Metrics details Although liquid biopsy has garnered increasing attention in recent years for diagnosing hepatocellular carcinoma (HCC) serum biomarkers continue to hold significant value for HCC diagnosis due to their simple operation This study aimed to screen for the optimal diagnostic combinations of alpha fetoprotein (AFP) a protein induced by vitamin K deficiency or antagonist II (PIVKA-II) and routine clinical indicators for diagnosing hepatitis B-associated HCC (HBV-HCC) A retrospective analysis was conducted on 358 HBV-HCC patients treated at Taizhou People’s Hospital from August 2015 to October 2021; 124 patients with chronic hepatitis B (CHB) and 241 patients with hepatitis B cirrhosis composed the control group the concordance between the screened indicators and liver pathology for HCC diagnosis was analyzed by Cohen’s kappa coefficient and the triple biomarker combination achieved the highest AUC (0.908) for HCC diagnosis surpassing the efficacy of both individual indicators and two biomarker combinations In both the Child‒Pugh A and Child‒Pugh B&C cirrhosis groups AFP and PIVKA-II were significantly different between patients with and without HCC and the AUC values of AFP combined with PIVKA-II for HCC diagnosis were 0.969 and 0.956 Using liver pathology as the gold standard the Kappa values of the above combinations in the three groups were 0.866 and GP73 in the CHB group and the combination of AFP and PIVKA-II in both the Child‒Pugh A and Child‒Pugh B&C cirrhosis groups had excellent diagnostic accuracy for HCC and were superior to the diagnostic ability of individual biomarkers the current complexity of liquid biopsy and its high detection costs hinder its routine clinical implementation which renders it inaccessible to most primary hospitals The screening of routine clinical indicators and the exploration of different diagnostic strategies for liver cancer are other directions The purpose of this study was to identify and screen for the most effective diagnostic combinations of AFP and routine clinical indicators in patients with HBV-HCC 403 out of 723 enrolled patients received antiviral treatment Among those who received antiviral treatment while the remaining patients were treated with nucleoside analogs or a combination of antiviral therapies Patients who had not received antiviral treatment at baseline were given antiviral treatment after completing relevant examinations and meeting the criteria for antiviral therapy This study was approved by the ethics committee of Taizhou People’s Hospital (ky2021-081-01) the data was the routine examinations of patients and the patient’s privacy was not involved imaging examinations (dynamic contrast-enhanced computed tomography (CT) or magnetic resonance imaging (MRI)) Examination of the specimen: A blood cell analyzer was used for complete blood count and an Abbott i2000SR automated chemiluminescent immunoassay analyzer was used to detect AFP and PIVKA-II and GP73 was measured using the up-converting phosphor technology immunoassay analyzer UPT-3 A produced by Beijing Hotgen Biotech Co. along with the corresponding quantitative detection kit Liver function and kidney function were tested by an Olympus 5421 automatic biochemical analyzer HBV markers were detected by a Roche Elecsys electrochemiluminescence automatic immune analyzer HBV DNA was quantified by a Roche Cobas TaqMan 48 virus quantification system and the lower limit of quantification was 1.3 lg IU/ml (20 IU/ml) The pathological data were obtained from multiple sources they involve puncture biopsies of liver nodules which cannot rule out the presence of HCC and do not exhibit the characteristic imaging features of HCC with the aim of obtaining a definitive pathological diagnosis pathological data of resected liver cancer specimens were collected liver biopsy evaluations were conducted to assess inflammation and fibrosis in HBV-infected patients as well as in those with liver disease who were serum HBsAg-negative and HBcAb-positive Liver biopsy was performed under the guidance of ultrasound utilizing a TSK 16G liver biopsy needle to procure liver nodule(s) Informed consent and signatures were obtained from the patients before the procedure The seven-point baseline sampling method was used for the resected specimens The pathological specimens were evaluated by an intermediate and a senior pathologist initially examined by the intermediate pathologist and subsequently reviewed by the senior pathologist the researcher and pathologist jointly deliberated and reached a consensus based on the criteria The validation cohort consisted of 382 patients with liver pathology data The number of males and female was 307 and 75 These patients were categorized into the CHB group (55 patients with HCC and 50 without) the Child‒Pugh A hepatitis B cirrhosis group (56 patients with HCC and 91 without) and the Child‒Pugh B&C hepatitis B cirrhosis group (60 patients with HCC and 70 without) there were 191 patients with CNLC stages Ia or Ib Approximately 70% of patients belong to the early to middle stage of HCC SPSS 26.0 statistical software was used for data analysis and processing and P < 0.05 indicated that the results were significantly different The chi-square test was used to analyze the level of concordance between patients with and without HCC in each group and the Kolmogorov‒Smirnov test was used to assess the normality of the measurement data The measurement data in this study exhibited a non‒normal distribution; thus the median and quartiles were used to describe the non‒normally distributed data The constituent ratio was used to describe the count variable The Mann‒Whitney U test was used to compare the measurement data of patients with and without HCC within each group The Pearson chi-square test was used to analyze the differences in classification data across groups After identifying indicators with statistically significant results from the univariate analysis a collinearity analysis was carried out and combined with references to exclude the mutual influence of individual variables These refined variables were subsequently included in a multivariate analysis Binary logistic regression was used to analyze the relationships between the levels of pertinent indicators and clinical variables in patients with HCC The receiver operating characteristic (ROC) curve was generated for diagnostic combinations of multiple indicators and the area under the curve (AUC) was calculated the consistency between the screened indicators and liver pathology for HCC diagnosis was analyzed with Cohen’s kappa collinearity analysis was conducted for the indicators of each group separately Collinearity analysis revealed that the variance inflation factor (VIF) of WBC and NEUT exceeded 10 in the Child-Pugh A cirrhosis group Considering that WBC counts included the NEUT WBC counts were excluded from the analysis and MONO counts were included in the multivariate analysis AUC-ROC of each indicator for HCC diagnosis in the CHB group. AUC-ROC of each indicator for HCC diagnosis in the Child‒Pugh class A cirrhosis group. AUC-ROC of each indicator for HCC diagnosis in the Child‒Pugh B&C cirrhosis group the detection of serum biomarkers remains a preferred method for rapid clinical decision-making in primary hospitals due to its advantages of simple operation This study compared the clinical routine indicators of HBV-HCC patients with different disease stages identified those with significant diagnostic value for HBV-HCC and subsequently evaluated their individual and combined effectiveness in diagnosing HBV-HCC This may also be the reason why this study did not observe differences in the levels of peripheral blood immune cells between HCC patients and non-HCC patients in the Child‒Pugh B&C cirrhosis group utilizing liver pathology as the gold standard the kappa values for the combined use of AFP and GP73 for HCC diagnosis exceeded 0.75 in each group indicating good consistency with the diagnostic efficacy of liver pathology the accuracy of GP73 in diagnosing HCC in patients with cirrhosis may be affected the multivariate analysis of GP73 did not show statistical significance between HCC and non-HCC patients in the cirrhosis group; additionally the kappa value was slightly lower in the cirrhosis group (combination of AFP and PIVKA-II) compared to the CHB group (combination of AFP consequently resulting in a lack of research on the early diagnosis of HCC and GP73 for diagnosing HBV-HCC without cirrhosis as well as combining AFP and PIVKA-II for diagnosing HBV-HCC with cirrhosis is consistent with that of liver pathology surpassing the accuracy of individual biomarkers the combination of multiple serum biomarkers exhibits greater clinical significance in guiding HCC clinical decision-making than a single biomarker The data supporting the results of the manuscript can be obtained from the corresponding author Zhou, M. et al. Mortality, morbidity, and risk factors in China and its provinces, 1990–2017: a systematic analysis for the global burden of disease study 2017. Lancet 394, 1145–1158. https://doi.org/10.1016/s0140-6736(19)30427-1 (2019) Zheng, R. S. et al. Cancer statistics in China, 2016. Zhonghua Zhong Liu Za Zhi. 45, 212–220. https://doi.org/10.3760/cma.j.cn112152-20220922-00647 (2023) Bray, F. et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 74, 229–263. https://doi.org/10.3322/caac.21834 (2024) Wang, M. et al. Contribution of hepatitis B virus and hepatitis C virus to liver cancer in China North areas: experience of the Chinese National Cancer center. Int. J. Infect. Dis. 65, 15–21. https://doi.org/10.1016/j.ijid.2017.09.003 (2017) Tzartzeva, K. et al. Surveillance imaging and alpha Fetoprotein for early detection of hepatocellular carcinoma in patients with cirrhosis: a meta-analysis. Gastroenterology 154, 1706–1718e1701. https://doi.org/10.1053/j.gastro.2018.01.064 (2018) Liebman, H. A. et al. Des-gamma-carboxy (abnormal) prothrombin as a serum marker of primary hepatocellular carcinoma. N Engl. J. Med. 310, 1427–1431. https://doi.org/10.1056/nejm198405313102204 (1984) Chen, Y. et al. Comparison of diagnostic performance of AFP, DCP and two diagnostic models in hepatocellular carcinoma: a retrospective study. Ann. Hepatol. 28, 101099. https://doi.org/10.1016/j.aohep.2023.101099 (2023) Ji, J. et al. Diagnostic evaluation of Des-Gamma-Carboxy prothrombin versus α-Fetoprotein for hepatitis B Virus-Related hepatocellular carcinoma in China: a large-scale, multicentre study. PLoS One. 11, e0153227. https://doi.org/10.1371/journal.pone.0153227 (2016) Kladney, R. D. et al. GP73, a novel Golgi-localized protein upregulated by viral infection. Gene 249, 53–65. https://doi.org/10.1016/s0378-1119(00)00136-0 (2000) Liu, L. et al. Hepatitis B virus promotes hepatocellular carcinoma development by activating GP73 to repress the innate immune response. Infect. Agent Cancer. 17, 52. https://doi.org/10.1186/s13027-022-00462-y (2022) Zhang, X. et al. Whether the golgi protein 73 could be a diagnostic serological marker in hepatocellular carcinoma: a meta analysis. BMC Gastroenterol. 23, 85. https://doi.org/10.1186/s12876-023-02685-8 (2023) Best, J. et al. GALAD score detects early hepatocellular carcinoma in an international cohort of patients with nonalcoholic steatohepatitis. Clin. Gastroenterol. Hepatol. 18, 728–735e724. https://doi.org/10.1016/j.cgh.2019.11.012 (2020) Lapitz, A. et al. Liquid biopsy-based protein biomarkers for risk prediction, early diagnosis, and prognostication of cholangiocarcinoma. J. Hepatol. 79, 93–108. https://doi.org/10.1016/j.jhep.2023.02.027 (2023) Xing, S. et al. Cell-free RNA for the liquid biopsy of Gastrointestinal cancer. Wiley Interdiscip Rev. RNA. 14, e1791. https://doi.org/10.1002/wrna.1791 (2023) Ye, Q., Ling, S., Zheng, S. & Xu, X. Liquid biopsy in hepatocellular carcinoma: circulating tumor cells and circulating tumor DNA. Mol. Cancer. 18, 114. https://doi.org/10.1186/s12943-019-1043-x (2019) Baca, S. C. et al. Liquid biopsy epigenomic profiling for cancer subtyping. Nat. Med. 29, 2737–2741. https://doi.org/10.1038/s41591-023-02605-z (2023) You, H. et al. Guidelines for the prevention and treatment of chronic hepatitis B (version 2022). J. Clin. Transl Hepatol. 11, 1425–1442. https://doi.org/10.14218/jcth.2023.00320 (2023) Zhou, J. et al. Guidelines for the diagnosis and treatment of primary liver Cancer (2022 Edition). Liver Cancer. 12, 405–444. https://doi.org/10.1159/000530495 (2023) Lin, J. et al. Epidemiological characteristics of primary liver Cancer in Mainland China from 2003 to 2020: a representative multicenter study. Front. Oncol. 12, 906778. https://doi.org/10.3389/fonc.2022.906778 (2022) Yang, J. D. et al. A global view of hepatocellular carcinoma: trends, risk, prevention and management. Nat. Rev. Gastroenterol. Hepatol. 16, 589–604. https://doi.org/10.1038/s41575-019-0186-y (2019) Li, J. et al. Low frequency of peripheral lymphocyte in chronic hepatitis B patients predicts poor progression to hepatocellular carcinoma. J. Clin. Lab. Anal. 30, 208–215. https://doi.org/10.1002/jcla.21838 (2016) Margetts, J. et al. Neutrophils: driving progression and poor prognosis in hepatocellular carcinoma? Br. J. Cancer. 118, 248–257. https://doi.org/10.1038/bjc.2017.386 (2018) Li, X. et al. The immunological and metabolic landscape in primary and metastatic liver cancer. Nat. Rev. Cancer. 21, 541–557. https://doi.org/10.1038/s41568-021-00383-9 (2021) Schoenberg, M. B. et al. The predictive value of tumor infiltrating leukocytes in hepatocellular carcinoma: a systematic review and meta-analysis. Eur. J. Surg. Oncol. 47, 2561–2570. https://doi.org/10.1016/j.ejso.2021.04.042 (2021) Kuang, D. M. et al. Peritumoral neutrophils link inflammatory response to disease progression by fostering angiogenesis in hepatocellular carcinoma. J. Hepatol. 54, 948–955. https://doi.org/10.1016/j.jhep.2010.08.041 (2011) Zhan, X. et al. Elevated neutrophil extracellular traps by HBV-mediated S100A9-TLR4/RAGE-ROS cascade facilitate the growth and metastasis of hepatocellular carcinoma. Cancer Commun. (Lond). 43, 225–245. https://doi.org/10.1002/cac2.12388 (2023) O’Keefe, S. J., El-Zayadi, A. R., Carraher, T. E., Davis, M. & Williams, R. Malnutrition and immuno-incompetence in patients with liver disease. Lancet 2, 615–617. https://doi.org/10.1016/s0140-6736(80)90284-6 (1980) Weiss, E. et al. Characterization of blood immune cells in patients with decompensated cirrhosis including ACLF. Front. Immunol. 11, 619039. https://doi.org/10.3389/fimmu.2020.619039 (2020) Loglio, A. et al. The combination of PIVKA-II and AFP improves the detection accuracy for HCC in HBV Caucasian cirrhotics on long-term oral therapy. Liver Int. 40, 1987–1996. https://doi.org/10.1111/liv.14475 (2020) Dai, M. et al. Diagnostic value of the combination of golgi protein 73 and Alpha-Fetoprotein in hepatocellular carcinoma: a meta-analysis. PLoS One. 10, e0140067. https://doi.org/10.1371/journal.pone.0140067 (2015) AR, N. Z. et al. The possible role of Dickkopf-1, golgi protein- 73 and midkine as predictors of hepatocarcinogenesis: a review and an Egyptian study. Sci. Rep. 10, 5156. https://doi.org/10.1038/s41598-020-62051-6 (2020) He, L. et al. Development of a diagnostic nomogram for alpha-fetoprotein-negative hepatocellular carcinoma based on serological biomarkers. World J. Gastrointest. Oncol. 16, 2463–2475. https://doi.org/10.4251/wjgo.v16.i6.2463 (2024) Zhang, J. et al. A meta-analysis of the prognostic significance of golgi protein 73 in hepatocellular carcinoma in Chinese patients. Arch. Med. Sci. 16, 1104–1110. https://doi.org/10.5114/aoms.2019.83821 (2020) Gatselis, N. K. et al. Serum cartilage oligomeric matrix protein and golgi protein-73: new diagnostic and predictive tools for liver fibrosis and hepatocellular cancer? Cancers (Basel). 13. https://doi.org/10.3390/cancers13143510 (2021) Peng, S. et al. Diagnostic value of serum golgi protein 73 for liver fibrosis: a systematic review and meta-analysis. Dig. Dis. 41, 622–631. https://doi.org/10.1159/000529815 (2023) Gatselis, N. K. et al. Golgi protein-73: a biomarker for assessing cirrhosis and prognosis of liver disease patients. World J. Gastroenterol. 26, 5130–5145. https://doi.org/10.3748/wjg.v26.i34.5130 (2020) Hui-Ling, C. et al. The potential value of serum GP73 in the ancillary diagnosis and grading of liver cirrhosis. Scand. J. Clin. Lab. Invest. 83, 95–102. https://doi.org/10.1080/00365513.2023.2175238 (2023) Zhou, J. M., Wang, T. & Zhang, K. H. AFP-L3 for the diagnosis of early hepatocellular carcinoma: a meta-analysis. Med. (Baltim). 100, e27673. https://doi.org/10.1097/md.0000000000027673 (2021) Download references This manuscript was supported by Taizhou People’s Hospital Scientifc Research Fund Project (QDJJ202108) These authors contributed equally: Hu Rui and Ni Yueqin The Affiliated Taizhou People’s Hospital of Nanjing Medical University The authors declare no competing interests Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations Download citation DOI: https://doi.org/10.1038/s41598-025-92067-9 Anyone you share the following link with will be able to read this content: a shareable link is not currently available for this article Sign up for the Nature Briefing newsletter — what matters in science Early detection of hepatocellular carcinoma (HCC) is crucial for improving survival in patients with chronic hepatitis The GALAD algorithm combines gender (biological sex) α-fetoprotein (AFP), Lens culinaris agglutinin-reactive fraction of AFP (AFP-L3) and protein induced by vitamin K absence or antagonist-II (PIVKA-II) for HCC detection the GAAD algorithm incorporates gender (biological sex) This study aimed to assess the clinical utility of AFP-L3 in the GALAD algorithm and its potential synergies with ultrasound We compared the clinical performance of GALAD with GAAD; AFP; AFP-L3; and PIVKA-II A total of 439 serum samples were analyzed using a Cobas® e 601 analyzer (healthy controls Performance was assessed through receiver operating characteristic curve analyses to calculate the area under the curve The area under the curve for differentiating early-stage HCC from patients with chronic liver disease was optimal for PIVKA-II (84.9%) with slightly improved performance for detecting all-stage HCC Clinical performance was unaffected by disease stage or etiology Sensitivity for early-stage HCC was highest for GAAD (57.6%) and GALAD (57.6%) Sensitivity for each strategy was further enhanced when combined with ultrasound regardless of disease stage or etiology (P < 0.01) These findings indicate that the role of AFP-L3 in the GALAD algorithm is minimal supporting the use of GAAD for HCC detection or PIVKA-II with ultrasound may improve diagnostic efficiency compared with recommended strategies Xia & He Publishing Inc. Huang, C.