinations of up-wind
the highest correlations between midge and infection vectors also identified the most likely type of midge movement responsible for infecting one farm from another
We recognise that the real parameter of interest is not DA but the day of infection after fertilisation and conception
occurred at an unrecorded date before the recorded foetal abnormality and hence could not be considered directly in the models
an estimate of the time of infection after conception can be made
We also later estimated the intrinsic incubation period by calculating the average difference between the time when one farm was shown in the model to be infecting another farm and the time that the infecting farm had itself been first infected
This is a somewhat indirect measure of IIP and will probably also include at least part of the extrinsic incubation period in the midges (EIP
the time taken for the development of a transmissible infection in a newly-infected midge)
Hence the incubation periods calculated by SWOTS are likely to be a measure of (EIP + IIP) rather than of EIP or IIP alone
Knowing the IIP from independent studies allows the estimation of EIP from this figure
A second modification of SBV-SWOTS concerned the wind-fields which
had been modelled) only at the locations of infected farms
BTV-SWOTS therefore had to interpolate wind speed and direction from these data for any other point of interest
the wind speeds and directions were modelled on a regular 0.25 degree grid and SBV-SWOTS simply selected the wind data at the nearest grid point
Establishment of a reverse genetic system for Schmallenberg virus
‘Schmallenberg virus’--a novel orthobunyavirus emerging in Europe
The 2006 outbreak of bluetongue in northern Europe--the entomological perspective
Financial consequences of the Dutch bluetongue serotype 8 epidemics of 2006 and 2007
Field Veterinary Survey on Clinical and Economic Impact of Schmallenberg Virus in Belgium
Transbound Emerg Dis; 10.1111/tbed.12030 (2012)
Epizootic spread of Schmallenberg virus among wild cervids
First detection of Schmallenberg virus in elk (Alces alces) indicating infection of wildlife in Białowiez·a National Park in Poland
EFSA. "Schmallenberg" virus: analysis of the epidemiological data (May 2013). EFSA Technical Report (2013)URL: <a href="http://www.efsa.europa.eu/en/supporting/doc/429e.pdf" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="http://www.efsa.europa.eu/en/supporting/doc/429e.pdf">http://www.efsa.europa.eu/en/supporting/doc/429e.pdf</a> (Accessed 21/10/2013)
Lack of evidence for zoonotic transmission of Schmallenberg virus
Salient lesions in domestic ruminants infected with the emerging so-called Schmallenberg virus in Germany
Schmallenberg virus in central nervous system of ruminants
Epizootic of ovine congenital malformations associated with Schmallenberg virus infection
Bluetongue Serotype 2 and 9 Modified Live Vaccine Viruses as Causative Agents of Abortion in Livestock: A Retrospective Analysis in Italy
Transbound Emerg Dis; 10.1111/tbed.12004 (2012)
Genetic reassortment between Sathuperi and Shamonda viruses of the genus Orthobunyavirus in nature: implications for their genetic relationship to Schmallenberg virus
RNA interference targets arbovirus replication in Culicoides cells
Detection of Schmallenberg virus in different Culicoides spp
First report of Schmallenberg Virus Infection in Cattle and Midges in Poland
Culicoids as vectors of Schmallenberg virus
Preliminary estimate of Schmallenberg virus infection impact in sheep flocks - France
Continued presentation of cases of Schmallenberg virus in sheep in England
Schmallenberg virus antibodies detected in cattle in Wales
Assessing the risk of windborne spread of bluetongue in the 2006 outbreak of disease in northern Europe
Investigating Incursions of Bluetongue Virus Using a Model of Long-Distance Culicoides Biting Midge Dispersal
Estimating front-wave velocity of infectious diseases: a simple
Assessment of the risk of a bluetongue outbreak in Europe caused by Culicoides midges introduced through intracontinental transport and trade networks
Modelling bluetongue virus transmission between farms using animal and vector movements
Quantitative analysis of transmission parameters for bluetongue virus serotype 8 in Western Europe in 2006
Colostral transmission of bluetongue virus nucleic acid among newborn dairy calves in California
Factors affecting Bluetongue serotype 8 spread in Northern Europe in 2006: The geographical epidemiology
[Bluetongue Disease: An Analysis of the Epidemic in Germany 2006–2009] Arthropods as Vectors of Emerging Diseases (ed
Mehlhorn H.) [103–135] (Springer Berlin Heidelberg
Transmission of Schmallenberg Virus during Winter
Endophily in Culicoides associated with BTV-infected cattle in the province of Limburg
Biotic and Abiotic Factors Influencing Distribution and Abundance ofCulicoides obsoletusGroup (Diptera: Ceratopogonidae) in Central Italy
Diel flight periodicity of the biting midge Culicoides impunctatus and the effects of meteorological conditions
Duration of viraemia infectious to Culicoides sonorensis in bluetongue virus-infected cattle and sheep
Culicoides biting midges: Their role as arbovirus vectors
Large-scale cross-sectional serological survey of schmallenberg virus in belgian cattle at the end of the first vector season
Distribution of Schmallenberg Virus and Seroprevalence in Belgian Sheep and Goats
Transbound Emerg Dis; 10.1111/tbed.12050 (2013)
Quantifying Dispersal of European Culicoides (Diptera: Ceratopogonidae) Vectors between Farms Using a Novel Mark-Release-Recapture Technique
e61269; 10.1371/journal.pone.0061269 (2013)
The range of attraction for light traps catching Culicoides biting midges (Diptera: Ceratopogonidae)
Congenital-Abnormalities in Newborn Lambs after Infection of Pregnant Sheep with Akabane Virus
Modelling the spatial distribution of Culicoides biting midges at the local scale
pastures and woodlands: the fine-scale distribution of Palearctic Culicoides spp
biting midges along an agro-ecological gradient
A new dynamical core for the Met Office's global and regional modelling of the atmosphere
<a data-track="click" data-track-action="download citation references" data-track-label="link" rel="nofollow" href="https://citation-needed.springer.com/v2/references/10.1038/srep03361?format=refman&amp;flavour=references">Download references</a>
We thank Laura Burgin from UK Met Office for the generation of the wind data and Simon Carpenter, Simon Gubbins and Chris Sanders from the Institute of Animal Health for the useful discussions on the OIE dataset. L.S. and D.J.R. are supported by the European Union grant FP7-261504 EDENext and this paper is catalogued by the EDENext Steering Committee as EDENext188 (<a href="http://www.edenext.eu">http://www.edenext.eu</a>)
The contents are the sole responsibility of the authors and do not necessarily reflect the views of the European Commission
conceived and designed the study and wrote the manuscript
performed the analysis and prepared all the figures and tables
Data sources and comparison with EFSA database
Modelled Schmallenberg spread in Europe 2011/2012
This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivs 3.0 Unported License. To view a copy of this license, visit <a href="http://creativecommons.org/licenses/by-nc-nd/3.0/" rel="license">http://creativecommons.org/licenses/by-nc-nd/3.0/</a>
<a data-test="citation-link" data-track="click" data-track-action="download article citation" data-track-label="link" data-track-external="" rel="nofollow" href="https://citation-needed.springer.com/v2/references/10.1038/srep03361?format=refman&amp;flavour=citation">Download citation</a>
Tropical Animal Health and Production (2020)
Sign up for the Nature Briefing newsletter — what matters in science
has been confirmed at four sheep farms in Norfolk
The Schmallenberg virus is believed to be carried by midges. It surfaced in the <a href="https://www.theguardian.com/world/netherlands" data-link-name="in body link" data-component="auto-linked-tag">Netherlands</a> and Germany in August 2011
and since then on hundreds of farms there and in Belgium
Themicrobe is difficult to detect in adult animals
According to the Department for Environment
it is likely the disease has been here since the autumn
carried via insects blown across the channel
Defra anticipates more cases will appear and has asked for &quot;enhanced surveillance&quot; from vets and farmers
The disease has now been confirmed on farms in the UK
18 JanuaryAnimals that have the virus and become pregnant have either miscarriages
stillbirths or offspring with deformities such as a twisted neck
There are mild symptoms of the virus in other adult animals – a few days of fever
and sometimes diarrhoea – but these cannot be easily distinguished from other common illnesses
It mostly affects sheep but can also enter cattle or goats
Russia banned imports of sheep and goat meat as well as live animals from the Netherlands on 18 January
The Dutch agriculture ministry said China had asked for more information
The UK's agency said the true extent of Schmallenberg is not known. The <a href="http://www.defra.gov.uk/animal-diseases/files/poa-schmallenburg-update-120117.pdf" data-link-name="in body link">Netherlands has been hardest hit</a>
while in Belgium it has been detected in 126 farms
meaning farmers have no legal duty to report it
and there are no control measures imposed on infected farms or restrictions on buying and selling animals
&quot;This may change based on forthcoming information over the coming weeks
but at present it is not anticipated,&quot; said Defra
allowing vets time to gather more information
A Defra spokesman said it was &quot;very much early days&quot; in determining the course of further action; however
farms already co-existed with salmonella and leptospirosis (Weil's disease)
The National Farmers Union said the discovery of the virus in Britain would be a worry for all livestock keepers
&quot;This is a new virus and there is still much that we don't know about it,&quot; said NFU animal welfare adviser Catherine McLaughlin
&quot;Farmers can help by reporting any unusual symptoms
If they are considering importing ruminants from the affected parts of continental Europe
the NFU would strongly recommend that they discuss their plans with their vet first to reduce the risk of buying in the virus.&quot;
The European Centre for Disease Prevention and Control released a <a href="http://ecdc.europa.eu/en/press/news/Lists/News/ECDC_DispForm.aspx?List=32e43ee8-e230-4424-a783-85742124029a&amp;ID=541&amp;RootFolder=/en/press/news/Lists/News" data-link-name="in body link">human health risk assessment for Schmallenberg virus</a> on 22 December
genetically similar orthobunyaviruses have not caused disease to humans
it is unlikely that this virus would cause disease in humans
but it cannot be excluded at this stage.&quot;
<a href="/articles/srep05746/metrics" data-track="click" data-track-action="view metrics" data-track-label="link" rel="nofollow">Metrics details</a>
Schmallenberg virus (SBV) is principally transmitted by Culicoides midges and affects ruminants
Clinical presentation is typified by foetal abnormalities
relatively few animals present with clinical signs
In this paper we further develop a previously published stochastic mathematical model of SBV spread to investigate the optimal deployment of a vaccine for SBV in Scotland
a country that has experienced only sporadic and isolated cases of SBV
We consider the use of the vaccine under different temperatures and explore the effects of a vector preference for feeding on cattle
We demonstrate that vaccine impact is optimised by targeting it at the high risk areas in the south of Scotland
At higher than average temperatures and hence increased transmission potential
the relative impact of vaccination is considerably enhanced
Vaccine impact is also enhanced if vectors feed preferentially on cattle
These findings are of considerable importance when planning control strategies for SBV and also have important implications for management of other arboviruses such as Bluetongue virus
Environmental determinants and feeding preferences should be researched further to inform development of effective control strategies
Schmallenberg virus (SBV) is a novel Orthobunyavirus, a member of the Simbu serogroup and is closely related to Akabane and Shamonda viruses<a data-track="click" data-track-action="reference anchor" data-track-label="link" data-test="citation-ref" aria-label="Reference 1" title="Hoffmann, B. et al. Novel orthobunyavirus in Cattle, Europe, 2011. Emerg. Infect. Dis. 18, 469–72 (2012)." href="/articles/srep05746#ref-CR1" id="ref-link-section-d450671253e375">1</a>
That there is evidence of spread during 2011
2012 and 2013 suggests that the disease has mechanisms for overwintering through the period of low vector activity
The mechanisms for overwintering are yet to be determined but could be through vertical transmission
but the possibility of reintroduction into these serologically naive populations remains
This finding could have implications for the likely pattern of transmission for a highly infectious disease such as SBV in mixed livestock contexts
SBV is not a notifiable disease in the UK and it is likely that farmers would be given the choice of whether to vaccinate their animals
Therefore guidance as to how to use the vaccine most effectively would be beneficial
Given the further data that now exist on SBV transmission and the availability of vaccines
To evaluate the effect of temperature on the potential for SBV spread in Scotland; 
To evaluate the potential for vector feeding preferences to alter the pattern of SBV transmission; 
To evaluate the effectiveness of different strategies for targeting vaccines for SBV; 
To evaluate the potential for spread in subsequent years following the introduction of SBV
</a>The proportion of farms for which the daily average temperature is greater than the baseline for the EIP of 12.35°C during the summer months
This is presented for the mean temperature
2012 mean temperature and 2013 mean temperature
The pattern of infections shows a focus in the south west for both cattle and sheep, this applies in years with daily mean temperatures and when the temperatures match those from 2013 (<a data-track="click" data-track-label="link" data-track-action="figure anchor" href="/articles/srep05746#Fig2">Figure 2</a>).
