Volume 9 - 2021 | https://doi.org/10.3389/fped.2021.628265 Teratoma in the medulla oblongata is extremely infrequent and has been rarely reported Severe and sustained brain stem compression resulting from these granitic tumors may cause potentially fatal impairment we reported a novel case of teratoma that occurred in the medulla oblongata This 15 year-old boy suffered from a progressive gait disturbance and weakness of limbs for nearly 13 years Magnetic Resonance Imaging (MRI) revealed an unusual mixed mass in the medulla oblongata and C1-2 spine which was confirmed as mature teratoma by histopathological examination followed by postoperative continuous rehabilitation this patient is currently able to mobilize with sticks surgical removal is still the preferred treatment for teratoma Surgery resection is essential but challenging the outcome of teratoma in medulla oblongata remains poor Prognosis varies depending on the excision of the tumor the clinical outcome of teratoma in the medulla oblongata proved to be undesirable A high signal intensity rims around a low signal intensity core on T1-weighted and a low signal intensity rims around a high signal intensity core on T2-weighted images A heterogeneous enhanced lesion was displayed on contrast-enhanced T1-weighted images Digital subtraction angiography (DSA) excluded the possibility of vascular malformation Neurological examination revealed bilateral 4/5 strength of lower limbs and increased muscle tension with normal deep tendon reflexes in both upper and lower limbers but deep and superficial sensations were normal Preoperative biomarkers in serum including Alpha-fetoprotein (AFP 1.02 ug/L) and beta subunit human chorionic gonadotropin (β-HCG (A) CT of the brain demonstrates the mass filled with calcified components extending to the medulla oblongata and C1 spine was displayed on T1-weighted sagittal image (C) A neurosurgery was performed via a midline sub-occipital approach (D) Osteoid components were removed during operation (E,F) Photomicrographs showing the bone structure and lipid dropletof the lesion (H,E) original magnification × 100 and × 200 (G) Postoperative enhanced MRI showed no residual or recurrence at three months of fellow up The patient underwent a craniotomy via a midline sub-occipital approach in prone position A vertical skin incision was made from the external occipital protuberance to the C2 spinous process The foramen magnum was opened and then C1-2 laminectomy was performed a slightly swollen medulla oblongata was exposed An ossified crust surrounded by soft material and partial calcified portion were visible We carefully isolated the tumor border from the brain stem and performed a complete removal of the intramedullary lesion The patient tolerated the procedure well without any neurological deterioration Pathological examination (Figure 1) found well-differentiated bone tissue some squamous epithelium and fatty tissue within the mass A final diagnosis of mature teratoma based on neuro-imaging findings and maturely differentiated components was carefully made by three different experienced pathologists the strength of the right limbs recovered to 4+/5 with normal muscle tone the boy received hyperbaric oxygen therapy and exercise-based rehabilitation and passive mobility training of left limbs the strength of the left limbs had improved progressively he is able to walk independently without any evidence of tumor recurrence Sixty percent of patients (3 of 5) have got the gross total resection and the others underwent chemo-radio-therapy after subtotal resection Based on the particularly high risk of neurosurgical removal follow up of these five cases has shown poor prognosis because of the intracranial infection or tumor regrowth Literature review of reported cases of primary teratoma in medulla oblongata for those tumors which show immature or malignant component postoperative adjuvant treatment should be reserved there was no positive biomarkers in serum that could make sure of mature teratoma specifically we failed to detect the relevant markers in patient's CSF which may have missed some meaningful results the gold standard still depends on the postoperative pathological findings his parents had been delayed for many years to decide the operation and the symptoms developed to a more serious situation this study was a retrospective study performed in a single case and the follow-up duration was not long enough for benign tumors As well as the extremely low incidence of this disease there was ineluctable statistical deviation in the literature review It is necessary to conduct related cases in the future for further summary This study retrospected an extremely rare case of mature teratoma in the medulla oblongata early surgical resection with the capsule maintained intact is a preferable option before irreversible neurological dysfunction occurs The surgeon needs to maintain the balance between the degree of tumor resection and the preservation of neurological function a long-term follow-up and further summary of related cases in the future is required to obtain a definite prognosis further studies focusing on biological characteristics are needed which can help the management of this tumor in the medulla oblongata The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number (s) can be found in the article/Supplementary Material Written informed consent was obtained from the individual (s) and minor (s)' legal guardian/next of kin for the publication of any potentially identifiable images or data included in this article TX and HW: revising it critically for important intellectual content TX and JC: provide approval for publication of the content All authors contributed to the article and approved the submitted version The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fped.2021.628265/full#supplementary-material The 2016 World Health Organization classification of tumours of the central nervous system CrossRef Full Text | Google Scholar Malignant teratoma of the medulla oblongata in an adult male Intracranial midline dermoid and epidermoid cysts in children Huge intradural ossification caused by a mature spinal teratoma: case report Diagnostic sensitivity of serum and lumbar CSF bHCG in newly diagnosed CNS germinoma AFP/beta-HCG secreting CNS germ cell tumors: long-term outcome with respect to initial symptoms and primary tumor resection Primary intracranial germ cell tumors: a clinical analysis of 153 histologically verified cases Metachronous mature teratoma in the corpus callosum occurring 12 years after a pineal germinoma Mature teratoma arising from the sella–case report CrossRef Full Text | Google Scholar Intracranial cysts: radiologic-pathologic correlation and imaging approach PubMed Abstract | CrossRef Full Text | Google Scholar Google Scholar Mature teratoma incidentally found in the sylvian fissure: a report of an autopsy case PubMed Abstract | Google Scholar T2*-based MR imaging (gradient echo or susceptibility-weighted imaging) in midline and off-midline intracranial germ cell tumors: a pilot study CT and MRI features of intracranial germ cell tumors Treatment and outcomes of primary intracranial teratoma The growing teratoma syndrome after subtotal resection of an intracranial nongerminomatous germ cell tumor in an adult: case report Intracranial germ-cell tumors: natural history and pathogenesis Xu T and Chen J (2021) “Bones in the Medulla Oblongata?”—A Case Report of Intracranial Teratoma and Review of the Literature Received: 11 November 2020; Accepted: 07 April 2021; Published: 05 May 2021 Copyright © 2021 Zhang, Wang, Hong, Xu and Chen. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) distribution or reproduction in other forums is permitted provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited in accordance with accepted academic practice distribution or reproduction is permitted which does not comply with these terms *Correspondence: Juxiang Chen, anV4aWFuZ2NoZW5Ac21tdS5lZHUuY24=; Tao Xu, eHV0YW9Ac21tdS5lZHUuY24= †These authors have contributed equally to this work Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher 94% of researchers rate our articles as excellent or goodLearn more about the work of our research integrity team to safeguard the quality of each article we publish Metrics details Kidney organoids are connected to the host circulation and mature after transplantation they are still immature compared to the adult kidneys and their precise maturation stages remain unclear By transplanting the mouse embryonic kidney as a model system for organoid transplantation we report here the maturation defects of the graft Single cell profiling of the developing kidneys in vivo identified gene sets associated with the maturation of the collecting duct epithelium and medullary stroma These data revealed an upregulation of genes associated with channel/transporter functions and immune defense as well as a downregulation of neuronal genes we found that the maturation of the collecting duct and medullary stroma in the grafts barely corresponds to the perinatal stage which was confirmed histologically by using representative genes the gene sets obtained serve as maturation coordinates for the renal medulla and will be helpful in analyzing its maturation defects after transplantation They will also provide a useful basis for further maturation of transplanted kidney organoids but the maturation status of the renal medulla remains unclear we extend our scRNA-seq analysis to 7 days after birth (P7) and focus mainly on the maturation of the renal medulla namely the collecting ducts and medullary stroma We identified many maturation-dependent genes in these cell types in the renal medulla in vivo and application of these maturation coordinates to the transplanted embryonic kidneys revealed maturation defects in the medulla We also selected representative gene markers for histologic evaluation at a high resolution we investigated the possible causes of medullary maturation defects after transplantation Morphologic characteristics of the graft do not match those of the neonatal kidney (a) Transplantation of E12.5 kidneys into the peri-testicular fat The left panel shows a planned transplant site (dotted circle) The middle and right panels show the transplanted embryonic kidneys at day 12 the surface membrane of the graft was removed to visualize the overall appearance of the graft the surface membrane was left intact to visualize the host blood vessel extending toward the graft (b) Size of the grafts and embryonic kidneys The major and minor axis lengths of the transplanted embryonic kidneys (at day 12) were compared with those of the E15.5 and P0 kidneys (n = 15 Multiple comparisons were performed using Dunnett’s T3 test Fifteen grafts from eight independent transplantation experiments were analyzed (c) Histologic analysis of the E15.5 and P0 kidneys and day 12 grafts 1st column: Hematoxylin and eosin (H&E) staining Scale bars: 500 μm; 2nd column: Immunostaining of SLC12A1 (loops of Henle) Scale bars: 500 μm; 3rd and 4th columns: magnified images of the 2nd column Three grafts from three independent transplantation experiments were analyzed NP: nephron progenitor; Pod: podocyte; PT: proximal tubule; LoH: loop of Henle; DT: distal tubule; UB: ureteric bud; CD: collecting duct; EC: endothelial cell; Mφ: macrophage; Ren: renin cell; Mes: mesangial cell; SP: stromal progenitor; iMS: inner medullary stroma; oMS: outer medullary stroma (b) Volcano plots showing the differentially expressed genes between the renal medulla (CD Red circles: representative genes that are more abundantly expressed at E15.5 Blue circles: representative genes that are more abundantly expressed at P7 (c) CNET plots showing the differentially expressed genes between the renal medulla (CD (d) Heatmaps of the developing kidneys (E15.5 and P7) using the top 200 maturation coordinates The representative genes are listed on the right side of the heatmaps for each cell type the decreased proliferation of differentiating nephrons together with the disappearance of the nephrogenic niche may at least partially explain the reduced graft size these gene sets will serve as promising coordinates for assessing the maturation stages of the renal medulla of developing kidneys in vivo and possibly of transplants Maturation coordinates place the graft medulla in the perinatal stage (a) Heatmaps of the developing kidneys and grafts (day 8 and 12) using the top 200 maturation coordinates Results for each medullary cell type are shown (CD (b) Volcano plots showing the differentially expressed genes between the day 12 graft and P7 kidney Red circles: representative genes that are more abundantly expressed in the graft Blue circles: representative genes that are more abundantly expressed in the P7 kidney (c) UMAP plots of the representative maturation coordinates for the renal medulla Blue arrowheads: CD; red arrowheads: innermost MS; purple arrowheads: oMS; green arrowheads: iMS It would be intriguing if prostaglandins and hypoxia were related to medullary elongation and maturation although their functional roles in the iMS remain elucidated the use of maturation coordinates suggests that the day 12 grafts may correspond to the perinatal stage Histologic evaluation using maturation markers validates the graft medulla as perinatal stage (a) In situ hybridization of maturation markers for the CD (Aqp4 and Aqp2) at E15.5 (b) In situ hybridization of the CD maturation markers in the P0 kidney and the day 12 graft 2nd and 3rd rows: magnified images of the 1st row Two grafts from two independent transplantation experiments were analyzed (c) In situ hybridization of maturation markers for the iMS (Hif1a and Ptgs2) at E15.5 2nd row: magnified images of the medulla in the 1st row 3rd row: magnified images of the cortex in the 1st row Ptgs2 is also expressed in the macula densa of the cortex (d) In situ hybridization of the iMS maturation markers in the P0 kidney and the day 12 graft (e) In situ hybridization of neuronal genes at E15.5 2nd row: magnified images of the medulla and cortex in the 1st row Scale bars: 100 μm; 3rd row: magnified images of the cortex in the 1st row Gria1 is expressed in stromal progenitor at E15.5 and P0 (f) In situ hybridization of neuronal genes in the E15.5 kidney and the day 12 graft the expression of Ptgs2 in the cortex remained relatively constant and was also detected in the transplants Administration of the HIF1 activator does not ameliorate medullary maturation defects The treated and untreated grafts transplanted into the peri-testicular fat were compared histologically at day 12 after transplantation of E12.5 kidneys Two independent transplantation experiments were performed (two grafts in each condition per experiment) (a) H&E staining of the grafts with and without Roxadustat treatment (b) In situ hybridization of the CD maturation markers (Aqp4 and Aqp2) in the grafts with and without Roxadustat treatment (c) In situ hybridization of the iMS maturation markers (Hif1a and Ptgs2) in the grafts with and without Roxadustat treatment (d) In situ hybridization of the neuronal genes (Cntn6 and Gria1) in the grafts with and without Roxadustat treatment We also speculated that there may be differences in circulating hormones between male and female hosts E12.5 kidneys were transplanted into the peri-ovarian fat of adult female mice (Fig S9a) and compared with grafts in male peri-testicular fat no obvious differences in the expression of maturation marker genes were observed in the CD the markers we selected served as useful coordinates for assessing the maturation status of the grafts Organ maturation is an important aspect of developmental biology transplantation is a common approach to facilitate the maturation of pluripotent stem cell-derived organoids currently available kidney organoids remain immature in vitro and even after transplantation we used embryonic kidney transplantation as a model system for organoid transplantation we identified maturation coordinates for the renal medulla (collecting ducts and medullary stroma) and used them to assess the maturation status of the transplanted embryonic kidneys there may be some redundant roles in immature stromal cells At least a decrease of such neuronal genes clearly correlates with stromal maturation It would be informative to see the medullary development/maturation in these rats and pigs as a similar surgical procedure in mice is technically difficult due to their small size should be identified to generate mature kidney organoids we have identified the maturation coordinates of the renal medulla and the impaired maturation of the transplanted embryonic kidney will serve as a basis to elucidate the mechanism of maturation and to generate functionally mature kidney organoids C57BL/6J mice and ICR mice were purchased from Japan SLC and immunodeficient mice (NOD.CB17-Prkdcscid /J) were purchased from KBT Oriental The mice were housed in a specific pathogen-free animal facility All animal experiments were performed in accordance with our institutional ethical guidelines and approved by the licensing committee of Kumamoto University (approval numbers: A2021-008 Mice were euthanized by intraperitoneal injection of 0.75 mg/kg medetomidine and 5.0 mg/kg butorphanol followed by cervical dislocation Two independent transplantation experiments (two grafts in each condition per experiment) were performed for Fig For the additional transplantation experiments E12.5 embryonic kidneys with a cloaca from the ICR pregnant mice were transplanted into the testicular fat of the male NOD.CB17-Prkdcscid /J mice (8- week-old) and harvested at day 8 and 12 after transplantation Dissociation of E15.5, E17.5, and P0 kidneys were described previously18 Grafts harvested on days 8 and 12 were dissociated using a similar method for the P0 kidney the grafts were digested with dissociation buffer comprising 2 mg/ml collagenase (Sigma; Cat#9407) 2.4 U/ml dispase II (Roche; Cat# 04942078001) and 10% fetal calf serum (FCS) (Sigma; Cat# 172012) in Dulbecco’s modified Eagle’s medium (DMEM) (Sigma; Cat# D5796) for 20 min at 37 °C washed with phosphate-buffered saline (PBS) and treated with 0.25% trypsin/EDTA 37 °C for 10 min the kidney was digested with dissociation buffer comprising 300U/ml collagenase Type I (Worthington; Cat# LS004194) 50 U/ml DNase I (Worthington #LS002139) in Hanks’ balanced salt solution (HBSS) (Thermo; Cat# 14185-052) for 20 min at 37 °C followed by treatment with 0.25% trypsin/EDTA at 37 °C for 10 min The Q30 base RNA reads (Q-scores indicating sequencing quality) of the samples were 86.2% for E15.5 and cluster-specific markers obtained were exported as csv files for confirmation analysis using Loupe Cell Browser software (10x Genomics) Paraffin sections were subjected to antigen retrieval in 10 mM citrate buffer (pH 6.0) after the deparaffinization The sections were washed three times with PBS and blocked by incubation with 1% BSA in PBS for 1 h at room temperature The sections were incubated with primary antibodies at 4 °C overnight followed by incubation with secondary antibodies conjugated with Alexa Fluor 488 Cell nuclei were counterstained with 4,6-diamidino-2-phenylindole (Roche) The following primary antibodies were used: mouse anti-E-cadherin (CDH1) (BD; 610181; 1:100); rabbit anti-NKCC2 (SLC12A1) (StressMarq Bioscience; SPC-401D; 1:100); rat anti-CK8 (KRT8) (DSHB; 11562-1-AP; 1:20) Fluorescence images were captured with a confocal microscope (TSC SP8; Leica) Whole-mount immunostaining was performed previously described with some minor modifications45 and 75% methanol/ H2O for 10 min each at room temperature and then in methanol with 20% DMSO overnight on a shaker at 4℃ and 25% methanol/ H2O for 60 min each at room temperature and then washed three times with 1% Triton X-100 in PBS for 5 min at room temperature The washed samples were placed in PBS containing 0.3 M glycine and 20% DMSO for 3 h at room temperature and then blocked in PBS containing 10% goat serum (Nippon Bio-Test Laboratories) and 10% DMSO overnight on a shaker at room temperature After washing in PBS containing 1% TritonX-100 and 10 µg/ mL heparin (PTrH) twice for 60 min at room temperature the tissues were incubated with primary antibodies conjugated with rabbit anti-E-cadherin (Cell Signaling; 3195; 1:50) and rat anti-CD31 (BD; 557355; 1:20) in PBS containing 10% goat serum The samples were washed with PTrH for 1 day at 4 °C and then incubated with secondary antibodies conjugated with Alexa Fluor 488 and 568 (1:100) overnight at 4 °C The tissues were washed with PTrH for two days at 4 °C The samples were serially dehydrated with 50% and 100% ethanol for 60 min each at 4 °C and cleared with ethyl cinnamate (Sigma-Aldrich) for more than 30 min at room temperature Three-dimensional fluorescence images were captured using a confocal microscope (TSC SP8; Leica) and reconstructed using LAS X (Leica) software and Imaris (Bitplane) Signal amplification was performed with TSA plus fluorophores (Thermo Fisher Scientific) The following RNAscope probes were used: Wnt7b (401131) The host mice received daily intraperitoneal injections of 10 or 25 mg/kg/day Roxadustat from day 2 to day 11 after transplantation The grafts at day 12 were compared histologically between those with and without Roxadustat treatment 8-week-old male mice received daily intraperitoneal injections of vehicle alone or 25 mg/kg/day Roxadustat for 10 days (n = 5 and 3 Mice were anesthetized by intraperitoneal injection of 0.75 mg/kg medetomidine Blood samples were collected from the inferior vena cava Blood hemoglobin levels were analyzed using an i-STAT1 analyzer with an EG6 + cartridge (Abbott We assumed that our sample data were normally distributed for the analysis of the three groups Bartlett’s test was performed to determine the equality of variances among the three groups If the variances were not significantly equal multiple comparisons were performed using Dunnett’s T3 test Differences with values of p<0.05 were considered statistically significant The asterisk (*) represents the p-value of the statistical test One asterisk indicates that the p-value is less than 0.05 Four asterisks indicate that the p-value is less than 0.0001 This analysis was performed using GraphPad Prism 10 (GraphPad Software Advances and challenges toward developing kidney organoids for clinical applications Human kidney organoids: Progress and remaining challenges Lower urinary tract development and disease Redefining the in vivo origin of metanephric nephron progenitors enables generation of complex kidney structures from pluripotent stem cells Directing human embryonic stem cell differentiation towards a renal lineage generates a self-organizing kidney Kidney organoids from human iPS cells contain multiple lineages and model human nephrogenesis Nephron organoids derived from human pluripotent stem cells model kidney development and injury Modelling kidney disease with CRISPR-mutant kidney organoids derived from human pluripotent epiblast spheroids Higher-order kidney organogenesis from pluripotent stem cells Comparative analysis and refinement of human PSC-derived kidney organoid differentiation with single-cell transcriptomics Human induced pluripotent stem cell-derived podocytes mature into vascularized glomeruli upon experimental transplantation Generation of functioning nephrons by implanting human pluripotent stem cell-derived kidney progenitors Renal subcapsular transplantation of PSC-derived kidney organoids induces neo-vasculogenesis and significant glomerular and tubular maturation in vivo Generation of human renal vesicles in mouse organ niche using nephron progenitor cell replacement system Generation of the organotypic kidney structure by integrating pluripotent stem cell-derived renal stroma Molecular detection of maturation stages in the developing kidney Postnatal development and progression of renal dysplasia in cyclooxygenase-2 null mice Oxygen sensing by metazoans: The Central role of the HIF hydroxylase pathway The effect of HIF on metabolism and immunity RNAscope: A novel in situ RNA analysis platform for formalin-fixed LTP requires a reserve pool of glutamate receptors independent of subunit type Impaired motor coordination in mice lacking neural recognition molecule NB-3 of the contactin/F3 subgroup Neural recognition molecules CHL1 and NB-3 regulate apical dendrite orientation in the neocortex via PTPα A Wnt7b-dependent pathway regulates the orientation of epithelial cell division and establishes the cortico-medullary axis of the mammalian kidney Wnt7b signaling from the ureteric bud epithelium regulates medullary capillary development Oral hypoxia–inducible factor prolyl hydroxylase inhibitor roxadustat (FG-4592) for the treatment of anemia in patients with CKD HIF-α activation by the prolyl hydroxylase inhibitor roxadustat suppresses chemoresistant glioblastoma growth by inducing ferroptosis Hypoxia-inducible factor upregulation by roxadustat attenuates drug reward by altering brain iron homoeostasis Generation of functional chimeric kidney containing exogenous progenitor-derived stroma and nephron via a conditional empty niche Generation of interspecies limited chimeric nephrons using a conditional nephron progenitor cell replacement system Organoids from nephrotic disease-derived iPSCs identify impaired NEPHRIN localization and slit diaphragm formation in kidney podocytes R: A language and environment for statistical computing Integrating single-cell transcriptomic data across different conditions Comprehensive integration of single-cell data Statistical significance of variables driving systematic variation in high-dimensional data Publication-ready volcano plots with enhanced colouring and labeling Korotkevich, G., Sukhov, V., Budin, N., Atryomov, M. N. & Sergushichev, A. Fast gene set Enrich. Anal. bioRxiv 060012 doi:https://doi.org/10.1101/060012 (2021) DOSE: An R/Bioconductor package for disease ontology semantic and enrichment analysis A web-based integrative transcriptome analysis uncovers the cell/tissue type-dependent action of sulforaphane rapid method to immunolabel large tissue samples for volume imaging Download references members of the Liaison Laboratory Research Promotion Center Institute of Molecular Embryology and Genetics We also thank all members of the Nishinakamura laboratory for helpful discussions Shunsuke Tanigawa & Ryuichi Nishinakamura Kumamoto University Graduate School of Medical Sciences interpretation of the studies and analysis of the data and review of the manuscript R.N.; project administration and supervision The authors declare no competing interests Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations Below is the link to the electronic supplementary material Download citation DOI: https://doi.org/10.1038/s41598-024-81984-w Anyone you share the following link with will be able to read this content: a shareable link is not currently available for this article Sign up for the Nature Briefing newsletter — what matters in science The dates displayed for an article provide information on when various publication milestones were reached at the journal that has published the article activities on preceding journals at which the article was previously under consideration are not shown (for instance submission All content on this site: Copyright © 2025 Elsevier B.V., its licensors, and contributors. All rights are reserved, including those for text and data mining, AI training, and similar technologies. For all open access content, the relevant licensing terms apply. News & Analysis on Cosmetics Innovation 02-Apr-2025 Last updated on 02-Apr-2025 at 02:19 GMT The brand is owned by Tokyo-based start-up SPARTY Inc, which has established a D2C business model grounded in personalisation, spanning skin care and hair care to dietary supplements. MEDULLA customises hair care formulas, products, and usage method recommendations based on an individual’s hair and scalp condition, concerns and preferences, which are