-F., et al. (2024). Surveillance Imaging and GAAD/GALAD Scores for Detection of Hepatocellular Carcinoma in Patients with Chronic Hepatitis. Journal of Clinical and Translational Hepatology. doi.org/10.14218/jcth.2024.00172 Posted in: Medical Science News | Medical Research News | Medical Condition News Cancel reply to comment Learn how experts are advancing benzodiazepine analysis and detection using insights from the lab discusses how he is addressing today’s medical challenges using the technology of the future Explore how the Radian ASAP mass spectrometer is being used to streamline and enhance seized drug screening you can trust me to find commercial scientific answers from News-Medical.net please log into your AZoProfile account first Registered members can chat with Azthena, request quotations, download pdf's, brochures and subscribe to our related newsletter content A few things you need to know before we start Read the full Terms & Conditions. Volume 9 - 2021 | https://doi.org/10.3389/fpubh.2021.784718 This article is part of the Research TopicDiagnosis, Treatment and Prognosis of Viral HepatitisView all 21 articles Increased protein induced by vitamin K absence or antagonist-II (PIVKA-II) levels had been widely reported in patients with hepatocellular carcinoma (HCC) and chronic hepatitis the role of PIVKA-II in hepatitis E is unclear The aim of this study was to clarify the changes related with PIVKA-II and its clinical significance in hepatitis E We enrolled 84 patients with hepatitis E hospitalized in two hospitals from December 2019 to June 2021 The levels of serum PIVKA-II and related serological indicators in the patients were determined to elucidate the role of PIVKA-II in hepatitis E We observed that 59.51% (50/84) of patients showed an increase in PIVKA-II levels Compared with the normal PIVKA-II group (<32 mAU/L) patients in the elevated PIVKA-II group (>32 mAU/L) had much higher serum total bilirubin (TBIL) and total bile acid (TBA) levels (p < 0.05 for each) Compared with the slightly elevated PIVKA-II group (32–125 mAU/L) patients in the significantly elevated PIVKA-II group (>125 mAU/L) had much lower serum albumin and longer days for the hospital stay (p < 0.05 for each) The association of PIVKA-II with TBIL and DBIL was an inverted U-shaped curve with an inflection point at 199.1 mAU/L) The association of PIVKA-II with IBIL was a U-shaped curve with an inflection point at 18.6 mAU/L while the association of PIVKA-II with albumin was an inverted U-shaped curve with an inflection point at 18.6 mAU/L PIVKA-II levels were gradually decreased and finally returned to normal This trend was consistent with that of bilirubin findings from our study show that the increase in PIVKA-II levels can be related to the degree of hepatic insufficiency in patients with hepatitis E wherein PIVKA-II levels are transiently increased and the trend of change can be related to the disease course Hepatitis E is an acute self-limiting disease caused by the hepatitis E virus (HEV) and is mainly transmitted through the fecal-oral route (1). According to statistics from the WHO, approximately 20 million people worldwide are infected with HEV each year, with more than 3 million cases of acute hepatitis E and 70,000 patient deaths (2) hepatitis E has become one of the most important public health problems worldwide We speculated that there might also be an increase of PIVKA-II in acute hepatitis and the increase might be related to the degree of liver damage the role of PIVKA-II in hepatitis E is still unclear we aimed to explore the relationship between PIVKA-II levels and HEV infection in this study to obtain a better understanding of the role of PIVKA-II in hepatitis E or the presence of alcoholic fatty liver disease; (4) drug-induced liver disease; (5) autoimmune liver disease; (6) liver cancer and/or female pregnancy; (7) co-infection with cytomegalovirus or Epstein–Barr virus; (8) presence of metabolic associated fatty liver disease; (9) approval for liver transplantation; and (10) incomplete data Studies involving human participants were reviewed and approved by the ethics committee of the First Affiliated Hospital of Wenzhou Medical University and Taizhou Hospital of Zhejiang Province (approval number: no Due to the retrospective study design involving electronic health records and no additional interventions written informed consent was waived from the patients or their relatives Serum levels of PIVKA-II were detected using an Abbott I 1000 automatic immunoassay analyzer Peripheral blood was obtained from each patient The serum was obtained by centrifuging for 5 min at 3,000 rpm and stored at −80°C until testing All the operational processes regarding the measurement of PIVKA-II were blind to measurers Detection of HEV IgM via ELISA was performed by Shanghai Kehua Biological Engineering Co. and albumin levels were analyzed using a Beckman AU5800 automatic biochemical detector The prothrombin time (PT) was analyzed using the Stago R Max and the standard operating procedure was strictly followed during the test All statistical analyses were performed using SPSS version 26.0, EmpowerStats (http://www. empowerstats.com), and package R (http://www.Rproject.org) the data were displayed as median (minimum–maximum) or as the actual value of the classification data Baseline features were summarized using descriptive statistics Groups were compared using chi-square tests for categorical variables Mann-Whitney U tests were used for continuous variables for comparing two independent groups A p < 0.05 was considered to be statistically different The flow chart for screening the patients with hepatitis E is shown in Figure 1. A total of 84 patients with hepatitis E aged 25–77 years were included in our study, with the baseline characteristics according to normal PIVKA-II or elevated PIVKA-II are presented in Table 1 and Figure 2 Since the range of reference value for PIVKA-II is 11–32 mAU/L we adopted 32 mAU/L as the cut-off value to divide the 84 patients into the normal group (n = 34) with PIVKA-II ≤ 32 mAU/L and elevated group (n = 50) with PIVKA-II >32 mAU/L The median level of PIVKA-II in normal group was 24.6 mAU/L range from 10.6 to 31.4 mAU/L while their counterpart in the elevated group was much higher as 53.8 mAU/L with significant statistical differences (p < 0.001) patients in the elevated PIVKA-II group had much higher serum TBIL and TBA levels (p < 0.05 for each) There were no significant differences in the distribution of age and gender between the two groups no significant differences were found in levels of albumin Screening flow chart for patients with hepatitis E metabolic associated fatty liver disease; CMV Baseline characteristics of patients with hepatitis E Levels of clinical biochemical indexes in different groups of serum PIVKA-II levels protein induced by vitamin K absence or antagonist-II Association between clinical biochemical indexes and degree of elevated PIVKA-II During hospitalization, the serological indicators and PIVKA-II levels of the patients were monitored. As the disease gradually improved, the trend in the PIVKA-II and TB levels was similar; that is, both had peaks that appeared in the third week, which was 2 weeks later than that of transaminase. The peak of AFP appeared was 1 week later than that of PIVKA-II in the fourth week is shown in Table 3 Changes in PIVKA-II and clinical biochemical indicators during hospitalization The scatter diagram and smooth curve fittings used to characterize the non-linear relationship between PIVKA-II with TBIL, DBIL, IBIL, and albumin levels are shown in Figures 3, 4 PIVKA-II is positively correlated with total bilirubin (r = 0.563 positively correlated with direct bilirubin (r = 0.556 positively correlated with indirect bilirubin (r = 0.357 and negatively correlated with albumin (r = −0.264 Scatter diagram for the correlation between PIVKA-II and bilirubin and albumin The correlation between PIVKA-II and bilirubin and albumin The solid red line represents the smooth curve fit between variables Blue bands represent the 95% CI from the fit The association between PIVKA-II with TBIL and DBIL was an inverted U-shaped curve, with the point of inflection identified using a two piecewise linear regression model, at 199.1 mAU/ml (Table 4) every 1 mAU/ml increase in PIVKA-II was associated with a 1.6 μmol/L greater TBIL (95% CI: 1.1–2.0); by comparison for individuals with a PIVKA-II >199.1 mAU/ml a 1 mAU/ml increase in PIVKA-II was associated with a 0.7 μmol/L decrease in TBIL (95% CI: −1.1 to −0.2) every 1 mAU/ml increase in PIVKA-II was associated with a 1.4 μmol/L greater DBIL (95% CI: 1.0–1.8); by comparison a 1 mAU/ml increase in PIVKA-II was associated with a 0.6 μmol/L decrease in DBIL (95% CI: −1.0 to −0.3) Threshold effect analysis of PIVKA-II on TBIL and albumin using the two-piecewise linear regression model every 1 mAU/ml increase in PIVKA-II was associated with a 1.1 μmol/L greater albumin (95% CI: 0.2–2.0) these patients had a median value of 53 years old ranged from 25 to 77 There were no significant differences in age distribution between the normal PIVKA-II group and the elevated PIVKA-II group Pregnant patients were not included in our study and none of the 84 patients progressed to acute liver failure during hospitalization we included 84 cases of patients with hepatitis E and measured the levels of the PIVKA-II and various serological indicators and monitored the indicators during hospitalization The PIVKA-II levels increased in 59.51% (50/84) of patients with hepatitis E four cases had PIVKA-II levels >1,000 mAU/ml We classified the degree of increase in the PIVKA-II levels into two groups Compared with the slightly elevated PIVKA-II group patients in the significantly elevated PIVKA-II group had much lower serum albumin An elevated PIVKA-II correlated with a greater TBIL we identified a non-linear relationship between PIVKA-II with TBIL and DBIL with a point of inflection at 199.1 mAU/ml and a non-linear relationship between PIVKA-II with IBIL and albumin with a point of inflection at 18.6 mAU/ml These results indicated that PIVKA-II levels might be related with the severity of hepatitis E An increase in prothrombin levels also leads to the production of abnormal prothrombin (18) we believe that PIVKA-II may be associated with the severity of acute liver damage the underlying mechanism behind the effect of HEV infection on serum PIVKA-II levels remains unclear We believe that this may be related to liver cell damage and metabolic disorders in patients with hepatitis E which decreased the ability of liver cells to synthesize protein and may weaken the function of vitamin K-dependent shuttling enzymes causing the metabolic utilization of vitamin K elevated PIVKA-II levels in hepatitis E may also be related with Vitamin K absence the relationship between serum vitamin K concentration and serum PIVKA-II levels was not explored in our current study because data on serum vitamin K levels are unavailable no related pieces of literature were previously published about the relationship between Vitamin K absence and HEV infection whether Vitamin K absence existed in patients with HEV infection was still unclear and the effect of HEV infection on serum PIVKA-II levels needs to be clarified in future research With the gradual recovery of patients with hepatitis E, PIVKA-II levels also gradually decreased, and the peak was delayed by 2 weeks compared with the peak of transaminase, which was roughly similar to that of bilirubin. The peak of AFP was 1 week later than that of PIVKA-II. Many studies believe that AFP exists in the cytoplasm of oval cells or hyperproliferative cells (22, 23) which indicates the proliferation of liver cells after injury and the new liver cells may synthesize AFP briefly in the early stage We believe that PIVKA-II is related to liver cell damage so there may be a certain node in the abnormal metabolism and hyperplasia of liver cell necrosis which is a turning point in the disease of the patients with hepatitis E we did not have enough cases in this study and the sample size needs to be further expanded it could be seen that more than half of patients with hepatitis E had elevated PIVKA-II levels and the patients gradually recovered after a few weeks With the recovery of patients from hepatitis E PIVKA-II could be a significant reference for the course of hepatitis E disease we can refer to the PIVKA-II level of patients with hepatitis E to assess the severity of the patient's condition and the trend of the outcome to assist in the diagnosis and treatment of the disease further If the patient's PIVKA-II continues to rise and the possibility of HCC should be ruled out The association between PIVKA-II with TBIL and albumin was a U-shaped or inverted U-shaped curve with an obvious point of inflection The data collection time was relatively short The study population was recruited from only two centers We need to conduct more cases and perform long-term follow-up evaluations we excluded individuals with HCC from our study sample as HCC may have a significant influence on PIVKA-II there remains the possibility of bias caused by other potential confounding factors that we did not adjust for The research involves patient private information the data that support the findings of this study are available from the corresponding author upon reasonable request The studies involving human participants were reviewed and approved by the Ethics Committee of the First Affiliated Hospital of Wenzhou Medical University and Taizhou Hospital of Zhejiang Province (approval number: No and MLu contributed to the conception and design of the study YC wrote the first draft of the manuscript All the authors contributed to manuscript revision The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher Calcineurin inhibitors stimulate and mycophenolic acid inhibits replication of hepatitis E virus Hepatitis E virus: advances and challenges Asia-Pacific clinical practice guidelines on the management of hepatocellular carcinoma: a 2017 update PIVKA-II as a potential new biomarker for hepatocellular carcinoma - a pilot study and lectin-bound alpha-fetoprotein in early hepatocellular carcinoma The influence of alcoholic liver disease on serum PIVKA-II levels in patients without hepatocellular carcinoma Altered faecal microbiota on the expression of Th cells responses in the exacerbation of patients with hepatitis E infection Des-gamma carboxyprothrombin can differentiate hepatocellular carcinoma from nonmalignant chronic liver disease in american patients Hepatitis E should be a global public health priority: recommendations for improving surveillance and prevention 2008-2018: a new analysis method for the disease's occupational characteristics Genetic diversity of avian hepatitis E virus in China Laboratory-based surveillance and clinical profile of sporadic hev infection in Shanghai 12250-020-00336-w doi: 10.1007/s12250-020-00336-w Seroprevalence of hepatitis E virus infection rural southern People's Republic of China HEV-LF (S) : A novel scoring model for patients with hepatitis E virus-related liver failure Clinical features of sporadic hepatitis E virus infection in pregnant women in Shanghai Des-γ-carboxy prothrombin (DCP) as a potential autologous growth factor for the development of hepatocellular carcinoma Clinical and molecular insights into the hepatocellular carcinoma tumour marker des-γ-carboxyprothrombin Clinical Practice Guidelines for Hepatocellular Carcinoma Differ between Japan United States and Europe PubMed Abstract | CrossRef Full Text | Google Scholar Diagnostic value of serum PIVKA-II levels for BCLC early hepatocellular carcinoma and correlation with HBV DNA Abnormal prothrombin in acute hepatic failure: the characterization and clinical evaluation PubMed Abstract | Google Scholar The emerging influences of alpha-fetoprotein in the tumorigenesis and progression of hepatocellular carcinoma (2021) 13:5096 doi: 10.3390/cancers13205096 Alpha-fetoprotein and ultrasonography screening for hepatocellular carcinoma Yang N and Lu M (2022) Changes and Clinical Significance of PIVKA-II in Hepatitis E Patients Received: 28 September 2021; Accepted: 15 December 2021; Published: 25 January 2022 Copyright © 2022 Chen, Yang, Li, Lin, Xie, Shi, Jiang, Zheng, Shao, Yang and Lu. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) distribution or reproduction in other forums is permitted provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited in accordance with accepted academic practice distribution or reproduction is permitted which does not comply with these terms *Correspondence: Naibin Yang, eWFuZ25iMDFAMTYzLmNvbQ==; Mingqin Lu, bG1xMDkwNkAxNjMuY29t †These authors have contributed equally to this work and share first authorship Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher 94% of researchers rate our articles as excellent or goodLearn more about the work of our research integrity team to safeguard the quality of each article we publish The work on the use of the PIVKA-II biomarker in Cuba for the early detection of liver carcinoma was presented at the National Imaging Conference ORIENTIMAGEN 2025 held by the end of February in the city of Holguín clinical hepatologist at the Hermanos Ameijeiras Clinical Surgical Hospital also known as des-gamma carboxy prothrombin II is used to improve early diagnosis of hepatocellular carcinoma (HCC) especially in patients with liver cirrosis Although patients diagnosed with cirrhosis undergo abdominal ultrasound and alpha-fetoprotein as there are certain cases in which carcinoma is not detected unless it is found in an advanced stage Pedro Pablo González Rojas is the lead radiologist of the multidisciplinary team that conducts the PIVKA-II research for the diagnosis of hepatocellular carcinoma performed by multidetector computed tomography and high-field magnetic resonance imaging to evaluate liver lesions González Rojas added that these dynamic studies are performed on patients with chronic liver disease with a focal lesión A contrast medium is administered to establish the dynamic behavior of that lesion Based on these findings specialists can establish whether or not it is a hepatocellular carcinoma and the action to follow The also President of the Cuban Society of Imaging explained embolization is one of the most effective treatments for HCC The National Imaging Conference contributed to the development of the specialty with a comprehensive and multidisciplinary approach Metrics details Accumulating evidence has shown that tRNA-derived small RNAs (tsRNAs) play crucial roles in malignant tumor development whether serum tsRNAs can act as potential biological markers for hepatocellular carcinoma (HCC) are still largely unknown was prominently elevated in the sera of HCC patients than that of hepatitis cases and healthy check-ups and it was related with TNM stage and lymphatic metastasis of HCC patients methodological evaluation confirmed that tsRNA-Thr-5-0015 had excellent stability the combined detection of serum tsRNA-Thr-5-0015 with AFP as well as PIVKA-II improved the diagnostic sensitivity for HCC dynamic monitoring found that the serum tsRNA-Thr-5-0015 was drastically decreased in the postoperative HCC patients Kaplan–Meier analysis displayed that patients with high level of serum tsRNA-Thr-5-0015 