</a>The parish level seroprevalence as a proportion of animals infected (averaged over 1000 model iterations) among cattle and sheep following introduction on day 45 given the mean temperature (top) and the temperatures seen during 2013 (bottom)
In an epidemic with the daily mean temperatures for 1990–2006 and an introduction on day 45, it is only sheep flocks that lamb prior to February that would be at considerable risk of presenting with birth malformations. The window in which cattle would be at risk is larger, this is due to the longer window of pregnancy in which cattle are at risk (<a data-track="click" data-track-label="link" data-track-action="figure anchor" href="/articles/srep05746#Fig3">Figure 3</a>).
</a>Given the epidemic in Figure 3A which is based upon the epidemic fitted to the mean temperature in <a data-track="click" data-track-label="link" data-track-action="figure anchor" href="/articles/srep05746#Fig2">Figure 2</a>
graphs B and C show the number of days of pregnancy that a cow or ewe will be at risk of infection that could lead to birth abnormalities
The red bars represent elevated risk (greater than 0.01% of animals infected daily) and the blue blocks lower (but still some) risk (greater than 0.001% and less than 0.001% of animals infected daily)
</a>Map of SBV seroprevalence as a proportion of animals infected (averaged over 1000 model iterations) when there is a vector preference for feeding upon cattle rather than sheep
</a>Farm level seroprevalence for cattle (black points) and sheep (red points) with and without a vector feeding preference
This is fitted with mean temperatures from 2013
</a>The numbers of infected animals resulting from disease introduction under different vaccination strategies
The red points are vaccination with a vector feeding preference for cattle and blue points the vaccination strategy without feeding preference
The grey centre line is the equality line – if sheep and cattle were becoming infected at equal rates relative to their population
During a year of average temperatures the disease must be introduced during the month of June for there to be substantial spread
This has implications for the options for control of the disease
so the timing of introduction could be coupled with data on the current temperatures to give an early warning as to the threat that the introduction presents
This would provide the opportunity to develop appropriate control options based upon these data
the model could be further adapted to incorporate temperature and precipitation in the kernel shape
Vaccination can be used by individual livestock owners with the aim of protecting their animals from infection that may cause losses (represented by the ad hoc vaccination strategy in this study)
vaccination may be used more tactically to break the transmission chain and reduce overall disease spread
tactical vaccination was represented by the strategies of vaccination in the south and vaccinating cattle
Although ad hoc vaccination is beneficial to individual livestock keepers
our study clearly shows the overall benefit of using tactical approaches
The value of the cattle vaccination strategy is further enhanced if there is a cattle feeding preference
the potential for spread in subsequent years decreases
This is because the animals become infected and develop immunity during the first year and thus fewer susceptible animals remain
may be explained by this depletion of susceptible animals
These results are important for SBV management and control
but also have important implications should there be another epidemic of BTV in GB
incorporation of more accurate knowledge on vector feeding preferences into models for BTV may provide an opportunity to break the transmission chain by targeting vaccination at animals at greatest risk of infection
such information may be very helpful in prioritising resources to limit spread
the vector will survive to lay a potentially infectious bite on another animal by a probability defined by the vector mortality rate and EIP
interval between blood meals and vector mortality rate are temperature dependent parameters
for the EIP there is a minimum temperature below which the process will not operate
The infected vector will feed on animals on the same or other farms as defined by a Gaussian spatial kernel with a mean transmission distance of 14 km35 that describes both the movement of the vector and movement of infected livestock
The model assumes a season of vector activity that runs between 1st May and 31st October with two peaks in vector abundance
where T0 is the observed temperature and 12.35°C is the minimum temperature at which incubation can take place<a data-track="click" data-track-action="reference anchor" data-track-label="link" data-test="citation-ref" aria-label="Reference 25" title="Gubbins, S. et al. Inferences about the transmission of Schmallenberg virus within and between farms. Prev. Vet. Med. 10.1016/j.prevetmed.2014.04.011 (2014)." href="/articles/srep05746#ref-CR25" id="ref-link-section-d450671253e1949">25</a>
temperatures in 2012 were 0.8°C lower than average and in 2013 were 0.92°C higher than average
Among cattle 27.5% of stock is replaced; 55% of the stock is under 2 years old and 31.9% of these animals are slaughtered annually (data from the Cattle Tracing System cattle movement database)
18.4% of the animals over two years old are slaughtered and replaced from the younger stock annually
In all analyses we consider two scenarios for feeding preference:
The vector is equally likely to feed on a cow as a sheep
The odds that a midge will feed on a sheep with odds of 0.205 relative to a cow, based upon Ayllón et al.<a data-track="click" data-track-action="reference anchor" data-track-label="link" data-test="citation-ref" aria-label="Reference 31" title="Ayllón, T. et al. Feeding behaviour of Culicoides spp. (Diptera: Ceratopogonidae) on cattle and sheep in northeast Germany. Parasit. Vectors 7, 34 (2014)." href="/articles/srep05746#ref-CR31" id="ref-link-section-d450671253e2006">31</a>
The model considers four strategies for deploying the vaccine:
All cattle and sheep that are being reared for breeding replacement stock are vaccinated (referred to in the results as “all”); 
50% of herds and flocks (selected randomly) vaccinate all breeding cattle and sheep
to represent a voluntary program with 50% uptake (“ad hoc vaccination”); 
All breeding cattle are vaccinated (“cattle vaccination”); 
Breeding cattle and sheep on herds and flocks located in the south of Scotland
in the counties to the south of the Forth and Clyde are vaccinated (“south vaccination”); 
We analyse the protective impact of vaccination by comparing the results of model runs with vaccination against baseline scenarios in which there is no vaccination undertaken
The number of animals vaccinated and percentage of animals vaccinated
The percentage reduction in the number of infections
Calculated as:  where IB is the number infected without vaccination and IV is the number infected with vaccination
The number of infections spared per vaccinated animal
Calculated as:  where IB is the number infected without vaccination
IV is the number infected with vaccination and V the number vaccinated
There are a number of assumptions that underlie this paper, some of which have previously been stated in Bessell et al.<a data-track="click" data-track-action="reference anchor" data-track-label="link" data-test="citation-ref" aria-label="Reference 21" title="Bessell, P. R. et al. Epidemic potential of an emerging vector borne disease in a marginal environment: Schmallenberg in Scotland. Sci. Rep. 3, 1178 (2013)." href="/articles/srep05746#ref-CR21" id="ref-link-section-d450671253e2143">21</a>:
Farm composition is homogeneous and ages of animals on each farm are assumed to be the same across the country
or hill and lowland sheep farms can be treated similarly
if the spatial distribution of an epidemic were being analysed the homogeneity of farms may create more specific foci of spread
That the width of the spatial kernel will not vary with temperature
Given a daily Culicoides dispersal distance
the transmission kernel should vary as the incubation period varies
The animal is equally infectious on each day of its infectious period
Once infected an animal will recover with full immunity and will not be susceptible to further infection
The attractiveness of a farm for vector feeding is based on the number of livestock on the farm and is determined by distance and the number of livestock
Large studies of efficacy are not yet available
We do not incorporate vectors feeding on species other than cattle and sheep
Other hosts include horses and wild ruminants
but the distribution of these species and the vector ecology in terms of feeding is relatively poorly understood
During an epidemic involving southern Scotland there is likely to be some transmission with farms in northern England
as this is likely to be a two-way exchange we consider that this would have minimal effect on the epidemic
Schmallenberg virus infection in small ruminants – First review of the situation and prospects in Northern Europe
EFSA. “Schmallenberg” virus: analysis of the epidemiological data (May 2013). Technical Report (2013)URL: <a href="http://www.efsa.europa.eu/en/supporting/doc/429e.pdf" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="http://www.efsa.europa.eu/en/supporting/doc/429e.pdf">http://www.efsa.europa.eu/en/supporting/doc/429e.pdf</a> (Date of access: 19/06/2014)
Seroprevalence of Schmallenberg Virus Antibodies among Dairy Cattle
The Schmallenberg Virus epidemic in Europe - 2011–2013
Modelling the continental-scale spread of Schmallenberg virus in Europe: Approaches and challenges