submitted through a questionnaire on its website. According to data accumulated from approximately 500,000 users, it was found that many people suffer from everyday damage like split ends and tangles, as well as severe damage caused by colouring and bleaching. Leveraging this information, the brand has developed a serum shampoo called ME-Drip RESQUE SHAMPOO, aimed at addressing these issues. “This shampoo is formulated with top-quality ingredients inspired by aesthetic medicine and skin care. Additional treatment is not required, which will delight the ‘bath-cancelling community (風呂キャンセル界隈)’ who would rather spend time on other things than on beauty. It also achieves the time-effectiveness sought after [by consumers],” the brand said. Bathing is an important and deeply ingrained part of Japanese culture. The bath-cancelling community refers to people who actively choose to skip taking a bath, often due to fatigue or mental health issues, such as anxiety and depression. The term was coined on social media when many people, particularly among the younger generation, started relating to the topic and sharing their experiences. MEDULLA added that one of the key features of its new product is the packaging — a drip bag-like pouch that comes with an S-hook, so it can be easily hung in the bathroom. It not only saves space, but is also handier to use than check valve tubes, which typically require squeezing to get the product out. The pouch can be hung to save space and the hassle of "squeezing" to get the shampoo. (MEDULLA)Cleanse and repairME-Drip RESQUE SHAMPOO is said to boast the “highest-quality ingredients among the brand’s products” that work together to help build the hair’s resilience. It uses a “polypeptide (PPT) surfactant” that replenishes the protein in hair and is less irritating to the skin. As the main ingredient, it cleanses and repairs hair at the same time, resulting in a moist finish after washing. Specifically, the product is formulated with six types of keratin-derived ingredients, including liposome keratin, to repair “even the inner core (medulla) of damaged hair”. “Feather-derived keratin is converted into liposomes, allowing the active ingredient to be absorbed more quickly and effectively. It mends damaged hair, and smoothes and protects the surface of hair simultaneously.” Besides caring for the hair, it is also made with ingredients that claim to be beneficial for the scalp. These include “pink vitamin” (cyanocobalamin, a man-made form of vitamin B12) that provides anti-ageing care for both hair and scalp; polydeoxyribonucleotide (PDRN) produced using DNA extracted from fish ovaries, which enhances the scalp’s moisturising power while controlling sebum secretion; and a hybrid ingredient comprising acetyl tetrapeptide-3 (a biomimetic peptide) and red clover flower extract to maintain a healthy scalp with continued use. In addition, MEDULLA has adopted the trend of “bond-building hair care”, a beauty-from-within approach that focuses on fixing and strengthening broken bonds in hair fibres for heathier locks. “The shampoo contains propylenediammonium dimaleate, a popular bond care ingredient that will leave your hair feeling smooth and silky to the touch every time you use it. Even without a treatment product, it protects the cuticle and hair from damage caused by external friction, preventing split ends and breakage.” Its fruity-floral fragrance stems from a blend of rose, lily of the valley and peony scents, lightly layered with fresh lychee and lemon notes. Pre-sales began on February 20 on MEDULLA website’s, Amazon, and Rakuten, with the official launch set on March 1 at major LOFT and PLAZA stores across Japan. ‘We see massive gaps’: Australian DIY hair extension brand aims to capitalise on untapped market opportunities27-Jan-2025By Amanda LimDIY hair extension brand Muse For Hair is positioning itself to address significant gaps in the market, targeting diverse consumer groups and evolving hair trends. New Korean study finds botanical that fills gaps in hair loss treatments such as minoxidil 16-Jan-2025By Amanda LimAstragalus sinicus extract (ASE) addresses gaps in existing hair loss solutions by addressing inflammation, oxidative stress, and cellular signalling pathways. Hair raising: Top 10 stories on APAC hair care development in 202407-Jan-2025By Amanda LimCheck out this round-up of our biggest stories on hair care this year, featuring product news, market insights, and more. Global beauty insights and trends for 2025Paid for and content provided by Meiyume How is intelligent, localised innovation helping beauty brands gain an edge in the industry?Paid for and content provided by Meiyume Setting the stage: How strategic turnkey partnerships will redefine beauty brands in 2024Paid for and content provided by Meiyume This piece was originally published by Urbanet Former President of Cities Alliance Assembly In the Department of Antioquia in Colombia an unprecedented strategic plan has the potential to transform the reality of the department completely The new territorial development model Medulla is already considered an ambitious but necessary commitment for the future of Antioquia the plan leaves the great metropolises aside and focuses on the regions This means that the priority of planning is development-oriented to protecting life within the region in all its forms the Antioquia 2040 Agenda proposes a territorial development model involving three planned areas that aim to include the comprehensive potential of Antioquia and its people The three areas are known as Medulla the Long City of Four Hearts the Biodiverse Pacific Antioquia and the North Caribbean Antioquia The guiding lines proposed for the physical and social development of the territory are based on actions that aim to close inequity gaps and consolidate a territorial system that responds to the demands of Antioquian society The heart of this territorial system constitutes Medulla which is also described as the long city of four hearts: the East which are home to 82 per cent of the department’s population The plan proposes a system of intermediate cities that are connected not only by technology and a road system but also through institutions This requires a government that understands and is sensitive to the needs of its citizens that is willing to listen to the voices of all territories and seize the opportunity to leave behind the centralised model of governance this new macro-region develops transversally and connects Antioquia with its territorial development nodes Along four of the nine subregions of the department Medulla covers 250 linear kilometres of biodiversity The area of Medulla comprises the plateau of the San Nicolas Valley at 2,000 meters above sea level subsequently descends through the Aburra Valley at 1,500 meters and continues through the valley of the Cauca River in the municipality of Santa Fe de Antioquia at 500 meters to finally reach the sea of Antioquia in Uraba These regions are characterised by extensive urban and functional development as well as by a concentration of population and tunnels that cross and surround the department’s mountains One of the most important megaprojects is the Guillermo Gaviria Echeverri tunnel The longest tunnel in America reduces travel times between Medellín and the sea of Antioquia by up to 25 per cent and contributes to the social and economic development of the municipalities in the project’s area of influence connecting the four cores also involves connecting their vocations: Uraba’s commitment to competitiveness around the sea and its biodiversity the West as the tourist heart of Antioquia Aburra Valley’s major infrastructures and constant innovation and the East’s engagement with agriculture and the availability of natural resources and sustainable territory has been designed to promote interaction and the flow of people the development of Medulla not only requires significant investment in the medium and long term but also a cultural change that promotes cooperation between the different regions of Antioquia moving towards a more equitable territorial development in Antioquia will result in a reduction of inequalities between the different regions of the department increase opportunities for people living in rural and remote areas and strengthen local economies What is already certain: Medulla constitutes a unique proposal in Latin America that highlights the geographic and biodiverse power of the department and focuses on rural and urban planning to promote sustainable and balanced usage of the region Cities Alliance is the global partnership fighting urban poverty and promoting the role of cities the Cities Alliance promotes long-term programmatic approaches that support national and local governments to develop appropriate policy frameworks Site by vardot™ © 2025 The Cities Alliance. Hosted by UNOPS. All Rights Reserved. Volume 6 - 2012 | https://doi.org/10.3389/fncir.2012.00072 the first extraction of motion and direction clues from local brightness modulations is thought to take place in the medulla whether and how these computations are represented in the medulla stills remain widely unknown because electrical recording of the neurons in the medulla is difficult we employed local electroporation in vivo in the medulla of the blowfly (Calliphora vicina) to stain small ensembles of neurons with a calcium-sensitive dye We studied the responses of these neuronal ensembles to spatial and temporal brightness modulations and found selectivity for grating orientation the responses to the two opposite directions of motion of a grating with the same orientation were similar in magnitude indicating that strong directional selectivity is either not present in the types of neurons covered by our data set or that direction-selective signals are too closely spaced to be distinguished by our calcium imaging The calcium responses also showed a bell-shaped dependency on the temporal frequency of drifting gratings with an optimum higher than that observed in one of the subsequent processing stages Medulla responses were elicited by on- as well as off-stimuli with some spatial heterogeneity in the sensitivity for “on” and “off” Medulla neurons thus show similarities to some established principles of motion and edge detection in the vertebrate visual system the preliminary steps leading to motion detection remain elusive and it is unknown whether the extraction of stationary features were only successful in brief recordings from a single neuron of each type still leaving open the question whether orientation selectivity or motion sensitivity is ubiquitously represented across various cell types in the medulla We addressed these issues by examining the responses of medulla neurons through population staining with calcium sensitive dyes circumventing the need for intracellular recordings or genetically induced labeling methods surprisingly similar functional design principles are realized in vertebrate and invertebrate visual systems Blowflies (Calliphora vicina) were raised in the department's stock at 25°C in a 12 h light/12 h dark cycle Experiments were carried out on females collected <3 days after eclosion and later to provide an immersion medium for microscopy Morphology of stained neurons in the medulla (A) Positioning and preparation of the fly The head of the animal is tilted forward and fixed with beeswax to look down at a screen presenting the visual stimulus The caudal head capsule is cut open to access the optic lobes so that our plane of imaging corresponded to the caudal brain surface and the plane in which the stimuli were presented (B) Schematic of visual neuropils of the right hemisphere Two planes represent a horizontal (lower left) and frontal (upper quadrant) cut through the brain A large cell of the lobula plate (dark blue) and an exemplary staining pattern in the medulla (green) are drawn in for clarity The two lines represent the propagation of retinotopic information through the system with inputs from the frontal and lateral visual fields crossing at the first optic chiasm between lamina and medulla and at the second chiasm between medulla The imaging plane of the camera is aligned with the caudal surface of the brain (C) Collapsed confocal image stack of an exemplary Calcium Green dextran population staining in the medulla and two groups of somas located superficially near the proximal and distal boundaries of the medulla Color coding of the structures indicates depth Medulla boundaries are indicated by the dashed lines (D) Collapsed image stacks obtained with widefield microscopy of four examples of population staining in different parts of the medulla Stainings usually show two groups of somas and tangential as well as columnar structures with the crossing point corresponding to the injection site in different layers of the medulla a second and third injection site was stained in the same manner Flies were left to incubate for 1–3 h at room temperature We recorded relative cytosolic Ca2+ concentration changes by epifluorescence imaging of Oregon Green dextran emission using a water immersion 40× (Olympus LUMPlan FI/IR 40×/0.8 W) or 25× (Leica HCX IRAPO L 25×/0.9 W) objective at an upright fixed-stage microscope (Leica DMLFSA) equipped with an electron-multiplying charged-coupled device (EMCCD) camera (Andor iXon DV887-BI Image resolution was 512 × 512 pixels at frame rates of 15–30 Hz 470 nm excitation light was provided by a Leica Fluo LED 4000 light source (filter set: excitation BP 470/40 nm In some of the preparations the morphology of the dye-stained neurons was inspected with a confocal microscope (Leica TCS SP2 equipped with a water-immersion objective HCX APO L UV-I 40×/0.80) The light from the TFT display was filtered by a dichroic glass filter (Blueberry 8 GB) which prevented bleed-through of the stimulus light to the fluorescence signal The brightness values (Minolta spot luminance meter LS-100) of the stimuli were 11 cdm−2 for the brightest pattern regions and 0.2 cdm−2 for the darkest pattern regions the Michelson contrast of the sine-wave grating was 0.96 We note that the effective contrast seen by the fly is presumably somewhat lower because fluorescence excitation light penetrates the fly's head and causes steady illumination of the photoreceptor layer Resulting from the high temporal resolution of the fly's visual system the use of stimulus devices with a refresh rate below 150 Hz might cause coupling of neuronal activity to the refresh rate Although these issues are not likely to be critical for the topic of the present study we validated our major conclusions by the use of an LED-based stimulus display Local changes in Calcium Green fluorescence induced by stimulation with motion in eight directions The length of each arrow represents average fluorescence increase (ΔF) in the underlying square region of the image (indicated by the grid in the upper left corner of the image) Motion direction is depicted by the direction of the arrow Fluorescence signals were time-averaged over the entire period of motion stimulation Stimuli were presented on a 60 Hz TFT screen The ellipse plotted in green represents a least- square fit to the data with the ratio of semimajor to semiminor axis giving the orientation selectivity index (OSI) and the ratio of center displacement to semimajor axis the direction selectivity index (DSI) The OSI yields a value of 1 for recordings that are not orientation selective and would rise to infinity when responses are obtained only for a single orientation of the grating indicating maximum directional selectivity (B) Preferred orientations and strengths of orientation selectivity Each line (N = 18) represents averaged signals from one population staining Lines colored in red show significant orientation selectivity (P < 0.05) Flicker stimuli elicit weaker responses than motion Response of 12 medulla cell populations during stimulation with two orthogonal orientations of motion and two corresponding orientations of counter-phase flicker Each data point represents average responses from one staining and 2–3 trials from a circular Region of Interest centered on the injection site Data has been normalized to preferred orientation motion response Gray bars represent the mean ± standard deviation Different letters denote significant difference (Wilcoxon signed-rank test) at P < 0.001 for letters a–c or P < 0.05 for letters d,e Tuning to different temporal and spatial frequencies (A) Average response of medulla population stainings to 4 s motion of a drifting sine-wave grating with preferred orientation at different velocities (left) or temporal frequencies (right) and pattern wavelengths Each series was normalized to the average response to the set of all 15 stimuli Each data point represents normalized average response from 6 stainings and 19 single recordings each from a circular ROI each centered on the injection site (B) Response of a single population staining (bottom left) to 1 s of downward motion with varying temporal frequency Each data point represents a single trial response from a circular ROI centered on the injection site with four corresponding example ΔF traces shown to the left Stimuli were presented on a high-speed LED array (A) Orthogonal views of an x-y-t-stack of relative fluorescence changes (ΔF/F) in a staining of the distal medulla (same cell as in C The top left plot shows the spatial activation pattern of the cell population at a point in time while the plots at the top (i–iv) and to the left show the temporal activation pattern of a single row or column in response to a bright moving bar stimulus Similar results were obtained in five further stainings (B,C) Relative fluorescence changes (ΔF/F) in the region of interest indicated in response to a bright edge (red) and dark edge (blue) drifting in four directions Regions of interest in C are centered on two somas near the distal rim of the medulla Stimulus presentation order was pseudorandom and stimulus presentation was paused for at least 10 s before starting the next recording Camera control and image acquisition were performed using ImSpector 3.20 (LaVision Biotec USA) and ImageJ (US National Institutes of Health Ca2+ concentration signals were evaluated as background-subtracted pixel-wise changes from baseline levels of the fluorescence of the Ca2+-sensitive dye divided by the baseline value (ΔF/F0) For the baseline values (F0) we used the average of the images during the first 1.5 s in the series For presentation as mean ΔF false-color-plots the image stacks were filtered with a 2-pixel half width xy-gaussian blur and a 2-frame running average in t-direction For calculation of orientation and direction selectivity indices (OSI and DSI), we fitted a conic ellipse to a polar plot of the responses at different motion directions using a linear least square criterion (modified from Matlab function “fit_ellipse”; Gal, 2003) After transformation to standard ellipse form this gives the 5 parameters semimajor axis a orientation ϕ and center coordinates x and y We define the orientation selectivity index as OSI = a/b and the direction selectivity index as DSI = (x2 + y2)0.5/a which have their somas located near the surface of the proximal medulla No stained structures extending into the lamina were visible which would correspond to L1–L5 type lamina interneurons or R7 or R8 photoreceptors but a co-staining of these cells cannot be ruled out because the curvature of the first optic chiasm obstructs the view to these cells from a caudal observation point for the grating with vertically oriented stripes) was present in regions along the medulla column as well as in the tangential structures stretching out to both sides of the column responses to the two opposing directions of motion of a grating with the same orientation were similarly strong Note that this definition of preferred orientation denotes an axis of motion which is orthogonal to the spatial orientation of the grating pattern As a measure for orientation selectivity we took the ratio between the semimajor and the semiminor axis of the ellipse called orientation selectivity index (OSI) in the following The strength of directional selectivity was quantified by taking the displacement of the center of the ellipse from the center of the coordinate system and dividing this value by the semimajor axis of the ellipse to normalize for differences in ellipse size we used a Monte-Carlo-approach to estimate the distribution of chance level OSI and DSI values obtained for the data set of a given recording the recorded data traces were randomly assigned to the different stimulus conditions Standard ellipses were fitted to each of 10,000 control datasets generated by this random shuffling procedure As a measure of error probability we then determined how many of the fits to these random datasets produced OSI or DSI values higher or equal to the measured values Results for 18 stainings are shown in Figure 4B Preferred orientations are slightly biased to the horizontal axis corresponding to movement in the anterior–posterior or posterior–anterior direction with 12 of 18 measurements falling into a range of ±45° around the horizontal Five of the stainings showed orientation selectivity above 5% chance level with OSIs reaching maximum values slightly below 2 and never showed statistical significance above chance level Selectivity for grating orientation and motion direction was also tested using an LED board which allowed us to present stimuli at a higher refresh rate than with the TFT display (4 kHz vs Four out of nine stainings in this series of experiments showed significant orientation selectivity as tested by the Monte-Carlo-approach (p < 0.05 One out of the four orientation-selective stainings also showed directional selectivity (p < 0.05) These results suggest that directional selectivity is not yet or only sporadically present on the processing stage of the medulla columns but that the orientation of moving stimuli is represented in the signals of medulla neurons since our recordings always consist of a population-average of the stained medulla cells we cannot rule out that individual signals with stronger selectivity for orientation or direction are pooled into an average with a broader tuning Motion stimuli always induce local modulations of brightness, which might also elicit responses in cells that are not selective for motion. We tested whether medulla elements respond stronger to motion than to brightness modulations that lack the motion-defining spatio-temporal correlations. For this, we stimulated the cells with several versions of flicker inducing temporal brightness modulations similar to the motion stimuli shown in Figure 2B which smoothly inverted their phase with a 4-Hz-frequency (counter-phase flicker) a 4-Hz sinusoidal untextured brightness modulation which lacks pattern orientation information (full-field flicker) A direct comparison of stationary counter-phase flicker stimuli with moving gratings is problematic because apart from the minima and the maxima of the sinusoidal pattern counter-phase flicker induces a lower local brightness modulation than moving gratings and full-field flicker For neurons with receptive fields much smaller than the pattern wavelength this difference in local brightness modulation between counter-phase flicker and motion can be compensated by shifting the flicker grating to align one of its minima or maxima with the receptive field we varied the position of the flicker grating in four steps We found that responses to counter-phase flicker at any of the tested phase positions, as well as full-field flicker, were significantly lower than to motion stimuli of the same temporal frequency (Figure 5) Orientation preference for counter-phase flicker was the same as for motion While the lowered contrast of the counter-phase stimuli in comparison with the moving grating makes a quantitative comparison of the responses difficult the attenuated response to full-field flicker in comparison to motion corroborates the presence of spatial filtering if calcium signals at high temporal frequencies were underestimated the true difference between LPTCs and medulla neurons would even be larger than indicated by our measurements This comparison suggests that the signals from the lamina are subject to temporal processing in the medulla which attenuates the responses to high temporal frequencies We also tested the temporal frequency tuning using counter-phase flicker presented on the LED array (data recorded in another staining Similar to the optimum during motion stimulation the largest responses to flicker were obtained at about 30 Hz and only weak responses were elicited by frequencies above 100 Hz In response to edges moving in vertical directions, all stainings showed a consecutive localized activation of the tangential structures, which corresponded to the motion of the stimulus through the visual field. This can be seen in the pattern of activation being tilted rightward in the YT-plot for upward motion [Figure 7A(iii)], and leftward for downward motion [Figure 7A(iv)] Such a localized activation pattern was not present for edges moving horizontally such direction-specific differences in response timing were not visible In the medulla of insects visual information is processed by cells that confine their processes into distinct sublayers of the neuropil in a similar fashion as cells of the plexiform layers in the vertebrate retina, suggesting a functional similarity of both systems in the extraction of visual features from the purely retinotopic image represented on the retina (Sanes and Zipursky, 2010) With its large number of densely interwoven neurites and the difficulty of intracellular recordings still relatively little is known about the representation of visual features in the medulla A likely reason for the low magnitude of somatic calcium signals is the long distance of the soma from dendritic and axonal structures which is typical for the morphology of many insect neurons the surface-to-volume ratio of a soma is much lower than that of a small neurite This difference might result into weaker cytosolic calcium concentration changes of the somas compared to neurites even if membrane calcium currents were similar In spite of these problems to characterize single-cell properties following electroporation stainings it is possible to outline which functional neuronal features exist in general in the fly medulla but their direct input elements remained elusive until now Due to the fact that we mainly measured population the orientation selectivity values we found provide the lower estimate of the orientation selectivity actually present in the medulla with single-cell orientation selectivity possibly higher than the values measured Our findings suggest that information about edge orientation provided by the medulla plays an important role in the downstream processing stages of the insect visual system with some of this high-frequency information being lost at the later computational stages This concept is supported by our finding that medulla cells exhibit responses to a broader spectrum of higher temporal frequencies than LPTCs hinting at a subsequent low-pass-filtering of signals in the computation of directional motion signals which bears a striking resemblance to the spatial displacement between on- and off-signals we found in the tangential processes in the distal medulla This input organization could explain the spatial offset between on- and off- responses This work was supported by a DFG grant (KU-1520/3-2) from the Deutsche Forschungsgemeinschaft We thank Jens Lindemann for generating some of the motion stimuli programs and helping with image processing routines and Martin Egelhaaf for helpful discussions We are grateful to the members of the applied laser physics and laser spectroscopy group for allowing laboratory use and for their support of our experiments The helpful comments of two reviewers on earlier versions of the manuscript are gratefully