had shorter overall survival than that of the low level ones bioinformatic prediction unveiled that the downstream targets of tsRNA-Thr-5-0015 were enriched in several signaling pathways tsRNA-Thr-5-0015 may be a promising biomarker for HCC diagnosis therapeutic effect assessment and prognosis judgement the combination with serum tsRNA-Thr-5-0015 AFP and PIVKA-II can enhance the diagnostic efficiency for HCC novel biomarkers should be explored to improve the diagnostic values and therapeutic effects for HCC these studies intensively disclosed that tsRNAs were generally involved in the occurrence and development of HCC it is still needed to investigate the diagnostic values of serum tsRNAs in HCC serum level of tsRNA-Thr-5-0015 was upregulated in HCC patients The clinical performance of serum tsRNA-Thr-5-0015 was further unlocked that it had the potential to be a new biomarker for diagnosis dynamic monitoring and prognosis judgement of HCC AFP and PIVKA-II could elevate the diagnostic efficiency for this deadly disease Screening of tsRNA in patients with HCC tsRNA-Sec-i-0080 (b) and tsRNA-Asn-5-0003 (c) (d–f) qRT-PCR was used to detect the serum level of tsRNA-Thr-5-0015 (d) tsRNA-Sec-i-0080 (e) and tsRNA-Asn-5-0003 (f) in HCC patients and healthy controls Only the expression of serum tsRNA-Thr-5-0015 was significantly upregulated in HCC (g,h) qRT-PCR analysis the expression of tsRNA-Thr-5-0015 in different HCC cell lines (g) and 20 pairs of HCC tissues and adjacent tissues The results showed significant up-regulation in four HCC cell lines and HCC tissue (h) (i) There was a positive correlation of tsRNA-Thr-5-0015 in serum and corresponding tissues of 20 HCC patients *P < 0.05; **P < 0.01; ***P < 0.001 The UCSC Genome Browser Database (https://genome-asia.ucsc.edu/) indicates that tsRNA-Thr-5-0015 is localized on chromosome 6p22.2 at coordinates 26533199 - 26533218 (Supplementary Fig. S1a). According to MINTbase v2.0 (https://cm.jefferson.edu/MINTbase/) tsRNA-Thr-5-0015 is a 5’-tRF of 20 nucleotides in length (GGCTCCGTGGCTTAGCTGGT) with the cleavage site located in the D loop it is also referred to as tRF-20-69M8NPN3 (Supplementary Fig Diagnostic and clinical applications of tsRNA-Thr-5-0015 in the serum of HCC patients (a) qRT-PCR analysis the serum level of tsRNA-Thr-5-0015 in 81 patients with HCC (b) Dynamic monitoring of serum tsRNA-Thr-5-0015 expression levels before and after surgery in 37 HCC patients (c) Difference of serum tsRNA-Thr-5-0015 level between postoperative HCC patients and healthy check-ups (d) tsRNA-Thr-5-0015 was released from tumor cells into the cell culture medium in a time-dependent manner (e) Kaplan–Meier curves analysis the relationship between serum tsRNA-Thr-5-0015 level and the overall survival of HCC patients Methodological evaluation of serum tsRNA-Thr-5-0015 (a,b) qRT-PCR analysis the expression of tsRNA-Thr-5-0015 after being treated with Room temperature placement experiments (a) and repeated freeze–thaw tests (b) and all showed no significant change in the expression (c,d) Gradient dilution experiments showed good linearity of RUN6B (U6) and tsRNA-Thr-5-0015 (e) Amplification and lysis curves of U6 and tsRNA-Thr-5-0015 displayed a significant amplification plateau period and a single-peak dissolution curve (f) Agarose electrophoresis showed a band of about 80 bp in the qRT-PCR product of tsRNA-Thr-5-0015 and the band for the internal reference U6 was roughly 90 bp (g) Sanger sequencing results confirmed that the qRT-PCR product had the complete base sequence of tsRNA-Thr-5-0015 The expression of serum tsRNA-Thr-5-0015 in different digestive system tumors qRT-PCR analysis the serum level of tsRNA-Thr-5-0015 in the patients with 35 cases of colorectal cancer (a) Showing that serum tsRNA-Thr-5-0015 was not significantly different in other digestive tumors Diagnostic values of HCC by combined serum tsRNA-Thr-5-0015 with AFP and PIVKA-II (a–c) ROC curves of the diagnostic roles of serum tsRNA-Thr-5-0015 AFP and PIVKA-II in differentiating patients with HCC from healthy check-ups serum tsRNA-Thr-5-0015 combined with AFP or PIVKA-II (b) (d–f) ROC curves of the diagnostic roles of serum tsRNA-Thr-5-0015 and PIVKA-II in differentiating patients with HCC from patients with hepatitis serum tsRNA-Thr-5-0015 combined with AFP or PIVKA-II (e) suggesting that it could greatly improved the diagnosis of HCC in the early stage Prediction of the downstream of tsRNA-Thr-5-0015 in HCC cells (a) TsRNA-Thr-5-0015 potential target genes (b) Gene ontology functional enrichment analysis of potential target genes (c) Kyoto Encyclopedia of Genes and Genomes (KEGG) biological pathway enrichment analysis of potential target genes and higher quality diagnostic biomarker for HCC these serum tsRNAs had enormous prospects in cancer diagnosis three tsRNAs were screened from the tsRFun database and qRT-PCR verified that only serum tsRNA-Thr-5-0015 was ascended in HCC patients which was closely correlated with their corresponding serum samples Our research further found that serum tsRNA-Thr-5-0015 was specifically expressed in HCC and had no difference in other digestive tumors including colorectal cancer tsRNA-Thr-5-0015 was also found to be frequently overexpressed in HCC cell lines then we speculated whether HCC cells could secrete tsRNA-Thr-5-0015 HCC-LM3 cells showed a time-dependent increase in cell culture medium suggesting that tumor cells might release tsRNA-Thr-5-0015 into the blood circulatory system by the methodological evaluation of tsRNA-Thr-5-0015 tsRNA-Thr-5-0015 could be regarded as a newly candidate HCC biomarker deserved for further investigation expanding serum samples from 81 HCC patients 60 hepatitis cases and 76 healthy check-ups the serum level of tsRNA-Thr-5-0015 in HCC patients was obviously higher than that of other two groups serum tsRNA-Thr-5-0015 was correlated with lymphatic metastasis and TNM stage indicating that it could judge the malignant degree and the progression of HCC the serum level of tsRNA-Thr-5-0015 was dropped after surgical resection unveiling its value in dynamic monitoring the therapeutic effects of HCC patients high level of serum tsRNA-Thr-5-0015 had shorter overall survival than that of low level ones suggesting that serum tsRNA-Thr-5-0015 was a great biomarker as a prognostic assessment for HCC ROC curve analysis showed that the AUC of serum tsRNA-Thr-5-0015 for differentiating HCC patients from healthy check-ups was 0.731(95% CI the sensitivity was 71.6% and the specificity was 72.4% Although the AUC was not as well as AFP and PIVKA-II its sensitivity was superior to both of them combined detection of serum tsRNA-Thr-5-0015 with AFP and PIVKA-II could improved the diagnostic sensitivity for HCC demonstrating that the combination of these three biomarkers could greatly enhance the differentiating diagnostic value of HCC patients from healthy check-ups the AUC of serum tsRNA-Thr-5-0015 for distinguishing HCC patients from hepatitis cases was 0.701 (95% CI 0.616–0.787) and the sensitivity and specificity were 71.6% and 68.3% When combined these three biomarkers together the AUC was 0.781 with a sensitivity of 88.9% suggesting its early diagnostic value for effectively distinguishing HCC patients from hepatitis cases Due to the fact that our samples can not represent other regions and the sample size is relatively small poor compliance during treatment as well as lacking lasting follow-up our current study is still in the preliminary stage for evaluation the value of serum tsRNA-Thr-5-0015 in HCC further studies should be intended to multiple centers expand sample size and long-term follow up the patients this study for the first time demonstrates the clinical values of serum tsRNA-Thr-5-0015 in HCC patients It may serve as a novel noninvasive biomarker for diagnosis PIVKA-II could greatly improve the diagnosis of HCC showing their promsing more sensitive and accurate biomarkers of this deadly disease Serum samples were collected from 359 subjects 35 patients with colorectal cancers and 76 healthy check-ups in the Affiliated Hospital of Nantong University from January 2019 to December 2021 All the patients were histopathologic examination who were not received any preoperative treatment we collected 20 sets of HCC tissues and paracancerous tissues confirmed by the Department of Pathology All samples were stored at a temperature of -80℃ This research complied with the Declaration of Helsinki clinical samples were collected after informed consent was obtained from the subjects and studies involving human subjects were reviewed and approved by the Ethics Committees of the Affiliated Hospital of Nantong University (Number: 2019-L071) Hep3B) from the Chinese Academy of Sciences (Shanghai 37℃ with DMEM or 1640 medium (Corning) containing 1% penicillin–streptomycin and10% fetal bovine serum (FBS) Serum RNA from HCC patients was extracted by centrifugal column method using Blood Total RNA Rapid Extraction Kit (Bio TeKe) Trizol reagent was used to extract total RNA from HCC tissues and cells (Invitrogen) Reverse transcription RNA into cDNA was conducted at 42 °C for 1 h and 70 °C for 5 min The 10 µL of ChamQ Universal SYBR qPCR Master Mix 5 µL of cDNA in a cumulative total 20 µL were contained in reaction system reverse primers for RUN6B (U6) and tsRNA-Thr-5-0015 Relative expression was measured by 2-ΔΔCT method with U6 as an internal reference 20 mixed serums were repeatedly picked up 0 and 7 times between -80 °C and ambient temperature to assess the expression of tsRNA-Thr-5-0015 the mixed serums were left at ambient temperature for 0 18 and 24h to assess the expression of tsRNA-Thr-5-0015 After extracting RNA from the mixed serum and reverse transcribing it into cDNA the resulting cDNA was diluted at factors of 10 Twenty serum samples were randomly mixed into 20 aliquots Ten samples from the same batch were tested and the other ten samples were tested one sample per day for ten consecutive days Levels of serum tsRNA-Thr-5-0015 and U6 were measured and coefficients of variation (CV) were calculated from intra- and inter-batch Ct values Determination of serum AFP and PIVKA-II concentrations by chemiluminescence immunoassay (ARCHITECT i2000SR analyzer Data were analyzed with SPSS 26.0 software and plotted by using Graphpad Prism 8.0 All data were initially tested for normality Differences of serum tsRNA-Thr-5-0015 were calculated by variance analysis and t test The Wilcoxon paired sign rank test was used to analyze the serum expression levels before and after HCC surgery as well as the differences between HCC tissues and adjacent tissues Relationship between tsRNA-Thr-5-0015 and clinicopathological parameters analyzed by χ2 test ROC curve evaluation of serum tsRNA-Thr-5-0015 assay for the diagnostic efficacy of HCC Construction of Kaplan–Meier survival curves to evaluate overall survival The difference was statistically significant when P < 0.05 The data that support the findings of this study are available from the corresponding author upon reasonable request From bench to bed: the tumor immune microenvironment and current immunotherapeutic strategies for hepatocellular carcinoma Loco-regional treatment of HCC: Current status Alpha-foetoprotein (AFP): A multi-purpose marker in hepatocellular carcinoma Combination of inflammatory score/liver function and AFP improves the diagnostic accuracy of HBV-related hepatocellular carcinoma PIVKA-II serves as a potential biomarker that complements AFP for the diagnosis of hepatocellular carcinoma Identification of a novel tRNA-derived RNA fragment exhibiting high prognostic potential in chronic lymphocytic leukemia tRNA-derived fragments and tRNA halves: The new players in cancers responds to hypoxia via the HIF1α/ANG axis and promotes colorectal cancer progression by regulating LATS2 Action mechanisms and research methods of tRNA-derived small RNAs Transfer RNA-derived fragment 5’tRF-Gly promotes the development of hepatocellular carcinoma by direct targeting of carcinoembryonic antigen-related cell adhesion molecule 1 Gly-tRF enhances LCSC-like properties and promotes HCC cells migration by targeting NDFIP2 5’-tiRNA-Gln inhibits hepatocellular carcinoma progression by repressing translation through the interaction with eukaryotic initiation factor 4A-I tRNA-derived small RNAs: novel regulators of cancer hallmarks and targets of clinical application tsRNAs: Novel small molecules from cell function and regulatory mechanism to therapeutic targets Transfer RNA-derived small RNA: A rising star in oncology Serum mitochondrial tsRNA serves as a novel biomarker for hepatocarcinoma diagnosis A comprehensive evaluation of serum tRF-29-R9J8909NF5JP as a novel diagnostic and prognostic biomarker for gastric cancer A novel class of tsRNA signatures as biomarkers for diagnosis and prognosis of pancreatic cancer Hepatocellular carcinoma: A narrative review on current knowledge and future prospects Clinical value of serum AFP and PIVKA-II for diagnosis treatment and prognosis of hepatocellular carcinoma The diagnostic value of serum PIVKA-II alone or in combination with AFP in Chinese hepatocellular carcinoma patients Surgical treatment of hepatocellular carcinoma Systemic therapy of advanced hepatocellular carcinoma Serum non-coding RNAs for diagnosis and stage of liver fibrosis Identification of plasma hsa_circ_0005397 and combined with serum AFP AFP-L3 as potential biomarkers for hepatocellular carcinoma Serum LncRNA-ATB and FAM83H-AS1 as diagnostic/prognostic non-invasive biomarkers for breast cancer Transfer RNA-derived small RNAs: Novel regulators and biomarkers of cancers Evaluation of serum tRF-23-Q99P9P9NDD as a potential biomarker for the clinical diagnosis of gastric cancer Comprehensive evaluation of serum tRF-17-WS7K092 as a promising biomarker for the diagnosis of gastric cancer Serum tRNA-derived small RNAs as potential novel diagnostic biomarkers for pancreatic ductal adenocarcinoma Download references This work was financially supported by the National Natural Science Foundation of China (82102480) Postdoctoral Research Funding Project of Jiangsu Province (2021K012A) Jiangsu Provincial Research Hospital (YJXYY202204-ZD06) the project of Nantong Science and Technology Bureau (No Postgraduate Research & Practice Innovation Program of Jiangsu Province (KYCX24_3583) Jinran Wu and Junling Yang contributed equally to this work Department of Clinical Laboratory Medicine Rugao Traditional Chinese Medicine Hospital Nantong Third People’s Hospital Affiliated Nantong Hospital 3 of Nantong University All authors reviewed the manuscript and approved the final version Clinical samples were collected after informed consent was obtained from the subjects Below is the link to the electronic supplementary material Download citation DOI: https://doi.org/10.1038/s41598-024-80592-y Sign up for the Nature Briefing: Cancer newsletter — what matters in cancer research Metrics details The high morbidity and mortality of hepatocellular carcinoma (HCC) has encouraged the search for new biomarkers to be used alongside alpha-foetoprotein (AFP) and imaging tests The aim of this study was to evaluate the clinical contribution of protein induced by vitamin K absence or antagonist-II (PIVKA-II) for HCC monitoring after liver transplantation (LT) and compare it with AFP A total of 46 HCC patients (Milan criteria) were enrolled in this study Serum levels of PIVKA-II and AFP were measured before and after transplantation Clinical features were determined for all the patients that were included Significant correlations were found between PIVKA-II expression levels and some clinicopathological features such as tumour size and number of pre-transplant transarterial chemoembolizations (TACEs) Serum levels of PIVKA-II and AFP decreased significantly after LT and increased in patients with tumour recurrence Serum PIVKA-II levels may play an important role in predicting disease severity monitoring PIVKA-II levels in HCC transplant recipients reflects the tumor early recurrence after transplantation and could be used The aim of the present study is to investigate the potential usefulness of PIVKA-II as a biomarker in the follow-up of HCC transplant patients and in the early detection of recurrence in these patients This analytical observational prospective dynamic cohort study was conducted at the Virgen de la Arrixaca Hospital (HCUVA Spain) and the Asturias Central Hospital (HUCA) Patients were recruited between September 2014 and May 2021 in two distinct stages: between September 2014 and October 2017 at HCUVA The inclusion criteria were HCC patients between 18 and 80 years candidates for LT and in compliance with the Milan criteria The diagnosis of HCC was made according to clinical It was established based on the presence of at least two compatible imaging scans or the existence of a compatible histological diagnosis The exclusion criteria were patients with HCC outside the Milan criteria metastatic HCC and taking vitamin K antagonist drugs such as the anticoagulants acenocoumarol or warfarin in the 6 months prior to sample collection Most patients underwent at least one session of transarterial chemoembolization (TACE) as bridge therapy until transplantation Of the 46 patients recruited after being evaluated by the liver transplant programmes of both hospitals 35 patients were eventually transplanted and followed up for biomarkers at 1 Due to losses in the follow-up of some patients a total of 46 blood samples were collected pre-transplant 24 samples at 1 year post-transplant and 23 samples at 2 years post-transplant PIVKA-II was determined by immunoenzymatic assay using chemiluminescence on the LUMIPULSE® G1200 system analyser (Fujirebio Europe N.V. with an analysis range of 5–75,000 mAU/mL and a cut-off value of 48 mAU/mL Serum AFP levels were analysed by immunochemistry assay on the Cobas 8000 Modular Analyzer series (Roche Diagnostics Switzerland) with a measurement range of 0.605–1210 ng/mL and a cut-off value of 11 ng/mL The number of tumours was determined by histopathological study of the tissue sample obtained during surgery The remaining clinical variables (aetiology of cirrhosis presence/absence of recurrence or post-transplant metastasis) were obtained from the clinical history of each patient considering for tumour size the diameter in centimetres of the largest lesion at diagnosis by imaging test (computerized tomography or magnetic resonance imaging) The presence of vascular invasion and tumor necrosis was determined by liver biopsy of the explant hepatitis B + C virus infection (HBV + HCV) HCV infection plus alcoholism (HCV + ALCH) HBV infection plus alcoholism (HBV + ALCH,) non-alcoholic steatosis (NASH) haemochromatosis (HEMO) and HCV infection + alcoholism + iron overload (HCV + ALCH + Fe) The aetiology of liver disease was considered cryptogenic (CRIPTO) if no cause was identified Different aetiologies were then classified into 3 groups: viral aetiology (HBV which encompasses viral plus non-viral aetiology (HCV + ALCH and HCV + ALCH + ALCH + Fe) The normality of all quantitative