“Schmallenberg” virus: Analysis of the Epidemiological Data and Assessment of Impact
Does covering of farm-associated Culicoides larval habitat reduce adult populations in the United Kingdom
Implicating Culicoides biting midges as vectors of Schmallenberg virus using semi-quantitative RT-PCR
Schmallenberg virus detection in bovine semen after experimental infection of bulls
Evidence of excretion of Schmallenberg virus in bull semen
Schmallenberg virus in Dutch dairy herds: potential risk factors for high within-herd seroprevalence and malformations in calves and its impact on productivity
Identifying environmental drivers of insect phenology across space and time: Culicoides in Scotland as a case study
Transmission of Schmallenberg virus in a housed dairy herd in the UK
NFUS. Schmallenberg Surveillance Results Out. URL: <a href="http://www.nfus.org.uk/news/2013/may/schmallenberg-surveillance-results-out" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="http://www.nfus.org.uk/news/2013/may/schmallenberg-surveillance-results-out">http://www.nfus.org.uk/news/2013/may/schmallenberg-surveillance-results-out</a> (2013)
The impact of Schmallenberg virus on British sheep farms during the 2011/2012 lambing season
Prevalence of seropositive sheep within flocks where Schmallenberg virus infection was suspected or confirmed
Evidence of Schmallenberg virus in Scotland in 2012
First case of Schmallenberg disease confirmed in Scotland
Schmallenberg virus circulating in Scotland
Inferences about the transmission of Schmallenberg virus within and between farms
The influence of the wind in the Schmallenberg virus outbreak in Europe
Feeding patterns of biting midges of the Culicoides obsoletus and Culicoides pulicaris groups on selected farms in Brandenburg
Identification of blood meals of the Scottish biting midge
by indirect enzyme-linked immunosorbent assay (ELISA)
Identity and diversity of blood meal hosts of biting midges (Diptera: Ceratopogonidae: Culicoides Latreille) in Denmark
R: A Language and Environment for Statistical Computing
Bivand, R. &amp; Lewin-Koh, N. maptools: Tools for reading and handling spatial objects. (2014)URL: <a href="http://CRAN.R-project.org/package=maptools" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="http://CRAN.R-project.org/package=maptools">http://CRAN.R-project.org/package=maptools</a> (Date of access: 19/06/2014)
A modeling framework to describe the transmission of bluetongue virus within and between farms in Great Britain
two-vector basic reproduction ratio (R(0)) for bluetongue
vector-feeding preferences and the risk of African horse sickness transmission in Great Britain
Host feeding patterns of Culicoides species (Diptera: Ceratopogonidae) within the Picos de Europa National Park in northern Spain
Bloodmeal analysis reveals avian Plasmodium infections and broad host preferences of Culicoides (Diptera: Ceratopogonidae) vectors
The generation of monthly gridded datasets for a range of climatic variables over the UK
Scottish Government. Results from the June 2012 Scottish Agricultural Census. URL: <a href="http://www.scotland.gov.uk/Publications/2012/09/1148" data-track="click_references" data-track-action="external reference" data-track-value="external reference" data-track-label="http://www.scotland.gov.uk/Publications/2012/09/1148">http://www.scotland.gov.uk/Publications/2012/09/1148</a> (2012)
Responses of the biting midge Culicoides impunctatus to acetone
carbon dioxide and an octenol-phenol mixture in northwestern Florida
Comparing methods to estimate the reproduction ratio of Bluetongue
<a data-track="click" data-track-action="download citation references" data-track-label="link" rel="nofollow" href="https://citation-needed.springer.com/v2/references/10.1038/srep05746?format=refman&amp;flavour=references">Download references</a>
This work was undertaken as part of the Scottish Government EPIC project. KRS and BVP are partly supported by EU grant FP7-261504 EDENext and this paper is catalogued by the EDENext Steering Committee as EDENext236 (<a href="http://www.edenext.eu">http://www.edenext.eu</a>)
The contents of this publication are the sole responsibility of the authors and don't necessarily reflect the views of the European Commission
performed the analysis and drafted the manuscript
contributed to aspects of arbovirus epidemiology and H.A
made changes to and approved the manuscript
<a data-test="citation-link" data-track="click" data-track-action="download article citation" data-track-label="link" data-track-external="" rel="nofollow" href="https://citation-needed.springer.com/v2/references/10.1038/srep05746?format=refman&amp;flavour=citation">Download citation</a>
Growing numbers of flocks are being struck by the deadly Schmallenberg virus in the south of England
Vets are urging farmers with deformed lambs to send them for post-mortem so they can be tested for the virus
This can be done free of charge through the Animal and Plant Health Agency (Apha)
but vets are hopeful this might change if more flocks are identified as infected
See also: <a href="https://www.fwi.co.uk/livestock/health-welfare/expert-advice-on-assessing-and-managing-lambing-difficulties">Expert advice on assessing and managing lambing difficulties</a>
Vet Kirby Dobson from Tyndale Vets in Gloucestershire estimates that 20 of their early lambing flocks have been blighted by the virus
The practice covers a 150-mile radius from the South West to Worcester and crosses the Severn Bridge into South Wales
“So far it has mainly been pedigree flocks that lamb in January
Most of these are Suffolk and Texel and have lost up to 50% of lambs,” she explains
The last significant wave of Schmallenberg happened in 2016-17
when Apha confirmed 141 sheep farms in England
Wales and Scotland had tested positive for the virus
Kirby believes the sharp rise in cases this year is the result of warm and wet weather in late autumn
This would have presented ideal conditions for biting midges
The most susceptible stage for foetal deformities is days 25-50 of gestation in sheep
with older foetuses able to clear the virus
She says typical malformations to look for include fused neck and legs or the neck bent in an S-shape
This makes it extremely difficult for the lambs to pass safely through the pelvic canal and any live lambs are unviable and must be euthanised
Source: National Animal Disease Information Service
Schmallenberg usually runs in cycles of three to five years
but this latest outbreak does not fit this pattern
and the midge challenge has been higher this year
Farmers were still getting flystrike in November [because conditions were so mild]
&#8220;There is no definite pattern to the disease spread in our area
they said it was not fitting the three-to-five-year pattern of immunity.”
Kirby says it is difficult to gauge if this is only the tip of the iceberg
although she remains hopeful the worst is over
given that later lambing flocks have seen improved scanning rates compared with earlier ones
“I’m hoping the higher scanning rates indicate ewes haven’t been infected
says it has had “several reports” of Schmallenberg
says it is turning out to be a difficult time for many of its clients
“We have been called out to a large number of farms who are suffering with Schmallenberg virus.”
says he attended a farm to help lamb a triplet
The ewe had two deformed lambs in one horn of the uterus and an unaffected lamb on the other side
adding: “We had rams at the back end that failed Schmallenberg blood tests
One flock afflicted was Pat Greaney’s early lambing flock of pedigree Suffolks
The ewes were artificially inseminated on 6 August to lamb on 28 December
but Schmallenberg was not identified until 29 December
“I went to lamb a ewe and I could only feel one back leg
&#8220;The first lamb’s bottom jaw was not fully formed
and the front legs were fused backward in a lying position
It died within minutes of being born,” Pat recalls
“We lost both lambs and the ewe never recovered from the operation,” he adds
the Greaneys have lost two ewes and six lambs – all doubles – to the disease
but the hardest thing was looking at the lambs
but this is gruesome – the image is etched in your mind forever.”
He says he is hearing of more flocks locally that have the disease and warns others not to take shortcuts with vet intervention in case ewes require a C-section or the lambs need putting down
Good aftercare of ewes birthing infected lambs is also imperative
They managed to save one ewe by promptly treating her with anti-inflammatories and antibiotics
although he concedes the lambs were breached and birthed easier
Pat is concerned some of the later calving animals could be harbouring foetuses infected with Schmallenberg
but we put it down to heat stress at the time
“There’s nothing we can do apart from expect the worst and hope for the best.”
Another farmer from the Worcestershire/Shropshire border has lost more than 50 lambs from his flock of 175 early lambers
He estimates the virus has already cost him £10,000
says: “About 90% [of ewes] are presenting nowhere near right and can’t be lambed without assistance.”
Although he has avoided having to call the vet for C-sections
there are still two large groups left to lamb
He adds: “A lot of farmers nearby are having similar problems
Katie Ford lambs a flock of 800 mixed ewes with her parents near Newent
They have lost 17 lambs and two ewes from an early lambing group of Suffolk crosses
They were synchronised to lamb after Christmas
Six scanned empty and 25 of the remaining 60 ewes had lambs with Schmallenberg
two recipient ewes lambed healthy Dutch Spotted lambs
Schmallenberg presents itself differently this time around – the lambs are more malleable and are easier to lamb.”