acknowledged We acknowledge the support for the publication fee by the Deutsche Forschungsgemeinschaft and the Open Access Publication Funds of Bielefeld University Spatial and temporal integration properties of units in first optic ganglion of dipterans Pubmed Abstract | Pubmed Full Text Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Motion detection by interneurons of optic lobes and brain of the flies Calliphora phaenicia and Musca domestica Pubmed Abstract | Pubmed Full Text Pubmed Abstract | Pubmed Full Text Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Defining the computational structure of the motion detector in Drosophila Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Visual motion-detection circuits in flies: parallel direction- and non- direction-sensitive pathways between the medulla and lobula plate Pubmed Abstract | Pubmed Full Text Functionally and anatomically segregated visual pathways in the lobula complex of a calliphorid fly Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Retinotopic pathways providing motion-selective information to the lobula from peripheral elementary motion-detecting circuits Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Non-directional motion detectors can be used to mimic optic flow dependent behaviors Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Neural encoding of behaviourally relevant visual-motion information in the fly Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Internal structure of the fly elementary motion detector Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Neural mechanisms of orientation selectivity in the visual cortex Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Ca2+ imaging of identifiable neurons labeled by electroporation in insect brains Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Gal, O. (2003). Fit_ellipse. Available online at: http://www.mathworks.com/matlabcentral/fileexchange/3215 Discrimination of visual motion from flicker by identified neurons in the medulla of the fleshfly Sarcophaga bullata Pubmed Abstract | Pubmed Full Text The functional organization of male-specific visual neurons in flies Pubmed Abstract | Pubmed Full Text reihenfolgen und vorzeichenauswertung bei der bewegungsperzeption des russelkafers chlorophanus Motion sensitive interneurons in the optomotor system of the fly: II The horizontal cells: receptive field organization and response characteristics Fluorescence changes of genetic calcium indicators and OGB-1 correlated with neural activity and calcium in vivo and in vitro Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Common visual response properties of giant vertical cells in the lobula plate of the blowfly Calliphora The computational basis of an identified neuronal circuit for elementary motion detection in dipterous insects Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Circuits that build visual cortical receptive fields Pubmed Abstract | Pubmed Full Text | CrossRef Full Text binocular interaction and functional architecture in the cat's visual cortex Pubmed Abstract | Pubmed Full Text ON and OFF pathways in Drosophila motion vision Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Transfer of graded potentials at the photoreceptor-interneuron synapse Pubmed Abstract | Pubmed Full Text Ca2+ clearance in visual motion-sensitive neurons of the fly studied in vivo by sensory stimulation and UV photolysis of caged Ca2+ Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Application of multiline two-photon microscopy to functional in vivo imaging Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Synaptic organization of columnar elements in the lamina of the wild type in Drosophila melanogaster Pubmed Abstract | Pubmed Full Text | CrossRef Full Text The color-vision circuit in the medulla of Drosophila Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Insect detection of small targets moving in visual clutter Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Feature detection and the hypercomplex property in insects Pubmed Abstract | Pubmed Full Text | CrossRef Full Text O'Carroll Visual system of calliphorid flies: motion- and orientation-sensitive visual interneurons supplying dorsal optic glomeruli Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Higher order visual processing in macaque extrastriate cortex Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Directionally selective cells in the locust medulla Pubmed Abstract | Pubmed Full Text Arrangement of optical axes and spatial resolution in the compound eye of the female blowfly Calliphora Pubmed Abstract | Pubmed Full Text Neurons selective for orientation and binocular disparity in the visual Wulst of the barn owl (Tyto alba) Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Visualizing retinotopic half-wave rectified input to the motion detection circuitry of Drosophila Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Dissection of the peripheral motion channel in the visual system of Drosophila melanogaster Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Calcium diffusion modeling in a spherical neuron Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Design principles of insect and vertebrate visual systems Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Quantitative studies of single-cell properties in monkey striate cortex Orientation specificity and ocular dominance Pubmed Abstract | Pubmed Full Text Columnar cells necessary for motion responses of wide-field visual interneurons in Drosophila Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Properties of elementary movement detectors in the fly Calliphora erythrocephala Dendritic computation of direction selectivity and gain control in visual interneurons Pubmed Abstract | Pubmed Full Text Spatial processing of visual information in the movement-detecting pathway of the fly Evidence for two distinct movement-detecting mechanisms in insect vision Vision in insects: pathways possibly underlying neural adaptation and lateral inhibition Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Vision egg: an open-source library for realtime visual stimulus generation Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Cholinergic circuits integrate neighboring visual signals in a Drosophila motion detection pathway Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Synaptic circuits of the Drosophila optic lobe: the input terminals to the medulla Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Characterisation of a blowfly male-specific neuron using behaviourally generated visual stimuli Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Direction selectivity in the retina: symmetry and asymmetry in structure and function Pubmed Abstract | Pubmed Full Text | CrossRef Full Text A model for the detection of moving targets in visual clutter inspired by insect physiology Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Orientation-sensitive neurons in the brain of the honey bee (Apis mellifera) Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Gerdes R and Kurtz R (2012) Neuronal representation of visual motion and orientation in the fly medulla Received: 03 August 2012; Paper pending published: 06 September 2012; Accepted: 20 September 2012; Published online: 09 October 2012 Copyright © 2012 Spalthoff, Gerdes and Kurtz. This is an open-access article distributed under the terms of the Creative Commons Attribution License distribution and reproduction in other forums provided the original authors and source are credited and subject to any copyright notices concerning any third-party graphics etc *Correspondence: Rafael Kurtz, Department of Neurobiology, Bielefeld University, Postbox 100131, 33501 Bielefeld, Germany. e-mail:cmFmYWVsLmt1cnR6QHVuaS1iaWVsZWZlbGQuZGU= †Present address: Christian Spalthoff Georg-August-Universität Göttingen Metrics details To investigate whether sepsis-induced neuroinflammation of medulla visceral zone (MVZ) predominates the systemic inflammation through cholinergic anti-inflammatory pathway (CAP) and to explore the effect of central anti-inflammation on systemic inflammation 112 adult Sprague–Dawley male rats were randomly divided into sepsis experimental group (n = 56) and neuroinflammation experimental group (n = 56) The two experimental groups were individually randomly divided into control group (n = 8) central anti-inflammatory group (n = 16) and vagus transection group (n = 16) Rats in two control groups were administered with saline at the dose of 6 mL/kg intraperitoneally or with 25 μL artificial cerebrospinal fluid injected into forth ventricle once a day for 3 days Rats in two model groups were administered with Lipopolysaccharide (LPS) at the dose of 6 mg/kg intraperitoneally or with 25 μg/25 μL LPS injected into forth ventricle once a day for 3 days Rats in two central anti-inflammatory groups were fed with 10 mg/mL minocycline sucrose solution as the only water source for 4 days prior to be treated as the model groups of their own and feeding style was continued until the end of the experiment Rats in the two vagus transection groups were undergone right vagotomy and 7 days of adaptive feeding prior to be treated as the same as those in the central anti-inflammatory group of their own mortality rate and heat rate variability (HRV) were recorded during the last 3 days of intervention Then the rats were sacrificed and blood samples were collected for ELISA analysis to detect the serum level of inflammatory cytokines such as TNF-α The expression of TNF-α and IL-6 in medulla oblongata were analyzed by Western blot The correlation and regression analysis among the expression levels of cytokines in medulla oblongata HRV indexes and serum inflammatory cytokines were performed The mortality rate and MSS of the sepsis model group and the MVZ’s neuroinflammation model group were significantly higher than those of their own control group and the central anti-inflammation reduced the mortality rate and MSS scores of the two model groups while the right vagotomy abolished the effect of central anti-inflammatory In the sepsis model group and the MVZ’s neuroinflammation model group and other cytokines in serum and MVZ were significantly increased LF/HF) were significantly decreased (P = 0.000) Central anti-inflammatory treatment reversed the above changes right vagotomy abolished the central anti-inflammatory effect Correlation and regression analysis showed that there was a significant linear correlation among the expression of inflammatory factors in MVZ the indexes of HRV and the levels of serum cytokines Our study shows that sepsis-induced MVZ’s neuroinflammation exert a powerful influence on the systemic inflammation through CAP in sepsis Central anti-inflammation effectively improves systemic inflammation through inhibiting MVZ’s neuroinflammation in sepsis The time domain and frequency domain indexes of HRV can reflect the regulatory effect of CAP and the degree of inflammation of MVZ which may be potentially used to monitor the condition and treatment effectiveness of sepsis patients This suggests that modulating immunity and inhibiting abnormal inflammatory responses should be still key issues for research and treatment of sepsis Whether the uncontrolled systemic inflammation caused by sepsis is primarily an inflammatory storm caused by the disordered self-activation of peripheral cytokines or it is mainly an inflammation-induced dysfunction of MVZ leading to the loss control of systemic inflammation still remains unclear as there is currently no relative research on this puzzle This study is to explore the activation of MVZ’s neuroinflammation by sepsis models and its impact on CAP’s modulation and systemic inflammation It is also to investigate the central anti-inflammatory effects and whether these effects were abolished after disconnection of CAP thus confirming that whether or not the neuroinflammation in MVZ is a main mechanism underlying the loss control of the systemic inflammation in sepsis we also utilized a neuroinflammation model in MVZ induced by lipopolysaccharide injection into the fourth ventricle to investigate whether or not the MVZ’s neuroinflammation exert a significant influence on CAP’s modulation and systemic inflammation we also investigate the effects of central anti-inflammation and disconnection of CAP in MVZ’s neuroinflammation models thereby validating whether or not neuroinflammation in MVZ is a critical pathological mechanism for the uncontrolled systemic inflammation in sepsis this research was approved by the Animal Care Welfare Committee of Guizhou Medical University (no According to the different processing methods of the rats in different groups the rats underwent 11–21 days of treatment before sampling and analysis Treatment of rats in each group are as follows: (1) Control Group: The sepsis control group was administered with 6 mg/kg of normal saline MVZ neuroinflammation model group: LPS 25 μg/25 μL was injected into the fourth ventricle once a day for 3 days In strict accordance with ethical requirements whether the rats went through the fourth ventricle injection or being sacrificed should be under anesthetization by inhalation of isoflurane Preparation of MVZ neuroinflammation model including such steps: After anesthesia the rats were fixed with a stereotaxic instrument set the anterior fontanel as the coordinate locate the surface injection point of the fourth ventricle as 11.6 mm posterior to the anterior fontanelle on the median line A small hole was made at this point with a microsyringe and the needle was inserted vertical into the skin 7.5–8.5 mm to reach the fourth ventricle The pale yellow clear cerebrospinal fluid was extracted without resistance while gently withdrawing the plunger of the syringe which was the proof of entry into the fourth ventricle LPS dissolved in ACSF (25 μg/25 μL) was injected vertically into the fourth ventricle slowly the needle was retained for 5 min to allow LPS to be fully absorbed (3) Central Anti-inflammatory Group: after 4 days of feeding with 10 mg/mL minocycline phosphate (dissolved in 5% sucrose solution) as the only water source the sepsis model rats were administered with intraperitoneally injection of LPS (6 mg/kg) and the MVZ neuroinflammation model rats were accepted injection of LPS 25 μg/25 μL by fourth ventricle as their own Model Groups Minocycline feeding was continued until the day of sampling The rats’ grouping and processing procedure Central Anti-inflammatory Group and Vagus Transection Group in the sepsis experiment; simultaneously 7 rats died in the Neuroinflammation Group Central Anti-inflammatory Group and Vagus Transection Group in the neuroinflammation experiment All the survival rats were involved with the next experiment MSS > 15 means success of preparing sepsis model Three experimenters evaluated every experimental rats separately the average score was taken for evaluation of the severity of the rats the time-domain parameters such as standard deviation of all RR intervals (SDNN) root mean square difference of successive RR intervals (RMSSD) frequency domain index such as low frequency (LF 0.75–2.5 Hz Hz) power were analyzed by 5-min short-duration electrocardiogram HRV was measured by BL-420F biological signal acquisition and analysis system manufactured by Chengdu Tailong Software Co. all the survival rats were anesthetized by inhalation of isoflurane their chests were opened to expose the hearts Blood samples (8 mL) were collected from the right ventricle and remained for 1 h at room temperature then they were centrifuged at 3000r for 10 min to obtain serum for detection the rats were perfused with normal saline until the internal organs turned pale then the medulla oblongata of the rats were got and frozen for further treatment The serum cytokines detection was performed according to the instructions of the ELISA kit 10 μL rat’s serum was added into the sample well of the plate and the corresponding standard well was set up at the same time The plate was gently shaken and then incubated at 37 °C for 2 h 100 μL biotin-labeled antibody working solution was added including Rat Tumor Necrosis Factor Alpha (TNF-α) manufacturer: elabscience; Rat Interleukin 6 (IL-6) the plates were incubated at 37 °C for 1 h prior to be dried and washed for 3 times 50 μL of chromogenic A and B were added to each well and the optical density (OD) value of each well was measured at 450 nm wavelength by a spectrophotometer reader within 10 min after stopping reaction The concentrations of various inflammatory molecules were calculated Mapping of the sampling site of the medulla oblongata locate the central site of medulla oblongata sampling as 12.8 mm posterior to the anterior fontanelle Samples of the medulla oblongata should contain the dorsal vagus motor nucleus (DVMN) Marked with red box; the nucleus of the solitary tract (NTS) Marked with bule box; and (rostral ventrolateral medulla All the data were expressed as mean ± standard deviation (M\({\overline{\text{X}}}\) ± S) The experimental data were statistically processed by SPSS 22.0 software package Measurement data were analyzed by analysis of variance Leven’s homogeneity test was performed first and Bonferroni test was used to determine homogeneous data The counting data were analyzed by χ2 test P < 0.05 suggests the results significant P < 0.01 suggests the results very significant The study was approved by Ethics Committee of Guizhou Medical University (no All the maneuvering measures were complied with the guidelines and regulations of Committee on Protection Welfare and Ethics of Experimental Animals This study was carried out in compliance with the ARRIVE guidelines The MSS and Kaplan–Meier Survival Curve among different groups Central Anti-inflammation Group and Vagus Transection Group All the survival rats were involved with the MSS The MSS of the Sepsis Model Group was significantly higher than that of the Control Group (24.29 ± 2.21 vs 0 and central anti-inflammation significantly reduced the MSS score in the model rats (5.43 ± 0.98 vs 24.29 ± 2.21 The MSS score of the Vagus Transection Group was significantly higher than that of the Central Anti-inflammatory Group (17.29 ± 0.95 vs 5.43 ± 0.98 and the difference between any two groups was extremely significant (P = 0.000) (B) The survival rate of the Sepsis Group was significantly lower than that of the Control Group (82.1% vs 100% and the survival rate of the Central Anti-inflammatory Group was higher than that of the Sepsis Group (93.2% vs 82.1% The survival rate of the Vagus Transection Group has a trend to descend when compared to that of the Central Anti-inflammatory Group (87.8% vs 93.2% The MSS score of the Neuroinflammation Group was significantly higher than that of the Control Group (26.43 ± 1.99 vs 0 and the Central Anti-inflammatory Group significantly reduced the MSS score of the Model Group (14.29 ± 2.87 vs 26.43 ± 1.99 The MSS score of the Vagus Transection Group was significantly higher than that of the Central Anti-inflammatory Group (18.71 ± 2.69 vs 14.29 ± 2.87 (D) The survival rate of the Neuroinflammation Group was significantly lower than that of the Control Group (71.4% vs 100% and the survival rate of the Central Anti-inflammatory Group was significantly higher than that of the Neuroinflammation Group (90.7% vs 71.4% The survival rate of the Vagus Transection Group tended to decrease compared to that of the Central Anti-inflammatory Group (81.6% vs 90.7% The indexes of HRV among different groups HRV indexes in the Sepsis Group were significantly lower than those in the Control Group [SDNN (ms): 1.28 ± 0.22 vs 3.40 ± 0.35 P = 0.000; RMSSD (ms): 0.86 ± 0.18 vs 2.83 ± 0.37 P = 0.000; LF (ms2): 126.00 ± 9.17 vs 306.45 ± 19.76 P = 0.000; HF (ms2): 24.85 ± 1.81 vs 42.94 ± 3.61 P = 0.000; LF/HF: 5.07 ± 0.07 vs 7.15 ± 0.29 P = 0.000]; HRV indexes in the Central Anti-inflammatory Group were significantly higher than those in the Model Group [SDNN (ms): 2.31 ± 0.17 vs 1.28 ± 0.22 P = 0.000; RMSSD (ms): 1.93 ± 0.19 vs 0.86 ± 0.18 P = 0.000; LF (ms2): 205.94 ± 22.17 vs 126.00 ± 9.17 P = 0.000; HF (ms2): 31.15 ± 3.19 vs 24.85 ± 1.81 P = 0.001; LF/HF: 6.61 ± 0.13 vs 5.07 ± 0.07 P = 0.000]; HRV indexes in the Vagus Transection Group were significantly lower than those in the Central Anti-inflammatory Group [SDNN (ms): 2.31 ± 0.17 vs 1.28 ± 0.22 There was no significant difference in LF and HF between the Model Group and the Vagus Transection Group (P = 0.116; P = 0.464) HRV parameters in the MVZ Neuroinflammation Group were much lower than those in the Control Group [SDNN (ms): 1.10 ± 0.22 vs 3.52 ± 0.35 P = 0.000; RMSSD (ms): 0.74 ± 0.18 vs 2.87 ± 0.37 P = 0.000; LF (ms2): 114.76 ± 9.17 vs 312.76 ± 19.76 P = 0.000; HF (ms2): 21.70 ± 1.81 vs 41.32 ± 3.49 P = 0.000; LF/HF: 5.29 ± 0.08 vs 7.58 ± 0.23 P = 0.000]; HRV parameters in the Central Anti-inflammatory Group were significantly higher than those in the Model Group [SDNN (ms): 2.13 ± 0.17 vs 1.10 ± 0.22 P = 0.000; RMSSD (ms): 1.81 ± 0.19 vs 0.74 ± 0.18 P = 0.000; LF (ms2): 194.70 ± 22.17 vs 114.76 ± 9.17 P = 0.000; HF (ms2): 28.00 ± 3.19 vs 21.70 ± 1.81 P = 0.001; LF/HF: 6.95 ± 0.14 vs 5.29 ± 0.08 P = 0.000]; HRV parameters in the Vagus Transection Group were obviously lower than those in the Central Anti-inflammatory Group [SDNN (ms): 1.44 ± 0.08 vs 2.13 ± 0.17 P = 0.000; RMSSD (ms): 1.18 ± 0.15 vs 1.81 ± 0.19 P = 0.000; LF (ms2): 133.68 ± 21.06 vs 194.70 ± 22.17 P = 0.000; HF (ms2): 21.16 ± 3.31 vs 28.00 ± 3.19 P = 0.000; LF/HF: 6.34 ± 0.53 vs 5.29 ± 0.08 There was no significant difference in LF and HF between the Model Group and the Vagus Transection Group (P = 0.071; P = 0.741) The serum concentration of inflammatory cytokines among different groups The serum concentration of inflammatory cytokines in the Sepsis Group were significantly higher than those in the Control Group [TNF-a (ng/L): 32.84 ± 1.39 vs 9.51 ± 1.50 P = 0.000; IL-6 (ng/L): 36.94 ± 2.50 vs 9.94 ± 1.44 P = 0.000; IL-10 (ng/L): 19.01 ± 1.21 vs 5.67 ± 1.07 P = 0.000]; They decreased significantly in the Central Anti-inflammatory Group compared to the Model Group [TNF-a (ng/L): 16.46 ± 1.55 vs 32.84 ± 1.39 P = 0.000; IL-6 (ng/L): 25.01 ± 1.13 vs 36.94 ± 2.50 P = 0.000; IL-10 (ng/L): 9.44 ± 1.03 vs 19.01 ± 1.21 they had marvelous rebounds compared to the Central Anti-inflammatory Group [TNF-a (ng/L): 27.36 ± 1.48 vs 16.46 ± 1.55 P = 0.000; IL-6 (ng/L): 30.30 ± 1.91 vs 25.01 ± 1.13 P = 0.007; IL-10 (ng/L): 14.08 ± 0.78 vs 9.44 ± 1.03 the concentrations of serum inflammatory cytokines in the Neuroinflammation Group were significantly higher than those in the Control Group [TNF-a (ng/L): 67.29 ± 3.49 vs 14.16 ± 2.00 P = 0.000; IL-6 (ng/L): 35.24 ± 3.54 vs 7.15 ± 2.13 P = 0.000; IL-10 (ng/L): 11.89 ± 0.54 vs 6.31 ± 0.49 P = 0.000]; They significantly decreased in the Central Anti-inflammation Group compared to the Model Group [TNF-a (ng/L): 26.24 ± 4.43 vs 67.29 ± 3.49 P = 0.000; IL-6 (ng/L): 21.76 ± 1.30 vs 35.24 ± 3.54 P = 0.001; IL-10 (ng/L): 8.00 ± 0.53 vs 11.89 ± 0.54 P = 0.000]; the same to the results in the sepsis models The serum levels of inflammatory cytokines in the Vagus Transection Group increased significantly compared to the Central Anti-inflammatory Group [TNF-a (ng/L): 47.20 ± 4.78 vs 26.24 ± 4.43 P = 0.000; IL-6 (ng/L): 29.45 ± 1.28 vs 21.76 ± 1.30 P = 0.019; IL-10 (ng/L): 10.35 ± 0.69 vs 8.00 ± 0.53 There was no significant difference in the serum concentrations of IL-6 and IL-10 between the Vagus Transection Group and the Neuroinflammation Group (P = 0.083; P = 0.065) The expression of inflammatory cytokines in MVZ among different groups. (A) The western blotting scanning images of inflammatory cytokines among different groups. The display of cropped gels and blots was used in order to improve the clarity and conciseness of the presentation, the original blots/gels are presented in Supplementary Fig. 1 (B) The histograms show that The expressions of MVZ inflammatory cytokines in the Sepsis Group were significantly higher than those in the Control Group (TNF-a: 0.551 ± 0.044 vs 0.083 ± 0.039 P = 0.000; IL-6: 0.885 ± 0.108 vs 0.229 ± 0.113 these cytokines were significantly dampened compared to those of the Model Group (TNF-a: 0.181 ± 0.054 vs 0.551 ± 0.044 P = 0.000; IL-6: 0.454 ± 0.091 vs 0.885 ± 0.108 The declination of cytokines by minocycline’s anti-inflammation in MVZ was obviously reversed by the right vagotomy (TNF-a: 0.370 ± 0.069 vs 0.181 ± 0.054 P = 0.002; IL-6: 0.664 ± 0.026 vs 0.454 ± 0.091 The expression of TNF-a in the Central Anti-inflammatory Group was not significantly different from that in the Control Group (P = 0.051) the expressions of MVZ inflammatory cytokines in the Neuroinflammation Group were significantly higher than those in the Control Group (TNF-a: 0.761 ± 0.051 vs 0.087 ± 0.023 P = 0.000; IL-6: 0.974 ± 0.036 vs 0.150 ± 0.017 P = 0.000); These cytokines decreased significantly in the Central Anti-inflammatory Group compared to those in the Model Group (TNF-a: 0.328 ± 0.074 vs 0.761 ± 0.051 P = 0.000; IL-6: 0.505 ± 0.056 vs 0.974 ± 0.036 The expressions of MVZ inflammatory cytokines in the Vagus Transection Group were significantly higher than those in the Central Anti-inflammatory Group (TNF-a: 0.618 ± 0.083 vs 0.328 ± 0.074 P = 0.003; IL-6: 0.806 ± 0.090 vs 0.505 ± 0.056 There was no significant difference in the expression of TNF-a between the Neuroinflammation Group and the Vagus Transection Group (P = 0.138) There was a strong positive correlation between the expression of inflammatory cytokines in MVZ and the concentrations of inflammatory cytokines in serum The Pearson Correlation Coefficient between MVZ’s expression of TNF-a in and serum concentration of TNF-a The Pearson Correlation Coefficient between MVZ’s expression of IL-6 and serum concentration of TNF-a Both the expression of inflammatory cytokines in MVZ and the levels of inflammatory cytokines in serum were negatively correlated with the indexes of HRV (P = 0.000), Table 2 The regression analysis between expression of inflammatory cytokines in MVZ SDNN of HRV indexes and the concentrations of TNF-a in serum The histograms in the upper row shows that the standard residuals of the three pairs of regression variables are normally distributed the lower row of P–P plots show that the three sets of variables are linear regressions with good fitting (A) Regression analysis was performed between the expression of TNF-a in MVZ and serum TNF-a level P = 0.000; (B) Regression analysis was performed between the expression of TNF-a in MVZ and SDNN in HRV P = 0.000; (C) The regression analysis was performed between SDNN in HRV and serum TNF-a level showed that βvalue = − 0.808 it is necessary to confirm that whether MVZ’s neuroinflammation play a predominant role on the systemic inflammation in sepsis through the cholinergic anti-inflammatory pathway we prepared sepsis experiment and neuroinflammation experiment and interfere with central anti-inflammation or CAP transection + central anti-inflammation to confirm our hypothesis sepsis-induced MVZ neuroinflammation is inevitable to affect the function of MVZ in regulating systemic inflammation the relationship between MVZ neuroinflammation and systemic inflammation is still unclear is it possible that the uncontrolled systemic inflammation induced by sepsis is predominated mainly by the inflammation and dysfunction of MVZ the self-activation and enlargement of inflammatory cytokines are not the main mechanism for the cytokines storm the pathological fatigue of rats with high MSS score is closely related to the activation of glial cells in the central nervous system and the increase of serum IL-1 and other cytokines which induces strong systemic inflammation and local inflammation in the brain leading to the disorder of autonomic nervous on modulation of systemic inflammation Our results showed that minocycline significantly reduced inflammatory cytokines in MVZ and also improved MSS score in septic rats indicating that neuroinflammation in MVZ is closely related to pathological behavior in rats resulted