variables was tested using the Shapiro–Wilk test Variables that followed a normal distribution were represented by the mean and standard deviation while those that did not show a normal distribution were represented by the median and interquartile range (IQR) Qualitative variables were expressed as absolute frequency and relative frequency in percentages For statistical analysis of the obtained data Spearman's rho test was used to verify the correlation between biomarkers as well as between biomarkers and quantitative clinical variables To study the association between pre-transplant biomarker levels and qualitative clinical variables the Mann–Whitney U test or the Kruskal–Wallis test was used depending on whether two groups or more than two groups were compared To assess whether there were significant differences in PIVKA-II and AFP levels between the groups before and after transplantation the Wilcoxon signed-rank test for related samples was performed Receiver Operating Characteristic (ROC) analysis was performed and the Area Under the Curve (AUC) was estimated to study the predictive efficacy of pre-transplant PIVKA-II and AFP values for post-transplant relapse The cut-off point for these markers with the best sensitivity and specificity Multimarker analysis was performed by binary logistic regression by the method of introduction A pooled ROC analysis was then performed to determine whether additional predictive power could be achieved considering values of p ≤ 0.05 statistically significant The study was approved by the Clinical Research Ethics Committee of HCUVA and HUCA hospitals and the subjects gave their written informed consent All procedures were in accordance with the ethical standards of the institutional and national research committees as well as with the 1964 Helsinki Declaration and its later amendments The general characteristics of the study population for all patients are shown in Table 1 The median follow-up was 57 months (IQR 4.5–76.5 months) with a minimum follow-up time of 2 months and a maximum follow-up time of 84 months The correlations between PIVKA-II and AFP with clinicopathological variables are shown in Table 2 We observed statistically significant differences in pre-transplant PIVKA-II and AFP values between the group with a diameter of the largest tumour lesion at diagnosis ≤ 3 cm and the group with lesions > 3 cm such that patients with a tumour size > 3 cm had significantly higher serum PIVKA-II and AFP levels than those with a tumour size < 3 cm we found statistically significant differences in AFP levels between the different Child–Pugh groups with patients in the Child C group having significantly higher AFP levels than patients in the Child A and B groups (p = 0.035) pre-transplant PIVKA-II and AFP levels were not significantly associated with the aetiology of the underlying liver disease neither when analyzing individual etiologies [PIVKA-II (X2 = 15.288; p = 0.083); AFP (X2 = 10.441; p = 0.316)] nor when analyzing etiologies in different groups: viral non-viral or mixed [PIVKA-II (X2 = 2.059; p = 0.357); AFP (X2 = 2.157; p = 0.340)] Evolution of median levels of PIVKA-II and AFP after OLT in patients with HCC Evolution of PIVKA-II and AFP levels after OLT in patient 23 Serum markers for both early diagnosis of patients at high risk for HCC and early detection of recurrence after transplantation are of great importance as they offer the opportunity to decrease patient mortality and reduce medical costs Although the role of PIVKA-II has been widely studied in the diagnosis and prognosis of HCC as well as in the evaluation of surgical treatments such as TACE there are hardly any studies in the literature that have explored the role of PIVKA-II in the follow-up of patients after LT for HCC This finding confirms the ability of AFP to reflect the severity of liver dysfunction in patients with HCC did not correlate significantly with the number of pre-transplant TACES PIVKA-II could be a good marker in the study of progression after liver transplantation Pre-transplant PIVKA-II concentration in peripheral blood in patients with HCC is significantly associated with clinical factors such as larger tumour size and the number of TACEs performed before transplantation however the levels of this biomarker are independent of the aetiology of the underlying liver disease According to the results of the present study high levels of this tumour marker could play an important role in predicting disease severity by indicating larger tumour volume and worse clinical stage there are practically no published studies on the role of PIVKA-II in the follow-up of HCC after liver transplantation in Western countries Our findings place PIVKA-II as a promising worldwide marker serving as a basis for future large-scale studies or meta-analyses that can strengthen its usefulness in clinical practice The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request lens culinaris Agglutinin-reactive fraction of AFP Positron emission tomography computed tomography Protein induced by vitamin K absence or antagonist-II Global Cancer Statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries Mechanisms of hepatocellular carcinoma progression Diagnosis of hepatic nodules 20 mm or smaller in cirrhosis: Prospective validation of the noninvasive diagnostic criteria for hepatocellular carcinoma Serum alpha-fetoprotein levels in patients with advanced hepatitis C: Results from the HALT-C Trial Alpha-Fetoprotein monitoring in Chinese patients with chronic hepatitis B virus infection: Role in the early detection of hepatocellular carcinoma Oncological evaluation by positron-emission tomography circulating tumor cells and alpha fetoprotein in patients with hepatocellular carcinoma on the waiting list for liver transplantation Matrix metal- loproteinase 1 as a novel biomarker for monitoring hepatocellular carcinoma in liver transplant patients Protein induced by vitamin K absence or antagonist-II versus alpha-fetoprotein in the diagnosis of hepatocellular carcinoma: A systematic review with meta-analysis Use of des-gamma-carboxyprothrombin in retrospective diagnosis of hidden intoxication of anticoagulants Park, M. S. et al. Usefulness of PIVKA-II after living-donor liver transplantation for hepatocellular carcinoma. Transpl. Proc. 49, 1109–1113. https://doi.org/10.1016/j.transproceed.2017.03.017 (2017) Des-gamma-carboxyl prothrombin is associated with tumor angiogenesis in hepatocellular carcinoma Diagnostic and treatment algorithm of the Japanese society of hepatology: A consensus-based practice guideline Management of hepatocellular carcinoma in Japan: Consensus-based clinical practice guidelines proposed by the Japan Society of Hepatology (JSH) 2010 updated version Multidisciplinary approach for post-liver transplant recurrence of hepatocellular carcinoma: A proposed management algorithm Factors associated with early recurrence after resection for hepatocellular carcinoma and outcomes Protein induced by vitamin K absence or antagonist-II production is a strong predictive marker for extrahepatic metastases in early hepatocellular carcinoma: A prospective evaluation Evaluation methods for pretransplant oncologic markers and their prognostic impacts in patient undergoing living donor liver transplantation for hepatocellular carcinoma Prognostic importance of the gross classification of hepatocellular carcinoma in living donor-related liver transplantation Liver transplantation for hepatocellular carcinoma: The Kyoto experience The changing global epidemiology of hepatocellular carcinoma Des-gamma carboxyprothrombin can differentiate hepatocellular carcinoma from nonmalignant chronic liver disease in American patients Sensitivity and specificity of des-gamma-carboxy prothrombin for diagnosis of patients with hepatocellular carcinomas varies according to tumor size Clinical utility of prothrombin induced by vitamin K absence in the detection of hepatocellular carcinoma in Indian population A high value of serum des-γ-carboxy prothrombin before hepatocellular carcinoma treatment can be associated with long-term liver dysfunction after treatment Epidemiology and clinical features of patients with hepatocellular carcinoma at a tertiary hospital in Jeddah Diagnostic value of gamma-glutamyltransferase/aspartate aminotransferase ratio protein induced by vitamin K absence or antagonist II and alpha-fetoprotein in hepatitis B virus-related hepatocellular carcinoma alpha-fetoprotein and AFP-L3 in patients with chronic hepatitis Comparing prothrombin induced by vitamin K absence-II (PIVKA-II) with the oncofetal proteins glypican-3 Alpha feto protein and carcinoembryonic antigen in diagnosing hepatocellular carcinoma among Egyptian patients Clinical aspects and treatment of hepatocellular carcinoma in north-eastern Poland Prognostic role of alpha-fetoprotein in patients with hepatocellular carcinoma treated with repeat transarterial chemoembolisation Poor prognosis for hepatocellular carcinoma with transarterial chemoembolization pre-transplantation: Retrospective analysis Cell apoptosis and regeneration of hepatocellular carcinoma after transarterial chemoembolization and GP73 as markers for monitoring treatment re- sponse and recurrence and as surrogate markers of clinicopathological vari- ables of HCC Diagnostic value of AFP-L3 and PIVKA-II in hepatocellular carcinoma according to total-AFP alpha-fetoprotein and a combination of both in diagnosis of hepatocellular carcinoma in patients affected by chronic HCV infection The combination of PIVKA-II and AFP improves the detection accuracy for HCC in HBV caucasian cirrhotics on long-term oral therapy Clinical significance of AFP and PIVKA-II responses for monitoring treatment outcomes and predicting prognosis in patients with hepatocellular carcinoma Predictors of micrometastases in patients with barcelona clinic liver cancer classification b hepatocellular carcinoma Des-gamma-carboxy prothrombin in hepatocellular cancer patients waiting for liver transplant: A systematic review and meta-analysis Evaluation of transarterial chemoembolization refractoriness in patients with hepatocellular carcinoma Tumor marker levels before and after curative treatment of hepatocellular carcinoma as predictors of patient survival The predictors of microvascular invasion in candidates for liver transplantation with hepatocellular carcinoma-with special reference to the serum levels of des-gamma-carboxy prothrombin Impact of des-gamma-carboxy prothrombin and tumor size on the recurrence of hepatocellular carcinoma after living donor liver transplantation Significance of des-gamma-carboxy prothrombin in selection criteria for living donor liver transplantation for hepatocellular carcinoma Combinations of biomarkers and Milan criteria for predicting hepatocellular carcinoma recurrence after liver transplantation Combined measurement of preoperative α-fetoprotein and des-γ-carboxy prothrombin predicts recurrence after curative resection in patients with hepatitis-B-related hepatocellular carcinoma Patient selection by tumor markers in liver transplantation for advanced hepatocellular carcinoma Asian Pacific Association for the Study of the Liver consensus recommendations on hepatocellular carcinoma Kokudo, N., Hasegawa, K., Akahane, M., Igaki, H., Izumi, N., Ichida, T., et al. Evidence-based clinical practice guidelines for hepatocellular carcinoma: The Japan Society of Hepatology 2013 update (3rd JSH-HCC Guidelines). Hepatol. Res. 45(2). https://doi.org/10.1111/hepr.12464 (2015) The Indian National Association for Study of the Liver (INASL) consensus on prevention diagnosis and management of hepatocellular carcinoma in India: The Puri Recommendations Download references The work was supported by the following funded research projects: 1: Usefulness of CTC PETTAC and dynamic MRI with gadoxetic acid to predict the efficacy of transarterial chemoembolization in hepatocellular carcinoma awaiting transplantation PIVKA II and PET-CT levels to predict the efficacy of transarterial chemoembolization in hepatocarcinoma awaiting transplantation Regional Science and Technology Agency (19447/PI/14) 3: Long-term prognostic assessment of the detection and characterization of CTC by microfluidic liquid biopsy in patients with hepatocarcinoma on the liver transplant waiting list (PI18/01302) These authors contributed equally: Francisco Villalba López Alberto Baroja Mazo and Pablo Ramírez Romero Maria Isabel Sánchez-Lorencio & Alberto Baroja-Mazo Pedro Antonio Cascales-Campos & Pablo Ramírez-Romero called the patients for the extraction of the samples and collected the analytical and clinical data performed the statistical analysis and data analysis All authors have read and approved the final manuscript Download citation DOI: https://doi.org/10.1038/s41598-023-32879-9 Metrics details Protein induced by vitamin K absence or antagonist II (PIVKA-II) plays a critical role in the diagnosis of hepatocellular carcinoma (HCC) studies on its efficacy in diagnosing recurrent HCC were rarely found HCC patients who had curative resection were monitored every 3 months in the first year post-surgery and every 6 months thereafter if no recurrence occurred Tumor markers were collected at the diagnosis of recurrence for those with recurrence and at the last follow-up for those without recurrence The median serum levels of PIVKA-II and AFP in the recurrence group were significantly higher than those in the non-recurrence group (PIVKA-II: 84.62 vs p < 0.001) and there is a significant correlation between PIVKA-II and AFP (R = 0.901 PIVKA-II showed better accuracy than AFP in the diagnosis of overall recurrent HCC (AUC: 0.883 vs but also in patients with negative PIVKA-II before curative resection (AUC: 0.878 vs Clinician should pay more attention to serum PIVKA-II values when following patients after curative HCC resection to detect early recurrence Clinical trial registration: ChiCTR2300070874 we carried out this retrospective study to determine the diagnostic accuracy of PIVKA-II compared with AFP in recurrent HCC after curative resection the serum levels of PIVKA-II and AFP were collected in patients with and without recurrent HCC after curative operation The performance of PIVKA-II and AFP in diagnosis of recurrent HCC were assessed and observational study from 3 centers was conducted: The Third Affiliated Hospital of Sun Yat-Sen University (Guangzhou The Second Affiliated Hospital of Guangzhou Medical University (Guangzhou The First Affiliated Hospital of Guangdong Pharmaceutical University (Guangzhou Inclusion criteria: (1) Patients with primary HCC and had not received other anti-tumor therapy; (2) Patient underwent curative resection; (3) No restrictions on gender Exclusion criteria were: (1) HCC patients complicated with preoperative metastasis portal vein carcinoma thrombus or bile duct carcinoma thrombus; (2) Patients with positive pathological margin; (3) Patients combined with primary tumors of other organs; (4) Patients take warfarin or vitamin K1; (5) Patients with acute hepatitis embryoma of gonad or any other diseases that could cause elevated AFP Patients with primary HCC underwent curative resection were re-examined every 3 months in the first year after surgery and then every 6 months in the later period if the tumor had not recurred Tumor markers (AFP and PIVKA-II) were collected at the time of diagnosis for recurrent patients and those at the last follow-up were collected for patients without recurrence The recurrent HCC was diagnosed according to the same criteria for primary HCC Criteria for curative resection of liver cancer Intraoperative criteria: ① No macroscopic cancer thrombus was observed in hepatic vein bile duct and inferior vena cava; ② No invasion of adjacent organs no hilar lymph nodes or distant metastasis; ③ The liver incisal margin was more than 1 cm from the tumor boundary but histological examination of the resection section of the liver shows no residual tumor cells CT and MRI (two of which must be performed) were performed 2 months after surgery and no tumor lesions were found; ② If tumor marker(AFP or PIVKA-II) is elevated before surgery the retest 2 months after surgery is required to be in the normal range Patients were divided into recurrence group and non-recurrence group according to whether the HCC has recurred clinical results and laboratory findings were collected Serum AFP was detected by electrochemiluminescence with Roche Cobase601 fully automated immunoassay analyzer with a reference range of < 8 ng/ml PIVKA-II was measured by chemiluminescence immunoassay (I4000 USA) and the reference range was < 40 mAU/ml All reagents are original kits and operate in strict accordance with reagent instructions All operations in the process of determination are carried out according to the laboratory indoor quality control documents Quality control tests were carried out before during and after the specimens were tested All data were analyzed by SPSS 25.0 software The levels of PIVKA-II and AFP in different groups were analyzed The results showed that PIVKA-II and AFP levels were skewed distribution Two independent samples were used to compare the levels of AFP and PIVKA-II between different groups negative predictive value and Kappa value of serum markers were calculated the appropriate reference range of AFP and PIVKA-II was determined by drawing receiver operating characteristic curve (ROC) The linear correlation analysis of AFP and PIVKA-II was carried out in all samples and primary liver cancer p < 0.05 was considered as statistically significant difference This study followed the most recent ethical guidelines of the World Medical Association Declaration of Helsinki and was reviewed and approved by the Institutional Review Boards (IRB) of each participating center (No Written informed consent was waived because of the retrospective nature of the study and that there was no study-specific intervention beyond routine clinical care Medical records of the included patients were anonymized and de-identified before analysis The median serum levels of PIVKA-II and AFP in HCC recurrence group were significantly higher than those non-recurrence group. (84.62 vs. 18.76 mAU/ml, p < 0.001) (4.90 vs. 3.00 ng/ml, p < 0.001) (Figs. 2, 3). Median values of PIVKA-II in HCC recurrence patients and non-recurrence patients. Boxes and error bars refer to, respectively, the median value and the interquartile ranges in the two groups. Due to the data skewness, the levels of PIVKA-II and AFP are plotted on a log scale for better visualization. (“****” means p < 0.001). Median values of AFP in HCC recurrence patients and non-recurrence patients the median value and the interquartile ranges in the two groups the levels of PIVKA-II and AFP are plotted on a log scale for better visualization There is a significant correlation between PIVKA-II and AFP (R = 0.901, p < 0.001 for the Pearson correlation, Fig. 4). Correlation between PIVKA-II and AFP in all subjects Correlation analysis was performed using Pearson correlation Receiver operating characteristics (ROC) curve comparing serum levels of PIVKA-II AFP and a combination of PIVKA-II and AFP in HCC recurrence patients and non-recurrence patients The area under the ROC curve (AUC) is shown with its 95% confidence intervals prothrombin induced by vitamin K absence-II; AFP AFP in HCC recurrence patients and non-recurrence patients in different groups This study followed the most recent ethical guidelines of the World Medical Association Declaration of Helsinki and was reviewed and approved by the Institutional Review Boards (IRB) of each participating center (Ethics committee of the Third Affiliated Hospital of Sun Yat-sen University II2023-021-01; Ethics committee of the First Affiliated Hospital of Guangdong Pharmaceutical University 2023-IIT-8; Clinical Research Ethics Committee of the 2nd Affiliated Hospital of Guangzhou Medical University we mainly investigated the performances of AFP and PIVKA-II in the diagnosis of recurrent HCC after curative resection Both AFP and PIVKA-II can be used to detect the recurrence of HCC but PIVKA-II showed a better performance of discrimination between recurrence patients and non-recurrence patients AFP did not show better performance in diagnosis of recurrent HCC than PIVKA-II when pre-operation AFP was elevated PIVKA-II was demonstrated to have more accurate diagnostic efficacy than AFP when pre-operation PIVKA-II was elevated even in patients with normal PIVKA-II range the total number of patients enrolled in was small and the selection bias was still difficult to avoid It is necessary to conduct a prospective study to compare the performance of PIVKA-II and AFP serum levels in detect the recurrence of HCC after curative resection A second limitation is that this study was conducted in China where most patients with HCC were suffering from HBV-related cirrhosis that’s different from United States and Europe where hepatitis C and excessive alcohol consumption are the leading etiologies of HCC our study confirmed that both AFP and PIVKA-II were able to detect the recurrence of HCC PIVKA-II showed better performance than AFP Although the combination of PIVKA-II and AFP did not improve the performance in detection of recurrent HCC Clinicians should pay more attention to serum PIVKA-II values when following patients after curative HCC resection to early detect recurrence even in patients with normal preoperative PIVKA-II ranges Data in this study are available from the corresponding author (wgshforsubmit@163.com) Protein induced by vitamin K absence or antagonist II Fitzmaurice, C. et al. The global burden of cancer 2013. JAMA Oncol. 