With the next batch starting to lamb in February
she hopes the remainder of the flock will be unaffected
“The midges have been [active] until late last year
contact the Royal Agricultural Benevolent Institution on 0800 188 4444 or the Farming Community network 03000 111 999
with the disease potentially spreading across the entire UK
They blamed climate change for bringing the virus to the country and said other new viruses could follow
where the illness was first detected in August 2011 in the small town that gives the virus its name
There are also hundreds of infected farms in France
&quot;It is inevitable we will detect more and more cases [in the UK],&quot; said <a href="http://www.liv.ac.uk/vetepi/teammembers/staff/matthew.htm" data-link-name="in body link">Professor Matthew Baylis, a veterinary epidemiologist at Liverpool University</a>
The birth deformities are the end result of mothers being infected with the virus earlier in their pregnancy so
with the lambing season in its early stages and calving not beginning until April
further infections are certain to be revealed
Scientists say there is no evidence that people are affected by the virus
The virus is believed to have been brought into the UK by biting midges, blown from mainland <a href="https://www.theguardian.com/world/europe-news" data-link-name="in body link" data-component="auto-linked-tag">Europe</a> in the autumn 2011 and infecting pregnant ewes and cows
There is nothing that can be done about the malformed lambs we see now,&quot; said Baylis
Very little is yet known about the virus, so whether a fresh outbreak will occur in 2012 is unknown. But Professor Peter Mertens, who leads the vector-borne diseases programme at the UK's <a href="http://www.iah.ac.uk/" data-link-name="in body link">Institute for Animal Health</a> in Surrey
said: &quot;This virus has the potential to spread across the entire country
It is likely the virus will not go away in a year
I think that would be almost too good to be true.&quot; Similar diseases have become endemic in other countries
Mertens said the virus would be more likely to spread if midges were not the only way it infected animals
&quot;The very high prevalence of infection on some farms – up to 100% of animals – raises an interesting question: is there some other form of local spread
Animals that contract Schallenberg virus while pregnant have miscarriages
stillbirths or offspring with deformities such as a twisted necks
The symptoms of the virus in adult animals are mild – a few days of fever
loss of appetite and sometimes diarrhoea – which makes it hard to distinguish from other common illnesses
Schmallenberg virus is the second midge-borne disease known to have invaded the UK, with <a href="http://en.wikipedia.org/wiki/Bluetongue_disease" data-link-name="in body link">bluetongue virus</a> having arrived in 2007
&quot;The spread of bluetongue virus was driven entirely by the temperature changes in Europe,&quot; he said
&quot;Our changing climate is making it more likely these things happen.&quot;
Bluetongue virus was first identified in Europe in the 1920s but was confined to southern Spain and Turkey until the 1990s
only reaching northern Europe in 2006 and the UK in 2007
Baylis believes other new diseases could arrive in the UK as a result of a climate change
There is currently no test for Schmallenberg virus suitable for widespread use and no vaccine
Work has begun on a vaccine but it will take at least 18 months to be tested and licensed
though he anticipated no problems in producing an effective vaccine
In the meantime little can be done to protect livestock beyond housing them inside
Nets and insecticides have proven to be of little use
&quot;There is no evidence of infection in humans,&quot; added Mertens
&quot;It is a little bit of an unknown but everything we know [about these viruses] says it is not a risk.&quot; Tests on people in the Netherlands for the virus have all been negative
<a href="/articles/srep01178/metrics" data-track="click" data-track-action="view metrics" data-track-label="link" rel="nofollow">Metrics details</a>
During 2011 Schmallenberg virus (SBV) presented as a novel disease of cattle and sheep that had apparently spread through northern Europe over a relatively short period of time
This paper describes the development of a model of SBV spread applied to Scotland in the event of an incursion
This model shows that SBV spread is very sensitive to the temperature
with relatively little spread and few reproductive losses predicted in years with average temperatures but extensive spread (&gt;1 million animals infected) and substantial reproductive losses in the hottest years
These results indicate that it is possible for SBV to spread in Scotland
however spread is limited by climatic conditions and the timing of introduction
Further results show that the transmission kernel shape and extrinsic incubation period parameter have a non-linear effect on disease transmission
so a greater understanding of the SBV transmission parameters is required
may determine the potential for spread of SBV and other arboviruses in Scotland
impunctatus dominating in bog and heathland habitats whilst other C
obsoletus complex species are primarily associated with pastural livestock farming
impunctatus to transmit BTV and potentially SBV
Assessment of the likely extent of spread and ramifications in Scotland would aid control and deployment of resources following introduction
To investigate the likely extent and impact of an SBV epidemic in Scotland
To explore the effect of temperature on the risk of SBV spread in Scotland and the potential effect of climatic warming on SBV transmission
To explore the importance of the parameters of SBV transmission
in particular the parameters relating to the vector
</a>Stacked barplots of the number of sheep (red bars) and cattle (black bars) infected on each day of the simulated epidemic under the baseline implementation in which the mean temperature is used
The dashed line represents the start of the period in which in-lamb ewes may be at risk of reproductive losses
There is little disease spread if there is introduction earlier or later than day 60
</a>Stacked barplots of the number of sheep (red bars) and cattle (black bars) infected on each day of the simulated epidemic when the maximum temperature is used
The broken line represents start of the period in which in-lamb ewes may be at risk of reproductive losses. Note the different scale compared to <a data-track="click" data-track-label="link" data-track-action="figure anchor" href="/articles/srep01178#Fig1">Figure 1</a>
</a>The number of farms infected against the number of disease introductions under the extreme case maximum temperature scenario
The solid red line represents the median and the broken red lines the 2.5 and 97.5 percentiles
The points have been jittered to ease interpretation
</a>Comparison of the numbers of animals infected under the scenarios in Table 1
Red points correspond to the exponential kernel
The black lines represent the range from the 10th to the 90th percentiles
The distribution of parish level risk of transmission illustrated by the expected number of infectious vectors resulting from an infected animal on day 60 under the extreme case maximum temperature scenario is shown by <a data-track="click" data-track-label="link" data-track-action="figure anchor" href="/articles/srep01178#Fig5">Figure 5</a>. There is a distinct concentration of higher risk in the south-west with some patches of higher risk in northerly areas.
</a>The expected number of infectious bites () resulting from an infected host on the 30th June (day 60) under the extreme case maximum temperature scenario
this model assumed that all pregnant animals infected during the at risk period are at risk of reproductive losses
but the true proportion of these animals would go on to suffer abortions or birth malformations is currently unknown
so the observed number of reproductive losses in an epidemic may be lower
a large number of cattle will become infected and this could manifest clinically in drops in milk production or calf birth malformations and reproductive losses
Under the baseline scenario, the size of the epidemic was exponentially smaller than the maximum temperature scenario, with around one thousandth of the numbers of animals infected (<a data-track="click" data-track-label="link" data-track-action="table anchor" href="/articles/srep01178#Tab1">Table 1</a>, <a data-track="click" data-track-label="link" data-track-action="figure anchor" href="/articles/srep01178#Fig4">Figure 4</a>)
these analyses show that even during an average year SBV does present a risk to livestock in Scotland
If average temperatures and frequency of warm periods in Scotland increase as a result of global warming then the risk of vector borne disease spread in Scotland and elsewhere in Europe will continue to increase
so can be considered as credible values for SBV
The sensitivity of the model to these parameters highlights the need to better understand the parameters for SBV transmission if we are to accurately predict the spread of the disease
under the maximum temperature scenario the Gaussian kernel resulted in more animals on more farms being infected
This is because the Gaussian kernel allows the virus to spread more rapidly to new areas
where as the exponential kernel limits transmission and ensures that locally the epidemic burns-out faster
However the reverse is true when the mean temperature is used
This is because under the lower temperatures there are fewer areas suitable for spread
The tighter exponential kernel is more effective in ensuring that infection remains within these areas
whereas the wider Gaussian kernel allows more opportunity for the virus to escape these risk areas to areas that are less favourable for spread and conditions are less likely to lead to further transmission
the climatic conditions in Scotland are at the lower end of the scale that is suitable for SBV transmission
but are still adequate for the disease to spread
given warmer than average (but still feasible) temperatures SBV could spread very quickly within Scotland with significant impacts in both the sheep and cattle populations
This is upon the assumption that SBV will spread with similar parameters as BTV and is highly dependant upon the nature of vector movement with respect to a transmission kernel
how the disease spreads within Scotland is very dependant upon the precise nature of the EIP of SBV
The model used in this analysis is a stochastic simulation model comprising two main compartments: a) the transmission from livestock host to vector; and b) the transmission from vector to host
Different introduction scenarios are simulated by seeding of infection on to farms to represent importation of infected animals or windborne virus spread
A number of assumptions have been made in this model:
No disease control measures will be employed
The EIP for SBV will be the same as for BTV
at time t the number of vectors that will feed on an infectious animal and survive sufficient time to lay an infectious bite is defined by a daily rate 
The actual number of infectious bites is taken from a Poisson distribution (Pois())
vt  =  0.25 when t &lt; 30 (31st May) or t &gt; 140 (September 18th) and t is between 65 (5th July) and 100 (9th August) days
vi is a term that describes the likely vector abundance given the landcover in a 1km buffer around i
with the more competent species associated with pasture and less competent species associated with heathland: 
where  and  are the proportion of land within the 1 km buffer classed as pasture and heathland respectively
 is the number of infectious animals on i at time t
σv is the probability of transmission from animal host to vector and is equal to 0.19, based upon experimental infections<a data-track="click" data-track-action="reference anchor" data-track-label="link" data-test="citation-ref" aria-label="Reference 3" title="Veronesi, E. et al. Implicating Culicoides biting midges as vectors of Schmallenberg virus using semi- quantitative RT-PCR. PLoS ONE (2013) (In press)." href="/articles/srep01178#ref-CR3" id="ref-link-section-d382134079e1230">3</a>
the EIP (Ve) and the interval between blood meals (vb)
where T is the temperature and the daily survival probability is 
In order to account for a vector taking more than one potentially infectious meal
the infectious bite rate of a vector is given by: 
This assumes that the midge will not survive to lay more than 10 infectious bites (although the probability of surviving more than two bites being very small and is almost negligible)
An infected vector from farm i will infect an animal on farm j (i can be the same as j) with probability defined by: 
where  is a spatial transmission kernel based upon the Euclidean distance between farms i and j () and describes the distances a vector will travel between infection and the laying of infectious bites
 describes the attractiveness of a farm to a vector and is equal to the number of susceptible hosts () on holding j
 is a scaling parameter that ensures that any potentially infectious bite is laid only once: 
The model parameters are summarised in <a data-track="click" data-track-label="link" data-track-action="table anchor" href="/articles/srep01178#Tab2">Table 2</a>