from the systemic inflammation caused by sepsis we designed a model of MVZ neuroinflammation induced by LPS injection into the fourth ventricle to observe whether or not neuroinflammation in MVZ leads to sepsis-like pathological behavior or pathological changes in rats changes in HRV indexes and in peripheral serum inflammatory cytokines by preparing the model of MVZ neuroinflammation we almost completely replicated these changes induced by sepsis TNF-a and IL-6 in the MVZ of the Neuroinflammation Group were significantly increased compared to the Control Group although screening out the influence from peripheral organs dysfunction the Neuroinflammation Group still showed significantly higher MSS scores as the Sepsis Group (24.29 ± 2.21 vs 26.43 ± 1.99) IL-6 and IL-10 in peripheral serum in the Neuroinflammation Group were also significantly increased and the survival rate was also significantly decreased compared to the Control Group the central anti-inflammatory intervention by minocycline not only significantly reduced the expression of TNF-a and IL-6 in MVZ but also significantly reduced the MSS score and significantly increased the survival rate in the Neuroinflammation Group The results of the two models (sepsis and MVZ neuroinflammation) and their interventions were nearly identical we reasonably think that it is central MVZ’s neuroinflammation that dominates systemic inflammation and immune disorders in sepsis all of which suggested that systemic inflammation was inhibited through CAP’s activation Other than the cecum punctured and ligated (CLP) sepsis models intraperitoneal injection of lipopolysaccharide (LPS) induced sepsis models are almost free from influence by minocycline should play an antibacterial role in CLP models minocycline inhibits the systemic inflammation induced by sepsis probably through central pathway The reasonable explanation is that minocycline inhibits activation of the MVZ’s glial cells to ameliorate MVZ’s neuroinflammation and thus to restore CAP’s modulation resulting in significant reduction of the level of serum inflammation cytokines thereby the central anti-inflammatory effect of minocycline was canceled the levels of serum inflammatory cytokines were significantly increased and the survival rate was decreased compared to the Central Anti-inflammation Group These results verified that minocycline inhibits the systemic inflammation induced by sepsis through dampened the MVZ’s neuroinflammation It suggested that HRV’s indexes may reflect the regulation effect of autonomic nervous system in sepsis which acts as a pathway of inflammatory reflex and executes MVZ’s instruction its regulatory activity must be reflected by HRV both sepsis and MVZ neuroinflammation resulted in significant decreases in HRV indexes such as SDNN indicating that both sepsis and MVZ neuroinflammation caused a decrease in vagal tone Central anti-inflammation with minocycline significantly improved these indexes of HRV and significantly inhibited serum inflammatory cytokines in both model rats while right cervical vagotomy abolished the improvement on HRV and systemic inflammation by central anti-inflammation with minocycline suggesting that neuroinflammation in MVZ may exert great impaction on the systemic inflammation through CAP To confirm the hypothesis that MVZ’s neuroinflammation underlies the systemic inflammatory storm through CAP we conducted a correlation analysis between any of the two kinds of variables including the expression of inflammatory cytokines such as TNF-a and IL-6 in MVZ HF and serum level of inflammatory cytokines such as TNF-a Both the expression of inflammatory cytokines in MVZ and the levels of inflammatory cytokines in serum were strongly negatively correlated to the indexes of HRV and the expression of inflammatory cytokines in MVZ is strongly positive correlated to the levels of serum inflammatory cytokines we conducted the regression analysis between three pairs of variables including TNF-a expression in MVZ and SDNN and TNF- a expression in MVZ and serum TNF-a level Results showed that the residuals of the three pairs of variables were normal distribution and the normal P–P plot of the standard residual also showed that the three pairs of variables were linearly correlated with a high degree of fitting and an extremely significant correlation we reasonably confirm that the neuroinflammation of MVZ underlies the changes of HRV and systemic inflammatory storm in sepsis That is to say that the neuroinflammation of MVZ exert a critical influence on the systemic inflammation disorder which does not accurately reflect the multiple cytokines mediated inflammatory storm in human sepsis this study required central intervention with minocycline which is an antibiotic and certainly brings about disinfection effect in CLP model sepsis the hemodynamic state and organ dysfunction of the rats were not monitored and observed in this study so the related effects of MVZ neuroinflammation model on MSS HRV and cytokines could not be evaluated objectively the neuroinflammation in the hypothalamus and cortex was not explored in this study which may also affect HRV and systemic inflammation in the model rats This study conducted an investigation of the relationship between MVZ’s neuroinflammation and systemic inflammation not only from the perspective that peripheral sepsis can induce MVZ’s neuroinflammation but also from the perspective that MVZ’s neuroinflammation can impact on the peripheral systemic inflammation It confirmed that sepsis-induced MVZ neuroinflammation exert a powerful impaction on the systemic inflammation through CAP and central anti-inflammation effectively dampened the systemic inflammation which may become a valuable treatment for early inflammatory storm in sepsis The time domain and frequency domain indexes of HRV not only can reflect the regulatory effect of CAP but also can reflect the degree of inflammation and injuries of MVZ which should be studied further for the clinic translation The data and materials will not make known to public until the research project supported by the Guizhou Provincial Science and Technology Foundation is checked and accepted we declare that all the data analyzed during the current study are available from the corresponding author on reasonable request Zampieri, F. G., Bagshaw, S. M. & Semler, M. W. Fluid therapy for critically ill adults with sepsis: A review. JAMA 329(22), 1967–1980. https://doi.org/10.1001/jama.2023.7560 (2023) Dellinger, R. P. et al. Surviving sepsis campaign. Crit. Care Med. 51(4), 431–444. https://doi.org/10.1097/CCM.0000000000005804 (2023) Wang, W. & Liu, C. F. Sepsis heterogeneity. World J. Pediatr. 19(10), 919–927. https://doi.org/10.1007/s12519-023-00689-8 (2023) Arora, J., Mendelson, A. A. & Fox-Robichaud, A. Sepsis: Network pathophysiology and implications for early diagnosis. Am. J. Physiol. Regul. Integr. Comp. Physiol. 324(5), R613–R624. https://doi.org/10.1152/ajpregu.00003.2023 (2023) Rhodes, A. et al. Surviving sepsis campaign: International guidelines for management of sepsis and septic shock: 2016. Intensive Care Med. 43(3), 304–377. https://doi.org/10.1007/s00134-017-4683-6 (2017) Liu, S. et al. Effect of an herbal-based injection on 28-day mortality in patients with sepsis: The EXIT-SEP randomized clinical trial. JAMA Intern. Med. 183(7), 647–655. https://doi.org/10.1001/jamainternmed.2023.0780 (2023) Osborn, T. M. Severe sepsis and septic shock trials (ProCESS, ARISE, ProMISe): What is optimal resuscitation?. Crit. Care Clin. 33(2), 323–344. https://doi.org/10.1016/j.ccc.2016.12.004 (2017) Zhang, L., Zhu, G., Han, L. & Fu, P. Early goal-directed therapy in the management of severe sepsis or septic shock in adults: A meta-analysis of randomized controlled trials. BMC Med. 13, 71. https://doi.org/10.1186/s12916-015-0312-9 (2015) Pancoto, J. A., Corrêa, P. B., Oliveira-Pelegrin, G. R. & Rocha, M. J. Autonomic dysfunction in experimental sepsis induced by cecal ligation and puncture. Auton. Neurosci. 138, 57–63. https://doi.org/10.1016/j.autneu.2007.10.006 (2008) Moraes, C. A., Zaverucha-do-Valle, C. & Fleurance, R. Neuroinflammation in sepsis: Molecular pathways of microglia activation. Pharmaceuticals (Basel) https://doi.org/10.3390/ph14050416 (2021) Systemic inflammation and microglial activation: Systematic review of animal experiments Piva, S., Bertoni, M., Gitti, N., Rasulo, F. A. & Latronico, N. Neurological complications of sepsis. Curr. Opin. Crit. Care 29(2), 75–84. https://doi.org/10.1097/MCC.0000000000001022 (2023) Electric stimulation of the vagus nerve reduced mouse neuroinflammation induced by lipopolysaccharide Occhinegro, A., McAllen, R. M., McKinley, M. J. & Martelli, D. Acute inhibition of inflammation mediated by sympathetic nerves: The inflammatory reflex. Neuroimmunomodulation 30(1), 135–142. https://doi.org/10.1159/000531469 (2023) Li, H. B., Zhou, Y., Zhao, A. H. & Guo, L. L. Exploring the mechanism on the medullary visceral zone inhibiting the cholinergic anti-inflammatory pathway induced by sepsis. Mediat. Inflamm. 29(2020), 1320278. https://doi.org/10.1155/2020/1320278 (2020) Ahn, N., Roh, S. & Park, J. The status and issues of the Institutional Animal Care and Use Committee of Seoul National University: From its establishment to the present day. Exp. Anim. 70(4), 532–540. https://doi.org/10.1538/expanim.21-0066 (2021) Zheng, W. H., Yan, C., Chen, T. & Kang, D. Z. New scheme for the preparation and use of artificial cerebrospinal fluid. J. Physiol. Pharmacol. https://doi.org/10.26402/jpp.2020.6.15 (2020) Cai, L., Rodgers, E., Schoenmann, N. & Raju, R. P. Advances in rodent experimental models of sepsis. Int. J. Mol. Sci. 24(11), 9578. https://doi.org/10.3390/ijms24119578 (2023) Sulzbacher, M. M. et al. Adapted murine sepsis score: Improving the research in experimental sepsis mouse model. Biomed Res. Int. 27(2022), 5700853. https://doi.org/10.1155/2022/5700853 (2022) Fowler, C., Raoof, N. & Pastores, S. M. Sepsis and adrenal insufficiency. J. Intensive Care Med. 38(11), 987–996. https://doi.org/10.1177/08850666231183396 (2023) Wang, D. W., Yin, Y. M. & Yao, Y. M. Vagal modulation of the inflammatory response in sepsis. Int. Rev. Immunol. 35, 415–433. https://doi.org/10.3109/08830185.2015.1127369 (2016) Pavlov, V. A., Wang, H., Czura, C. J., Friedman, S. G. & Tracey, K. J. The cholinergic anti-inflammatory pathway: A missing link in neuroimmunomodulation. Mol. Med. 9, 125–134. https://doi.org/10.1007/BF03402177 (2003) Zhai, Q. et al. Selective activation of basal forebrain cholinergic neurons attenuates polymicrobial sepsis-induced inflammation via the cholinergic anti-inflammatory pathway. Crit. Care Med. 45, e1075–e1082. https://doi.org/10.1097/ccm.0000000000002646 (2017) Bourhy, L. et al. Neuro-inflammatory response and brain-peripheral crosstalk in sepsis and stroke. Front. Immunol. 13, 834649. https://doi.org/10.3389/fimmu.2022.834649 (2022) ATP mediates rapid microglial response to local brain injury in vivo Barichello, T., Generoso, J. S., Collodel, A., Petronilho, F. & Dal-Pizzol, F. The blood-brain barrier dysfunction in sepsis. Tissue Barriers 9, 1840912. https://doi.org/10.1080/21688370.2020.1840912 (2021) Sonneville, R. et al. Understanding brain dysfunction in sepsis. Ann. Intensive Care 3, 15. https://doi.org/10.1186/2110-5820-3-15 (2013) Torii, K., Takagi, S., Yoshimura, R. & Miyata, S. Microglial proliferation attenuates sickness responses in adult mice during endotoxin-induced inflammation. J. Neuroimmunol. 15(365), 577832. https://doi.org/10.1016/j.jneuroim.2022.577832 (2022) Lekander, M. et al. Intrinsic functional connectivity of insular cortex and symptoms of sickness during acute experimental inflammation. Brain Behav. Immun. 56, 34–41. https://doi.org/10.1016/j.bbi.2015.12.018 (2016) Cheng, D. et al. Minocycline, a classic antibiotic, exerts psychotropic effects by normalizing microglial neuroinflammation-evoked tryptophan-kynurenine pathway dysregulation in chronically stressed male mice. Brain Behav. Immun. 107, 305–318. https://doi.org/10.1016/j.bbi.2022.10.022 (2023) Amorim, M. R. et al. Neuroinflammation in the NTS is associated with changes in cardiovascular reflexes during systemic inflammation. J. Neuroinflamm. 16(1), 125. https://doi.org/10.1186/s12974-019-1512-6 (2019) Huffman, W. J. et al. Modulation of neuroinflammation and memory dysfunction using percutaneous vagus nerve stimulation in mice. Brain Stimul. 12(1), 19–29. https://doi.org/10.1016/j.brs.2018.10.005 (2019) Campanaro, C. K. et al. Dynamics of ventilatory pattern variability and Cardioventilatory Coupling during systemic inflammation in rats. Front. Netw. Physiol. 31(3), 1038531. https://doi.org/10.3389/fnetp.2023.1038531 (2023) Exaggerated neuroinflammation and sickness behavior in aged mice following activation of the peripheral innate immune system Dejager, L., Pinheiro, I., Dejonckheere, E. & Libert, C. Cecal ligation and puncture: The gold standard model for polymicrobial sepsis?. Trends Microbiol. 19, 198–208. https://doi.org/10.1016/j.tim.2011.01.001 (2011) Lu, Y. C., Yeh, W. C. & Ohashi, P. S. LPS/TLR4 signal transduction pathway. Cytokine 42, 145–151. https://doi.org/10.1016/j.cyto.2008.01.006 (2008) Download references We show our acknowledgements to the Guizhou Provincial Science and Technology Foundation and Science and Technology Fund of Guizhou Provincial Health Commission for their funding support This study was supported by the Guizhou Provincial Science and Technology Foundation NO: Key Projects [2023] 001; Science and Technology Fund of Guizhou Provincial Health Commission These authors contributed equally: Xian Liu and Cheng Zhang Department of Geriatric Medicine of the First People’s Hospital of Guiyang of Guizhou Province Emergency Department of the First People’s Hospital of Guiyang of Guizhou Province Xian Liu and Cheng Zhang equally contributed to this research Hongbing Li was responsible for the conception and design of the study and manuscript writing Cheng Zhang processed the experimental data Xian Liu assisted Cheng Zhang to perform the experiment and collect the data All authors agree to publish this manuscript Download citation DOI: https://doi.org/10.1038/s41598-024-67531-7 Sorry, a shareable link is not currently available for this article. Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily. Volume 8 - 2014 | https://doi.org/10.3389/fncir.2014.00137 The periaqueductal gray (PAG) modulates nociception via a descending pathway that relays in the rostral ventromedial medulla (RVM) and terminates in the spinal cord Previous behavioral pharmacology and electrophysiological evidence suggests that brain-derived neurotrophic factor (BDNF) plays an important role in descending pain modulation detailed information is still lacking on the distribution of BDNF activation of BDNF-containing neurons projecting to RVM in the condition of pain and neurochemical properties of these neurons within the PAG Through fluorescent in situ hybridization (FISH) and immunofluorescent staining the homogenous distributions of BDNF mRNA and protein were observed in the four subregions of PAG Both neurons and astrocytes expressed BDNF By combining retrograde tracing methods and formalin pain model there were more BDNF-containing neurons projecting to RVM being activated in the ventrolateral subregion of PAG (vlPAG) than other subregions of PAG The neurochemical properties of BDNF-containing projection neurons in the vlPAG were investigated BDNF-containing projection neurons expressed the autoreceptor TrkB in addition to serotonin (5-HT) and parvalbumin (PV) but not tyrosine decarboxylase (TH) It is speculated that BDNF released from projection neurons in the vlPAG might participate in the descending pain modulation through enhancing the presynaptic release of other neuroactive substances (NSs) in the RVM there is no direct evidence to demonstrate that BDNF is involved in the descending pain modulation through PAG-RVM pathway there has been no report to investigate the NSs' expression of BDNF-containing projection neurons in the PAG for underling the presynaptic mechanism participating in the descending pain modulation We therefore observed the neurochemical properties of BDNF-containing projection neurons in the vlPAG Adult male Sprague Dawley rats (250–300 g) were used in all experiments Group 1 (3 rats) was used for FISH and double-immunofluorescent histochemical staining Group 2 (6 rats) was used for simple retrograde tracing investigation and triple-immunohistochemical staining Group 3 (6 rats) was used for combining retrograde tracing and formalin pain model and triple-immunohistochemical staining Group 4 (3 rats) was used for injecting normal saline into the hindpaw Rats were housed in a temperature-controlled environment on a 12 h light/dark cycle with access to food and water ad libitum The experiments were approved by the Institutional Animal Care and Use Committee of the Fourth Military Medical University (Xi'an and the ethical guidelines to investigate experimental pain in conscious animals China) by using the DNA probe sequences antisense as 5′-GGCGC CACTC CGACC CCGCC CGCCG TGGGG AGCTG-3′ and 5′-AAGTG TAATC CCATG GGTTA CACGA AGGAA GGCTG-3′ for BDNF mRNA free-floating sections were hybridized for 24 h at 50°C with digoxigenin-labeled DNA probe for BDNF in a hybridization buffer the hybridized sections were incubated overnight at room temperature (RT) with peroxidase-conjugated antidigoxigenin sheep antibody (11-426-338-910; Roche Diagnostics Switzerland) in 0.1 M Tris-HCl (pH 7.5)-buffered 0.9% (w/v) saline containing 1% blocking reagent (TSB) To visualize the signals for BDNF mRNA efficiently we performed the biotinylated tyramine-glucose oxidase amplification method the sections were incubated with 10 μg/ml Alexa594-conjugated streptavidin (S-32356; Invitrogen OR) in TSB for 3 h and then incubated for 15 min with DAPI (1:5,000 USA) diluted in 0.01 M phosphate-buffered saline (PBS pH 7.4) and underwent three more wash steps followed by mounting and coverslipping on microscope slides Negative controls were treated with hybridization buffer without BDNF DNA probe and the other procedures were unchanged following the previous instructions No hybridization signals were detected in these sections Each injection was made slowly over 10 min and the injection needle was kept in place for another several minutes After being kept alive for 5–7 days the rats were re-anesthetized with 2% sodium pentobarbital (40 mg/kg i.p.) and injected with 10 μl of 1% colchicines for efficiently detecting the peptide neurotransmitters into the lateral ventricle (0.48 mm caudal to Bregma 1.6 mm right to midline and 3.6 mm ventral to the surface of the cranium) and survived for another 24 h before perfusion The pain behaviors were manually recorded with a stop watch by retrieving spontaneous flinches or lickings of the injected hindpaw from the recorded videos rats were perfused and used for the later morphological studies Under deep anesthesia with 2% sodium pentobarbital (100 mg/kg rats were perfused through the ascending aorta with 200 ml of normal saline followed by 500 ml of 2% (w/v) paraformaldehyde and 15% (v/v) saturated picric acid in 0.1 M PB immersed in the same fixative for 4 h at 4°C and transferred to 30% (w/v) sucrose in 0.1 M PB until sink After being embedded in an inert mounting medium (OCT; Tissue-Tek; Sakura; Torrance coronal sections of the brain containing PAG or RVM were cut at 25 μm thickness using a freezing microtome and were collected into dishes containing 0.01 M PBS The sections containing PAG or RVM regions in the first dish were mounted onto gelatin-coated glass slides air dried and coverslipped with a mixture of 50% (v/v) glycerin and 2.5% (w/v) triethylenediamine (anti-fading agent) in 0.01 M PBS and then observed using a fluorescence microscope (Olympus BX-60; Tokyo Japan) for investigating the injection or projection sites Following our previous protocol (Li et al., 1996), the sections underwent double- or triple-labeling IF using different antibodies in the combinations and dilutions showing in Table 1 free-floating sections containing PAG were blocked for 30 min with 10% normal donkey serum (NDS) in 0.01 M PBS Then the sections were subjected to the following sequential incubations with: (1) primary antibodies in the antibody dilution medium (0.01 M PBS containing 5% (v/v) NDS (PBS-NDS) 0.05% (w/v) NaN3 and 0.25% (w/v) λ-carrageenan) overnight at RT and then 72 h at 4°C; (2) a mixture of secondary antibodies in PBS-NDS for 3 h at RT and then 10 h at 4°C; (3) fluorescence isothiocyanate (FITC)-conjugated avidin in PBS containing 0.3% Triton X-100 (PBS-X Some other sections were used as controls by replacing the primary antibodies with the combinations of normal rabbit goat or guinea pig serum according to the species of primary antibodies used while keeping the other conditions unchanged The antibodies used in the current study were rabbit anti-BDNF antiserum (ab6201; Abcam USA); mouse anti-NeuN antiserum (MAB377; Millipore USA); mouse anti-GFAP antiserum (MAB3402; Millipore); mouse anti-OX42 antiserum (CBL1512; Millipore); guinea pig anti-FG antiserum (NM-101; PROTOS BIOTECH CORP USA); goat anti-5-HT antiserum (20079; ImmunoStar USA); rat anti-NT antiserum (NP-103; PROTOS BIOTECH CORP); rat anti-SP antiserum (MAB356; Millipore); goat anti-CGRP antiserum (ab36001; Abcam); mouse anti-NOS antiserum (N-2280; Sigma USA); mouse anti-PV antiserum (P-3171; Sigma); mouse anti-TH antiserum (T-2928; Sigma); goat anti-TrkB antiserum (sc-20542; Santa Cruz Biotechnology USA); mouse anti-FOS antiserum (ab11959; Abcam); biotin-donkey anti-rabbit IgG (AP182F; Millipore); Alexa594-donkey anti-mouse IgG (A21203; Invitrogen USA); Alexa594-goat anti-guinea pig IgG (A-11076; Invitrogen); Alexa594-donkey anti-goat IgG (A-11058; Invitrogen); Cy3-donkey anti-rat IgG (AP189c; Millipore); Alexa647-donkey anti-guinea pig IgG (AP193SA6; Millipore); FITC-Avidin (A-2001; Vector the sections were observed and images were captured under confocal laser scanning microscope (FV1000; Olympus) with appropriate filters for FITC (excitation 492 nm a careful focus through the thickness of all sections determined that the immunolabeling had penetrated the whole thickness of sections in which the maximum of the nuclei could be observed with obvious light emission the sections were carefully moved across the stage and analyzed from left to right the total number of BDNF-immunoreactive (-ir) neurons was counted Sections were captured digitally with 20 X objective by confocal laser microscope For analyzing the coexpression of BDNF and other NSs and related proteins we counted the immunopositive neurons separately in total area of each subregion then calculate the percentages of double- or triple-labeling neurons Counts were performed by a blinded microscopist Cell count estimates were presented as mean±SD (mean number of total labeled cells per rat) a one-way analysis of variance (One-Way ANOVA) was used The level of statistical significance was set at P < 0.05 7.8 ± 0.6 per 100 × 100 μm2; One-Way ANOVA These results indicate that BDNF mRNA and protein distribute homogenously in the four subregions of PAG Nissl staining shows the PAG and its four subregions in the midbrain at Bregma −7.92 mm The green dashed lines are manually outlined based on the atlas of the rat brain Distributions of BDNF mRNA and protein in the four subregions of PAG (A–C) Low magnification FISH photomicrographs show the signals for BDNF mRNA visualizing with Alexa594 (red) and DAPI (blue) in the PAG (D–G) High magnification images also show the signals for BDNF mRNA and DAPI The framed area in (F) is magnified in (G) Arrows indicate cells expressing BDNF mRNA (H) Percentages of BDNF mRNA signals among DAPI+ cells in the four subregions of PAG (I) Numbers of BDNF-ir neurons per 100 × 100 μm2 in the four subregions of PAG There was no significant difference between columns in (H) and (I) Scale bars = 50 μm in (C) (applies A–C); 20 μm in (F) (applies D–F); 10 μm in (G) The presence of BDNF mRNA and protein in the PAG inspired us to investigate the cell expression patterns of BDNF. The neuronal and glial expressions of BDNF were explored by markers for different cells. Double labeling between BDNF and NeuN (Neuronal Nuclei), as well as between BDNF and GFAP (Glial Fibrillary Acidic Protein) could be observed in the PAG. But double labeling between BDNF and OX42 was not observed (Figure 3) These results indicate that not only neurons (NeuN positive cells) but also astrocytes (GFAP positive cells) express BDNF in the PAG Microglia (OX42 positive cells) never shows any BDNF staining Given the existence of BDNF-containing neurons in the PAG we wanted to know whether these neurons could project to RVM involved in the descending pain modulation Fluorescent photomicrographs show both neurons and astrocytes express BDNF (A–D) Colocalization of BDNF (green) and NeuN (red) (E–H) Colocalization of BDNF (green) and GFAP (red) (I–L) Expression of BDNF (green) and OX42 (red) The framed areas in (C,G,K) are magnified in (D,H,L) respectively Arrows indicate the colocalization of BDNF/NeuN (D) and BDNF/GFAP (H); arrowheads indicate the single expression of NeuN (D) or OX42 (L) Scale bars = 20 μm in (K) (applies A–C I–K); 10 μm in (H) (applies D,H,L) Most FG-labeled neurons were small to medium sized and had fusiform Pressure injection of FG into RVM also gave rise to a large number of retrogradely labeled neurons in the midbrain adjacent to PAG and external cortex of the inferior colliculus Distribution of retrogradely labeled neurons in the PAG after FG was injected into the raphe magnus nucleus (A) Fluorescent photomicrograph shows FG injection site in the raphe magnus nucleus and its adjacent regions (B–D) Fluorescent photomicrographs show the general distributing patterns of FG retrogradely labeled neurons from the RVM in the four subregions of the PAG FG labeled neurons were observed in the dmPAG (B) (E) Summary of the numbers of FG labeled neurons in four subregions of the PAG commissure of the inferior colliculus; CnF it is supposed that there is factually a PAG-RVM BDNF-containing pathway and BDNF-containing projection neurons are likely to be distributed over most but not all of the PAG Fluorescent photomicrographs show the distribution of BDNF-ir neurons and FG labeled neurons in the PAG after FG was injected into the raphe magnus nucleus The distributions of BDNF-ir (green) and/or FG labeled (red) neurons are shown in the dmPAG (A–C) (J–M) High magnification images show the colocalization of BDNF and FG in the PAG Arrows indicate the merged BDNF/FG neurons and double arrowheads indicate the FG labeled neurons Scale bars = 50 μm in (I) (applies A–I); 20 μm in (L) (applies J–L); 10 μm in (M) Numbers of neurons labeled with BDNF and/or FG in four subregions of the PAG the number of BDNF/FG/FOS labeled neurons and the activated percentage in the vlPAG were more than those in the other subregions the distribution of FOS labeled neurons was sparse and only scattered FOS was found in the PAG And less than 1% of BDNF-ir neurons were labeled with FOS in the PAG It is suggested that BDNF-containing projection neurons in the PAG play a role in the formalin-induced hindpaw pain and vlPAG might play a more important part than the other subregions So our attentions were focused on the BDNF-containing projection neurons in the vlPAG Activation of BDNF-containing projection neurons in the PAG after formalin injection BDNF-containing (green) projection neurons (blue) could express FOS (red) Arrows indicate BDNF/FG/FOS merged neurons (D); filled arrowheads indicate neurons singlely expressing BDNF (A); unfilled arrowheads indicate neurons singlely expressing FOS (B); unfilled arrows indicate neurons singlely labeled by FG (C); double filled arrowheads indicate colocalization of BDNF and FOS (D); double unfilled arrowheads indicate BDNF-ir and FG labeled neurons (D) The framed areas in (D) are magnified in (E) Counting the numbers of activated BDNF-containing