1, 505–527. https://doi.org/10.1001/jamaoncol.2015.0735 (2015) Ferlay, J. et al. Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012. Int. J. Cancer 136, E359-386. https://doi.org/10.1002/ijc.29210 (2015) Greten, T. F., Wang, X. W. & Korangy, F. Current concepts of immune based treatments for patients with HCC: From basic science to novel treatment approaches. Gut 64, 842–848. https://doi.org/10.1136/gutjnl-2014-307990 (2015) Imamura, H. et al. Risk factors contributing to early and late phase intrahepatic recurrence of hepatocellular carcinoma after hepatectomy. J. Hepatol. 38, 200–207. https://doi.org/10.1016/s0168-8278(02)00360-4 (2003) Wen, T. et al. Multidisciplinary management of recurrent and metastatic hepatocellular carcinoma after resection: an international expert consensus. Hepatobiliary Surg. Nutr. 7, 353–371. https://doi.org/10.21037/hbsn.2018.08.01 (2018) Bruix, J. & Sherman, M. Management of hepatocellular carcinoma: an update. Hepatology (Baltimore, Md.) 53, 1020–1022. https://doi.org/10.1002/hep.24199 (2011) Trevisani, F. et al. Serum alpha-fetoprotein for diagnosis of hepatocellular carcinoma in patients with chronic liver disease: influence of HBsAg and anti-HCV status. J. Hepatol. 34, 570–575. https://doi.org/10.1016/s0168-8278(00)00053-2 (2001) Lu, Y. et al. Circulating exosome-derived bona fide long non-coding RNAs predicting the occurrence and metastasis of hepatocellular carcinoma. J. Cell Mol. Med. 24, 1311–1318. https://doi.org/10.1111/jcmm.14783 (2020) Richardson, P. et al. Determinants of serum alpha-fetoprotein levels in hepatitis C-infected patients. Clin. Gastroenterol. Hepatol. 10, 428–433. https://doi.org/10.1016/j.cgh.2011.11.025 (2012) Poté, N. et al. Performance of PIVKA-II for early hepatocellular carcinoma diagnosis and prediction of microvascular invasion. J. Hepatol. 62, 848–854. https://doi.org/10.1016/j.jhep.2014.11.005 (2015) Caviglia, G. et al. Biomarkers of oncogenesis, adipose tissue dysfunction and systemic inflammation for the detection of hepatocellular carcinoma in patients with nonalcoholic fatty liver disease. Cancers 13, 2305. https://doi.org/10.3390/cancers13102305 (2021) Durazo, F. A. et al. Des-gamma-carboxyprothrombin, alpha-fetoprotein and AFP-L3 in patients with chronic hepatitis, cirrhosis and hepatocellular carcinoma. J. Gastroenterol. Hepatol. 23, 1541–1548. https://doi.org/10.1111/j.1440-1746.2008.05395.x (2008) Marrero, J. A. et al. Alpha-fetoprotein, des-gamma carboxyprothrombin, and lectin-bound alpha-fetoprotein in early hepatocellular carcinoma. Gastroenterology 137, 110–118. https://doi.org/10.1053/j.gastro.2009.04.005 (2009) Ito, T. et al. Expansion of selection criteria for patients with hepatocellular carcinoma in living donor liver transplantation. Liver Transplant. 13, 1637–1644. https://doi.org/10.1002/lt.21281 (2007) Ertle, J. et al. A combination of α-fetoprotein and des-γ-carboxy prothrombin is superior in detection of hepatocellular carcinoma. Digestion 87, 121–131. https://doi.org/10.1159/000346080 (2013) Seo, S. et al. Diagnostic value of PIVKA-II and alpha-fetoprotein in hepatitis B virus-associated hepatocellular carcinoma. World J. Gastroenterol. 21, 3928–3935. https://doi.org/10.3748/wjg.v21.i13.3928 (2015) Zhao, L., Yang, Q. & Liu, J. Clinical value evaluation of microRNA-324-3p and other available biomarkers in patients with HBV infection-related hepatocellular carcinoma. Open forum Infect. Dis. 8, 1108. https://doi.org/10.1093/ofid/ofab108 (2021) Caviglia, G. et al. Alpha-fetoprotein, protein induced by vitamin k absence or antagonist II and glypican-3 for the detection and prediction of hepatocellular carcinoma in patients with cirrhosis of viral etiology. Cancers 12, 3218. https://doi.org/10.3390/cancers12113218 (2020) Marrero, J. et al. Des-gamma carboxyprothrombin can differentiate hepatocellular carcinoma from nonmalignant chronic liver disease in American patients. Hepatology (Baltimore, Md.) 37, 1114–1121. https://doi.org/10.1053/jhep.2003.50195 (2003) Lok, A. et al. Des-gamma-carboxy prothrombin and alpha-fetoprotein as biomarkers for the early detection of hepatocellular carcinoma. Gastroenterology 138, 493–502. https://doi.org/10.1053/j.gastro.2009.10.031 (2010) Caviglia, G. et al. Prognostic role of serum cytokeratin-19 fragment (CYFRA 21–1) in patients with hepatocellular carcinoma. Cancers 12, 2776. https://doi.org/10.3390/cancers12102776 (2020) Inagaki, Y. et al. Clinical and molecular insights into the hepatocellular carcinoma tumour marker des-γ-carboxyprothrombin. Liver Int. 31, 22–35. https://doi.org/10.1111/j.1478-3231.2010.02348.x (2011) Fujikawa, T. et al. Des-gamma-carboxyl prothrombin-promoted vascular endothelial cell proliferation and migration. J. Biol. Chem. 282, 8741–8748. https://doi.org/10.1074/jbc.M609358200 (2007) Wang, S. et al. Des-gamma-carboxy prothrombin stimulates human vascular endothelial cell growth and migration. Clin. Exp. Metastasis 26, 469–477. https://doi.org/10.1007/s10585-009-9246-y (2009) Gao, F. et al. Des-gamma-carboxy prothrombin increases the expression of angiogenic factors in human hepatocellular carcinoma cells. Life Sci. 83, 815–820. https://doi.org/10.1016/j.lfs.2008.10.003 (2008) Suzuki, M. et al. Des-gamma-carboxy prothrombin is a potential autologous growth factor for hepatocellular carcinoma. J. Biol. Chem. 280, 6409–6415. https://doi.org/10.1074/jbc.M406714200 (2005) Ma, M. et al. Vitamin K2 inhibits the growth of hepatocellular carcinoma via decrease of des-gamma-carboxy prothrombin. Chemotherapy 55, 28–35. https://doi.org/10.1159/000167022 (2009) Download references This work was supported by National Natural Science Foundation of China (82100691 These authors contributed equally to this work: Wenfeng Zhu The Third Affiliated Hospital of Sun Yat-Sen University Guangdong Key Laboratory of Liver Disease Research The First Affiliated Hospital of Guangdong Pharmaceutical University The Seventh Affiliated Hospital of Sun Yat-Sen University Department of Hepatobiliary and Pancreatic Surgery The Second Affiliated Hospital of Guangzhou Medical University State Key Laboratory of Traditional Chinese Medicine Syndrome Guangdong Provincial Hospital of Traditional Chinese Medicine The Second Affiliated Hospital of Guangzhou University of Chinese Medicine Chinese Medicine Guangdong Laboratory (Hengqin Laboratory) J.P.X.; Analysis and interpretation of data: W.F.Z. and J.P.X.; Drafting of manuscript: W.F.Z. and J.P.X.; Critical revision of manuscript: S.G.Z. All authors of this paper had read and approved the final version submitted and contents of this manuscript have not been copyrighted or published previously and is not under consideration for publication elsewhere Download citation DOI: https://doi.org/10.1038/s41598-024-59174-5 Sign up for the Nature Briefing: Translational Research newsletter — top stories in biotechnology Metrics details Protein induced by vitamin K absence or antagonist-II (PIVKA-II) is avitamin K (VK) deficiency indicator in neonates PIVKA-II detection frequency in neonatal blood at birth and the correlation between PIVKA-II and gestational age are unclear We retrospectively analyzed infants admitted to our institution between June 1 whose clinical and PIVKA-II data were available and classified them into preterm and term infant groups Overall incidence of PIVKA-II-positive cases (≥ 50 mAU/mL) was 42.8% including 0.6% apparent VK deficiency (≥ 5000 mAU/mL) 3.1% experimental VK deficiency (1000–4999 mAU/mL) and 10.7% latent VK deficiency (200–999 mAU/mL) cases Incidence of PIVKA-II-positive cases was significantly higher in the term group than in the preterm group (49.4% vs Gestational age correlated with PIVKA-II levels (r2 = 0.117 Median serum PIVKA-II levels and incidence of PIVKA-II-positive cases (≥ 50 mAU/mL 16.4%) were lower at 5 days after birth than at birth possibly reflecting the postnatal VK prophylaxis impact Only one infant was diagnosed with VK deficiency bleeding (PIVKA-II levels at birth: 10,567 mAU/mL; at day 5: 2418 mAU/mL) serum PIVKA-II levels after birth weakly correlated with gestational age VK deficiency was more common in term infants than in preterm infants we believe that data on the range of PIVKA-II in neonatal blood at birth are more clinically useful no large-scale studies involving preterm infants have performed highly sensitive PIVKA-II measurements using neonatal blood This study aimed to clarify the frequency of PIVKA-II detection in neonatal blood immediately after birth and examine the correlation between PIVKA-II and gestational age A total of 2042 newborns were admitted to our institution between June 1, 2018, and March 31, 2022. Of these infants, 283 were excluded because of a lack of serum PIVKA-II data at birth. All the required data were available for the remaining 1759 infants. The clinical characteristics of the enrolled infants are demonstrated in Table 1 The study population included 592 preterm (33.7%) and 190 small for gestational age (SGA) (10.8%) infants The median serum PIVKA-II levels measured using CLEIA were 42.0 (2.0 The overall incidence of PIVKA-II-positive cases (≥ 50 mAU/mL) was 42.8% A comparison of the characteristics of the preterm and term groups revealed that cesarean section and SGA were significantly more common (p < 0.001) while primiparity was significantly less common in the preterm group (p < 0.01) the incidence of PIVKA-II-positive cases (49.4 vs ≥ 200 mAU/mL) were significantly higher in the term group (p < 0.001) the proportion of infants with different levels of high PIVKA-II concentrations was significantly different between the groups As 5-day-old infants have routinely received prophylactic VK administration the median serum PIVKA-II levels and the incidence of PIVKA-II-positive cases (≥ 50 mAU/mL including apparent VK deficiency (≥ 5000 mAU/mL experimental VK deficiency (1000–4999 mAU/mL the incidence of PIVKA-II-positive cases (21.1 vs the proportion of infants with different levels of high PIVKA-II concentrations was significantly different between the two groups and Apgar scores of 6 and 8 at 1 min and 5 min Her mother (38 years old) underwent duodenojejunal bypass surgery for superior mesenteric artery syndrome at the age of 32 years and had anorexia due to lower back pain for 1 week before delivery Hematuria was observed in the infant 6 h after birth and left perinephric hematoma was noted on ultrasound at 1 and 2 days of age resulting in a diagnosis of renal hemorrhage In addition to prophylactic administration two intravenous injections of vitamin K2 were administered and the hematuria disappeared at 2 days of age This infant’s PIVKA-II levels were 10,567 mAU/mL at birth and 2418 mAU/mL at day 5 Correlation between gestational age and PIVKA-II levels Gestational age correlates with PIVKA-II levels (mAU/mL we observed that the incidences of cases with detectable PIVKA-II concentrations in neonatal serum soon after birth were 0.6% for ≥ 5000 mAU/mL Our results are generally consistent with those of previous studies which reported a substantially high incidence of abnormally high PIVKA-II levels This difference observed in PIVKA-II levels between populations from Japan and Uganda (0.7% vs 23% for ≥ 5000 mAU/mL) could be due to the differences in maternal nutritional status which is substantially high compared to our study (8.1% the number of cases included in these studies was not sufficient our study is the first to measure PIVKA-II in neonates of all gestational ages and demonstrate that preterm infants are less prone to VK deficiency because this was a single-center retrospective study in Japan it may not be applicable to other countries where the nutritional status and genetic background of pregnant women differ as data regarding maternal background and detailed neonatal information care should be taken when interpreting the results of this study since we were not able to extract long-term clinical outcomes we could not confirm the correlation between PIVKA-II level at birth and the risk of subsequent bleeding symptoms this study alone could not clarify the PIVKA-II threshold for the risk of developing VK deficiency bleeding future prospective studies that include detailed maternal and neonatal information are required the overall incidence of PIVKA-II-positive cases (≥ 50 mAU/mL) was 42.8% Serum PIVKA-II levels after birth were weakly correlated with gestational age and VK deficiency was more commonly observed in term infants than in preterm infants The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Ethics Committee at Kobe University Graduate School of Medicine (IRB approval number: B220244 All parents provided written informed consent for the use of their children’s personal medical data We classified the patients into two groups according to their gestational age: preterm infants (< 37 gestational weeks) and term infants (≥ 37 gestational weeks) Clinical characteristics and serum PIVKA-II levels were compared between the two groups and Fisher’s exact test were used to compare data between the two groups as appropriate Regression analysis was performed to linearly compare gestational age and serum PIVKA-II levels; regression equations and correlation coefficients (r2) were calculated Statistical significance was set at p < 0.05 Analyses were performed using GraphPad Prism 7 software (GraphPad Software a graphical user interface for R 4.2.2 (R Foundation for Statistical Computing All data generated or analyzed during this study are included in this published article Motohara, K., Endo, F. & Matsuda, I. Effect of vitamin K administration on acarboxy prothrombin (PIVKA-II) levels in newborns. Lancet 2, 242–244. https://doi.org/10.1016/s0140-6736(85)90291-0 (1985) Humpl, T. et al. Fatal late vitamin K-deficiency bleeding after oral vitamin K prophylaxis secondary to unrecognized bile duct paucity. J. Pediatr. Gastroenterol. Nutr. 29, 594–597. https://doi.org/10.1097/00005176-199911000-00023 (1999) Chuansumrit, A. et al. Prevalence of subclinical vitamin K deficiency in Thai newborns: Relationship to maternal phylloquinone intakes and delivery risk. Arch. Dis. Child Fetal Neonatal Ed. 95, F104-108. https://doi.org/10.1136/adc.2009.173245 (2010) Greer, F. R. Vitamin K the basics–what’s new?. Early Hum. Dev. 86(Suppl 1), 43–47. https://doi.org/10.1016/j.earlhumdev.2010.01.015 (2010) Clarke, P. et al. Vitamin K prophylaxis for preterm infants: A randomized, controlled trial of 3 regimens. Pediatrics 118, e1657-1666. https://doi.org/10.1542/peds.2005-2742 (2006) Greer, F. R. et al. A new mixed micellar preparation for oral vitamin K prophylaxis: Randomised controlled comparison with an intramuscular formulation in breast fed infants. Arch. Dis. Child 79, 300–305. https://doi.org/10.1136/adc.79.4.300 (1998) Sultanik, P. et al. Diagnostic accuracy of des-gamma-carboxy prothrombin for hepatocellular carcinoma in a French cohort using the Lumipulse((R)) G600 analyzer. J. Viral Hepat. 24, 80–85. https://doi.org/10.1111/jvh.12622 (2017) Caviglia, G. P. et al. Identification of the best cut-off value of PIVKA-II for the surveillance of patients at risk of hepatocellular carcinoma development. Biology (Basel) https://doi.org/10.3390/biology12010094 (2023) Meguro, T. & Yamada, K. A simple and rapid test for PIVKA-II in plasma. Thromb. Res. 25, 109–114. https://doi.org/10.1016/0049-3848(82)90219-5 (1982) Shapiro, A. D. et al. Vitamin K deficiency in the newborn infant: Prevalence and perinatal risk factors. J. Pediatr. 109, 675–680. https://doi.org/10.1016/s0022-3476(86)80241-4 (1986) Vitamin K1 metabolism and the production of des-carboxy prothrombin and protein C in the term and premature neonate Santorino, D. et al. Prevalence and predictors of functional vitamin K insufficiency in mothers and newborns in Uganda. Nutrients 7, 8545–8552. https://doi.org/10.3390/nu7105408 (2015) Hunnali, C. R., Devi, U., Kitchanan, S. & Sethuraman, G. Three different regimens for vitamin K birth prophylaxis in infants born preterm: A randomized clinical trial. J. Pediatr. https://doi.org/10.1016/j.jpeds.2022.10.031 (2022) Fujioka, K. et al. Renin is activated in monochorionic diamniotic twins with birthweight discordance who do not have twin-to-twin transfusion syndrome. J. Perinatol. 