The model introduces infection on different start dates from the 1st June (being the first month at which temperatures are suitable for within vector incubation) with 30 day intervals between start days (up to start day  =  120 (29th August))
The model is initiated by introducing disease on certain ‘seed’ farms. The seeds are assumed to be introductions from England, so a farm is more likely to be a seed if it is further south (described in the <a data-track="click" data-track-label="link" data-track-action="supplementary material anchor" href="/articles/srep01178#MOESM1">supplementary information</a>) with seeds sampled at random (with replacement
so it is possible for a seed farm to become infected twice)
The seed is infected by a single random animal becoming infected
</a>The shape of the exponential kernel (red line) and Gaussian kernel (blue line)
To explore the sensitivity of the model to certain parameters sensitivity analysis was conducted by altering the parameter and rerunning the model with the new values and comparing these results to those from the baseline (mean temperature) scenario
Analysis was conducted to explore the effects of using the maximum mean monthly temperature of each grid cell over the period of the data (1990–2006)
The parameter for EIP is taken from studies of BTV and the parameter for SBV may have a different minimum incubation temperature or a different virus replication rate
Thus an equation with a minimum temperature 1°C cooler: 
Implicating Culicoides biting midges as vectors of Schmallenberg virus using semi- quantitative RT-PCR
EFSA “Schmallenberg” virus: analysis of the epidemiological data 1
10 on Schmallenberg Virus in Northern Europe
Impact of climate change and other factors on emerging arbovirus diseases
Potential arbovirus emergence and implications for the United Kingdom
host and landscape factors on Culicoides species in Scotland
Distribution and Abundance in Scotland of Culicoides Midge Species and their Potential as Vectors of Animal Disease
Oral Susceptibility to Bluetongue virus of Culicoides (Diptera: Ceratopogonidae) from the United Kingdom
The vector potential of British Culicoides species for bluetongue virus
Observations on biology of Culicoides impunctatus Goetgh (Diptera:Ceratopogonidae) in Southern England
EFSA “Schmallenberg” virus: Analysis of the Epidemiological Data and Assessment of Impact
Assessing the consequences of an incursion of a vector-borne disease I
Identifying feasible incursion scenarios for bluetongue in Scotland
Assessing the consequences of an incursion of a vector-borne disease
Spread of bluetongue in Scotland and impact of vaccination
9 on Schmallenberg Virus in Northern Europe
Temperature dependence of the extrinsic incubation period of orbiviruses in Culicoides biting midges
Estimates for local and movement-based transmission of bovine tuberculosis in British cattle
Representing the UK's cattle herd as static and dynamic networks
Potential for transmission of infections in networks of cattle farms
Sheep movement networks and the transmission of infectious diseases
Mapping the basic reproduction number (R0) for vector-borne diseases: a case study on bluetongue virus
Seasonal transmission of bluetongue virus by Culicoides sonorensis (Diptera: Ceratopogonidae) at a southern California dairy and evaluation of vectorial capacity as a predictor of bluetongue virus transmission
Seasonal abundance and survivorship of Culicoides sonorensis (Diptera: Ceratopogonidae) at a southern California dairy
with reference to potential bluetongue virus transmission and persistence
Environmental effects on vector competence and virogenesis of bluetongue virus in Culicoides: interpreting laboratory data in a field context
Rates of bluetongue virus transmission between Culicoides sonorensis and sheep
CORINE Land Cover technical guide - Addendum 2000
<a data-track="click" data-track-action="download citation references" data-track-label="link" rel="nofollow" href="https://citation-needed.springer.com/v2/references/10.1038/srep01178?format=refman&amp;flavour=references">Download references</a>
This work was undertaken as part of the Scottish Government EPIC project. IGH was supported through Institute Strategic Grant funding from the BBSRC. KRS and BVP are partly supported by EU grant FP7-261504 EDENext and this paper is catalogued by the EDENext Steering Committee as EDENext084 (<a href="http://www.edenext.eu">http://www.edenext.eu</a>)
contributed to aspects of arbovirus epidemiology and HKA contributed to veterinary aspects of SBV
Supplementary information for: Epidemic potential of an emerging vector borne disease in a marginal environment: Schmallenberg in Scotland
<a data-test="citation-link" data-track="click" data-track-action="download article citation" data-track-label="link" data-track-external="" rel="nofollow" href="https://citation-needed.springer.com/v2/references/10.1038/srep01178?format=refman&amp;flavour=citation">Download citation</a>
Sorry, a shareable link is not currently available for this article.
Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.
Notifications can be managed in browser preferences.
Farmers fear livestock crisis after thousands of animals killed by Schmallenberg disease
I would like to be emailed about offers, events and updates from The Independent. Read our <a href="/service/privacy-policy-a6184181.html" class="sc-141s52x-0 gKwTSi">Privacy notice</a>
Tens of thousands of lambs have been stillborn or deformed throughout Britain as a result of the deadly Schmallenberg virus, with the industry bracing itself for what could be a blighted lambing season.
In infected flocks the rate of lamb loss has been between 25 and 30 per cent on average, according to the National Farmers Union livestock chief, who has lost 40 per cent of the lambs from his early breeding flock to the emerging virus. Schmallenberg has been reported on more than 1,200 farms across the country, but there are fears the disease is being under-reported and that the Government is not taking the threat seriously enough.
Although there are hopes that many later-lambing ewes, which make up the majority of the national flock, have escaped infection, farmers warn that losses on a similar rate throughout the lambing season would plunge the sheep-farming industry into “crisis”.
“Farmers need a good lambing season to avert a crisis,” Robin Milton, the NFU’s Uplands chairman who keeps 700 ewes on Exmoor, Devon, said. “It’s a fragile state of affairs. If there was even a five per cent loss, in some flocks, that’s the profit for the year gone.”
Sheep farmers are already struggling with falling lamb prices and the after effects of last year’s poor weather. Farmgate prices for lambs have dropped by a quarter and the wholesale price is down 17 per cent, but the price for lamb on the shelf has dipped only two per cent, leaving farmers to pick up the deficit.
Schmallenberg first appeared in eastern England more than a year ago, but is now believed to have spread to every county in England and Wales. The virus, which originated in Germany and is thought to have spread in infected insects blown across the Channel, causes abortions and birth defects in livestock. Cattle farmers also fear the virus could affect this year’s calves.
Uncertainty over the damage Schmallenberg might cause has led to calls for the Government to accelerate development of a vaccine, which is not predicted to be released on to the market until next year. Defra is still treating Schmallenberg as a low-priority, non-notifiable disease, meaning that farmers do not have to report cases of it, which has led to fears the Government may be underestimating its true extent.
The virus is spread by midges, mosquitoes and ticks and although an infection to a ewe or a ram does not necessarily mean offspring will die, early losses have raised concerns that the disease’s impact could be greater than first feared.
The Government anticipates that later lambing flocks will be less vulnerable because later-breeding animals may have had time to develop natural immunity to the virus. “It would be useful if the Government did everything they could to make the vaccine available,” Mr Sercombe said. “Confidence in sheep farming is at rock bottom. The safest option is to give us the vaccine to protect our flocks.”
A Defra spokesman said: “It’s extremely distressing for any farmer whose flocks have been affected by Schmallenberg – particularly those who have seen a greater impact on their sheep and cows.”
Schmallenberg virus is an emerging livestock virus that originated in Germany and has been detected in Belgium, the Netherlands and now the UK.
It is transmitted by vectors such as midges, mosquitoes and ticks. It is believed the disease arrived in the UK carried by midges blown across the Channel.
The virus can cause late abortion or birth defects in newborn sheep, cattle and goats as well as diseases such as milk drop, pyrexia and diarrhoea in adult cattle. It is not a notifiable disease, meaning that farmers do not have to report it, but they are advised to contact a vet if they encounter symptoms in their livestock.
There is a low likelihood of any risk to public health.
Join thought-provoking conversations, follow other Independent readers and see their replies
<a href="http://www.defra.gov.uk/ahvla-en/2013/02/27/sbv-updated-test-results/" data-link-name="in body link">Data from the Animal Health and Veterinary Laboratories Agency</a>, part of the Department for Environment, Food and Rural Affairs (Defra), showed <a href="http://www.defra.gov.uk/animal-diseases/a-z/schmallenberg-virus/" data-link-name="in body link">Schmallenberg virus</a> had been confirmed in livestock in all counties of England and Wales
as well as to a more limited extent in Scotland
The virus was detected in the Netherlands and Germany in late 2011 and named after the town in North Rhine-Westphalia where it first emerged
it tends to cause abnormalities to skulls and limbs
loss of appetite and reduced milk production
It was first detected in lambs in eastern England at the start of 2012
A possible vaccine has been developed and tried out elsewhere in Europe with apparent success. <a href="http://www.nfuonline.com/News/VMD-confirms-Schmallenberg-vaccine/" data-link-name="in body link">Defra's Veterinary Medicines Directorate has confirmed</a> it is considering an application for use of the Bovilis SBV vaccine
The spread of the disease will be seen more vividly with the lambing season
and the National Farmers Union has called on the government to make sure the vaccine is available soon
warning that while the disease is still classified as low impact overall it can cause significant difficulties to individual farmers
Joanne Pugh from the National Sheep Association <a href="http://www.bbc.co.uk/news/science-environment-21609335" data-link-name="in body link">told the BBC</a>: &quot;It's incredibly high impact for the flocks that have had it and had massive losses.&quot;
The Schmallenberg virus first emerged in the Netherlands and Germany last year
causing mild to moderate symptoms in adult cattle
including reduced milk yield and diarrhoea
and late abortions and birth deformities in newborn sheep
It is thought the virus is spread by midges
and has crossed the Channel from the continent
The Animal Health and Veterinary Laboratories Agency (AHVLA) said the infection had now been identified on 74 farms
Five of the positive cases have been diagnosed in cattle
none of the affected farms have reported importing animals during 2011 from the affected areas in mainland Europe
Positive cases have been identified on the Isle of Wight and in Wiltshire
This is in addition to the counties in the east and south of England which have previously had cases identified
A spokesman for the Department for Environment
Food and Rural Affairs said: &quot;As everyone connected with the livestock industry has been expecting
the number of cases of Schmallenberg has increased as lambing and calving begin to gather pace
&quot;Schmallenberg has been identified in the south
and we suspect livestock got the virus from infected midges blown across the Channel from affected areas in Europe
and governments continue to gather information about the progress and effects of this disease
it's vital that farmers continue to report any suspicions they have as soon as possible
&quot;The European Centre for Disease Prevention and Control says it is unlikely Schmallenberg virus would cause disease in humans.&quot;
The <a href="http://www.defra.gov.uk/animal-diseases/a-z/schmallenberg-virus/" data-link-name="in body link">Schmallenberg virus</a>
has survived the winter in the UK and because it is highly efficient at spreading quickly and infecting whole herds
it could reach as far as Scotland and Wales
&quot;There is no reason why it should not spread to most of the [UK] this year,&quot; said Peter Mertens, professor at the <a href="http://www.iah.ac.uk/" data-link-name="in body link">Institute for Animal Health</a>
the susceptible animals are there – it could spread to the whole country.&quot;