projection neurons (BDNF/FG/FOS-ir neurons) (F) and the percentages of these neurons among BDNF-containing projection neurons (G) in the four subregions of PAG Scale bars = 20 μm in (D) (applies A–D); 10 μm in (E) Fluorescent photomicrographs show the expression of neurotransmitters (5-HT CGRP) in BDNF-containing projection neurons in the vlPAG after FG was injected into the raphe magnus nucleus BDNF-containing (green) projection neurons (blue) could express 5-HT (A–E) Arrows indicate the merged BDNF/FG/neurotransmitters BDNF-ir projecting neurons expressing 5-HT (D) CGRP (S); filled arrowheads indicate singly BDNF-ir (A,F,K,P) or FG labeled neurons (H,M); double filled arrowheads indicate BDNF and 5-HT (D) CGRP (S) merged neurons; double unfilled arrowheads indicate BDNF and FG merged neurons (D,I,N) The framed areas in (D,I,N,S) are magnified in (E,J,O,T) respectively Scale bars = 20 μm in (S) (applies A–D,F–I P–S); 10 μm in (T) (applies E,J,O,T) Fluorescent photomicrographs show the expression of NOS and TrkB in BDNF-containing projection neurons in the vlPAG after FG was injected into the raphe magnus nucleus BDNF-containing (green) projection neurons (blue) could express NOS Arrows indicate the triply labeled neurons BDNF-ir projecting neurons expressing NOS (D) and TrkB (S); filled arrowheads indicate singly BDNF- (A,F,K,P) or NOS- (B) or TH-ir (L) or FG (C,H,M,R) labeled neurons; double filled arrowheads indicate BDNF and TH (N) merged neurons; double unfilled arrowheads indicate BDNF and FG (D,I,N,S) merged neurons; filled and unfilled arrowheads indicate FG and TrkB merged neurons (S) The framed areas in (D,I,N,S) are magnified in (E) Scale bars = 20 μm in (S) (applies A–D There were numerous neurons expressing NOS in the dlPAG, vlPAG, and caudal DR. PV-expressing neurons were observed in all four subregions of the PAG and DR. The TH-ir neurons mainly distributed in the DR, and small numbers extended into the vlPAG of the rostral portion. BDNF-containing projection neurons expressing NOS and PV could be observed, while triplely labeled BDNF/FG/TH neurons were not found (Figure 8) The numbers and percentages of these triple- and double-labeling neurons were shown in Table 3 The numbers of triple-labeling neurons were 280.0 ± 37.7 69.1 ± 2.4% neurons that projected to RVM 28.5 ± 1.6% of BDNF-containing projection neurons expressed 5-HT BDNF could be expressed in 84.0 ± 4.9% PV-containing projection neurons in the vlPAG Respecting BDNF-containing projection neurons expressed 5-HT BDNF has the ability to enhance the release of neurotransmitters We next examined whether BDNF-containing projection neurons expressed BDNF receptors TrkB-containing neurons were observed in all of the four subregions of PAG and DR there were 443.3 ± 45.0 BDNF/TrkB/FG-ir neurons 70.8 ± 6.3% of BDNF/TrkB-ir neurons projected to the RVM 61.7 ± 5.9% of BDNF-containing projection neurons expressed TrkB and 81.2 ± 1.3% of TrkB-containing projection neurons expressed BDNF These results indicate that BDNF and its receptor TrkB coexist in the same PAG-RVM projection neurons The present data enhance our understanding of the PAG-RVM pathway underlying the descending pain modulation including descending inhibition and facilitation BDNF homogeneously distributes in the four subregions and is mainly expressed in neurons and astrocytes; (ii) a subset of PAG neurons expressing BDNF are involved in the formalin pain model especially in the vlPAG which also projecte to RVM; (iii) in the vlPAG BDNF-containing neurons projecting to RVM express 5-HT or PV; (iv) BDNF-containing projection neurons also express its own receptors It is speculated that BDNF released from projection neurons in the vlPAG participate in the descending pain modulation likely through regulating the presynaptic release of NSs in the RVM Our report now clarifies which cells express BDNF in the PAG Neurons, astrocytes, and microglia all express BDNF in other different regions of brain (Martinowich et al., 2007; Boyadjieva and Sarkar, 2013; Degos et al., 2013; Gomes et al., 2013; Quesseveur et al., 2013) but microglia do not express BDNF in the PAG What is the reason of expressing cellular differences especially between astrocytes and microglia in different regions Heterogeneity of BDNF expression might confer a regional specificity on cellular expressing of BDNF for different functions BDNF released from astrocytes might locally modulate local circuits that participate in the descending targets of the PAG The neuronal expression of BDNF illustrated the probability that BDNF-containing neurons could project to the RVM and participate in descending pain modulation we detected more BDNF-ir neurons due to different antibody against BDNF used in our work Therefore higher percentages of BDNF-ir projection neurons among FG labeled neurons were observed 81.5 ± 0.9% and 70.6 ± 5.4% vs It should also be noticed that BDNF-containing projection neurons were activated in dmPAG and lPAG Those functional BDNF-containing projection neurons might be related to fear and anxiety and vocalization for pain rather than pain modulation the NSs investigated in our study are a part of all NSs involved in the PAG-RVM pathway More studies about other NSs are indeed to be carried out in the future Although there were technical limitations to investigate coexpression of BDNF/TrkB/NSs/FG in the vlPAG we infer the existence of at least some coexpression for 5-HT SP and CGRP based on the high percentages of triple-labeling neurons among BDNF/FG-ir neurons It is presumed that there is the same mechanism for BDNF modulating the presynaptic NSs' release by binding presynaptic TrkB in the PAG-RVM pathway BDNF is expressed mainly in neurons and astrocytes within the PAG There are amounts of BDNF-containing projection neurons in the four subregions of PAG these neurons in the vlPAG are more activated in the formalin pain model the vlPAG BDNF-containing neurons projecting to RVM express 5-HT These findings suggest that BDNF released from the projection neurons in the vlPAG regulates the release of NSs via the presynaptic TrkB These NSs work together with BDNF participating in the PAG-RVM descending pain modulation This work was supported by grant from the Natural Science Foundation of China (NO 81100816); intramural grant of the Fourth Military Medical University The Supplementary Material for this article can be found online at: http://www.frontiersin.org/journal/10.3389/fncir.2014.00137/abstract Anatomic and functional topography of the dorsal raphe nucleus Attenuation of mouse somatic and emotional inflammatory pain by hydralazine through scavenging acrolein and inhibiting neuronal activation “Midbrain periaqueductal gray control of defensive behavior in the cat and the rat,” in The Midbrain Periaqueductal Gray Matter:Functional Bandler and A Depaulis (New York: Plenum Press) Google Scholar Columnar organization in the midbrain periaqueductal gray and the integration of emotional expression Columnar organization in the midbrain periaqueductal gray: modules for emotional expression Glutamate decarboxylase-immunoreactive neurons and terminals in the periaqueductal gray of the rat Endogenous pain control systems: brainstem spinal pathways and endorphin circuitry Functional characteristics of the midbrain periaqueductal gray The nuclei of origin of brain stem enkephalin and substance P projections to the rodent nucleus raphe magnus The sites of origin brain stem neurotensin and serotonin projections to the rodent nucleus raphe magnus Relationship of glutamate and aspartate to the periaqueductal gray-raphe magnus projection: analysis using immunocytochemistry and microdialysis The periaqueductal gray-raphe magnus projection contains somatostatin neurotensin and serotonin but not cholecystokinin The NK1 receptor is essential for the full expression of noxious inhibitory controls in the mouse Influence of growth factors on neuronal differentiation Brain sources of inhibitory input to the rat rostral ventrolateral medulla Cyclic adenosine monophosphate and brain-derived neurotrophic factor decreased oxidative stress and apoptosis in developing hypothalamic neuronal cells: role of microglia Supramedullary afferents of the nucleus raphe magnus in the rat: a study using the transcannula HRP gel and autoradiographic techniques Role of the brain-derived neurotrophic factor at glutamatergic synapses Expanded distribution of mRNA for nerve growth factor and neurotrophin 3 in the rat brain after colchicine treatment Fos expression in serotonergic neurons in the rat brainstem following noxious stimuli: an immunohistochemical double-labelling study Origins of endomorphin-immunoreactive fibers and terminals in different columns of the periaqueductal gray in the rat Neurokinin-1 receptor-expressing neurons that contain serotonin and gamma-aminobutyric acid in the rat rostroventromedial medulla are involved in pain processing Distribution of brain-derived neurotrophic factor (BDNF) protein and mRNA in the normal adult rat CNS: evidence for anterograde axonal transport BDNF from microglia causes the shift in neuronal anion gradient underlying neuropathic pain Regulation of neuropeptides in adult rat forebrain by the neurotrophins BDNF and NGF analgesia and aggression in mice lacking the receptor for substance P Neuroprotective effects of dexmedetomidine against glutamate agonist-induced neuronal cell death are related to increased astrocyte brain-derived neurotrophic factor expression Cardiovascular effects of acetylcholine microinjection into the ventrolateral and dorsal periaqueductal gray of rats Nitrous oxide-antinociception is mediated by opioid receptors and nitric oxide in the periaqueductal gray region of the midbrain Dose-dependent antinociceptive action of neurotensin microinjected into the rostroventromedial medulla of the rat Effects of BDNF infusion on the regulation of TrkB protein and message in adult rat brain Chemical neuroanatomy of the dorsal raphe nucleus and adjacent structures of the mouse brain Afferents to brain stem nuclei (brain stem raphe nucleus reticularis pontis caudalis and nucleus gigantocellularis) in the rat as demonstrated by microiontophoretically applied horseradish peroxidase Differential expression of VGLUT1 or VGLUT2 in the trigeminothalamic or trigeminocerebellar projection neurons in the rat Activation of microglial cells triggers a release of brain-derived neurotrophic factor (BDNF) inducing their proliferation in an adenosine A2A receptor-dependent manner: A2A receptor blockade prevents BDNF release and proliferation of microglia Supraspinal brain-derived neurotrophic factor signaling: a novel mechanism for descending pain facilitation Involvement of nitric oxide and serotonin in modulation of antinociception and pressor responses evoked by stimulation in the dorsolateral region of the periaqueductal gray matter in the rat An endocannabinoid mechanism for stress-induced analgesia Trk receptors: roles in neuronal signal transduction doi: 10.1146/annurev.biochem.72.121801.161629 Anti-nociceptive effects of calcitonin gene-related peptide in nucleus raphe magnus of rats: an effect attenuated by naloxone and trkC messenger RNA expression by bulbospinal cells of the rat Down-regulation of insulin signaling is involved in painful diabetic neuropathy in type 2 diabetes Cyclooxygenase-1-derived prostaglandins in the periaqueductal gray differentially control C- versus A-fiber-evoked spinal nociception GABAergic and glycinergic neurons projecting to the trigeminal motor nucleus: a double labeling study in the rat BDNF and activity-dependent synaptic modulation Effect of interleukin-1 beta on the release of substance P from rat isolated spinal cord New insights into BDNF function in depression and anxiety Costorage and coexistence of neuropeptides in the mammalian CNS Presynaptic functional trkB receptors mediate the release of excitatory neurotransmitters from primary afferent terminals in lamina II (substantia gelatinosa) of postnatal rat spinal cord Contribution of dopamine receptors to periaqueductal gray-mediated antinociception “Differences in antinociception evoked from dorsal and ventral regions of the caudal peqiaquductal gray matter,” in The Midbrain Periaqueductal Gray Matter: Functional Google Scholar The initial step in norepinephrine biosynthesis Intraventricular administration of BDNF increases neuropeptide expression in newborn rat brain The parvalbumin-containing nonpyramidal neurons in the rat hippocampus Nitric oxide synthase immunoreactive neurons anatomically define a longitudinal dorsolateral column within the midbrain periaqueductal gray of the rat: analysis using laser confocal microscopy T-type channels control the opioidergic descending analgesia at the low threshold-spiking GABAergic neurons in the periaqueductal gray Google Scholar BDNF overexpression in mouse hippocampal astrocytes promotes local neurogenesis and elicits anxiolytic-like activities Contribution of brainstem GABAergic circuitry to descending antinociceptive controls: I GABA-immunoreactive projection neurons in the periaqueductal gray and nucleus raphe magnus Induction of NADPH-diaphorase activity in the rat periaqueductal gray matter after nociceptive visceral stimulation Ultrastructural evidence for a pre- and postsynaptic localization of full-length trkB receptors in substantia gelatinosa (lamina II) of rat and mouse spinal cord The neurotrophin hypothesis for synaptic plasticity Antinociceptive effect of brain-derived neurotrophic factor and neurotrophin-3 Distribution of messenger RNAs encoding enkephalin and calcitonin gene-related peptide in the midbrain periaqueductal grey in the rat A quantitative and morphological study of projection neurons in lamina I of the rat lumbar spinal cord Columnar distribution of catecholaminergic neurons in the ventrolateral periaqueductal gray and their relationship to efferent pathways Neuroprotective effects of extremely low-frequency electromagnetic fields on a Huntington's disease rat model: effects on neurotrophic factors and neuronal density Role of neurotensin in the nucleus raphe magnus in opioid-induced antinociception from the periaqueductal gray Molecular depletion of descending serotonin unmasks its novel facilitatory role in the development of persistent pain Systematic examination in the rat of brain sites sensitive to the direct application of morphine: observation of differential effects within the periaqueductal gray Immunocytochemical localization of TrkB in the central nervous system of the adult rat Projections from serotonin- and substance P-like immunoreactive neurons in the midbrain periaqueductal gray onto the nucleus reticularis gigantocellularis pars alpha in the rat Brain-derived neurotrophic factor-mediated downregulation of brainstem K+-Cl− cotransporter and cell-type-specific GABA impairment for activation of descending pain facilitation Wang W and Li Y-Q (2014) Neurochemical properties of BDNF-containing neurons projecting to rostral ventromedial medulla in the ventrolateral periaqueductal gray Received: 03 January 2014; Accepted: 31 October 2014; Published online: 20 November 2014 Copyright © 2014 Yin, Wu, Dong, Zhang, Wang, Zhang, Wei, Lu, Wu, Wang and Li. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) provided the original author(s) or licensor are credited and that the original publication in this journal is cited *Correspondence: Wen Wang and Yun-Qing Li, Department of Anatomy and K.K. Leung Brain Research Centre, Preclinical School of Medicine, Fourth Military Medical University, No. 169 West Changle Road, Xi'an 710032, China e-mail:d2FuZ3dlbkBmbW11LmVkdS5jbg==;ZGVwdGFuYXRAZm1tdS5lZHUuY24= Metrics details Retained medullary cord (RMC) is a recently defined term denoting closed spinal dysraphism arising from the failure of regression in secondary neurulation Despite the acknowledgment of this condition there needs to be more literature elucidating the radiologic manifestations of RMC This study aimed to describe the MR imaging findings of RMC A retrospective analysis was conducted on spinal MRI scans of pediatric patients with surgically confirmed RMC The investigation focused on evaluating the following image characteristics: level and morphology of the cord-like structure (C-LS) the signal intensity in the far distal C-LS nerve root-like structures originating from the C-LS mean age 7.3 months) who showed a low-lying cord in all cases The morphology of C-LS was either smooth tapered (50%) or hourglass with fusiform cystic dilatation (50%) The C-LS exhibited aberrant T2 hypointense signal compared to the juxta-proximal level T2 hypointense signal vestigial nerves emanating from the C-LS and intradural fatty masses were observed (89.5%) Sacral arachnoid cysts in extradural location were identified in eight patients The characteristic MR features of RMC revealed an extremely low-lying distal C-LS with smooth tapering or hourglass-shaped cystic dilatation of the caudal part accompanied by an intradural fatty stalk and the aberrant signal vestigial nerve This study suggests those radiologic findings can be RMC instead of the previously called terminal syrinx with low-lying conus existing literature lacks a detailed description of the preoperative MR image of RMC this observational study aimed to explore the preoperative MR findings of RMC and investigate radiological findings for the differential diagnosis among the ambiguous secondary neurulation disease spectrum and the most common cutaneous marker was a sacral dimple (52.6%) and cigarette burn scar (2.6%) were also noted Most patients (60.5%) showed no significant clinical symptom confirmed by nerve conduction test and electromyography and two patients had decreased bladder compliance Associated diseases were noted in eight patients (21.1%) as follows: an imperforate anus (10.5%) Retained medullary cord with arachnoid cyst (A) 5-month-old girl with a gluteal fold deviation represented a distal cord-like structure (C-LS) (white arrows) without syringohydromelia and an extradural cystic lesion (asterisks) attached to the fatty tissue (black arrows) at the thecal sac on a T1-weighted (left) and T2-weighted (right) sagittal image D) Axial T2-weighted images showed the shifted C-LS (white arrows) due to an elongated-shaped arachnoid cyst (asterisk) in the right extradural space accompanied by T2 hypointense signal component (arrowheads) in the distal C-LS considering no definite fat tissue at this level (E) After vertical incision and S1-2 laminectomy the upper portion of the cyst was noted in the caudal epidural space (arrow) After nerve root stimulation was done to find the caudal end of the functioning cord (F) Hematoxylin and eosin (left) and immunohistochemical glial fibrillary acidic protein (right) staining also revealed the ependymal lining (black dotted circle) in the C-LS with glioneuronal tissue (brown); therefore The far distal C-LS and the fine vestigial nerve from the C-LS showed T2 hypointense signal as confirmed by intraoperative electrophysiological monitoring there may be controversy over inclusion criteria in this study whether the definition of RMC disease itself is narrow or broad spectrum we retrospectively collected MR image data with a small cohort that was strictly defined and based on the intraoperative data to identify characteristic imaging findings This study described several MR characteristics of RMC that may have resulted from an arrest of secondary neurulation late in the cavitation stage of medullary cord development just before its degeneration Going into the field knowing the possibility of RMC through preoperative imaging may help select the incision site allowing for limited bone exposure and only amputation of the junction between the functional and non-functional cords This retrospective study was approved by the Seoul National University Hospital Institutional Review Board (IRB no The institutional review board waived the requirement of informed consent for the study All methods followed the relevant guidelines and regulations that conform to the Declaration of Helsinki We identified and included 38 patients with intraoperative electrophysiologically and histopathologically confirmed retained medullary cord (RMC) with retrospective reviewing through the clinical data repository system for image analysis of preoperative performed MRI MRI was performed using the following parameters: repetition time/echo time 537–750/–13 ms (T1-weighted) and 3000–4470/93–117 ms (T2-weighted); section thickness 3 mm (sagittal plane) and 5 mm (axial plane); a field of view 448–512 × 224–256 (sagittal plane) and 256–320 × 128–192 (axial plane) Two pediatric radiologists retrospectively reviewed the MR images by consensus (S The distal C-LS structure means the ambiguous indistinct conus medullaris-like structure from the evident distal spinal cord and extending to the dural cul-de-sac previously interpreted as a low-lying cord with terminal syrinx or filar lipoma on MRI as follows: the level and morphology of C-LS the aberrant signal intensity of far distal C-LS the nerve root within the sac from the distal C-LS attached fatty stalk extending to the extradural subcutaneous fat layer and ancillary findings such as arachnoid cyst Statistical analyses were primarily descriptive because of the small sample size Categorical variables were summarized using frequencies and percentages whereas continuous variables were summarized using means and standard deviations Statistical significance was set at a P value of less than 0.05 Data analyses were performed using the commercially available statistical software MedCalc The datasets generated or analyzed during the study are available from the corresponding author on reasonable request Secondary neurulation of human embryos: Morphological changes and the expression of neuronal antigens Secondary neurulation defects-1: Retained medullary cord Retained medullary cord and terminal myelocystocele as a spectrum: Case report New classification of spinal lipomas based on embryonic stage Retained medullary cord in humans: Late arrest of secondary neurulation Retained medullary cord confirmed by intraoperative neurophysiological mapping Retained medullary cord extending to a sacral subcutaneous meningocele Enlargement of sacral subcutaneous meningocele associated with retained medullary cord Disorders of secondary Neurulation: Suggestion of a new classification according to pathoembryogenesis Ependyma-Lined Canal with surrounding neuroglial tissues in Lumbosacral Lipomatous malformations: Relationship with retained medullary cord Retained medullary cord with sacral subcutaneous meningocele and congenital dermal sinus Two cases of large filar cyst associated with terminal lipoma: Relationship with retained medullary cord Two cases of retained medullary cord running parallel to a terminal lipoma Subpial Lumbar Lipoma Associated with retained medullary cord Surgical management of complex spinal cord lipomas: A new perspective Cystic retained medullary cord in an intraspinal J-shaped cul-de-sac: A lesion in the spectrum of regression failure during secondary neurulation Secondary Neurulation defects-1: Thickened Filum Terminale Retained Medullary cord2423–2437 (Springer Embryopathological relationship between retained medullary cord and caudal spinal lipoma The incidence and diagnostic relevance of chemical shift artefact in the magnetic resonance imaging characterisation of superficial soft tissue masses The pathology of lumbosacral lipomas: Macroscopic and microscopic disparity have implications for embryogenesis and mode of clinical deterioration Caudal cell mass developmental aberrations: An imaging approach Download references We thank for the kind permission to reproduce figure for Dr Seoul National University College of Medicine Seoul National University Medical Research Center Seoul National University Children’s Hospital Writing-review & editing: Yeon Jin Cho Seunghyun Lee is a Scientific Reports editorial board member but has no role in the review process or decision to publish this article All remaining authors have declared no conflicts of interest Download citation DOI: https://doi.org/10.1038/s41598-024-81152-0 Volume 12 - 2018 | https://doi.org/10.3389/fncel.2018.00285 This article is part of the Research TopicNeuromodulatory Control of Brainstem Function in Health and DiseaseView all 36 articles including the lateral paragigantocellular nucleus (LPGi) and rostral VLM (RVLM) is commonly considered to be a chemosensitive region the specific mechanism of chemoreception in the VLM remains elusive a family of voltage-independent proton-gated cation channels can be activated by an external pH decrease to cause Na+ entry and induce neuronal excitability TWIK-related acid-sensitive potassium channels (TASKs) are members of another group of pH-sensitive channels; in contrast to AISICs they can be stimulated by pH increases and are inhibited by pH decreases in the physiological range Our previous study demonstrated that ASICs take part in chemoreception The aims of this study are to explore whether TASKs participate in the acid sensitivity of neurons in the VLM Blocking TASKs by microinjection of the non-selective TASK antagonist bupivacaine (BUP) specific TASK1 antagonist anandamide (AEA) or specific TASK3 antagonist ruthenium red (RR) into the VLM increased the integrated phrenic nerve discharge (iPND) shortened the inspiratory time (Ti) and enhanced the respiratory drive (iPND/Ti) microinjection of artificial cerebrospinal fluid (ACSF) at a pH of 7.0 or 6.5 prolonged Ti increased iPND and enhanced respiratory drive which were inhibited by the ASIC antagonist amiloride (AMI) microinjection of alkaline ACSF decreased iPND and respiratory drive our data suggest that TASK1 and TASK3 are coexpressed with ASIC1 in the VLM TASK1 and TASK3 contribute to the central regulation of breathing by coordinating with each other to perceive local pH changes; these results indicate a novel chemosensitive mechanism of the VLM it is unclear whether TASKs participate in central chemoreception It seems that both TASKs and ASICs are involved in the pH sensitivity of chemosensitive neurons in the CNS the colocalization of TASKs and ASICs in chemosensitive neurons has not been addressed and little is known about the cooperation of these two types of channels in respiratory regulation we hypothesized that TASKs and ASIC1 are coexpressed in the VLM and cooperate in the central control of respiration we found both ASIC1 and TASKs (1 and 3) expressed in the VLM of rats We then investigated the role of ASIC1 and TASKs (1 and 3) in chemoreception Our data showed that ASIC1 and TASKs (1 and 3) were colocalized in VLM neurons The microinjection of different TASKs blockers including a non-selective antagonist bupivacaine (BUP) a specific TASK1 antagonist anandamide (AEA) and a specific TASK3 antagonist ruthenium red (RR) into the VLM facilitated phrenic nerve discharge (PND) the microinjection of artificial CSF (ACSF) at a pH of 7.0 or 6.5 increased integrated PND (iPND) Inspiratory time (Ti) and respiratory drive which were inhibited by the ASIC antagonist the microinjection of alkaline ACSF decreased iPND and respiratory drive Our research indicated that TASKs and ASICs contribute to the central regulation of breathing by coordinating with each other to cause the perception of local pH changes This investigation will help to establish a new understanding of the pH-sensing mechanism of chemosensitive neurons in the VLM Male Sprague–Dawley rats (250–350 g aged 3–4 months) were obtained from Shanghai Jiesijie Experimental Animal Co All animals were kept in a room under a 12-h light-dark cycle an ambient temperature of 22 ± 0.5°C and a relative humidity of 60 ± 2% The animal experiments were conducted in strict accordance with the US National Institutes of Health Guidelines for the Care and Use of Laboratory Animals and were approved by the Ethics Committee of Experimental Research A total of 58 adult rats were used in this study Maximal efforts were undertaken