32, 514–519. https://doi.org/10.1038/jp.2011.136 (2012) Itabashi, K., Miura, F., Uehara, R. & Nakamura, Y. New Japanese neonatal anthropometric charts for gestational age at birth. Pediatr. Int. 56, 702–708. https://doi.org/10.1111/ped.12331 (2014) Carroll, A., Desforges, M., Jones, C. J. P. & Heazell, A. E. P. Morphological and functional changes in placentas from prolonged pregnancies. Placenta 125, 29–35. https://doi.org/10.1016/j.placenta.2022.01.009 (2022) Maiti, K. et al. Evidence that fetal death is associated with placental aging. Am. J. Obstet. Gynecol. 217(441), e441-441. https://doi.org/10.1016/j.ajog.2017.06.015 (2017) Londero, A. P. et al. Placental aging and oxidation damage in a tissue micro-array model: An immunohistochemistry study. Histochem. Cell Biol. 146, 191–204. https://doi.org/10.1007/s00418-016-1435-6 (2016) Placental transfer of vitamin K1 and its implications in fetal hemostasis Modified guidelline of vitamin K administration for vitamin K deficiency in infancy Araki, S. & Shirahata, A. Vitamin K deficiency bleeding in infancy. Nutrients https://doi.org/10.3390/nu12030780 (2020) Lembo, C., Buonocore, G. & Perrone, S. The challenge to define the optimal prophylactic regimen for vitamin K deficiency bleeding in infants. Acta Paediatr. 110, 1113–1118. https://doi.org/10.1111/apa.15566 (2021) Motohara, K., Kuroki, Y., Kan, H., Endo, F. & Matsuda, I. Detection of vitamin K deficiency by use of an enzyme-linked immunosorbent assay for circulating abnormal prothrombin. Pediatr. Res. 19, 354–357. https://doi.org/10.1203/00006450-198519040-00008 (1985) Download references This work was partially supported by JSPS KAKENHI Grant Numbers 23K14949, 20K08229, and 19K17360 (Japan). The authors declare no competing interests. We would like to thank Editage [http://www.editage.com] for editing and reviewing this manuscript for the English language Kobe University Graduate School of Medicine contributed to the conception and design of the study; T.S. contributed to the acquisition of the data; T.S All authors have read and approved the final version of this manuscript for publication Download citation DOI: https://doi.org/10.1038/s41598-024-51674-8 Metrics details A Corrigendum to this article was published on 19 December 2016 This article has been updated Prognosis of hepatocellular carcinoma (HCC) remains unsatisfying due to a lack of early detecting methods Protein Induced by Vitamin K Absence or Antagonist-II (PIVKA-II) has been proved to be an efficient biomarker for HCC the predicting efficacy of PIVKA-II has barely been reported In the Hepatitis Biobank of Southwest Hospital (HBS) cohort at Southwest Hospital we did a two-stage nested case-control study 45 HCC cases versus 138 matched controls were enrolled to compare levels of α-fetoprotein (AFP) and PIVKA-II in sequential sera at −12 Levels of both PIVKA-II and AFP in HCC cases elevated significantly at all time points compared with controls the sensitivity and specificity of PIVKA-II at baseline were 58.3% and 92.6% while AFP+/PIVKA-II- patients covered 25.5% Both PIVKA-II and AFP have the potential for HCC prediction while PIVKA-II has a better positive rate than AFP before diagnosis a feasible surveillance strategy for at-risk populations is necessary biomarkers for early detection of HCC are highly required the roles of PIVKA-II in hepatitis B virus (HBV)-associated HCC might vary a lot using retrospectively collected sera from patients with HCC and at-risk controls to identify if PIVKA-II could identify preclinical HCC The clinical characteristics at baseline point were shown in Table 1 The female ratio for HCC patients and controls was 20.0% and the median age were 48.0 (40.0–66.0) versus 47.0 (39.0–67.0) HBV DNA were controlled under detecting level in most patients and controls (67.6% vs 73.3%) and 73.3% were diagnosed at BCLC 0 or A stage TBIL and TBA showed no differences between patients and controls but TP level elevated significantly in HCC patients compared with CHB controls (P = 0.024) Levels of PIVKA-II and AFP at all time points at discovery stage and validation stage Gray points refer to each value and dark lines refer to the 25th and 75th percentile values with a long dark line indicating median levels P values were calculated by Mann-Whitney tests between two columns ROC curve was drawn and AUC was calculated at diagnostic time to provide best cut-off values for validation stage analysis The AUC for AFP was 0.853 (0.738–0.969) and for PIVKA-II was 0.739 (0.568–0.910) 7.1 ng/ml (Youden Index = 0.567) and 40.5 mAU/ml (Youden Index = 0.433) were calculated as proper cut-off values which illustrates Multivariable analysis of HCC in discovery stage) matching terms in validation stage were still gender Baseline information of HCC patients and controls was shown in Table 1 The female ratio for HCC patients and controls was 27.8% and the median age were 45.5 (39.5–52.0) versus 46.0 (39.0–52.0) half were diagnosed at early stage and copy number of HBV DNA in 80.5% patients (79.6% in controls) was undetectable TBIL and TBA levels elevated significantly in HCC patients compared with CHB controls but AST and ALT showed no difference between patients and controls (P = 0.585 and.807 In validation stage, sera at M-12, M-9, M-6, M-3 and M-0 were tested of AFP and PIVKA-II levels during more than 3-year follow-ups. Similar to discovery stage, levels of both PIVKA-II and AFP in HCC cases elevated significantly compared with controls at all time points (Fig. 1) PIVKA-II values elevated during the one-year follow-up from 22.0 (16.0–36.0) to 35.5 (19.0–437.5) mAU/ml (P = 0.008) and AFP values from 5.2 (2.8–13.6) to 13.1 (3.9–143.0) ng/ml (P = 0.024) but remained unchanged in the controls: 21.0 (17.0–25.0) and 21.0 (18.0–26.0) mAU/ml for PIVKA-II 3.2 (2.4–4.6) and 3.1 (2.2–3.6) ng/ml for AFP ROC curves at all time points at validation stage The area under the curve is shown with its 95% confidence intervals the more accurate the biomarkers performed only one marker above cut-off value gave a much better sensitivity but both markers above cut-off value presented poor results All cases in discovery stage and validation stage at diagnostic time were pooled together for analysis cirrhosis and BCLC) were compared to figure out if they had impact on the biomarker levels There was no difference both in AFP and PIVKA-II values (P = 0.689 and 0.280) between male and female Neither were the impact of age (>40 versus ≤40 years old) and cirrhotic basis and P values were 0.218 versus 0.094 and 0.673 versus 0.696 AFP values in early HCC patients and advanced HCC patients (BCLC B+C+D) showed no difference (P = 0.720) but PIVKA-II value elevated significantly in advanced stage compared with early stage (P = 0.005) ROC curve at diagnosis for all HCC cases The AUC is shown with its 95% confidence intervals The combination of AFP and PIVKA-II increases the diagnostic performance compared with single marker Sensitivities and specificities of AFP and PIVKA-II at different cut-off values were calculated and given on Table 3 PIVKA-II of 32 mAU/ml and AFP of 5.0 ng/ml still gave the best detecting performance compared with other cut-off values Pie charts of positive rate at all time points for HCC patients (A–C) show the positive rate of every marker in all HCC cases while (D,E) show the positive rate for different stage HCCs and (F,G) show the positive rate for different etiological basis of HCC Entirely, levels of the two biomarkers elevated as it came close to the diagnosis time, but from individual aspect, there existed tremendous diversity in all HCC patients (see Fig. 2, Supplemental Content which illustrates individual serum level of AFP and PIVKA-II in each HCC patients at validation stage) PIVKA-II in some patients (11 out of 36) had great prediction efficacy whose levels were above cut-off value 12 months prior to diagnosis circumstances were complicated in most cases (18 out of 36) the levels were either ups and downs with time goes by or below the cut-off value at all time most researches concentrate more on diagnosis time when the enhanced CT/MRI or biopsy is golden criterion But before imaging apparatus could detect abnormality millions of cells have underwent tumorigenesis This is why we focus on the predictive efficacy of PIVKA-II before HCC imaging diagnosis This nested case-control study included two stage levels of both biomarkers were higher in HCC patients than controls each levels did not increase significantly with time it is obvious that baseline levels of AFP and PIVKA-II elevated significantly in HCC patients This increase happened before imaging diagnosis suggesting that AFP and PIVKA-II are proper biomarkers closely linked to HCC tumorigenesis both markers are efficient predictors for HCC before imaging discovery levels of markers elevated at all time points in HCC patients values in patients were dispersed in a wide range suggested the great heterogeneity among HCC itself indicating that AFP was an irreplaceable biomarker but still insufficient while PIVKA-II was a favourable complement many previous researches had manifested that PIVKA-II represented better than AFP in early stage HCC 37.9% were AFP+/PIVKA-II- and 10.4% were AFP-/PIVKA+ cases combination will substantially increase detection rate we believed that PIVKA-II is necessary for HCC prediction in HBV-related patients 31.4% were two markers negative and at time M-6 it was 29.4% 17.6% cases were still buried but could be found by ultrasound This demonstrated that ultrasound is helpless when the cancerization happen at cellular level But secretion of cancer cell has started at that time so new markers are urgently required to detect the 31.4% or 29.4% cases before imaging diagnosis The strength of our research lies in that we collected sequential sera making a cohort we closely monitor serological changes of each markers so that the differences could be detected every patients underwent at least 4-year follow-up the time points are not that precise and few data are missing or unregistered all cases lack of necessary information were discarded without hesitation our HCC cases are less numerous and that is why we separate our research into two stages our research proved that both AFP and PIVKA-II had the potential for HCC prediction but patients of PIVKA-II positive were more than AFP positive at the time prior to HCC diagnosis The combination of two markers could improve the detection rate New serological markers or imaging methods should be discovered or developed to discover HCC of all detection targets negative We used the Hepatitis Biobank of Southwest Hospital (HBS) sample cohort dataset provided by the Department of Infectious Diseases The HBS dataset corresponded to about 450000 patients chronically infected with HBV in Southwest Hospital since 2001 3327 patients with more than 4 years follow-up were enrolled we screened out patients with hepatitis B surface antigen (HBsAg) negative with HCV/hepatitis D virus (HDV)/hepatitis E virus (HEV) infection with other cancer records and with autoimmune hepatitis 3172 patients with chronic hepatitis B (CHB) were qualified for our research CHB was defined as chronic necroinflammatory liver damage caused by persistent HBV infection CHB patients also included patients with HBV-induced liver cirrhosis who were confirmed by biopsy Patients receiving warfarin or vitamin K before haemospasia were screened out for the influence on PIVKA-II level which illustrates the selection procedure based on the HBS cohort dataset) We checked all the 3172 cases from our research cohort to screen for HCC cases (a total of 113 HCC cases) Follow-up patients with stored blood samples at the time of HCC diagnosis (M-0) and 12 (M-12) 6 (M-6) months before diagnosis were classified into discovery stage at-risk controls were randomly selected and 1:2 matched in age (±1 year) Discovery stage was designed to clarify if liver function had impact on levels of two biomarkers to further provide an unbiased criterion for selecting matches in validation stage HCC patients repeating ultrasound examinations every 6 months and preserving blood samples at the time of HCC diagnosis and 12 3 (M-3) months before diagnosis were classified into validation stage 3 controls were randomly selected from the HBS which matched in accordance with the results of discovery stage only patients with more than 18 months follow-up ahead of time 0 with no clue of HCC were chosen for the matching group Serum levels of PIVKA-II were determined by chemiluminescence enzyme immunoassay (CLEIA) (LUMIPULSE® G1200 Serum levels of AFP were measured by AFP Reagent kit via chemiluminescent microparticle immunoassay (CMIA) (ARTHITECT i2000 All the statistical analyses were performed at SPSS version 18.0 statistical software (IBM USA) and the graphs were constructed on the Prism version 5.01 (GraphPad Software Inc. Each variable was represented as median with interquartile range Kolmogorov-Smirnov tests that all variables were skewed data so Mann-Whitney test was applied to compare the differences between categorical variables (gender Kappa value and diagnostic accuracy were calculated by 2 × 2 table in SPSS Pearson Chi-square test was employed to evaluate statistical differences of diagnostic performance at different cut-off values logistic regression was conducted to screen for parameters that have impact on biomarkers Receiver operating characteristic (ROC) curve was applied for analysing the predicting or diagnostic performance The area under the curve (AUC) and its 95% confidence interval (CI) were also performed automatically by SPSS Two-tailed P value less than 0.05 was defined to be statistically significant The study involved in the manuscript was approved by the ethics committee of Southwest Hospital informed consent of research use of surplus blood after clinical laboratory test was obtained from each patient included in the study and the study protocol conforms to the ethical guidelines of the 1975 Declaration of Helsinki as reflected in a priori approval by the institution’s human research committee Efficacy of PIVKA-II in prediction and early detection of hepatocellular carcinoma: a nested case-control study in Chinese patients A correction has been published and is appended to both the HTML and PDF versions of this paper Primary liver cancer: worldwide incidence and trends and prevalence across five continents: defining priorities to reduce cancer disparities in different geographic regions of the world Journal of clinical oncology : official journal of the American Society of Clinical Oncology 24 Epidemiology of fibrolamellar hepatocellular carcinoma in the USA Recurrence patterns after hepatectomy of hepatocellular carcinoma: implication of Milan criteria utilization Japan’s Successful Model of Nationwide Hepatocellular Carcinoma Surveillance Highlighting the Urgent Need for Global Surveillance EASL-EORTC clinical practice guidelines: management of hepatocellular carcinoma American Association for the Study of Liver Management of hepatocellular carcinoma: an update Meta-analysis: surveillance with ultrasound for early-stage hepatocellular carcinoma in patients with cirrhosis Alimentary pharmacology & therapeutics 30 doi: 10.1111/j.1365-2036.2009.04014.x (2009) Des-gamma-carboxy (abnormal) prothrombin as a serum marker of primary hepatocellular carcinoma Management of hepatocellular carcinoma in Japan: Consensus-Based Clinical Practice Guidelines proposed by the Japan Society of Hepatology (JSH) 2010 updated version Diagnostic value of PIVKA-II and alpha-fetoprotein in hepatitis B virus-associated hepatocellular carcinoma World journal of gastroenterology : WJG 21 Elevated PIVKA-II is associated with early recurrence and poor prognosis in BCLC 0-A hepatocellular carcinomas Asian Pacific journal of cancer prevention: APJCP 15 Des-gamma-carboxy prothrombin and alpha-fetoprotein as biomarkers for the early detection of hepatocellular carcinoma Hepatocellular carcinoma: role of hepatitis B and hepatitis C viruses proteins in hepatocarcinogenesis doi: 10.1111/j.1365-2893.2004.00521.x (2004) Diagnostic accuracy of des-gamma-carboxy prothrombin versus alpha-fetoprotein for hepatocellular carcinoma: A systematic review Hepatology research : the official journal of the Japan Society of Hepatology 44 Diagnostic accuracy of tumor markers for hepatocellular carcinoma: a systematic review Abnormal prothrombin (DES-gamma-carboxy prothrombin) in hepatocellular carcinoma Novel des-gamma-carboxy prothrombin in serum for the diagnosis of hepatocellular carcinoma Journal of gastroenterology and hepatology 28 The usefulness of determining des-gamma-carboxy prothrombin by sensitive enzyme immunoassay in the early diagnosis of patients with hepatocellular carcinoma Usefulness of serum des-gamma-carboxy prothrombin in detection of hepatocellular carcinoma Risk factors for hepatocellular carcinoma may impair the performance of biomarkers: a comparison of AFP Cancer biomarkers: section A of Disease markers 3 The role of tumor markers in the diagnosis of hepatocellular carcinoma with special reference to the des-gamma-carboxy prothrombin Liver transplantation and surgery: official publication of the American Association for the Study of Liver Diseases and the International Liver Transplantation Society 1 A combination of alpha-fetoprotein and des-gamma-carboxy prothrombin is superior in detection of hepatocellular carcinoma and AFP-L3 as tumor markers enhances diagnostic accuracy for hepatocellular carcinoma in cirrhotic patients Scandinavian journal of gastroenterology 51 Performance of Protein Induced by Vitamin K Absence or Antagonist-II (PIVKA-II) for Hepatocellular Carcinoma Screening in Chinese Population SCCA-1 and follisatin as surveillance biomarkers for hepatocellular cancer in non-alcoholic and alcoholic fatty liver disease Clinical evaluation of lens culinaris agglutinin-reactive alpha-fetoprotein and des-gamma-carboxy prothrombin in histologically proven hepatocellular carcinoma in the United States Diagnostic value of protein induced by vitamin K absence (PIVKAII) and hepatoma-specific band of serum gamma-glutamyl transferase (GGTII) as hepatocellular carcinoma markers complementary to alpha-fetoprotein Prognosis of Hepatocellular Carcinoma: The BCLC Staging Classification Download references We gratefully acknowledge the HBS biobank (Southwest Hospital China) for technical support and all enrolled patients for their kind dedication This work was supported in part by the National Basic Research Program of China (973 Program 2011CB512106) the National Natural Science Foundation of China (grant No 81071694) and the TMMU key projects for clinical research (2012XLC05) Chongqing Key Laboratory of Infectious Diseases The authors declare no competing financial interests Download citation Analytical and Bioanalytical Chemistry (2017) Metrics details The methylation SEPT9 (mSEPT9) appeared to be effective for hepatocellular carcinoma (HCC) detection its performance in high-risk population has not been validated We designed a pilot study and aimed to investigate the performance of mSEPT9 PIVKA-II and their combination in hepatic cirrhosis (HC) population A training cohort was established including 103 HCC and 114 HC patients 10 ml blood was collected from each patient with K2EDTA tubes and 3–4 ml plasma was