The <a href="https://www.theguardian.com/science/2012/jan/23/schmallenberg-virus-confirmed-uk-farms?INTCMP=SRCH" data-link-name="in body link">first cases</a> of the Schmallenberg virus in the UK were found early this year in farms in the south and east of England
though there could be many more as yet undetected
ewes and cows can give birth to offspring with severe deformities
from bent limbs to animals born without a brain
There is believed to be <a href="http://ecdc.europa.eu/en/press/news/Lists/News/ECDC_DispForm.aspx?List=32e43ee8-e230-4424-a783-85742124029a&amp;ID=541&amp;RootFolder=/en/press/news/Lists/News" data-link-name="in body link">no risk to human health</a>
and the deformed animals are removed from the food chain
<a href="https://www.theguardian.com/environment/2012/feb/26/schmallenberg-virus-74-farms-england?INTCMP=SRCH" data-link-name="in body link">Farmers have been warned</a> that the signs of infection include stillbirths or major birth defects in lambs and calves
reduced milk yield and loss of appetite in adult animals
The risks to offspring occur only if females become infected with the virus during the early to middle stages of pregnancy
This is likely to limit the damage to farmers from the virus
which is markedly less devastating than the bluetongue virus
which struck northern Europe in 2006 killing up to a third of infected animals
but it is not as bad as that,&quot; said Martens
But while the economic impact across the country is likely to be &quot;relatively limited&quot;
according to the government's chief veterinary officer Nigel Gibbens
the disease could still be &quot;distressing for individual farmers&quot;
Farmers will not receive compensation if their herds are infected
A vaccine is now in development, and veterinary experts are hopeful that it can be brought forward soon, though it is unlikely to be this year. When the <a href="https://www.theguardian.com/environment/2007/may/13/ruralaffairs.conservation?INTCMP=SRCH" data-link-name="in body link">bluetongue virus</a> hit northern Europe
the UK was able to vaccinate susceptible animals in early 2008 before the insects that carried it re-emerged from winter
As a result there were no more infections in the UK
&quot;Bluetongue was a major success story,&quot; said Mertens
The <a href="https://www.theguardian.com/environment/2012/feb/27/schmallenberg-virus-birth-defects-sheep?INTCMP=SRCH" data-link-name="in body link">Schmallenberg virus</a> was first isolated in December 2011 after numerous cases across Europe
and named after the German town where it was identified
It is related to viruses that cause cattle disease in Africa
but similar insect-borne diseases have not been found before in northern Europe
Mertens said it was clear that climate change was a factor in its spread
assisted by increasing international trade
He warned that other illnesses were likely to spread northwards as the climate warms
<a href="https://www.producer.com/livestock/" rel="tag">Livestock</a>
Schmallenberg virus has continued to spread across Europe since I last wrote about it two years ago
The infectious agent was named for the German town where the virus was first discovered
non-fatal illness in adult sheep and cattle
Clinical signs include fever and loss of appetite and weight
Milk production can be substantially reduced in affected dairy cattle
Jailed chicken farmer found to be in compliance for number of laying hens after EFA inspection 
nannies and cows that are infected for the first time while pregnant
New studies have found that only a small proportion of infected pregnant cows have these severe outcomes
Researchers have found Schmallenberg virus in biting midges from several European countries
which supports the theory that these tiny insects play an important role in virus spread
Transmission continued last winter but it is unknown whether midges were present within barns to spread the virus or if other insects were capable of transmission
Schmallenberg virus is not spread by contact
Infected dams can pass the virus to offspring
Antibodies in infected cattle can last at least two years after infection
Recovered animals are resistant to re-infection for at least a year
Several tests have been developed over the last two years that use blood or tissues
Vaccines have been developed but their widespread efficacy
use and cost-benefit have yet to be established
Researchers found no trace of it in cattle and sheep blood from the years immediately before the first cases occurred
which suggests it was either circulating at low levels or came from elsewhere
The European Food Safety Authority says the most significant economic impact is from trade restrictions imposed by countries where the disease is not endemic
The impact at the herd level seems to vary
One study of dairy cows found only small differences in milk production and slightly reduced fertility during the season when Schmallenberg virus emerged compared to the previous year
some farms experienced greater than 40 percent lamb mortality
The disease also took its toll on producers
with one in four farmers reporting a high impact on emotional well-being
An explosion of research has occurred since 2012
with more than 100 scientific papers published
found that 100 percent of cattle and more than 40 percent of sheep and goats had antibodies against Schmallenberg virus
It’s possible that the test used in the study could have cross-reacted with other viruses
Researchers need to do further testing to confirm that Schmallenberg is indeed present in Africa
laboratories and research institutions collaborated in response to this outbreak with remarkable speed and openness
which bodes well for future disease emergence scenarios
The Canadian Food Inspection Agency has modified importation requirements to prevent Schmallenberg virus from entering Canada
Animals from which sperm or embryos are collected must test negative for the virus before entry into Canada
The virus hasn’t jumped the ocean to North America yet
but understanding emerging disease issues across the world is important
given the speed and volume of global travel and trade
Newsletter Sign Up - Receive free Western Producer newsletters
Breaking ag news stories and commodities markets snapshots delivered daily right to your inbox
&#916;document.getElementById( "ak_js_1" ).setAttribute( "value"
Cattle markets hold value amidst uncertainty
Drought preparation is better than reaction
Producers must take foot-and-mouth disease seriously
Farmer incorporates cattle into grain operation to boost soil health
<a href="/website-terms-of-use/">Terms and Conditions</a> | <a href="/privacy/">Privacy Policy</a> | &copy; 2025
Western Producer Publications Limited Partnership
&quot;(Required)&quot; indicates required fields
&#916;document.getElementById( "ak_js_2" ).setAttribute( "value"
A key building block in the Schmallenberg virus could be targeted by anti-viral drugs
according to a new study led from the University of Leeds
which causes birth defects and stillbirths in sheep
was first discovered in Germany in late 2011 and has already spread to more than 5,000 farms across Europe
There is currently no way of treating infected animals
but a study published in Nucleic Acids Research reports that the Schmallenberg virus nucleocapsid protein
A University of Leeds-led team of virologists and structural biologists used X-ray crystallography and electron microscopy to decipher the three-dimensional shape of the nucleocapsid protein and also show how it builds the inner workings of the virus itself
of the University of Leeds&#146; Faculty of Biological Sciences and co-leader of the study
said: &#147;The protein forms a chain a bit like a necklace that wraps around and protects the RNA
This chain also recruits other proteins that are vital to the virus&#146; ability to multiply and cause disease
We have developed a very finely detailed picture of the shape of the protein and all the nooks and crannies that it needs to present to other molecules to be able to function.&#148;
The nucleocapsid proteins bind together in a ring-like structure of four identical protein units
and the ring is held together by contacts between the protein units
a bit like people holding hands in a circle
also from Leeds&#146; Faculty of Biological Sciences
said: &#147;The shape of the nucleocapsid protein has shown us important details of how the individual proteins in these rings are interacting
This not only tells us how the virus works
but importantly we think we can block that interaction and disrupt the process of making the ring
It would stop the protein wrapping up the RNA
We are now designing small molecules that could block ring formation and could therefore be an effective antiviral drug.&#148;
The Schmallenberg virus appears to be spread by midges
It causes a relatively mild illness in adult animals but is responsible for stillbirths and birth defects in cattle
Food and Rural Affairs (DEFRA) believes the disease was probably brought into the UK from infected midges blown across the Channel
causing severe losses on many holdings across the entire UK
There is new evidence that the Schmallenberg virus can also spread to wild animal populations such as deer and wild boar
raising the possibility that a reservoir of the disease could develop outside the control of farmers and cause problems for many years to come
Developing a vaccine for the Schmallenberg virus is a possibility
One already exists for the similar Akabane virus
but the discovery by the Leeds-led team is the first step toward developing a treatment that could be used after an animal is infected
The research was funded by The Wellcome Trust and involved researchers from The University of Leeds
&#147;Nucleocapsid protein structures from orthobunyaviruses reveal insight into ribonucleoprotein architecture and RNA polymerization,&#148; is published in Nucleic Acids Research.Further information
Dr John Barr and Dr Thomas Edwards are available for interview
Copies of the paper and high-resolution computer generated images of the structure of the protein and virus are available on request
Contact Chris Bunting, Press Officer, University of LeedsT: +44 (0)113 343 2049 E: <a href="mailto:c.j.bunting&#064;leeds.ac.uk">c.j.bunting&#064;leeds.ac.uk</a>  
Weeks after government vets <a href="https://www.theguardian.com/science/2012/jan/23/schmallenberg-virus-confirmed-uk-farms" data-link-name="in body link">confirmed the arrival in Britain of the deadly Schmallenberg virus</a>
which causes miscarriages and birth deformities in lambs
74 farms in southern and eastern England have been found to have the disease and the number is expected to rise sharply as the lambing season peaks
imports and exports are unlikely because officials do not want to further jeopardise rural economies to combat a virus that has also affected cattle and goats across Europe but is not thought to be dangerous to people
Public health bodies are monitoring the health of farmers
farm workers and vets who have been in contact with infected animals
The <a href="http://www.nfuonline.com/" data-link-name="in body link">National Farmers Union</a> has warned of a &quot;ticking time bomb&quot; over the disease
which has affected up to 20% of lambs on some farms
which is thought to have been carried by midges over the North Sea or English Channel
is named after a farm in Germany where it was first identified last year
It was initially seen in cattle and quickly spread through the Netherlands and Belgium to northern France
The virus has hit sheep on 69 farms and cattle on five since its first detection in England last month, according to the <a href="http://www.defra.gov.uk/ahvla/2012/02/24/schmallenberg-virus-further-updates-on-gb-testing-results-2/" data-link-name="in body link">Animal Health and Veterinary Laboratories Agency (AHVLA)</a>
The midges suspected of being the virus carriers probably arrived last summer, according to <a href="http://www.defra.gov.uk/" data-link-name="in body link">the Department for Environment, Food and Rural Affairs</a>
&quot;The midges are not around at the moment
so movement restrictions are not going to have any effect,&quot; said a spokesman
Such restrictions could cause huge problems for farmers without reducing the spread of the disease
AHVLA says methods of infection have not been confirmed
&quot;The potential for direct transmission (ie direct from one animal to another) is therefore
Symptoms of the disease have not been identified in adult sheep but it causes diarrhoea
There is currently no treatment and a vaccine could take 18 months to two years to develop
Farmers are calling for a more definitive method of recording cases of Schmallenberg virus
as the true extent of the issue remains largely unrecorded
Sheep farmers across the country have repeatedly expressed concerns
as this year’s lambing season has seen the highest numbers of affected flocks within the past five years
See more: <a href="https://www.fwi.co.uk/livestock/health-welfare/livestock-diseases/schmallenberg/surge-in-cases-of-schmallenberg-impacting-lambing">Surge in cases of Schmallenberg impacting lambing</a>
chief executive of the National Sheep Association (NSA)
said that the organisation has received worrying reports from farmers across the country
“It seems to be at its worst through the West Midlands belt from Somerset
“That’s where we’re hearing about the biggest losses.”