to minimize the number of animals and their suffering USA) were freshly prepared in ACSF immediately before administration The ACSF solutions were prepared at different pHs (8.0 glucose 11 and sucrose 10 at pH 7.4 and ethanol served as the vehicle and volume controls Adult Sprague-Dawley rats were anesthetized with urethane (1 g.kg−1) and perfused through the left ventricle with normal saline followed by 4% paraformaldehyde transferred to graded sucrose solutions (20% and 30%) until sinking and were cut into coronal sections at 25-μm thickness using a Leica freezing microtome The slides were washed with 0.01 M PBS and blocked in 1% BSA for 1 h at room temperature the slides were incubated with a primary antibody against TASK1 or TASK3 (Alomone Laboratory and the controls were incubated with 0.01 M PBS without primary antibody overnight The reaction was then detected using a Boshide avidin-biotin-HRP complex (ABC) immunohistochemical kit (Wuhan Slices were dried in the drying oven and mounted with coverslips after dehydration and rendering transparent and were then observed and photographed under a microscope Slides were washed with 0.01 M PBS and then blocked with a 5% mixture of donkey and goat serum for 1 h at room temperature the slides were incubated with primary antibodies against TASK1 (Alomone Laboratory 1:100) and ASIC1 (Santa Cruz Biotechnology the slides were incubated with goat anti rabbit IgG conjugated with cy3 rabbit anti mouse IgG conjugated with DY light 405 (1:100 The slides were then mounted in antifading medium (Beyotime Institute of Biotechnology) and fluorescence was detected using a Zeiss LSM confocal laser system PND was recorded with platinum bipolar electrodes which were amplified (filters set at 5.0 kHz) using a Polygraph System (NIHON KOHDEN) and digitized using a SMUP system (SMUP-E The experiments were started after the phrenic activity was stabilized (approximately 30 min) The iPND was obtained as a moving average of the phrenic signal The value of each iPND and the period of Ti reflected the respiratory drive Rats were held in stereotaxic frames with their heads inclined forward at 45 degrees to the level of the dorsal surface of the brain stem after anesthetization A stainless steel needle was used to unilaterally microinject 0.1 μL into the VLM (12.3 mm posterior 2% pontamine sky blue was microinjected into the same injection point The brains were then removed and fixed in 10% formalin solution the brain stem was coronally sectioned (30 μm) and stained with neutral red to determine the injection site Data are expressed as the means ± SD The significance of differences among the groups was evaluated using the Student t-test or a one-way ANOVA test A value of p < 0.05 was considered statistically significant The localization of TASK1 and TASK3 immunopositive cells was determined in the VLM of rats (Figure 1) TASK1-ir and TASK3-ir cells are mainly localized in the VLM including the rostroventrolateral reticular nucleus (RVL) and the lateral paragigantocellular nucleus (LPGi) The location of TWIK-related acid-sensitive potassium channel 1 and 3 (TASK1 and 3)-positive cells in the ventrolateral medulla (VLM) of SD rats (A) TASK1-positive cells were located in the VLM of rats (B,C) represent high-power visual fields of the area shown in (A) showing a detailed view of TASK1-positive cells in the VLM (D) TASK3-positive cells in the VLM of rats (E,F) represent high-power visual fields of the area shown in (D) showing a detailed view of TASK3-positive cells in the VLM (G) Coronal diagram of the rat medulla; the area shown in black represents the distribution of TASK1 and TASK3 Cell morphology is indicated by the arrows shown in (C,F) Scale bar: 200 μm (A,D,H,I); 80 μm (B,E) and 20 μm (C,F) To detect whether TASK1 and TASK3 are localized in VLM neurons, TASK1-ir and TASK3-ir cells were measured in rat VLM by double immunofluorescence. TASK1 and TASK3 were colocalized with neurofilaments, the biomarker for neurons. Furthermore, TASK1 and TASK3 were colocalized in VLM (Figure 2) TASK1 and TASK3 are expressed and colocalized in VLM neurons (A,B) Representative confocal photomicrograph showing the colocalization of TASK1-ir and TASK3-ir (green) with neurofilament-ir (red) in the VLM (C) Representative confocal photomicrograph showing the colocalization of TASK1 (red) and TASK3 (green) in the VLM We have previously shown that ASIC1 is expressed in VLM neurons and contribute to respiratory regulation (Song et al., 2016). Thus, we wondered whether ASIC1 is coexpressed with TASK1 or TASK3 in VLM neurons. Immunofluorescence was applied to observe the coexpression of ASIC1 and TASK1 or TASK3. Our data showed that ASIC1 was coexpressed with TASK1 and with TASK3 in VLM neurons (Figure 3) TASK1 and TASK3 are expressed and colocalized in the VLM neurons of adult rats (A) Representative confocal photomicrographs showing the colocalization of ASIC1-ir (green) TASK1-ir (red) and neurofilament-H (blue) in the VLM (B) Representative high power visual field of the area shown in (A) (C) Representative confocal photomicrographs showing the colocalization of ASIC1-ir (green) TASK3-ir (red) and neurofilament-H (blue) in the VLM (D) Representative high power visual field of the area shown in (C) (A–C) Scale bar = 200 μm; (B,D) scale bar = 20 μm These results indicate that the inhibition of TASKs in VLM neurons leads to cell depolarization by decreasing K+ efflux bupivacaine (BUP) stimulated respiration of rats (A) The phrenic nerve discharge (PND) was recorded from the same animal The unilateral microinjection of 200 μM BUP into the VLM increased PND and integrated PND (iPND) The microinjection of artificial cerebrospinal fluid (ACSF; pH 7.4) served as a control (B) Inspiratory time (Ti) was decreased by BUP injection (C) Group data showing the effects of BUP on iPND Note that BUP stimulated respiration (*p < 0.05 **p < 0.01 relative to control; n = 6) (E) Histological staining with neutral red: the sky blue spot indicates the injection site in the VLM and the injection plot was confirmed by comparison with the Bregma −12.72 mm coronal diagram in the Paxinos and Watson stereotaxic atlas of the rat brain red arrowheads represent the injection points and dots signify injection points out of VLM these results suggest that both TASK1 and TASK3 in the VLM are involved in the central regulation of respiration inhibition of TASK1 and TASK3 in rat VLM stimulated breathing that is controlled by the respiratory center ruthenium red (RR) stimulated the respiration of rats (A,B) The PND was recorded from the same animal The unilateral microinjection of 100 μM AEA and 10 μM RR into the VLM increased PND and iPND The microinjection of ethanol and ACSF (pH 7.4) served as a control (C–F) Ti was decreased by AEA and RR injection (D–G) Group data showing the effects of AEA and RR on iPND (E–H) Responses of the respiratory drive Note that AEA and RR stimulated respiration ***p < 0.001 relative to control; n = 5 ASIC antagonists attenuated the stimulatory effect of acidification on respiration in rat VLM (A–C) The unilateral microinjection of 0.1 μL ACSF (pH 7.4 7.0 and 6.5) into the VLM increased raw PND (A) and iPND (B,C) AMI pre-treatment (100 μM) blocked this effect The microinjection of ACSF (pH 7.4) served as a control (D–F) Statistical data showing the effects of alkalization and AMI on Ti (D) TASK1 antagonists attenuated the subdued effect of alkalization on respiration in the rat VLM (A–C) The unilateral microinjection of 0.1 μL ACSF (pH 8.0) into the VLM decreased raw PND (A) and iPND (B,C) TASK1 antagonist AEA pre-treatment (100 μM) blocked this effect (D–F) Statistical data showing the effects of different levels of alkalization and AEA on Ti (D) The central chemoreflex is essential to the maintenance of circulatory acid-base homeostasis by adjusting the activity of breathing the mechanism of chemoreflex has remained unclear until now Our previous study demonstrated that ASICs are expressed on the neurons of chemosensitive areas such as the lateral hypothalamus and VLM and contribute to respiratory regulation we focused on the role of another class of pH-sensitive ion channels in breathing regulation and their cooperation with ASICs in the central chemosensory system We found that TASK1 and TASK3 are expressed in the VLM of rats TASK1 and TASK3 cooperate with ASIC1 to participate in the central regulation of respiration This might be the chemosensitive mechanism of the VLM these morphological results lay the foundation for exploring the function of ASIC1 and TASKs (1 and 3) in the brainstem we found that microinjection of the agonist of CB receptors we consumed that it is unlikely the activation of CB receptor medicated respiratory regulation there is no direct evidence to rule out the role of CB receptors and TRP channels in VLM mediated respiratory regulation Further investigations are needed to explore the roles of TASKs channels in the central regulation of breathing It has been well documented that central respiratory chemoreceptors are located in the medullary raphe, nucleus tractus solitarius, VLM and hypothalamus (Funk, 2010). VLM, including RVL and LPGi, is a putative site for central chemoreception, (Corcoran et al., 2009) the specific pH sensing mechanism remains controversial we focused on the effect of ASIC1 and TASKs in the VLM on chemoreception The results indicated that activation of TASK-1 may have minor effect on Ti further studies are needed to explore the roles of TASKs in regulation of breathing the inhibition of TASK1 and TASK3 in the VLM under physiological conditions stimulates respiration The acidification of the VLM led to PND enhancement which was mainly caused by TASK1 activation This result indicates that ASIC1 and TASKs (1 and 3) coexist in the chemosensitive neurons of VLM and coordinate with each other to sense local pH fluctuations; this may be one of the mechanisms by which central chemosensitive neurons respond to pH changes extracellular pH is a critical signal in the central regulation of breathing we have shown that TASKs including TASK1 and TASK3 are expressed in the VLM of rats and are coexpressed with ASIC1 in VLM neurons we have shown that local acidification of the VLM can stimulate respiration Our findings support the notion that ASIC1 TASK1 and TASK3 are expressed on neurons in the VLM and participate in the chemical regulation of respiration in response to extracellular pH change under physiological conditions XW performed the in vivo and some of the in vitro experiments and prepared the manuscript RG conducted some of the in vitro experiments NS and LS designed the experiments and revised the manuscript This work was funded by a grant from the National Natural Science Foundation of China (Nos Alvarez de la Rosa subcellular localization and ontogeny of ASIC1 in the mammalian central nervous system Pharmacology of acid-sensing ion channels–Physiological and therapeutical perspectives Emerging roles for two-pore-domain potassium channels and their potential therapeutic impact The role of pH-sensitive TASK channels in central respiratory chemoreception The TASK family: two-pore domain background K+ channels TASK-1 is a highly modulated pH-sensitive ‘leak’ K+ channel expressed in brainstem respiratory neurons Motoneurons express heteromeric TWIK-related acid-sensitive K+ (TASK) channels containing TASK-1 (KCNK3) and TASK-3 (KCNK9) subunits acid- and anaesthetic-sensitive TASK-like background potassium channel in rat arterial chemoreceptor cells Abnormal respiration under hyperoxia in TASK-1/3 potassium channel double knockout mice Mutations causing neurodegeneration in Caenorhabditis elegans drastically alter the pH sensitivity and inactivation of the mammalian H+-gated Na+ channel MDEG1 Medullary serotonin neurons and central CO2 chemoreception Czirják TASK-3 dominates the background potassium conductance in rat adrenal glomerulosa cells Excitability of prefrontal cortical pyramidal neurons is modulated by activation of intracellular type-2 cannabinoid receptors The TASK background K2P channels: chemo- and nutrient sensors a human background K+ channel to sense external pH variations near physiological pH Molecular background of leak K+ currents: two-pore domain potassium channels The ‘connexin’ between astrocytes ATP and central respiratory chemoreception García-Añoveros BNaC1 and BNaC2 constitute a new family of human neuronal sodium channels related to degenerins and epithelial sodium channels Central chemoreception: lessons from mouse and human genetics Combined antisense and pharmacological approaches implicate hTASK as an airway O2 sensing K+ channel The neuronal background K2P channels: focus on TREK1 Acid-sensing ion channels contribute to chemosensitivity of breathing-related neurons of the nucleus of the solitary tract CB1 receptor-mediated respiratory depression by endocannabinoids a new member of the tandem pore K+ channel family Local anesthetic inhibition of baseline potassium channels with two pore domains in tandem TASK channels contribute to the K+-dominated leak current regulating respiratory rhythm generation in vitro Kopczyńska The contribution of VR1 and CB1 receptors and the role of the afferent vagal pathway in modelling of cardio-respiratory effects of anandamide in rats The endocannabinoid anandamide is a direct and selective blocker of the background K+ channel TASK-1 Role of ventrolateral medulla in regulation of respiratory and cardiovascular systems Expression and distribution of TRPV2 in rat brain a novel tandem pore domain acid-sensitive K+ channel The TASK-1 two-pore domain K+ channel is a molecular substrate for neuronal effects of inhalation anesthetics Acid-sensing ion channels are expressed in the ventrolateral medulla and contribute to central chemoreception Acid sensing ion channel 1 in lateral hypothalamus contributes to breathing control Cns distribution of members of the two-pore-domain (KCNK) potassium channel family A role for TASK-1 (KCNK3) channels in the chemosensory control of breathing Differences in respiratory changes and Fos expression in the ventrolateral medulla of rats exposed to hypoxia A proton-gated cation channel involved in acid-sensing Cardiorespiratory neurons of the rat ventrolateral medulla contain TASK-1 and TASK-3 channel mRNA Serotonergic raphe neurons express TASK channel transcripts and a TASK-like pH- and halothane-sensitive K+ conductance Anandamide and arachidonic acid use epoxyeicosatrienoic acids to activate TRPV4 channels Song N and Shen L (2018) TASK1 and TASK3 Are Coexpressed With ASIC1 in the Ventrolateral Medulla and Contribute to Central Chemoreception in Rats Received: 04 December 2017; Accepted: 10 August 2018; Published: 29 August 2018 Copyright © 2018 Wang, Guan, Zhao, Zhu, Song and Shen. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) *Correspondence: Nana Song, c29uZy5uYW5hQHpzLWhvc3BpdGFsLnNoLmNu Linlin Shen, bGxzaGVuQHNobXUuZWR1LmNu † These authors have contributed equally to this work Disclaimer: All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher. 94% of researchers rate our articles as excellent or goodLearn more about the work of our research integrity team to safeguard the quality of each article we publish. This study aims to examine brain activity during different swallowing actions in patients with dysphagia caused by medullary infarction (MI) before and after treatment using blood oxygen level-dependent (BOLD) functional magnetic resonance imaging. Fifteen patients were enrolled in this study. Brain activation during saliva swallowing and effortful saliva swallowing was observed using BOLD imaging in the acute phase of stroke and after 4 weeks of rehabilitation training. Differences in the activation of brain regions during saliva swallowing before and after treatment, during effortful saliva swallowing before and after treatment, and between the two swallowing actions before and after treatment were compared. Cortical activation increases after recovery from dysphagia, and the increased activation of the postcentral gyrus might play a functional compensatory role. Effortful saliva swallowing is a more effective rehabilitation training method for patients with dysphagia caused by MI. Volume 15 - 2024 | https://doi.org/10.3389/fneur.2024.1346522 This article is part of the Research TopicNew approaches to evaluation and management of dysphagia in neurological diseaseView all 16 articles Introduction: This study aims to examine brain activity during different swallowing actions in patients with dysphagia caused by medullary infarction (MI) before and after treatment using blood oxygen level-dependent (BOLD) functional magnetic resonance imaging Methods: Fifteen patients were enrolled in this study Brain activation during saliva swallowing and effortful saliva swallowing was observed using BOLD imaging in the acute phase of stroke and after 4 weeks of rehabilitation training Differences in the activation of brain regions during saliva swallowing before and after treatment during effortful saliva swallowing before and after treatment and between the two swallowing actions before and after treatment were compared only the bilateral precentral and left lingual gyrus were partially activated during saliva swallowing and there was no obvious activation in the insula Effortful saliva swallowing activated more brain regions than saliva swallowing before treatment including the bilateral supplementary motor area (SMA) The number of brain regions activated during saliva swallowing increased after treatment Discussion: Cortical activation increases after recovery from dysphagia and the increased activation of the postcentral gyrus might play a functional compensatory role Effortful saliva swallowing is a more effective rehabilitation training method for patients with dysphagia caused by MI Dysphagia is a common manifestation in stroke patients, occurring in ~25–45% of acute stroke cases, and severe dysphagia is more likely to occur in patients with medullary infarction (MI) (1) hinder the recovery of patients with stroke and increase the incidence of adverse outcomes and mortality Early detection and treatment of dysphagia can reduce subsequent complications the brain regions that are activated during swallowing movements change Because fMRI scanning requires the swallowing action to be performed in the supine position thereby increasing the risk of choking during swallowing in patients with dysphagia there are relatively few BOLD imaging studies on patients with dysphagia Dysphagia can be caused by damage to the brainstem which result in similar clinical manifestations current research findings on the activated regions and compensatory mechanisms during swallowing after stroke lack consistency This may be because the studies failed to differentiate the damaged site or type of swallowing disorder We aimed to select patients with dorsolateral medullary infarction whose clinical manifestations and Fiberoptic Endoscopic Evaluation of Swallowing (FEES) results were consistent with those of pharyngeal phase dysphagia to minimize variability between participants in the group and obtain more consistent conclusions Swallowing rehabilitation is a pivotal intervention for treating dysphagia the cortical compensatory mechanism of rehabilitation training for improving swallowing function and which rehabilitation method is better for specific patients remain uncertain this study aimed to investigate the cortical activation during saliva swallowing and effortful saliva swallowing using BOLD imaging in patients with dysphagia shortly after MI and after dysphagia recovery to explore the cortical compensatory mechanism of dysphagia recovery We recruited patients with acute stroke of the dorsolateral medulla who met the following criteria and were hospitalized at the Department of Neurology of Tianjin Huanhu Hospital between January 2022 and June 2022 The inclusion criteria were as follows: (i) first-time stroke with confirmed lesions involving the dorsolateral medulla on MRI within 48–72 h of onset; (ii) age between 30 and 75 years; (iii) no history of swallowing disorders before stroke but presenting with dysphagia after stroke with a score of 3–4 on the Kubota Water Swallowing Test; (iv) clear consciousness a Mini-Mental State Examination (MMSE) score >24 and ability to cooperate with the functional examination and swallowing rehabilitation training confirmed by simulated measurements; and (v) voluntarily participated in the study and provided written informed consent The exclusion criteria were as follows: (i) dysphagia caused by other neurological diseases or organic lesions; (ii) concomitant cerebral infarction in other brain regions and cerebellum; (iii) patients with metal or other implants who could not undergo 3.0 T MRI; (iv) patients with lesions in the oral cavity and larynx who could not undergo FEES; and (v) patients with obvious hiccups or severe dysphagia who could not complete the supine swallowing action and those with unstable conditions who were not able to undergo fMRI Fifteen patients with an age range of 35–75 years and average age of 54 years were included in the study, and three patients were female. Based on the Edinburgh Handedness Inventory (7), all 15 patients were all right handed before stroke onset (Table 1) This study was conducted in accordance with the Declaration of Helsinki The studies involving human participants were reviewed and approved by the Ethics Committee of Tianjin Huanhu Hospital The patients provided their written informed consent to participate in this study FEES and BOLD scanning were performed after enrollment and swallowing rehabilitation training was provided 5 days a week and BOLD scanning were performed again after 4 weeks of treatment Swallowing function was assessed using the Kubota Water Swallowing Test (8) wherein the participants drank 30 mL of warm water while seated The classification criteria were as follows: Grade 1 swallowed in two parts without choking; Grade 3 swallowed at once but experienced choking; Grade 4 swallowed in more than two parts with choking; and Grade 5 frequent coughing and inability to swallow and topical anesthesia (1% lidocaine + 1/200,000 adrenaline solution) was administered A fiberoptic endoscope was passed along the floor of the nose through the velopharyngeal port into the pharynx We tested the sensation in the throat when the probe touched the arytenoid cartilage We asked the patient to phonate a high-pitched “eee” to observe the contraction of the pharyngeal muscle and elevation of the larynx The endoscope was then passed into the hypopharynx and the patients were asked to swallow fluid (orange juice) and solid food (soft bread) in turn to assess leakage Considering the need for a supine examination two training methods—saliva swallowing and effortful saliva swallowing—were selected for BOLD scanning Germany) with a 20-channel head coil was used to obtain functional and structural images Patients were positioned supine on the scanner bed with their heads fixed in a birdcage-shaped coil and they viewed the experimental tasks on a screen through a mirror mounted on the head coil Foam earplugs and pads were used to reduce scanner noise and head motion High-resolution T1-weighted structural imaging and diffusion-weighted imaging (DWI) were performed sequentially with the scanning plane parallel to the anterior-posterior commissure line The structural (T1) image parameters were as follows: TR DWI was performed using the following parameters: TR 240 mm × 240 mm; 36 slices; and slice thickness Functional imaging was performed using the magnetic-sensitive GRE-EPI BOLD contrast T2*WI imaging sequence 64 × 64; 36 slices; slice thickness 370 s; a total of 90 dynamics were acquired to cover the entire frontal lobe cortex to the level of the medulla oblongata with each set of swallowing actions lasting for 18 s followed by an 18 s rest period for a total of 10 sets The final 10 s blank module was also included the experimenters accompanied the participants to the MRI room and observed their swallowing actions to ensure that they followed the visual cue requirements for swallowing and resting Specific task sequence of swallowing during BOLD scanning All fMRI data were preprocessed using SPM 12 (Statistical Parametric Mapping Wellcome Department of Imaging Neuroscience The first 10 time points were removed to eliminate the possibility of unstable AMRI signals If a patient's motion and rotation parameters exceeded 1.5 mm and 1.5° this run of data was excluded from future analysis The images were subsequently spatially normalized to the Montreal Neurological Institute template brain resampling voxel size = 3 × 3 × 3 mm3 Functional images were spatially smoothed with a three-dimensional Gaussian kernel of 6 mm full width at half maximum to increase the signal-to-noise ratio and reduce inter-subject differences The experimental data were organized into a database using Excel and the SPSS statistical software package version 20.0 (SPSS Inc. USA) was used to analyze the activation volume and intensity of the brain functional areas The General Linear Model (GLM) was used in the first-level analysis.The activated brain regions and their voxels in each participant were tested using one sample t-test effortful saliva swallowing minus saliva swallowing as con3 the beta weights of two contrasts were statistically compared separately using one sample t-test with the age and sex of participants as covariate The results were corrected for multiple comparisons using the false discovery rate (FDR) correction at the voxel-level and the significance threshold was set at FDR-corrected P < 0.01 with a minimum cluster size (the number of voxels) of 10 voxels Diffusion-weighted images showing dorsolateral medulla infarction (arrow) These are the DWI images of patient 8 (left image lesion located in the right medulla oblongata) and patient 1 (right image lesion located in the left medulla oblongata) The z-value of the coordinate for the slice position is −52 All lesions were located in the left or right side of dorsolateral medulla oblongata FEES was performed after enrollment (2–3 days after the onset of stroke) revealing impaired pharyngeal swallowing function valleculae and pyriform fossa retention of a saliva-like substance absence of swallowing reflex upon touching the epiglottis cartilage and posterior pharyngeal wall with a touch stick residual vallecular material observed when swallowing viscous food and bread and leakage and aspiration in some patients The residual material was removed after repeated swallowing five patients declined follow-up FEES due to their perception of swallowing without any difficulty and 10 patients underwent a follow-up FEES Examination of the 10 patients revealed significantly improved pharyngeal swallowing function; there was no vocal cord paralysis and no obvious retention of saliva-like substances in the valleculae or pyriform fossa the swallowing reflex was still delayed upon touching the epiglottis cartilage and posterior pharyngeal wall with a touch stick After acute stroke, less activation of the brain regions was observed during saliva swallowing, and only the left lingual gyrus and bilateral precentral gyrus were activated. Low-intensity activation was observed in the right inferior occipital lobule, right inferior semilunar lobule, and right posterior lobe of the cerebellum, as shown in Figure 3 and Table 2 Only the left lingual gyrus and bilateral precentral gyrus were activated during saliva swallowing in the acute stroke period (P < 0.01 Brain regions activated during saliva swallowing in the acute stroke period In the acute stroke period, more brain regions were activated during effortful saliva swallowing, including the left lingual gyrus, bilateral precentral gyrus, postcentral gyrus, and SMA, along with low-intensity activation in the right insula, bilateral posterior cerebellum, right inferior temporal gyrus, as shown in Table 3 Brain regions activated during effortful saliva swallowing in the