extracted for subsequent tests PIVKA-II and their combination was optimized by the training cohort Test performance was prospectively validated with a validation cohort At the optimal thresholds in the training cohort specificity and area under curve (AUC) was 72.82% The combined test significantly increased the sensitivity to 84.47% (P < 0.05) at the specificity of 86.84% with an AUC of 0.91 Stage-dependent performance was observed with all single markers and their combination in plasma marker levels Moderate correlation was found between mSEPT9 and AFP plasma levels (r = 0.527 Good complementarity was found between any two of the three markers providing optimal sensitivity in HCC detection when used in combination Subsequent validation achieved a sensitivity The combined test yielded a significantly increased sensitivity of 84.00% (P < 0.05) at 85.57% specificity The performance was optimal by the combination of mSEPT9 and the combination may be effective for HCC opportunistic screening in HC population This compromised the screening capability of US or combined US/AFP screening convenient and cost-effective screening method is still needed to facilitate HCC screening Since HC patients generally receive anti-virus therapy or liver protecting treatment in clinics or hospitals opportunistic screening of HC patients at hospital environment may be an efficient way identifying those with high HCC risk and did not reflect the performance of combined markers in screening scenario but screening study has not been performed with mSEPT9 or its combination with AFP and PIVKA-II in HCC high-risk population By establishing training and validation cohorts of HCC high-risk population we hoped to optimize the performance of the combination in this pilot study and provide evidence for future large-scale screening study The study plan and ethics materials were submitted to the ethics committee of the affiliated Calmette hospital of Kunming medical university (the first people’s hospital of Kunming) before recruitment of patients and tests started The study was approved by the hospital ethics committee Informed consent was obtained from all patients before the collection of blood samples and all patients were informed the test results tests and diagnosis for both training and validation cohorts in this study Symptomatic patients visiting haptic clinics or hospitals all received ultrasound and AFP test as initial screening and 389 high-risk patients were included based on inclusion and exclusion criteria Patients in the training cohort was retrospectively recruited based on the diagnosis from enhanced CT/MRI examination AFP and PIVKA-II(DCP) before any treatment for this visiting Patients in the validation cohort was prospectively recruited and were tested by mSEPT9 AFP and PIVKA-II(DCP) before CT/MRI diagnosis and they were divided into HCC and HC groups based on the diagnosis As a result, a total of 217 subjects, including 103 HCC and 114 HC, were recruited for the training cohort, and a total of 172 patients, including 51 HCC and 121 HC, were recruited for the validation cohort (Table 1; Fig. 1) all technicians who transferred the blood samples or performed the tests were blinded to the information of potential diagnostic status of patients Investigators were also blinded to the ultrasound and CT/MRI results during the study Samples were collected from outpatients and inpatients of the designated departments A 10 ml peripheral blood sample was collected with a 10 ml K2EDTA anticoagulant tube (Jiangsu KANGJIAN Medical Apparatus Co. Plasma was isolated from the blood samples by spinning the tube at 1350 g for 12 min The supernatant was collected in a 15 ml centrifugal tube and spined at 12,000 g for 12 min The final supernatant was collected in a 15 ml centrifugal tube for cfDNA extraction 200 μl plasma was aliquoted for AFP and PIVKA-II tests All plasma samples were transported to an authenticated clinical laboratory and stored at -80 °C for future tests Plasma cfDNA extraction and bisulfite conversion were performed following the manufacturer’s instructions of the mSEPT9 assay (BioChain (Beijing) Science and Technology One PCR was performed for each subject on an ABI 7500 Fast Dx Real Time PCR device (Life Technologies ACTB was used as an internal reference to assess the integrity of each sample The validity of mSEPT9 test results for each sample was determined on the basis threshold count (Ct) values of ACTB Plasma AFP and PIVKA-II levels were measured using the corresponding commercial kits with the Abbott ARCHITECT i2000SR chemiluminescence immunoanalyzer according to manufacturer’s instructions (Abbott Laboratories; Chicago AFP and PIVKA-II were determined by identifying the optimal Youden’s index (sensitivity + specificity-1) from the ROC analysis The blood levels of markers at the best Youden’s index were determined as the thresholds The establishment of thresholds also referred to the scatter plots The determination of the final thresholds took into account both Youden’s index and scatter plots The thresholds for mSEPT9 and the combined test were adjusted in the validation cohort using the identical methods The combined test of the three markers was determined as positive if any one of the three markers was positive A score for combined test was calculated based on the average percentile of mSEPT9 the percentile for one patient was 45% for mSEPT9 the average percentile is (45 + 38 + 78)/3 = 53.67 The asterisks indicate the significance from Chi-square test when compared with the combined group AFP and PIVKA-II and their combinations in HCC detection in the training cohort Panel A: box and whisker plots for quantitative data of each stage in mSEPT9 Panel B: the positive detection rate (PDR) for each stage for all tests and their combination Panel C: the ROC curve for each stage for all test and their combinations The correlation and complementarity of mSEPT9 Panel A: moderate correlation was found between mSEPT9 and AFP (r = 0.527 while no significant correlation was found in quantitative measurements between mSEPT9 and PIVKA-II Panel B: the complementarity between the tests is shown by the percentage of four situations Strong complementarity can be observed between any two of the three markers This suggested that the US screening capability was largely compromised by the low compliance although it is a non-invasive convenient test HCC screening by blood test has its application scenarios and target population Opportunistic screening in this enriched population may therefore identify high ratio of HCC patients Different to screening in average-risk population or low-middle risk population this high-risk population included patients with hepatic cirrhosis hepatic cirrhosis with liver nodules and those with precancerous or cancerous diseases Screening test in this population therefore needs to distinguish between non-cancerous benign diseases and cancerous diseases which requires both high sensitivity and high specificity test optimization in this specific population is required and this was the focus of the present study The optimization aimed to balance the sensitivity with the specificity and this was because the false positive rate in this high-risk population was higher than that in the normal subjects or low-middle risk population The pursuit of high specificity comes at the cost of reduced sensitivity the sensitivity can be improved by combined use of multiple markers the combined use of the three markers still ensured high specificity we found that the combined use improved the overall sensitivity which demonstrated the advantages of combined markers from multiple omics A simple algorithm was therefore used to ensure both high sensitivity and specificity The high sensitivity of mSEPT9 in HCC and CRC made it an optimal marker when used alone or in combination with other markers has its advantages over the NGS sequencing method the tests of single markers are easier than the NGS test in terms of techniques lab and instrument requirements and staff training the tests of single markers do not need validation by very large cohorts and complex algorithm making them easier in clinical trials and practice the costs of the tests of single markers are much lower than the NGS test currently the sensitivity and specificity obtained from tests of single markers after optimization are comparable with those obtained from NGS tests validation of the test should be performed in larger cohorts ideally in prospective screening population in future as the number of patients in current cohorts in this study was still limited optimization of test performance and algorithm in hepatitis C and NAFLD related populations should be performed to facilitate the HCC screening of these populations in future algorithm can still be optimized in future in larger cohorts The datasets generated and/or analyzed during the current study are available from the corresponding author upon reasonable request Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global Cancer S 2020: GLOBOCAN estimates of incidence and Mortality Worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71(3):209–49. https://doi.org/10.3322/caac.21660 Is it possible to halve the incidence of liver cancer in China by 2050 Marrero JA, Kulik LM, Sirlin CB, Zhu AX, Finn RS, Abecassis MM, Roberts LR, Heimbach JK. Diagnosis, Staging, and Management of Hepatocellular Carcinoma: 2018 Practice Guidance by the American Association for the Study of Liver Diseases. Hepatology. 2018;68(2):723–750. https://doi.org/10.1002/hep.29913 Singal AG, Pillai A, Tiro J. Early detection, curative treatment, and survival rates for hepatocellular carcinoma surveillance in patients with cirrhosis: a meta-analysis. PLoS Med. 2014;11(4):e1001624. https://doi.org/10.1371/journal.pmed.1001624 Natural history of chronic hepatitis B: special emphasis on disease progression and prognostic factors Leal C, Strogoff-de-Matos J, Theodoro C, Teixeira R, Perez R, Guaraná T, de Tarso Pinto P, Guimarães T, Artimos S. Incidence and Risk Factors of Hepatocellular Carcinoma in Patients with Chronic Hepatitis C Treated with Direct-Acting Antivirals. Viruses. 2023;15(1):221. https://doi.org/10.3390/v15010221 Professional Committee for Prevention and Control of Hepatobiliary and Pancreatic Diseases of Chinese Preventive Medicine Association;; Professional Committee for Hepatology,Chinese Research Hospital Association;; Chinese Society of Hepatology Chinese Medical Association;; Prevention of Infection Related Cancer (PIRCA) Group Specialist Committee of Cancer Prevention and Control of Chinese Preventive Medicine Association [Guideline for stratified screening and surveillance of primary liver cancer(2020 Edition)].Zhonghua Gan Zang Bing Za Zhi doi: 10.3760/cma.j.cn112152-20201109-00970.PMID: 33541021 Bailey C, Black JRM, Reading JL, Litchfield K, Turajlic S, McGranahan N, Jamal-Hanjani M, Swanton C. Tracking Cancer Evolution through the Disease Course. Cancer Discov. 2021;11(4):916–32. https://doi.org/10.1158/2159-8290.CD-20-1559 Identification of mutations in circulating cell-free tumour DNA as a biomarker in hepatocellular carcinoma Tan P, Grundy L, Makary P, Eng KH, Ramsay G, Bekheit M. The value of liquid biopsy in the diagnosis and staging of hepatocellular carcinoma: a systematic review. Transl Gastroenterol Hepatol. 2021;6:54. https://doi.org/10.21037/tgh.2020.01.11 Song L, Chen Y, Gong Y, Wan J, Guo S, Liu H, Li Y, Zeng Z, Lu Y. Opportunistic screening and survival prediction of digestive cancers by the combination of blood mSEPT9 with protein markers. Ther Adv Med Oncol. 2020;12:1758835920962966. https://doi.org/10.1177/1758835920962966 Li B, Huang H, Huang R, Zhang W, Zhou G, Wu Z, Lv C, Han X, Jiang L, Li Y, Li B, Zhang Z. SEPT9 gene methylation as a noninvasive marker for Hepatocellular Carcinoma. Dis Markers. 2020;2020:6289063. https://doi.org/10.1155/2020/6289063 Plasma mSEPT9: a novel circulating cell-free DNA-Based epigenetic biomarker to diagnose Hepatocellular Carcinoma A meta-analysis and of clinical values of 11 blood biomarkers and GP73 for diagnosis of hepatocellular carcinoma Wang X, Zhang Y, Yang N, He H, Tao X, Kou C, Jiang J. Evaluation of the combined application of AFP, AFP-L3%, and DCP for Hepatocellular Carcinoma diagnosis: a Meta-analysis. Biomed Res Int. 2020;2020:5087643. https://doi.org/10.1155/2020/5087643 Hu B, Tian X, Sun J, Meng X. Evaluation of individual and combined applications of serum biomarkers for diagnosis of hepatocellular carcinoma: a meta-analysis. Int J Mol Sci. 2013;14(12):23559–80. https://doi.org/10.3390/ijms141223559 Dietrich D, Hasinger O, Liebenberg V, Field JK, Kristiansen G, Soltermann A. DNA methylation of the homeobox genes PITX2 and SHOX2 predicts outcome in non-small-cell lung cancer patients. Diagn Mol Pathol. 2012;21(2):93–104. https://doi.org/10.1097/PDM.0b013e318240503b Screening for Colorectal Cancer: A Systematic Review for the U.S Rockville (MD): Agency for Healthcare Research and Quality (US); 2016 Jun Tang H, Ma X, Zhou L, Li W, Shu Y, Xu H, Li J, Wang F, Sun F, Duan Y. Distinct Performance of Methylated SEPT9 in Upper and Lower Gastrointestinal Cancers and Combined Detection with Protein Markers. Genet Test Mol Biomarkers. 2022;26(4):239–248. https://doi.org/10.1089/gtmb.2021.0127 Zhang L, Yang X, Tian Y, Yu Q, Zhou D, Wu Z, Zhao X. Noninvasive Detection of Esophageal Cancer by the Combination of mSEPT9 and SNCG. Genet Test Mol Biomarkers. 2022;26(1):8–16. https://doi.org/10.1089/gtmb.2021.0089 Zhao L, Li M, Zhang S, Liu Y. Plasma-methylated SEPT9 for the Noninvasive diagnosis of gastric Cancer. J Clin Med. 2022;11(21):6399. https://doi.org/10.3390/jcm11216399 Cao CQ, Chang L, Wu Q. Circulating methylated septin 9 and ring finger protein 180 for noninvasive diagnosis of early gastric cancer. Transl Cancer Res. 2020;9(11):7012–21. https://doi.org/10.21037/tcr-20-1330 Powrózek T, Krawczyk P, Kucharczyk T, Milanowski J. Septin 9 promoter region methylation in free circulating DNA-potential role in noninvasive diagnosis of lung cancer: preliminary report. Med Oncol. 2014;31(4):917. https://doi.org/10.1007/s12032-014-0917-4 Yang Y, Qin Y, Zeng Z, Lu Y, Gong Y, Li Y, Song L. The pan-cancer noninvasive screening and early detection by epigenetic techniques. Epigenomics. 2021;13(9):649–52. https://doi.org/10.2217/epi-2021-0063 Song L, Jia J, Peng X, Xiao W, Li Y. The performance of the SEPT9 gene methylation assay and a comparison with other CRC screening tests: a meta-analysis. Sci Rep. 2017;7(1):3032. https://doi.org/10.1038/s41598-017-03321-8 Min L, Chen J, Yu M, Liu D. Using Circulating Tumor DNA as a Novel Biomarker to Screen and Diagnose Colorectal Cancer: A Meta-Analysis. J Clin Med. 2023;12(2):408. https://doi.org/10.3390/jcm12020408 Performance of protein induced by vitamin K absence or antagonist-II assessed by chemiluminescence enzyme immunoassay for hepatocellular carcinoma detection: a meta-analysis Gao P, Li M, Tian QB, Liu DW. Diagnostic performance of des-γ-carboxy prothrombin (DCP) for hepatocellular carcinoma: a bivariate meta-analysis. Neoplasma. 2012;59(2):150-9. https://doi.org/10.4149/neo_2012_020 Chen J, Wu G, Li Y. Evaluation of serum Des-Gamma-Carboxy Prothrombin for the diagnosis of Hepatitis B Virus-Related Hepatocellular Carcinoma: a Meta-analysis. Dis Markers. 2018;2018:8906023. https://doi.org/10.1155/2018/8906023 Protein induced by vitamin K absence or antagonist-II versus alpha-fetoprotein in the diagnosis of hepatocellular carcinoma: a systematic review with meta-analysis GALAD demonstrates high sensitivity for HCC surveillance in a cohort of patients with cirrhosis GALAD score detects early hepatocellular carcinoma in an international cohort of patients with nonalcoholic steatohepatitis DCP as Biomarkers for Detection of Hepatocellular Carcinoma (HCC): A Phase 3 Biomarker Study in the United States Search for effective serum tumor markers for early diagnosis of Hepatocellular Carcinoma Associated with Hepatitis C Zakhary NI, Khodeer SM, Shafik HE, Abdel Malak CA. Impact of PIVKA-II in diagnosis of hepatocellular carcinoma. J Adv Res. 2013;4(6):539–46. https://doi.org/10.1016/j.jare.2012.10.004 Simão A, Madaleno J, Silva N, Rodrigues F, Caseiro P, Costa JN, Carvalho A. Plasma osteopontin is a biomarker for the severity of alcoholic liver cirrhosis, not for hepatocellular carcinoma screening. BMC Gastroenterol. 2015;15:73. https://doi.org/10.1186/s12876-015-0307-1 Ertle JM, Heider D, Wichert M, Keller B, Kueper R, Hilgard P, Gerken G, Schlaak JF. A combination of α-fetoprotein and des-γ-carboxy prothrombin is superior in detection of hepatocellular carcinoma. Digestion. 2013;87(2):121–31. https://doi.org/10.1159/000346080 Park H, Park JY. Clinical significance of AFP and PIVKA-II responses for monitoring treatment outcomes and predicting prognosis in patients with hepatocellular carcinoma. Biomed Res Int. 2013;2013:310427. https://doi.org/10.1155/2013/310427 Lee Q, Yu X, Yu W. The value of PIVKA-II versus AFP for the diagnosis and detection of postoperative changes in hepatocellular carcinoma. J Interv Med. 2021;4(2):77–81. https://doi.org/10.1016/j.jimed.2021.02.004 Johnson PJ, Innes H, Hughes DM, Kalyuzhnyy A, Kumada T, Toyoda H. Evaluation of the aMAP score for hepatocellular carcinoma surveillance: a realistic opportunity to risk stratify. Br J Cancer. 2022;127(7):1263–9. https://doi.org/10.1038/s41416-022-01851-1 Capurro M, Wanless IR, Sherman M, Deboer G, Shi W, Miyoshi E, Filmus J. Glypican-3: a novel serum and histochemical marker for hepatocellular carcinoma. Gastroenterology. 2003;125(1):89–97. https://doi.org/10.1016/s0016-5085(03)00689-9 GP73 expression and its significance in the diagnosis of hepatocellular carcinoma: a review Zhao S, Long M, Zhang X, Lei S, Dou W, Hu J, Du X, Liu L. The diagnostic value of the combination of golgi protein 73, glypican-3 and alpha-fetoprotein in hepatocellular carcinoma: a diagnostic meta-analysis. Ann Transl Med. 2020;8(8):536. https://doi.org/10.21037/atm.2020.02.89 A novel blood-based panel of methylated DNA and protein markers for detection of early-stage Hepatocellular Carcinoma Zhu HT, Liu RB, Liang YY, Hasan AME, Wang HY, Shao Q, Zhang ZC, Wang J, He CY, Wang F, Shao JY. Serum microRNA profiles as diagnostic biomarkers for HBV-positive hepatocellular carcinoma. Liver Int. 2017;37(6):888–896. https://doi.org/10.1111/liv.13356 Wen Y, Han J, Chen J, Dong J, Xia Y, Liu J, Jiang Y, Dai J, Lu J, Jin G, Han J, Wei Q, Shen H, Sun B, Hu Z. Plasma miRNAs as early biomarkers for detecting hepatocellular carcinoma. Int J Cancer. 