Mr Stocker explains that Schmallenberg tends to follow a four- or five-year pattern
The disease was first detected in the UK in 2012 with a large initial outbreak – an event which was followed by years of lower instances
“The critical time is if in-lamb ewes are bitten from day 10 to 65 – essentially that first one-third of pregnancy – then the unborn lamb has got a high chance of being affected,” said Mr Stocker
then they build up immunity and carry that for quite some time
“It is causing some real stress and anxiety
When you talk to the farmers going through it
the first thing they will mention is anxiety
While a licensed vaccine for Schmallenberg does exist
it is not currently in production or available in the UK
“A lot of people who have been badly hit this year have said that they would use a vaccine every year from now on
“They wouldn’t run this risk again – it has just been devastating,” said Mr Stocker
“The vaccine manufacturers have had their fingers burnt on this before
when they’ve produced a load and not seen the uptake
“But I think there would be enough demand for there to be a production of vaccines this year.”
To try and build an accurate picture of the number of losses this year
and to give the vaccine manufacturers hard industry evidence
Mr Stocker says affected farmers should be regularly in touch with their vets
“They should be talking to their vets about samples being submitted to the veterinary investigation centres for proper analysis
although quite often you will just get aborted lambs
or lambs that are born alive and just don’t survive and you struggle to get them going
it’s going to be very difficult for us on an industry scale to see what is going on.”
Shrewsbury sheep farmer Ben Lowe has lost 40% of his pedigree Texel lambs to Schmallenberg this year
with devastating emotional and financial losses
He says that farmers need a reliable mechanism to be able to report and quantify the losses that they have had
“The biggest concern of mine at the moment is that the whole situation is massively under-reported and under-quantified,” he said
 “Schmallenberg is silent and kept in lambing sheds
kept quiet with farmers that are struggling with it
“The only difference with something like bluetongue is that it is so much more demonstrative in the way that you have adult cattle and sheep
Ben has had to keep them away from the lambing sheds this year due to the high number of traumatic losses
“You get to the point where you’re snapping legs to get them out
“These fused limbs are so stiff that you have to snap the legs to be in a position to get the lamb out
“I can’t put either myself or my boys through what we went through again.”
the industry will have a shot at getting a Schmallenberg vaccine back into production
Especially from a food security point of view when we have uncertain times ahead of us and a massive potential loss in lamb production in the UK.”
Zoetis has announced the launch of Zulvac SBV
a new&nbsp;Schmallenberg vaccine licensed for use in cattle and sheep in two doses at a three week interval
the second at least two weeks before mating
Zulvac SBV is licensed for use in cattle and sheep in two doses at a three week interval
Duration of immunity is six months in cattle and seven in sheep
this covers the window of susceptibility during pregnancy; in sheep from day 28 to 56
Animals infected during these periods are at risk of malformed offspring and subsequent stillbirth
The company says vaccination combined with insecticidal measures to control the midge vector remains the most effective way of protecting the population1 and ensuring a more unified level of immunity
Zoetis vet Carolyn Hogan said: "Although SBV is now considered to be an enzootic pathogen in England and Wales
there is plenty of evidence that seroprevalence at farm level – particularly on sheep farms - varies
the proportion of herds and flocks naïve to SBV and at risk via introduction of naïve replacements increases
So the risk of reinfection in assumed enzootic areas is potentially underestimated2
are widespread in Europe and move easily between farms and regions
Carolyn says that whilst there have been no confirmed diagnoses of congenital abnormalities in calves or lambs from APHA in 2014 or 2015
unconfirmed anecdotal cases have been reported
"We do not know whether our ruminant population is immune or susceptible and neither do we know if another SBV challenge will appear
Vaccination remains the most effective way of ensuring valuable livestock are protected."
PS: Whilst you're here, take a moment to see our <a href="https://www.vetsurgeon.org/veterinary-jobs/">latest job opportunities for vets</a>
<a title="VetSurgeon - Contact Us" href="https://www.vetsurgeon.org/p/contact-vetsurgeon.aspx">Contact Us</a> | <a title="VetSurgeon Privacy Policy" href="https://www.vetsurgeon.org/p/privacy.aspx">Our Privacy Policy</a> | <a title="VetSurgeon Cookies" href="https://www.vetsurgeon.org/p/vetsurgeon-cookie-policy.aspx">Cookies</a> | <a title="VetSurgeon Terms and Conditions" href="https://www.vetsurgeon.org/p/terms-conditions.aspx">Terms &amp; Conditions</a>
<a href="https://www.facebook.com/vetsurgeon.org/" target="_blank">Facebook</a> | <a href="https://www.linkedin.com/showcase/vetsurgeon-org" target="_blank">Linkedin</a> | <a href="https://www.instagram.com/vetsurgeon_dot_org/" target="_blank">Instagram</a> | <a href="https://twitter.com/_vetsurgeon" target="_blank">Twitter</a>
<a href="https://www.vetsurgeon.org/p/veterinary-advertising.aspx">Learn more about advertising on VetSurgeon.org</a>
With numerous reports of Schmallenberg appearing in early lambing flocks this season
farm vet from Cross Counties Farm Vets – part of the VetPartners group
Mrs Rigby chairs the VetPartners Sheep Clinical Interest Group and runs the Cross Counties Flock Health Club
She also has a small flock of sheep at home
Have you seen an unusually high level of Schmallenberg in early lambing flocks so far this season
I didn’t see any cases of Schmallenberg last year
and only a couple of cases the year before
Our earliest lambers seem to have been affected at the end of their lambing
and those just starting are seeing cases now too
In some parts of the country the situation has been much worse
with some litters having one or more seemingly unaffected lambs
Some of the affected lambs are born alive and need euthanising
How is this affecting your farming clients
Lambing is a high pressure time of year as it is
For some it&#8217;s the anticipation of what&#8217;s to come having heard news of cases on neighbouring farms
for others it&#8217;s the heartache of having to deal with increased mortalities
The economic effects of poorer scanning results and fewer live lambs will be felt later in the year which obviously has a big impact on farming businesses
Since Schmallenberg is spread by infected midges
climate and therefore climate change undoubtedly has an effect
A mild wet autumn/winter last year will have allowed midge survival later in the year
meaning ewes could be bitten and infected during the critical window in pregnancy.At the moment
it is thought that Schmallenberg is now endemic in our midge populations
whereas previously infection occurred when infected midges were blown here from abroad
This means future outbreaks are less dependent on the weather and infection levels overseas
We currently seem to see the worst outbreaks of SBV in three-to-five-year cycles
but also due to waning immunity in the national sheep flock
meaning there is a greater number of susceptible sheep every three-to-five years
The APHA are currently offering free Schmallenberg testing on brain samples from affected lambs
or blood samples from ewes to look for exposure to the virus
It&#8217;s really important that we continue testing even if it seems ‘obvious&#8217; that&#8217;s its SBV to ensure we are assuming the correct diagnosis
and to help us build a picture of the national situation
or any other notifiable diseases on your farm
Ruminant Health and Welfare has a web page dedicated to updates and information including farmer FAQs for BTV3, please visit: <a href="https://ruminanthw.org.uk/bluetongue-virus/" target="_blank" rel="noreferrer noopener">https://ruminanthw.org.uk/bluetongue-virus/</a>
Read more livestock articles <a href="https://www.farmersguide.co.uk/livestock-news/" target="_blank" rel="noreferrer noopener">here</a>
Business and Rural news from the UK’s favourite monthly farming magazine
We’ve now moved to our new office in Stowmarket
If you wish to contact us please use our new address:
Vets are urging farmers to be vigilant for Schmallenberg virus (SBV) – which can mimic other diseases including bluetongue – as a rising number of early lambing flocks are hit with deadly SBV this season
Independent sheep consultant Fiona Lovatt said the UK has seen an increase in SBV
“I’ve seen SBV in flocks that have been lambing since the beginning of January – a flock down in Dorset as well as a couple in the Cheshire area (22% of lambs born were affected in one of these flocks)
“This is devastating for the farmers and really disheartening for everyone involved at lambing time,” she commented
APHA has been offering free testing and since December 2023 has confirmed more than 25 cases in England through its scanning surveillance system
However more suspect cases and samples are received daily
The majority of the confirmed cases are congenital deformed lambs as a result of intra-uterine infection during pregnancy
Acute clinical disease in adult cattle presents as:
Adult sheep and goats generally do not show signs of clinical disease
or with deformities following infection of the dam
The most susceptible stages of pregnancy for foetal deformities are days 62–180 in cattle and 25–50 in sheep
A recent technical webinar saw Rudolph Reichel
stress the importance of ruling out other conditions which could mimic SBV – including bluetongue virus
This is particularly important due to the new BTV-3 strain circulating in the UK
as less is known about how this serotype presents
Mr Reichel said recent cases of SBV have been confirmed in November
showing signs of milk drop in dairy cattle
congenital deformed lambs are being submitted
which are likely to have been born end of December/early January
and more recently in Oxfordshire and Gloucestershire
so usually cases peak in late summer/early autumn
However it’s thought that warmer weather this winter could be responsible for the unusual cases
NSA chief executive Phil Stocker said:&nbsp;“It is extremely concerning to hear of proven (and assumed) cases of this virus in many areas of the UK
These cases are from animals that were bitten by infected midges back in the autumn during their early stages of pregnancy.&nbsp;
“NSA would urge all working with sheep and cattle at these times to be vigilant to the signs of SBV and to contact their vets should they suspect the presence of any cases on their farms.”