acute stroke period The additionally activated regions during effortful saliva swallowing (effortful saliva swallowing minus saliva swallowing) included the bilateral SMA, postcentral gyrus, and right insula, with increased voxel numbers in the bilateral precentral gyrus compared with those regions activated with saliva swallowing in the acute stroke period (Figure 4) T-score map showing difference between two swallowing actions (effortful saliva swallowing minus saliva swallowing) in the acute stage of stroke and the bilateral precentral gyrus can be seen (P < 0.01 After treatment, more brain regions were activated during saliva swallowing, including the left lingual gyrus, bilateral precentral and postcentral gyrus, SMA, insula, thalamus, and low-intensity activation in left inferior frontal gyrus, left calcarine, which are similar to the brain regions activated during saliva swallowing in healthy individuals, as shown in Table 4 Brain regions activated during saliva swallowing after treatment After treatment, there are many brain areas activated during effortful saliva swallowing, including the right cerebellum, right superior temporal gyrus, bilateral precentral and postcentral gyri, SMA, insula, thalamus, and bilateral supramarginal gyrus. These regions were similar to those activated in healthy individuals during effortful saliva swallowing (Figure 5) T-score map showing many brain areas activated during effortful saliva swallowing after treatment in axial slices including bilateral precentral and postcentral gyrus and bilateral supramarginal gyrus (P < 0.01 Compared with those before treatment, the bilateral precentral and postcentral gyri, bilateral SMA, bilateral insula, and bilateral thalamus were additionally activated during saliva swallowing after rehabilitation training (saliva swallowing after treatment minus that at acute period, Figure 6) T-score map showing the difference during saliva swallowing between two timepoints (saliva swallowing after treatment minus saliva swallowing in the acute stroke period) the bilateral precentral and postcentral gyrus and bilateral thalamus were additionally activated (P < 0.01 we observed that after several consecutive swallows and additional actions may be required to produce more saliva which may cause a change in the activated areas allowing participants to have enough time to rest and produce more saliva there was a lack of general cortical activation during swallowing It is speculated that the activation of the cortex during swallowing in patients with dysphagia is more related to the damaged region and degree than to the post-injury period most cortices will exhibit decreased activation regardless of the time after injury The absence of insular activation may affect the patient's ability to plan swallowing movements leading to uncoordinated or abnormal swallowing completion which is manifested as a delay in the start of pharyngeal swallowing Activation of the insula maybe a compensatory mechanism for the recovery of swallowing function These inconsistent results may be attributed to the heterogeneity of the enrolled patients it is advisable to select relatively consistent patients such as those with unilateral involvement of a certain cortical or subcortical structure which may be attributed to different post-injury periods and different compensatory mechanisms between the early and chronic periods This suggests that after the motor function is impaired increased somatosensory input is required to complete swallowing tasks; that is sensory reorganization contributes to compensation and FEES revealed decreased sensation in the pharynx When the probe touched the epiglottis and posterior pharyngeal wall causing a delay in the swallowing response; this is an important cause of choking The patients in this study underwent ice-cotton swab stimulation training which improved pharyngeal sensation and increased sensory input to the postcentral gyrus Sensory compensation contributed to clinical recovery which showed improved pharyngeal sensation after recovery This finding suggests that the tactile input during swallowing may be a crucial factor in recovery it is necessary to focus not only on motor training but also on sensory stimulation training to better promote swallowing function The results of the present study were similar although the range of differences in activation was smaller a significant increase was observed in brain activation between the two swallowing actions This finding suggests that patients with acute medullary stroke need to exert more effort to complete effortful saliva swallowing and activate more brain regions which are the compensatory areas activated when normal saliva swallowing is performed after recovery The BOLD imaging results confirmed that the recovery of swallowing function after stroke can be attributed to the compensation of more brain regions; however the results cannot confirm that rehabilitation training itself stimulates the compensatory brain regions we observed that effortful swallowing after MI can activate these compensatory brain regions and promote faster recovery of swallowing function This indicates that in pharyngeal dysphagia caused by MI effortful saliva swallowing can activate more brain regions and better promote the recovery of swallowing function making it a more suitable rehabilitation training method than saliva swallowing This study has some limitations. First, to ensure the comfort of patients during BOLD study, saliva swallowing and effortful saliva swallowing actions were observed subjectively by the experimenters without objective quality control. Nevertheless, documenting the quality control of the performance of participants during fMRI is very important (2) electromyography or pads placed on the neck to record the thyroid cartilage motion could be used to mark swallowing FEES was only used to confirm that the enrolled patients had pharyngeal dysphagia at the initial design of the experiment if FEES scoring was available for the improvement of pharyngeal sensation and the MI was not differentiated between the left and right sides making it impossible to distinguish whether the contralesional or ipsilesional hemispheres were more compensatory increasing the number of trial participants and grouping them according to the injured side can ensure more accurate observation of compensatory mechanisms We can observe whether this safe training technique is useful for patients with dysphagia in the future This study demonstrated that patients with dysphagia after MI did not exhibit insular activation at the acute stroke period activation of the posterior central gyrus increased which is consistent with the improved swallowing function and pharyngeal sensation in FEES The BOLD results confirmed that the sensory cortex might play a compensatory role in the recovery of swallowing function effortful saliva swallowing after MI significantly increased activation in swallowing-related regions and these brain regions promoted the recovery of swallowing function suggesting that effortful saliva swallowing is a more effective rehabilitation training method for patients with dysphagia after MI The data analyzed in this study is subject to the following licenses/restrictions: The raw data is the result of fMRI, which is saved in the form of a CD and requires software analysis. The figures and tables attached in the article can be used publicly, but only members of the research team can view the original MRI images. Requests to access these datasets should be directed to FG, Z29vZ2xlZHJhZ29uQDE2My5jb20= The studies involving humans were approved by Ethics Committee of Tianjin Huanhu Hospital The studies were conducted in accordance with the local legislation and institutional requirements The participants provided their written informed consent to participate in this study Writing – review & editing The author(s) declare financial support was received for the research This study was funded by the Tianjin Health Science and Technology Project (ZC20038) and Tianjin Key Medical Discipline (Specialty) Construction Project (No All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations Any product that may be evaluated in this article or claim that may be made by its manufacturer is not guaranteed or endorsed by the publisher The occurrence rate of swallowing disorders after stroke patients in Asia: a PRISMA-compliant systematic review and meta-analysis doi: 10.1016/j.jstrokecerebrovasdis.2020.105113 Functional MRI in radiology—a personal review Cortical activation during human volitional swallowing: an event-related fMRI study Cerebral cortical representation of automatic and volitional swallowing in humans Cerebral areas processing swallowing and tongue movement are overlapping but distinct: a functional magnetic resonance imaging study Functional MRI of swallowing: from neurophysiology to neuroplasticity The assessment and analysis of handedness: the Edinburgh inventory PubMed Abstract | Crossref Full Text | Google Scholar Beijing: People's Medical Publishing House Google Scholar FMRI study on the central regulatory mechanism of modified catheter balloon dilation therapy in patients with dysphagia after brain stem stroke Google Scholar Differentiation of cerebral representation of occlusion and swallowing with fMRI Sequential evolution of cortical activity and effective connectivity of swallowing using fMRI A comparative study of functional magnetic resonance imaging related to swallowing task between patients with delayed swallowing after stroke and healthy volunteers Functional magnetic resonance imaging study on the rehabilitation mechanism of swallowing disorder after stroke doi: 10.3760/cma.j.issn.0254-1424.2009.12.008 Functional magnetic resonance imaging study on dysphagia after unilateral hemispheric stroke: a preliminary study Analysis of deglutition-related central function recombination and laterality in patients with acute cerebral infarction doi: 10.3760/cma.j.issn.0254-1424.2017.12.005 Functional connectivity and laterality of the motor and sensory components in the volitional swallowing network Brain imaging correlates of recovered swallowing after dysphagic stroke: a fMRI and DWI study Swallowing function in the chronic stage following stroke is associated with white matter integrity of the callosal tract between the interhemispheric S1 swallowing representation areas Sensory stimulation activates both motor and sensory components of the swallowing system Characterising the central mechanisms of sensory modulation in human swallowing motor cortex Functional MRI of oropharyngeal air-pulse stimulation Cortical activation during swallowing rehabilitation maneuvers: a functional MRI study of healthy controls Exploring the efficacy of the effortful swallow maneuver for improving swallowing in people with Parkinson disease-a pilot study Tongue-to-palate resistance training improves tongue strength and oropharyngeal swallowing function in subacute stroke survivors with dysphagia A systematic review of the physiological effects of the effortful swallow maneuver in adults with normal and disordered swallowing Comparison of activation patterns in mirror neurons and the swallowing network during action observation and execution: A task-based fMRI study Wang Y and Wu J (2024) Cortical compensation mechanism for swallowing recovery in patients with medullary infarction-induced dysphagia Received: 03 December 2023; Accepted: 15 July 2024; Published: 31 July 2024 Copyright © 2024 Gu, Han, Zhang, Li, Wang and Wu. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) *Correspondence: Jialing Wu, d3l3amwyMDA5QGhvdG1haWwuY29t Volume 8 - 2014 | https://doi.org/10.3389/fncir.2014.00040 This article is part of the Research TopicNeuromodulatory Control of Spinal Function in Health and DiseaseView all 25 articles Bulbospinal systems (BS) originate from various regions of the brainstem and influence spinal neurons by classical synaptic and modulatory mechanisms Our aim was to determine the brainstem locations of cells of origin of BS pathways passing through the medial longitudinal fasciculus (MLF) and the caudal ventrolateral medulla (CVLM) We also examined the transmitter content of spinal terminations of the CVLM pathway Six adult rats received Fluorogold (FG) injections to the right intermediate gray matter of the lumbar cord (L1–L2) and the b-subunit of cholera toxin (CTb) was injected either into the MLF or the right CVLM (3 animals each) Double-labeled cells were identified within brainstem structures with confocal microscopy and mapped onto brainstem diagrams An additional 3 rats were injected with CTb in the CVLM to label axon terminals in the lumbar spinal cord Double-labeled cells projecting via the MLF or CVLM were found principally in reticular regions of the medulla and pons but small numbers of cells were also located within the midbrain CVLM projections to the lumbar cord were almost exclusively ipsilateral and concentrated within the intermediate gray matter Most (62%) of terminals were immunoreactive for the vesicular glutamate transporter 2 while 23% contained the vesicular GABA transporter The inhibitory subpopulation was glycinergic The proportions of excitatory and inhibitory axons projecting via the CVLM to the lumbar cord are similar to those projecting via the MLF CVLM projections are predominantly ipsilateral and concentrated within intermediate gray but do not extend into motor nuclei or laminia VIII Terminations of the CVLM pathway are located in a region of the gray matter that is rich in premotor interneurons; thus its primary function may be to coordinate activity of premotor networks Therefore these systems can have monosynaptic inhibitory actions on spinal neurons in addition to direct excitatory actions Such actions could serve to coordinate motor output by facilitating or depressing specific components of motor networks the exact locations of cells with axons that project via the MLF are still largely unknown Furthermore the locations of cells that give rise to the pathways passing through the CVLM are completely unknown In view of the limited anatomical information available concerning these systems our primary aim was to determine the locations of cells that give rise to these pathways We exploited the propensity for CTb to be taken up by axons of passage by injecting it into MLF or the CVLM and we injected Fluorogold (FG) into the spinal cord Hence we were able to map the locations of double-labeled cells in the brainstem that project to the spinal cord via these two routes Stereotaxic injections of CTb within the MLF revealed terminals in the lumbar spinal cord that were concentrated within the intermediate gray matter and the ventral horn Although the majority (59%) of axon terminals in the lumbar spinal cord were glutamatergic a sizable minority were inhibitory (20%) and these could be subdivided into those that are GABAergic (7%) those that are glycinergic (9%) and those that contained both transmitters (3%) None of the terminals contained serotonin and there was also a significant population (18%) that did not show immunoreactivity for any of the transmitters tested A secondary aim of the study therefore was to determine the types of neurotransmitters associated with the CVLM pathway A glass micropipette with a tip diameter of 20 μm filled with 1% CTb in distilled water was aligned with the burr hole and inserted into the brain CTb (200 nl) was injected by pressure with a Pico-Injector (10 ms pulses at 20 psi; World Precision Instruments USA) into the right MLF (3 animals) or the right CVLM (6 animals: 3 for spinal injections) the scalp was sutured and animals were placed in an incubator to assist recovery Table 1. Interaural stereotaxic coordinates used to target the medial longitudinal fascicle (MLF) and caudal ventrolateral medulla (CVLM) From Paxinos and Watson (2005) six animals (three MLF and three CVLM) were re-anesthetized with isoflurane and placed in a spinal frame The thirteenth thoracic vertebra was identified according to the location of the last rib and a small dorsal midline incision was made at this level A hole with a diameter of 1 mm was made adjacent to the midline in the laminar surface of the caudal part of the Th13 or L1 vertebrae to expose the dorsal surface of L1 or L2 segments of the spinal cord Unilateral spinal injections of 50 nl were made with glass micropipettes containing 4% FG in distilled water The tip of the injection pipette (20 μm in diameter) was inserted into the spinal cord to a depth of up to 1.5 mm from the surface at an angle of 15° to target the intermediate gray matter of the right side of the spinal cord The wound was sutured and animals recovered uneventfully Following a 7 day survival period from initial brain injections rats were anaesthetized with pentobarbitone (1 ml i.p.) and perfused through the left ventricle with mammalian Ringer's solution followed by one litre of a fixative containing 4% formaldehyde in 0.1 M phosphate buffer (PB; pH 7.4) at room temperature Spinal cords and brains were removed and post-fixed for 8 h at 4°C and were cut into 60 μm thick transverse sections with a Vibratome (Oxford Instruments All sections were treated with an aqueous solution of 50% ethanol for 30 min to aid complete antibody penetration Subsequently they were incubated in secondary antibodies coupled to fluorphores for 3 h and mounted on glass slides with anti-fade medium Spinal injection sites containing FG were examined with UV epifluorescence and photographed whereas brainstem injection sites were visualized by using 3,3′-diaminobenzidine (DAB) as a chromogen Sections were incubated in goat anti-CTb for 48 h followed by biotinylated anti-goat IgG for 3 h at room temperature They were then incubated in avidin-horseradish peroxidase (HRP) for 1 h and hydrogen peroxide plus DAB was applied for a period of approximately 15 min to reveal immunoreactivity In experiments to examine descending axons, brainstem injection sites were processed as described above. Spinal sections from L3–5 segments were incubated in a combination of antibodies (see Tables 2B–E for details) against: (1) CTb a mixture of VGLUT1+2 antibodies and VGAT; (3) CTb glutamic acid decarboxylase 67 (GAD67) and the glycine transporter 2 (GLYT2) or (4) CTb and serotonin (5-HT) Thereafter the sections were washed in PBS incubated in secondary antibodies coupled to fluorphores for 3 h and had a final wash with PBS before they were mounted on glass slides Cell counts are presented as averaged numbers of double-labeled cells per structure for the three animals in each group This was done for cells contralateral and ipsilateral to spinal injections with the exception of cells within midline structures such as raphe nuclei or the MLF where data on both sides were pooled confocal microscope images were acquired from a minimum of six sections per animal Fields containing CTb-labeled axon terminals were scanned by using a x40 oil-immersion lens with a zoom factor of 2 at 0.5 μm intervals For each section three fields with a 100 × 100 μm scanning area were obtained from different regions of the gray matter Stacks of images were analyzed with Neurolucida for Confocal software (MBF Bioscience Image stacks were initially viewed so that only CTb immunoreactivity was visible All CTb labeled terminals within the scanning box from each animal were used for analysis The terminals were then examined in the blue and green channels in order to assess expression of transmitter-related markers The percentage of double-labeled CTb terminals as a proportion of the total number of CTb terminals was calculated for each animal This value was averaged for the three animals and expressed as the mean percentage ± the standard deviation (SD) Representative examples of injection sites are shown in Figure 1 MLF injections were centered upon the right medial longitudinal fascicle We attempted to minimize the extent of MLF injections but there was always some spread of CTb into the contralateral MLF In addition there was also spread into the raphe obscuris paramedian reticular nucleus and tectospinal tract The rostro-caudal spread of these injections was ±1.38 mm on average from the location of the injection CVLM injections were centered upon the lateral reticular nucleus but spread into surrounding structures including the parvicellular reticular nucleus the internal reticular nucleus and the nucleus ambiguous; however they did not encroach on the rubrospinal tract The rostro-caudal spread of CTb in CVLM injections extended over a distance of ±0.65 mm on average Spinal injections were confined to L1–2 and injection sites were present in the intermediate gray matter in all experiments but the precise location of each injection varied Considerable spread of Fluorogold was observed within the gray matter ipsilateral to injection sites but there was no spread to the contralateral gray matter The rostro-caudal spread of FG within the spinal gray matter was ±0.27 mm on average on each side of the injection site Figure 1. CVLM and MLF injection sites with associated spinal injection sites. (A–D) Shows an experiment to double-label cells with axons passing through the CVLM and (E–H) are taken from an experiment to label axons of cells passing through the MLF. (A,E) Show CTb injection sites in coronal sections of the medulla. (B,F) Show injection sites mapped onto outline diagrams (Paxinos and Watson, 2005) (C,G) Fluorescent images superimposed upon dark field images of the same sections illustrating Fluorogold injection sites at L1–2 Drawings showing the locations of spinal injections (black) are shown in (D,H) Note the spread of Fluorogold within the gray matter surrounding the injection Confocal images of double-labeled cells in the Medulla (A) Shows a montage of a coronal section through the medulla of an animal that had received a CVLM and spinal injection Areas 1 and 2 within the boxes are shown at higher magnification in series (B,C) respectively which are short projected sequences of confocal images showing cells labeled from the CVLM (B,C) the spinal cord (B′,C′) and merged images showing yellow double-labeled cells (B″,C″) Confocal images of double-labeled cells in the pons (A) Shows a montage of a coronal section through the pons of an animal that had received a MLF and spinal injection Areas 1 and 2 within the boxes are shown at higher magnification in series (B,C) respectively which are short projected sequences of confocal images showing cells labeled from the MLF (B,C) Location of double-labeled cells in the brainstem following Fluorogold injections into the right lumbar cord and injections of cholera toxin in the MLF or right CVLM including the nucleus of the solitary tract (sol) and the medial vestibular nucleus (MVe) Double-labeled cells following CVLM injections were also found predominantly ipsilateral to spinal injections (673 vs 307 contralateral cells) and were present in many of the same structures observed for the MLF except that many more cells were located within the lateral paragigantocellular nucleus (LPGi) and the raphe pallidus (RPa) than were found for MLF injections Additional cells were also present in sol and MVe along with the facial nucleus (7n) and the lateral reticular nucleus (LRt) Outline diagrams of coronal sections through the medulla at three levels (anterior-posterior coordinates according to Bregma) showing the locations of cells following spinal injections in the right intermediate gray matter and injections within the MLF or right CVLM Black circles represent double-labeled cells; green circles represent spinally-projecting cells; and red circles represent cells labeled from MLF or CVLM Outline diagrams of coronal sections through the pons at two levels (anterior-posterior coordinates according to Bregma) showing the locations of cells following spinal injections in the right intermediate gray matter and injections within the MLF or right CVLM Small numbers of double-labeled cells were found in the midbrain (Figure 6) they were concentrated in two areas: the pararubral nucleus (PaR) and parabrachial pigmented nucleus of the ventral tegmental area (PbP) The only midbrain region containing cells following MLF injections was the ventrolateral periaqueductal gray (VLPAG) Outline diagrams of coronal sections through the midbrain at two levels (Bregma anterior-posterior coordinates) showing the locations of cells following spinal injections and injections within the left CVLM Black circles represent double-labeled cells; green circles represent spinally-projecting cells; and red circles represent cells labeled from CVLM parabrachial pigmented nucleus of the ventral tegmental area CVLM Injection sites (Figures 7A,B) were similar to those shown above for double-labeling experiments. Axon terminals were found throughout lumbar segments principally ipsilateral to the injection site (Figures 7C–F) The majority of terminals were concentrated within the intermediate gray matter (laminae V Few terminals were present in the dorsal horn above lamina V and in the ventral horn including motor nuclei and lamina VIII Figure 7. CVLM injections and distribution of terminals in lumbar spinal cord. (A) Shows a light micrograph of a transverse section through the medulla illustrating a CTb injection site. Injection sites were mapped onto outline diagrams of the medulla (B) obtained from the stereotaxic atlas of Paxinos and Watson (2005) The black area is the core of the injection and the gray area represents the spread of CTb Plate (C) shows a transverse section through L4 that was reacted to reveal CTb-labeled terminals (D) The distribution of terminals was mapped onto outline diagrams of the spinal cord Note the predominance of terminals ipsilateral to the injection site which are concentrated in the intermediate gray matter (E,F) Are magnified views of boxes 1 and 2 of plate (C) Note the scarcity of terminals contralateral to the injection site (E) and the abundance of terminals on the ipsilateral side (F) Percentages of immunoreactive terminals in the lumbar spinal cord labeled by CVLM injections Transmitter phenotypes of spinal axons projecting from the CVLM (A–D) Single optical sections of (A) CTb labeled terminals in the same optical plane for vesicular glutamate transporters (VGLUT)1 and 2 (B,C) and a merged image (D) Arrows indicate VGLUT2-immunoreactive terminals and arrow heads indicate terminals unlabeled for both markers (E–H) A similar series where tissue was reacted with a mixture of VGLUT1 and 2 antibodies and the vesicular GABA transporter (VGAT; F,G) Large arrows indicate VGLUT-immunoreactive terminals small arrows indicate VGAT-immuno- reactive terminals and the arrowhead indicates a terminal that is not immunoreactive for either marker Transmitter phenotypes of spinal axons projecting through the CVLM (A–D) Single optical sections of (A) CTb labeled terminals shown in the same plane for immunoreactivity for the glycine transporter T2 (GLYT2) and the 67 isoform of glutamate decarboxylase (GAD67; B,C) A merged image is shown in (D) The arrow indicates a GLYT2-immuno- reactive terminal and the arrowhead is a GAD67 labeled terminal (E) Shows immunoreactivity for serotonin (5-HT) Note the absence of 5-HT immunoreactivity (green) in CTb-labeled axon terminals (red) it is almost impossible to label only one side of the MLF as a consequence of the inevitable spread of tracer across the midline and our sample of spinally-projecting MLF cells is likely to be composed of cells with axons that travel through left or right sides of the MLF whereas CVLM double-labeled cells will be exclusively unilateral with axons passing through the right CVLM only For example cells attributed to the mlf may have belonged to ROb or Gi Another complication was that as we were injecting CTb into the brainstem itself the area in the immediate vicinity of the injection site could not be used to identify double-labeled cells This is possibly why no cells could be identified within RPa following MLF injections in addition