2015;137(7):1679–90. https://doi.org/10.1002/ijc.29544 Download references This study was supported by the Spring City Plan: the High-level Talent Promotion and Training Project of Kunming (project number: 2022SCP002) Kepu Zheng and Leiyang Dai contributed equally to this study Department of Hepato-Biliary-Pancreatic Surgery The Affiliated Calmette Hospital of Kunming Medical University All authors designed the study and were responsible for project management and implementation All authors collected the data and performed the data analysis and the final statistics and made the figures and tables All authors wrote the manuscript and proof read the manuscript Kepu Zheng and Jianghua Ran submitted the manuscript This research was approved by the Affiliated Calmette Hospital of Kunming Medical University (The First People’s Hospital of Kunming) ethics committee and conducted in accordance with the hospital’s guiding principles unless otherwise stated in a credit line to the data Download citation DOI: https://doi.org/10.1186/s12876-023-02900-6 The event was attended by the managing board along with Aviagen KFT team members -- Barbara Boka Regional Technical Manager; and Krisztina Nemeth "From the last broiler to the end of the brooding period," offered valuable management guidance to ensure a successful transition of chicks to the next stages of production Pivka Assistant Production Manager commented "We are proud of our outstanding broiler growers The awards prove that we are committed to our mission and that our primary focus is the care of our animals." Dejan was impressed with Pivka's accomplishments "Despite the challenges faced by today’s producers our birds achieve improved results year on year and working together with the excellent farm management of Pivka they continue to reach award-worthy heights in efficiency Global Ag Media provides a knowledge sharing platform offering premium news analysis and information resources for the global agriculture industry Sign up to our regular newsletter and access news from across the Global AG Media network Over 5,000 viewers attended the reenactment of the historic encounter between US and Soviet troops on the Elbe River in April 1945: this was the highlight of the Military Festival held in Pivka (Slovenia) from September 11th to 17th a small Slovenian town near the Italian border The Park is a museum exhibition located in the buildings of the Pivka barracks (Komanda) built in the 1930s by the Italians and occupied after 1945 by the JNA (Jugoslovenska Narodna Armija Inside the museum you can find not only the history of the individual and team weapons used from the Second World War to date but also an extraordinary collection of armored vehicles especially those of the armies of the Eastern Bloc the Pivka Museum organizes every year the Festival of Military History on the third weekend of September The Festival takes place in the large clearing behind the barracks complex re-enactors of all ages from all over the country and abroad meet to stage firefights or sword fightings encamping in the vast woodland surrounding Pivka still untouched and creating a truly evocative setting The festival is multi-thematic: you can find Roman and medieval reenactors return to rumble on dirt roads and trenches (even during the year you can get into some of the armored vehicles and tanks that are in Pivka) the re-enactment was centered on the historic encounter between US and Soviet troops on the Elbe River in April 1945 despite the bad weather many people attended the reenactment During the “battle” hundreds of blank shots were fired on the German and allied side one T34 tank and one M36 Jackson tank destroyer were used to represent the Red Army and the US forces respectively Remote controlled explosions then helped make the scene even more realistic simulating the artillery shots Deutschlandinfo@vsmedien.de International contact to all4shooters.com:info@all4shooters.com The international editorial team General Terms and Conditions Terms of Use Colophon Contacts Privacy Policy Metrics details Although vitamin K deficiency has been implicated in adult inflammatory bowel disease (IBD) its prevalence in pediatric IBD remains unknown We carried out a cross-sectional study in 63 children with Crohn's disease (CD) and 48 with ulcerative colitis (UC) to assess the prevalence of vitamin K deficiency and to search for potential correlation between vitamin K status and pediatric IBD activity Vitamin K status was assessed using protein induced by vitamin K absence-II (PIVKA-II; ELISA) Prevalence of vitamin K deficiency was 54.0% in CD and 43.7% in UC Vitamin K deficiency was more common in patients with higher CD activity in CD patients with higher mass Z-scores and less common among children with CD treated with infliximab Relation of vitamin K deficiency to pediatric IBD clinical course and treatment demand further research vitamin K status has not been investigated in children with IBD so far The aim of this study was to assess the prevalence of vitamin K deficiency and its correlates in children with Crohn's disease (CD) and ulcerative colitis (UC) The Pediatric Crohn's Disease Activity Index (A) and Truelove-Witts (B) scores in children with and without vitamin K deficiency as well as the minimum and maximum values are shown The asterisk denotes statistical significance (p = 0.04) The prevalence of vitamin K deficiency was 28.6% in children with CD receiving infliximab and 61.2% in children with CD not receiving biological therapy (χ2 The median PCDAI scores in CD patients receiving infliximab and in children not treated with infliximab did not differ (14.5 [12.5–17.5] and 20.0 [10.0–42.5] Significant differences in body mass Z-scores of vitamin K-sufficient and vitamin K-deficient CD patients were also noted (p = 0.04) Higher prevalence of vitamin K deficiency in CD patients treated with corticosteroids was statistically non-significant (χ2 Body mass Z-score values in vitamin K-deficient children with UC were not significantly lower than in vitamin K-sufficient children with UC (p = 0.07) PIVKA-II levels positively correlated with PCDAI scores (σ = 0.37 PIVKA-II concentrations did not correlate with longer CD duration (σ = −0.22 p = 0.08) and patients' body mass Z-scores (σ = 0.17 No variables correlated with PIVKA-II levels in children with UC In univariate logistic regression models the probability of vitamin K deficiency increased with higher PCDAI scores (OR = 1.04 higher body mass Z-scores predicted vitamin K deficiency in children with CD (OR = 1.64 For all other continuous variables analyzed p was 0.09 or greater Multiple regression analyses in CD and UC did not yield any significant results (p ≥ 0.10 for all factors) vitamin K deficiency should lead to a more severe IBD course and more pronounced undernutrition and malabsorption PCDAI scores positively correlated with PIVKA-II levels indicating greater prevalence of vitamin K deficiency in patients with more active CD Although the results obtained do not seem to lend support to the hypothesis that vitamin K deficiency plays a causative role in the pathogenesis of IBD it needs to be underscored that this is a separate question that the study presented did not address Vitamin K deficiency was less common in patients receiving infliximab This fact points to a possibility that vitamin K status in CD reflects the intensity of inflammation Further research is needed to clarify whether biological therapy influences vitamin K status in children with Crohn's disease no studies on the relationship between anti-TNF therapies and vitamin K status have been published so far It is interesting that while body mass Z-scores of vitamin K-deficient children with CD were higher compared to those who were vitamin K-sufficient body mass Z-scores in vitamin K-deficient patients with UC were lower than in those who were vitamin K-sufficient The reasons for higher Z-scores in vitamin K-deficient patients with CD remain unclear vitamin K status was not analyzed directly It remains an open question if direct measurement of vitamin K concentration in the blood would be more clinically relevant than the measurement of PIVKA-II concentration Different vitamin K levels may lead to vitamin K sufficiency in different patients the estimation of vitamin K status using PIVKA-II concentrations may present an advantage in that it reflects a lack of vitamin K cofactory function enabling for carboxylation of vitamin K-dependent compounds there are factors other than vitamin K status that influence PIVKA-II concentration and it cannot be ruled out that they are linked to IBD activity The cross-sectional character of the study did not allow for analysis of PIVKA-II concentrations' evolution along with disease activity changes No data on dietary intake of vitamin K were available If there are seasonal variations of vitamin K status as the patients were examined at different time points Vitamin K deficiency was highly prevalent in pediatric IBD In CD patients it correlated with a lack of infliximab treatment a higher pediatric CD activity and higher body mass Z-scores The inclusion criteria were: CD or UC diagnosed according to the aforementioned standards and age of 18 years at most The exclusion criteria were: liver disease not related to IBD Statistical analyses were performed in the R environment (version 2.14.1; The R Foundation for Statistical Computing Austria) and using STATISTICA 10 (StatSoft Inc. Wilcoxon rank sum test was used to compare subgroups of CD and CU patients who were vitamin K sufficient and vitamin K deficient Results obtained from logistic regression analysis Pearson's chi-squared test and Fisher's exact test are appropriately labeled The level of significance was set at p < 0.05 The study was conducted in accordance with the Declaration of Helsinki Informed and written consent was obtained from patients' parents and patients who were at least 16 years old The study design was approved by Poznan University of Medical Sciences Bioethical Committee Vitamin K status in patients with short bowel syndrome Vitamin K: the coagulation vitamin that became omnipotent The role of vitamin K in soft-tissue calcification Vitamin K and the nervous system: an overview of its actions an example of triage theory: is micronutrient inadequacy linked to diseases of aging Vitamin K-dependent carboxylation of osteocalcin: friend or foe Comparison of biochemical indexes for assessing vitamin K nutritional status in a healthy adult population Prevalence of subclinical vitamin K deficiency in Thai newborns: relationship to maternal phylloquinone intakes and delivery risk Prevalence of vitamin K deficiency in children with mild to moderate chronic liver disease Vitamin K status in peritoneally dialyzed patients with chronic kidney disease The effect of vitamin K supplementation on biochemical markers of bone formation in children and adolescents with cystic fibrosis Suboptimal vitamin K status despite supplementation in children and young adults with cystic fibrosis The effects of vitamin K insufficiency induced by oral anticoagulation Hypovitaminosis D and K are highly prevalent and independent of overall malnutrition in the institutionalized elderly The prevalence of vitamin K deficiency in chronic gastrointestinal disorders High prevalence of vitamin K and D deficiency and decreased BMD in inflammatory bowel disease Association of vitamin K deficiency with bone metabolism and clinical disease activity in inflammatory bowel disease Mechanism of cephalosporin-induced hypoprothrombinemia: relation to cephalosporin side chain A study of Vitamin K status in children on prolonged antibiotic therapy Use of cefoperazone still needs a caution for bleeding from induced vitamin K deficiency Vitamin K and vitamin D status: associations with inflammatory markers in the Framingham Offspring Study IBD Working Group of the European Society for Paediatric Gastroenterology Inflammatory bowel disease in children and adolescents: recommendations for diagnosis–the Porto criteria The second European evidence-based Consensus on the diagnosis and management of Crohn's disease: Definitions and diagnosis validation and evaluation of a pediatric ulcerative colitis activity index: a prospective multicenter study Development and validation of a pediatric Crohn's disease activity index Azathioprine or 6-mercaptopurine before colectomy for ulcerative colitis is not associated with increased postoperative complications Developmental standards of body height and weight in children and adolescents between 3-18 years of age in the city of Poznań Vitamin K1 versus vitamin K3 for prevention of subclinical vitamin deficiency: a randomized controlled trial Download references by a grant from Poznan University of Medical Sciences Department of Pediatric Gastroenterology and Metabolic Diseases Department of Pediatric Endoscopy and Gastrointestinal Function Testing Ludwik Rydygier Collegium Medicum in Bydgoszcz Gastroenterological and Endocrinological Surgery took part in data interpretation and drafted the manuscript provided the data and revised the manuscript took part in data interpretation and revised the manuscript All authors read and approved the final manuscript Download citation A report describes a case of a term neonate born who developed ecchymosis for two days heeded by altered sensorium and seizures on day 25 of life He had an uneventful perinatal transition and was exclusively breastfed The patient had received an intramuscular Vitamin K (1 mg) at birth and a repeat dose before referral Examination revealed bilateral grade III intraventricular hemorrhage He was administered blood products and antiseizure medication Laboratory investigation revealed high protein induced by vitamin K absence-II (PIVKA-II) The patient was administered twice weekly Vitamin K (parenteral followed by oral) for 6 wk He showed delayed milestones and spasticity at three months of follow-up and required ventriculoperitoneal shunt placement It was hypothesized that exclusive breastfeeding could have caused VKDB in the index case which was diagnosed by elevated PIVKA-II levels - a highly specific marker Bleeding in a Neonate and Role of Elevated PIVKA-II Levels Medtalks is India's fastest growing Healthcare Learning and Patient Education Platform designed and developed to help doctors and other medical professionals to cater educational and training needs and to discover discuss and learn the latest and best practices across 100+ medical specialties Also find India Healthcare Latest Health News & Updates on the India Healthcare at Medtalks This work, COANG Brig. Gen. Jerome Limoge first to see Yugoslavian MiG 21 display, by Maj. Kinder Blacke, identified by DVIDS, must comply with the restrictions shown on https://www.dvidshub.net/about/copyright This webpage uses Cookies and JavaScript in order to work properly We strongly recommend to enable those technologies in yur browser In case of wrongly displayed content you can request necessary information at e-mail address wwwadmin@mzv.cz Ambassador Juraj Chmiel emphasized the importance and value of NATO He supported military assistance to Ukraine and strongly condemned the Russian aggression the Mayor of Pivka and the Director of the Park of Military History and their entire staff for the warm welcome the Director of the Institute for Tourism Pivka as well as its cultural and historical background She presented the development of the municipality of Pivka over the last 30 years where the existence of the Yugoslav army barracks prevented tourism to a town that can be proud of its three exhibition centers which is even the most visited museum in Slovenia The director of the Park of Military History presented the history of the museum's development with which they have successfully preserved the rich military-historical heritage and used it for the benefit of tourism Pivka had only overcrowded roads with tourists going to the seaside He ended his speech by adding that this is the first event of this kind organized at the Park of Military History The meeting was followed by a tour of the Park of Military History led by the museum director Ambassadors were acquainted with the rich military history and since the museum is also designed as an experience center they took the opportunity to pilot the MIG 21 fighter aircraft and the Spitfire fighter aircraft on the simulator They were particularly impressed by the most attractive exhibit of the museum which was donated to the museum by Montenegro in 2011 The meeting ended in a pleasant atmosphere with a tasting of products from local companies Pivka and Delamaris Czechia to Send New Ambassador to Lebanon "Czech Support to Ukraine Will Continue," Minister Lipavský Assured Ukrainian Foreign Minister Sybiha World Press Freedom Day 2025 New Ambassadors to Jordan and Ukraine Text description provided by the architects. What is long-lasting and what is recycle friendly was one of the key questions we were able to follow in the project for a metal recycle plant, where they first accumulate and then separate different waste metals and prepare them for reuse. The project consists of an immense production plateau and two small buildings on the edge of it. © Miran KambičOn the other hand, the small 100% metal office building works as a very specific control deck supervising the weighing of the incoming waste and out-coming metals. Since this specificity means non-adaptability we had to allow for easy and clear on-site recycling when this building is not needed anymore. © Matevz PaternosterIn contrast to the very rough production that goes on at the site we have embedded some abstract or we like to think “poetic” content in the project but materially very different: one is made entirely out of concrete whereas the other is all steel – from structure to cladding Thus the two buildings speak about the context of material separation process of the metal recycle plant You'll now receive updates based on what you follow Personalize your stream and start following your favorite authors If you have done all of this and still can't find the email the Special Unit of the General Police Directorate took part in the international tactical exercise Pivka 2008 the international network of special intervention units in the European Union special units from other EU Member States joined their Slovenian colleagues in the exercise (ten officers each from Austria's Cobra unit Poland's Boa unit and Lithuania's Aras unit) Two representatives of Slovakia's Lynx unit and Portugal's Goa unit also took part within the context of the structures working group The exercise was observed by police director general Jože Romšek and his deputy Matjaž Šinkovec (in the photograph with the deputy commander of the Special Unit Milan Pleško) Members of these units underwent training at several locations in Slovenia (Pivka The exercise included a simulation of a mass hostage-taking situation involving the use of explosives Special Unit commander Marjan Anzeljc considered the exercise a success: the 'specials' disarmed the terrorists and rescued the hostages demonstrating a high level of professionalism and training and excellent readiness for demanding situations of this kind Police surround the building occupied by terrorists Members of Aras about to enter the room where the hostages are being held Rapid action by officers of Slovenia's Special Unit Members of Austria's Cobra unit keeping guard Members of Polish special unit BOA disarming the terrorists A bomb squad officer from the Special Unit searches a terrorist