Dr Ami Sawran of Westpoint Farm Vets commented: “The SBV cases currently being detected are likely due to infection in late summer/early autumn
Most cases confirmed by APHA are in stillborn lambs
but it is worth noting that this may be seen in cattle
“There are currently no plans to offer a vaccine for SBV
however many different diseases can cause abortion or deformation in neonates
some of which are manageable at herd or flock level
so it is important to pursue diagnostics to determine the cause on your farm
“If you have unfortunately been affected by poor scanning percentages
abortions or issues at lambing and calving
it is important to speak with your vet to determine any management changes that may serve to protect your herd or flock.”
Farmers affected by SBV are encouraged to take part in a survey by the University of Nottingham to help build a picture of the extent of the problem, which can be found <a href="https://bit.ly/4bmukxR" target="_blank" rel="noreferrer noopener">here</a>
For more information on free APHA SBV testing visit <a href="http://apha.defra.gov.uk/vet-gateway/news/20220124.html" target="_blank" rel="noreferrer noopener">here</a>
Read more <a href="https://www.farmersguide.co.uk/livestock-news/" target="_blank" rel="noreferrer noopener">livestock articles here</a>
A devastating virus that causes fatal deformities in lambs has emerged again six years after killing thousands across UK farms
Schmallenberg virus has been identified in 50 different flocks so far
with farmers being urged to submit dead lambs with skeletal deformities for post-mortem
Phil Stocker, chief executive of the National Sheep Association, <a href="http://www.thetimes.co.uk/edition/news/virus-returns-to-kill-up-to-fifth-of-newborn-lambs-zzw6md2qh" rel="nofollow">told the Times</a> that farmers have already experienced huge losses: "Some people are reporting 20% of the lamb crop lost," he said
it causes severe malformations of lamb foetuses
The<a href="https://www.ibtimes.co.uk/lambing-season-schmallenberg-virus-photos-305123" target="_blank" rel="noopener"> disease spread</a> through Western Europe in 2011 and caused a <a href="https://bvajournals.onlinelibrary.wiley.com/journal/20427670" rel="nofollow">major epidemic</a> the following lambing season
It is thought the latest cases were caused by midges blown across the sea from the Netherlands or Germany
largely disappeared over the following years &ndash; potentially through immunity built up by the animals
with vets warning it could have a major impact - most breeding ewes have not yet given birth
Ben Strugnell, from Farm Post Mortems, <a href="http://meatinfo.co.uk/news/fullstory.php/aid/20774/Industry_concerns_as_Schmallenberg_cases_increase_.html" rel="nofollow">told Meat Trades Journal</a>: "The possible re-emergence of Schmallenberg was predicted following a study in autumn 2015 which tested young flock replacement sheep in the south of England
the results of which suggested that levels of immunity may have dropped
"It is very important that if producers encounter lambs with skeletal deformities
these are submitted for post-mortem examination so appropriate samples can be taken to establish whether Schmallenberg is the cause ..
Younger sheep may be most at risk as older ones may be immune from previous exposure to the virus."
The first case was detected in Cornwall in October
experts warned that governments and farmers had become less aware of the virus because of its reduced circulation
said: "Five years after its initial emergence
this could shape the ideal conditions for a renewed large scale re-emergence of Schmallenberg virus that would probably be followed by a new abortion storm
It seems advisable to closely monitor the situation via different surveillance techniques to allow timely warnings to veterinarians and farmers and to remind them to remain alert."
the disease has been detected in the North East of England
Get our news on your inbox!  Suscribe <a href="#" class="close">x</a>
MercoPress, en <a href="https://es.mercopress.com/">Español</a>
Montevideo, <a title='Browse all articles for May 2025' href='/2025/05'>May</a> <a title='Browse all articles for May 6th 2025' href='/2025/05/06'>6th</a> <a href='/2025' title='Browse all articles for 2025'>2025</a>  - 02:55 UTC
A disease that can lead to lambs and calves being stillborn or deformed has spread to every county in England and Wales
Some farmers are expected to lose livestock during the lambing season
Schmallenberg virus was first detected in the UK earlier this year in the south and east of England
&#147;We've seen quite rapid geographic spread,&#148; the government's Chief Veterinary Officer
&#147;That means a lot of herds and flocks will have been exposed to the disease
The likelihood is that many of them won't show disease because they weren't infected at the right time to show disease
&#148;Some will - in those herds and flocks we expect an impact of 2-5% of their lambs and calves.&#147;
Schmallenberg causes severe deformities in lambs and calves born to infected mothers
Cases have been documented on 976 farms in England and Wales
officials believe the true number of cases is higher
The first sign is often when livestock give birth to deformed or dead young - which can be months after the infection has occurred
the number of infected flocks and herds is likely to be &#148;very high&#147;
head of endemic food-borne zoo-noses at the Animal Health Veterinary Laboratories Agencies
said farmers should be vigilant for signs of infection
particularly when livestock are giving birth
&#148;The infection has been transmitted through the whole of England and Wales
The new emerging livestock disease was identified late last year
It is believed the virus was carried to England by midges blown across the Channel and was then spread by native midges during the summer
Evidence from Europe suggests that around 6% of infected sheep flocks (and 4% of infected cattle herds) will suffer symptoms from the disease
which is only dangerous when it is passed to the unborn lamb or calf
Flocks that are infected should expect to lose between 2% and 5% of lambs
I have no idea what this has to do with Latin America
but it does and as a farmer I am worried that it will spread here
The Europeans are very strict about animal health standards in South America but are very sloppy about controlling thier own research stations
This latest disease &#147;escaped&#148; from a research station in Germany
The last outbreak of foot and mouth disease in UK emanated from a research laboratory in Kent
Not to mention the feeding of sheeps brains infected with scrapie to cattle which created BSE and its related human diseases which killed a number of people
Well out here we dont allow those sloppy practices to kill people
Commenting for this story is now closed.If you have a Facebook account, become a fan and comment on our <a href="http://www.facebook.com/pages/MercoPress-South-Atlantic-News-Agency/139220750082">Facebook Page</a>
2012 4:32 PMFast-Spreading Animal Virus Leaps Europe
UK BordersA newly identified disease dubbed the Schmallenberg virus is moving rapidly through livestock in Europe
and it has authorities both worried and puzzled
Superbug blogger Maryn McKenna reports.Save this storySaveSave this storySaveA newly identified disease is moving rapidly through livestock in Europe and has authorities both worried and puzzled
dubbed Schmallenberg virus for a town in west-central Germany where one of the first outbreaks occurred
kids and calves to be born dead or deformed
The new virus belongs to the Bunyaviridae family
Genetic characterisation has shown that the new virus is closest to the following Simbu serogroup viruses: Shamonda-
which do not cause disease in humans.However
at least 30 orthobunyaviruses are zoonotic and may cause disease in humans
with symptoms ranging from mild to severe -- e.g
Schmallenberg outbreaks in Germany as of Feb
6.The insect vector is also believed to be how the disease got to the UK
The seven counties where it has been found so far -- Norfolk
West Sussex and Hertfordshire -- are all in the southeast
They are the first places in the UK to catch winds from the Continent
and therefore the first where anything carried by the wind
The <a data-offer-url="http://www.promedmail.org/direct.php?id=20120207.1035481" class="external-link" data-event-click="{&quot;element&quot;:&quot;ExternalLink&quot;,&quot;outgoingURL&quot;:&quot;http://www.promedmail.org/direct.php?id=20120207.1035481&quot;}" href="http://www.promedmail.org/direct.php?id=20120207.1035481" rel="nofollow noopener" target="_blank">international disease-warning mailing list ProMED</a> has collected links to all the maps of outbreaks published so far:
And the CDC journal Emerging Infectious Diseases has just posted ahead of print the <a href="http://wwwnc.cdc.gov/eid/ahead-of-print/article/18/3/11-1905_article.htm">first paper on the new disease</a>
Meanwhile, the British Veterinary Record seizes on the outbreaks to make a larger point: Finding new diseases such as Schmallenberg <a href="http://veterinaryrecord.bmj.com/content/170/5/110.full">depends on having good disease surveillance</a> -- but in the UK
It is precisely this kind of emerging disease threat that scanning surveillance aims to detect – and it is also this kind of disease threat that might not be detected promptly if
arrangements for surveillance fall short of the mark..
Schmallenberg virus is not the first new disease to be detected by scanning surveillance
It was scanning surveillance that identified the emergence of BSE in the late 1980s and
the early detection of pandemic H1N1 influenza in pigs
antimicrobial resistance in Salmonella and virulent psoroptic mange in cattle
The AHVLA has noted that the value of its surveillance programme has greatly exceeded the cost in recent years
with monetised benefits having been estimated at over £200 million a year
(Hat tip to constant reader Pat Gardiner.)
It is the essential source of information and ideas that make sense of a world in constant transformation
The WIRED conversation illuminates how technology is changing every aspect of our lives—from culture to business
The breakthroughs and innovations that we uncover lead to new ways of thinking
I wrote about maintaining enthusiasm for farming
I have been criticised for being negative and praised for straight-talking
We got away with it in the February lambers
but have been badly hit by the virus in the late-March group
A new symptom of the virus seems to be floppy
non-viable lambs that aren’t deformed but cannot get going
See also: <a href="https://www.fwi.co.uk/livestock/health-welfare/schmallenberg-outbreak-hits-early-lambing-flocks">Schmallenberg outbreak hits early lambing flocks</a>
An inability to regulate body temperature is one of the first signs
We’ve had lambs that have got going but then go floppy and can’t bear their own weight
This has been extremely tiring and demoralising
and it looks like it’s killing about 11% – and that’s before all the other losses from stillbirths and E coli
Wet conditions forced us to house everything for two weeks
It’s been nice to have the option of sheds
We have good grass cover on the rented ground
The lambing students from Nottingham were good and understood lamb mal-presentation very quickly
including a couple of caesareans in the Texels
which was very fortunate given how many had died over the winter
but the Baltimore Bridge collision will result in container ships being in the wrong place for at least eight weeks
The trip around Africa is extremely expensive
and of course the nightmare weather will peg the lamb crop down
A strong hogg price will probably mean people cash in sheep on the trade
On with the next job: bull preparations for the spring sale
We have two great Charolais easy-calving bulls and two muscly Simmentals