to anterograde labeling of descending axons CTb injections in the CVLM also label spinomedullary neurons retrogradely; hence some of the terminals we observed could have arisen from collateral axons of these cells similar numbers of spinomedullary cells are labeled on both sides of the cord but very few terminals are present in the contralateral gray matter following CVLM injections which contrasts with the large numbers of terminals found in the ipsilateral gray matter For this reason we consider it unlikely that our sample of terminals was contaminated by significant numbers of terminals from collateral axons of ascending neurons we cannot exclude the possibility that some of the double-labeled cells we observed give rise to bifurcating axons which pass through both structures Thus the function of the CVLM pathway may be to harmonize motor activity with respiratory and autonomic activity to produce the coordinated output of these systems required for physical exercise Zilli Huma is supported by a postgraduate scholarship provided by the Khyber Medical University Christina Brown was supported by a Wellcome Trust Vacation Scholarship We are grateful to Robert Kerr and Christine Watt for excellent technical support We wish to thank Professor Elzbieta Jankowska and Dr Anne Bannatyne for commenting on the manuscript central nucleus of the inferior colliculus; Cu parabrachial pigmented nucleus of the VTA; PCRt glutamic acid decarboxylase 67 isoform; GLY T2 phosphate buffer saline containing 0.3% Trition X-100; RST A direct projection from the medial vestibular nucleus to the cervical spinal dorsal horn of the rat as demonstrated by anterograde and retrograde tracing Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Networks of inhibitory and excitatory commissural interneurons mediating crossed reticulospinal actions Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Three bulbospinal pathways from the rostral medulla of the cat: an autoradiographic study of pain modulating systems Pubmed Abstract | Pubmed Full Text | CrossRef Full Text The origin of descending pathways in the dorsolateral funiculus of the spinal cord of the cat and rat: further studies on the anatomy of pain modulation Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Origins of serotonergic projections to the spinal cord in rat: an immunocytochemical-retrograde transport study Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Termination of spinal afferents to inferior olive in cat Pubmed Abstract | Pubmed Full Text Retrograde double labeling of neurons: the combined use of horseradish peroxidase and diamidino yellow dihydrochloride (DY X 2HCl) compared with true blue and DY X 2HCl in rat descending brainstem pathways Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Evidence that cholera toxin B subunit (CTb) can be avidly taken up and transported by fibers of passage Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Characterization of last-order premotor interneurons by transneuronal tracing with rabies virus in the neonatal mouse spinal cord Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Cortical and brainstem control of locomotion Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Neurotransmitter phenotypes of descending systems in the rat lumbar spinal cord Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Tracing of neuronal connections with cholera toxin subunit B: light and electron microscopic immunohistochemistry using monoclonal antibodies Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Disynaptic excitation from the medial longitudinal fasciculus to lumbosacral motoneurons: modulation by repetitive activation Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Bilateral postsynaptic actions of pyramidal tract and reticulospinal neurons on feline erector spinae motoneurons Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Disynaptic vestibulospinal and reticulospinal excitation in cat lumbosacral motoneurons: modulation during fictive locomotion Pubmed Abstract | Pubmed Full Text | CrossRef Full Text The intrinsic function of a motor system–from ion channels to networks and behavior Pubmed Abstract | Pubmed Full Text | CrossRef Full Text The origin of a descending pathway with monosynaptic action on flexor motoneurones Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Spinal projections from the nucleus locus coeruleus and nucleus subcoeruleus in the cat and monkey as demonstrated by the retrograde transport of horseradish peroxidase Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Projections of the caudal ventrolateral medulla to the thoracic spinal cord in the rat doi: 10.1002/(SICI)1097-0185(199801)250:1<95::AID-AR9>3.0.CO;2-D Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Origin of the dopaminergic innervation of the central extended amygdala and accumbens shell: a combined retrograde tracing and immunohistochemical study in the rat Pubmed Abstract | Pubmed Full Text | CrossRef Full Text The ventro-medial medullary projections to spinal motoneurons: ultrastructure Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Distribution of glycine/GABA neurons in the ventromedial medulla with descending spinal projections and evidence for an ascending glycine/GABA projection Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Quantitative differences in collateralization of the descending spinal pathways from red nucleus and other brain stem cell groups in rat as demonstrated with the multiple fluorescent retrograde tracer technique Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Spinal interneuronal networks in the cat: elementary components Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Neuronal basis of crossed actions from the reticular formation on feline hindlimb motoneurons Pubmed Abstract | Pubmed Full Text | CrossRef Full Text On coupling and decoupling of spinal interneuronal networks Pubmed Abstract | Pubmed Full Text The efferent projections from the reticular formation and the locus coeruleus studied by anterograde and retrograde axonal transport in the rat Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Descending command systems for the initiation of locomotion in mammals Pubmed Abstract | Pubmed Full Text | CrossRef Full Text The use of PRV-Bartha to define premotor inputs to lumbar motoneurons in the neonatal spinal cord of the mouse Pubmed Abstract | Pubmed Full Text | CrossRef Full Text A study of the origin of brain stem projections to monkey spinal cord using the retrograde transport method Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Retrograde axonal transport of horseradish peroxidase from spinal cord to brain stem cell groups in the cat Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Funicular trajectories of descending brain stem pathways in cat Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Localizing spinal-cord-projecting neurons in adult albino rats Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Nuclei of the solitary tract: efferent projections to the lower brain stem and spinal cord of the cat Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Spinal projections from the mesencephalic and pontine reticular formation in the North American Opossum: a study using axonal transport techniques Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Spinal projections of the gigantocellular reticular formation in the rat Evidence for projections from different areas to laminae I and II and lamina IX Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Termination mode and branching patterns of reticuloreticular and reticulospinal fibers of the nucleus reticularis pontis oralis in the cat: an anterograde PHA-L tracing study Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Morphology of single pontine reticulospinal axons in the lumbar enlargement of the cat: a study using the anterograde tracer PHA-L Pubmed Abstract | Pubmed Full Text Locomotor role of the corticoreticular-reticulospinal-spinal interneuronal system Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Descending projections from the gigantocellular tegmental field in the cat: cells of origin and their brainstem and spinal cord trajectories Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Sites and mode of termination of reticulo-spinal fibers in the cat An experimental study with silver impregnation methods Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Patterns of projection and braching of reticulospinal neurons Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Reticulospinal pathways in the ventrolateral funiculus with terminations in the cervical and lumbar enlargements of the adult rat spinal cord Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Direct and indirect connections with upper limb motoneurons from the primate reticulospinal tract Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Medullary and spinal efferents of the pedunculopontine tegmental nucleus and adjacent mesopontine tegmentum in the rat Pubmed Abstract | Pubmed Full Text | CrossRef Full Text The caudal ventrolateral medulla as an important inhibitory modulator of pain transmission in the spinal cord Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Observations on the brainstem-spinal descending systems of normal and reeler mutant mice by the retrograde HRP method Pubmed Abstract | Pubmed Full Text | CrossRef Full Text The origin of reticulospinal fibers in the cat; an experimental study Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Motor antagonism exposed by spatial segregation and timing of neurogenesis Pubmed Abstract | Pubmed Full Text | CrossRef Full Text The organization of the brainstem and spinal cord of the mouse: relationships between monoaminergic Pubmed Abstract | Pubmed Full Text | CrossRef Full Text The effect of pyramidal lesions on the performance of a conditioned avoidance response in cats Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Ascending and descending projections from nucleus reticularis magnocellularis and nucleus reticularis gigantocellularis: an autoradiographic and horseradish peroxidase study in the rat Pubmed Abstract | Pubmed Full Text | CrossRef Full Text Brown C and Maxwell DJ (2014) Origin and neurochemical properties of bulbospinal neurons projecting to the rat lumbar spinal cord via the medial longitudinal fasciculus and caudal ventrolateral medulla Received: 14 February 2014; Accepted: 04 April 2014; Published online: 28 April 2014 Copyright © 2014 Huma, Du Beau, Brown and Maxwell. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) *Correspondence: David J. Maxwell, Spinal Cord Group, Institute of Neuroscience and Psychology, College of Medicine, Veterinary Medicine and Life Sciences, University of Glasgow, West Medical Building, Glasgow G12 8QQ, UK e-mail:ZGF2aWQubWF4d2VsbEBnbGFzZ293LmFjLnVr Metrics details An Author Correction to this article was published on 25 October 2024 This article has been updated Medullary carcinoma of the breast (MedBC) is a rare histological type that accounts for less than 5% of all invasive breast cancers we performed an exploratory study aimed to determine whether imaging mass cytometry (IMC) can be used to characterize the immune infiltration and the spatial distribution heterogeneity in the rare subtype of MedBC compared to atypical MedBC and TNBC-TILS+ tumors there was a notable enrichment of immune cells in the peripheral regions of the tumors the immune cells exhibited a central enrichment pattern This distribution of infiltrated cells reflects an active immune recruitment correlated to more favorable prognosis spatial analysis shows that immune cells are localized at a greater distance from the tumor cells IMC highlights the heterogeneity of immune microenvironment across three main subtypes of breast tumors and could help to define distinct immune patterns Despite the favorable prognosis associated with MedBC in general the current therapeutic approach for this subtype remains similar to that of TNBC This raises an important question regarding the potential overtreatment of patients with MedBC We performed this study with the specific aim of exploring whether imaging mass cytometry (IMC) on tissue samples allows to characterize the relative proportion and spatial distribution of intratumoral lymphocytes in MedBC and atypical MedBC Our ultimate goal was to identify potential immune biomarkers that merit further exploration in larger studies to assess their usefulness in clinical practice for distinguishing these distinct subtypes and refining their prognostic characterization Eight patients (32%) were diagnosed with stage I disease 13 (52%) patients were stage II while the remaining 4 patients (16%) were stage III They were all treated with chemotherapy either in the neoadjuvant (20%) or in the adjuvant (80%) setting All patients had a minimum level of TILS of 40% (range: 40–90%) two (8%) patients were identified to have a BRCA1 mutation one in the MedBC group and the other in the atypical MedBC group BRCA status was missing in 10 patients (40%) 24 (96%) are alive with no evidence of disease while survival data is missing for one patient in the MedBC group experienced a locoregional relapse (lymph nodes) at 48 months of diagnosis treated with chemotherapy and local radiotherapy and is now in complete remission at 100 months of follow up Color overlay of representative images of Immune cells (A), Epithelial cells (B), Lymphocytic infiltration inside the tumor (C), Cells interaction (D) and Extra-cellular interaction (E) in Breast cancer sample. Scale bar in upper right image. Interaction cell proportions using all identity marker in the 25 patients Ratio of proportions is calculated per cell and tumor type Each proportion level was scaled through all ROI samples and an empirical percentile transformation (percentize) was applied on the ratio scores to normalize the color scale between 0 and 1 in order to accentuate the differences between the values The vertical axis represents surface markers on cell phenotypes A Difference in cell proportions according to ROI B Difference in cell proportions according to tumor type C Difference in cell proportions according to ROI and tumor type We examined the cell proportions within different ROIs of all 25 samples, including the periphery and the central region of the tumor, and the surrounding normal tissue. The heatmap in Fig. 2A illustrates the proportion of cell types across the ROI highlighting the clustering of the peripheral and central tumor areas in relation to the normal tissue area The healthy region is predominantly composed of epithelial cells with lower proportions of immune cells as compared to the tumor zones a higher abundance of immune cells is observed Notable immune cell populations in the tumor periphery included (CD8+) cytotoxic T-lymphocytes (CD68+) macrophages and dendritic cells and (CD20+) B lymphocytes (CD8+ Ki67+) proliferating cytotoxic T lymphocytes was the predominant subtype cell interactions were prominently observed in the peripheral zone of the tumor involving not only interactions among immune cells but also between immune cells and the stroma This suggests a complex interplay between immune cells and the tumor microenvironment the distance of each cell phenotype was measured from the pankeratin positive cells The range of scale is divided into 3 measurements: 0–10 µm/10–100 µm/ > 100 µm The X axis represents the percentage of immune cell population A The graph illustrates the distance of the different cell types in each region of interest (ROI) B The graph illustrates the distance of the different cell types in each tumor type C Color (up) and schematic (down) overlay of representative images of lymphocytic infiltration inside the tumor for each tumor type we not only examined the diverse cellular components within the tumor and peritumoral tissue but also analyzed their spatial distribution and interactions in these three BC subtypes we observed a consistent predominance of immune cells within the tumor regions compared to the surrounding healthy tissue in all three groups of TNBC TILS analyzed the proliferating subtype (positive for Ki67+) of (CD4+) and (CD8+) T-cells were consistently predominant in the central region of both MedBC and atypical MedBC tumors This observation highlights the substantial infiltration of immune cells in these tumor types which may contribute to their eventual prognosis This spatial distribution may indicate an active immune surveillance mechanism aimed at eliminating tumor cells in these areas and reflects distinct mechanisms of immune cell recruitment and localization within the tumor microenvironment our study revealed a notable difference in the interaction between infiltrating lymphocytes and tumor cells among the different breast cancer types In the case of TNBC-TILS and atypical MedBC tumor type we observed that the lymphocytes were closely adhering to and in direct contact with the tumor cells which contrasts with the findings in MedBC where the immune cells appeared located at a greater distance from the tumor cells despite this tumor is in general associated to a more favorable prognosis the close association between infiltrating lymphocytes and tumor cells in TNBC TILS and atypical MedBC raises the possibility of a suppression effect whereby the immune response fails to effectively surveil and eliminate the tumor cells This is in contrast to the spatial analysis of TNBC TILS and atypical MedBC which exhibited a different immune cell distribution pattern determined by the humoral immune response (prevalence of CD20+ lymphocytes) This classification reflects the commonality of immune cell infiltration observed in these subtypes regardless of clinical outcomes and the variability of immune cells subtypes the distinct immune signature observed in medullary breast cancer (MedBC) using the innovative IMC technique along with its well-known favorable outcome raises important considerations regarding the development of tailored treatment approaches different from those of TNBC TILS While our study did not draw definitive conclusions on clinical outcomes due to limitations such as the small sample size these findings call into question the utility of grouping MedBC with other subtypes under the same classification comprehensive clinical data and pattern of immune infiltration is warranted to thoroughly evaluate the prognostic implications and treatment responses of MedBC compared to other subtypes Such insights would pave the way for personalized treatment strategies of MedBC and potentially of other unique subtypes Following approval from the Ethics Committee at Gustave Roussy we conducted a retrospective study using archived formalin-fixed paraffin-embedded (FFPE) tumor sections obtained from 25 patients diagnosed with BC between January 2015 and September 2021 and treated at Gustave Roussy The slides underwent a thorough second reading and review conducted by an expert pathologist from Gustave Roussy (MLT) This process aimed to validate the initial diagnosis and classify the tumors into the selected three distinct categories: 15 patients with MedBC 5 patients with atypical MedBC and 5 patients with TNBC and TILs ≥10% (TNBC TILS) All patients whose tumors did not fit into any of these categories were excluded from further analysis to ensure the accuracy and relevance of the study all patients provided consent for the utilization of any leftover tumor samples for scientific research Each tissue sample underwent staining using the Maxpar Human Immuno-Oncology Kit (Standard BioTools reference: 201508), which consists of 17 pathologist-verified antibodies and a nucleic acid stain (Supplementary Table 1) The antibodies selected target various antigens involved in tissue architecture such as Alpha smooth muscle actin expressed by myofibroblasts and pericytes the panel includes antibodies targeting antigens associated with immune activation such as Granzyme B expressed by Natural Killer cells and T-lymphocytes PD-1 on T follicular helper cells and activated T cells and PD-L1 expressed by activated macrophages dendritic cells and activated T and B lymphocytes markers specific of tumor-infiltrating lymphocytes are included in the panel CD8a corresponding to cytotoxic T-lymphocytes FOXP3 by regulatory T lymphocytes and Pan-Keratin by keratinocytes A Visualization and pre-processing analyses: highly multiplexed images are generated using ablated regions of interest (ROI) and visualized by MCD viewer The nuclei on the iridium channel were segmented with QuPath software and a cell mask was generated with FiJi B Cell type content analysis: Cell mask from each ROI was used by HistoCAt to generate FCS file Phenograph clustering was performed using 14 markers and dimensionality reduction was performed using UMAP to visualize the classification of cell type the proportion of cell type were calculated using a gating strategy on FlowJO software C Spatial analysis: an Euclidian distance map (EDM) of the pankeratin positive cells were performed on Fiji software the distances between each cell type and the nearest pankeratin positive cells on the EDM were calculated the Hyperion mass cytometry system IMC was autotuned using a 3-element tuning slide according to the tuning protocol provided by Standard BioTools ROIs with sizes of 1 mm2 (1000 × 1000 µm) were ablated and acquired at 200 Hz one to 4 ROI were defined for the acquisition on Hyperion where each antibody corresponded to a single image per sample These individual images were then combined to create a multi-image stack No formal statistical analysis was planned for this study due to its retrospective the small population size further limited the feasibility of conducting comprehensive statistical analyses the study primarily focused on providing a descriptive overview of the cellular composition and spatial distribution within the tumor microenvironment The findings were intended to serve as preliminary insights and lay the groundwork for future research with larger sample sizes that would allow for more robust statistical analysis All experiments and analysis details are described thoroughly in the “Materials and Methods” sections A Correction to this paper has been published: https://doi.org/10.1038/s41523-024-00705-8 Histological and immunohistochemical features of medullary breast cancer Histopathology of BRCA1- and BRCA2-associated breast cancer Medullary breast cancer is a predominantly triple-negative breast cancer—histopathological analysis and comparison with invasive ductal breast cancer Distinguishing medullary carcinoma of the breast from high-grade hormone receptor-negative invasive ductal carcinoma: an immunohistochemical approach Overdiagnosis of medullary carcinoma: a mammographic-pathologic correlative study Medullary carcinoma of the breast: interobserver variability in histopathologic diagnosis WHO classification of tumors of the breast The 2019 World Health Organization classification of tumours of the breast Protein profiling of breast cancer for treatment decision-making Am Soc Clin Oncol Educ Book Am Soc Clin Oncol Annu Meet 42 The single-cell pathology landscape of breast cancer Imaging mass cytometry and multiplatform genomics define the phenogenomic landscape of breast cancer Medullary carcinoma of the breast a clinicopathologic study with 10 year follow-up Human epidermal growth factor receptor 2 testing in breast cancer: American Society of Clinical Oncology/College of American Pathologists Clinical Practice guideline focused update Eighth edition of the AJCC cancer staging manual: breast cancer Assessing tumor-infiltrating lymphocytes in solid tumors: a practical review for pathologists and proposal for a standardized method from the International Immunooncology Biomarkers Working Group: Part 1: assessing the host immune response TILs in invasive breast carcinoma and ductal carcinoma in situ metastatic tumor deposits and areas for further research Spatial predictors of immunotherapy response in triple-negative breast cancer Diagnostic significance of intratumoral CD8+ tumor-infiltrating lymphocytes in medullary carcinoma CD8+ lymphocytes and apoptosis in typical and atypical medullary carcinomas of the breast Clinicopathologic features and immune cell subtypes analysis of tumor-infiltrating lymphocytes rich invasive breast carcinoma of no special type Invasive breast carcinoma of no special type with medullary pattern: morphological and immunohistochemical features a high ratio of tumour-infiltrating intraepithelial CD8+ to FoxP3+ cells is characteristic for the medullary subtype The tumor-infiltrating B cell response in medullary breast cancer is oligoclonal and directed against the autoantigen actin exposed on the surface of apoptotic cancer cells The humoral immune system has a key prognostic impact in node-negative breast cancer Download references We thank the members of the Gustave Roussy platforms including PETRA Core Facility for tissue slide preparation and PFIC Core Facility for Imaging Mass Cytometry This work was supported by grants from Gustave Roussy Institute Department of Medical Oncology- Breast Cancer Unit U981 were responsible for the image analysis pipeline and the analysis of data; C.C were responsible for the selection of antibodies panel the tissue labeling and the IMC acquisition process; H.E were responsible for the cases and sample selection; V.M were responsible for the slides preparation before tissue labeling; all authors participated in the manuscript preparation the interpretation of data analysis results and critical review/revision of the manuscript for important intellectual content All authors read and approved the final manuscript All authors agreed to be accountable for all aspects of the work Daiichi-Sankyo; Research funding: Daiichi-Sankyo FM: Consulting fees: Novartis; Personal fees: Pegascy No potential conflicts of interest were disclosed by the other authors Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations Download citation DOI: https://doi.org/10.1038/s41523-024-00691-x Sign up for the Nature Briefing: Cancer newsletter — what matters in cancer research, free to your inbox weekly. Volume 15 - 2021 | https://doi.org/10.3389/fncir.2021.657445 Serotonergic (5-HT) neurons in the medulla play multiple functional roles associated with many symptoms and motor activities The descending serotonergic pathway from medulla is essential for initiating locomotion the ionic properties of 5-HT neurons in the medulla remain unclear we studied the biophysical and modulatory properties of persistent inward currents (PICs) in 5-HT neurons of medulla in ePet-EYFP transgenic mice (P3–P6) PICs were recorded by a family of voltage bi-ramps (10-s duration and the ascending and descending PICs were mirrored to analyze the PIC hysteresis PICs were found in 77% of 5-HT neurons (198/258) with no significant difference between parapyramidal region (n = 107) and midline raphe nuclei (MRN) (n = 91) in either PIC onset (−47.4 ± 10 mV and −48.7 ± 7 mV; P = 0.44) or PIC amplitude (226.9 ± 138 pA and 259.2 ± 141 pA; P = 0.29) Ninety-six percentage (191/198) of the 5-HT neurons displayed counterclockwise hysteresis and four percentage (7/198) exhibited the clockwise hysteresis The composite PICs could be differentiated as calcium component (Ca_PIC) by bath application of nimodipine (25 μM) sodium component (Na_PIC) by tetrodotoxin (TTX and TTX- and dihydropyridine-resistance component (TDR_PIC) by TTX and nimodipine Na_PIC and TDR_PIC all contributed to upregulation of excitability of 5-HT neurons including a 26% increase in amplitude of the compound currents of Ca_PIC and TDR_PIC (P < 0.001 3.6 ± 5 mV hyperpolarization of Na_PIC and TDR_PIC onset (P < 0.05 30% increase in amplitude of TDR_PIC (P < 0.01) and 2.0 ± 3 mV hyperpolarization of TDR_PIC onset (P < 0.05 5-HT also facilitated repetitive firing of 5-HT neurons through modulation of composite PIC the high voltage-activated TDR_PIC facilitated the repetitive firing in higher membrane potential and this facilitation could be amplified by 5-HT Morphological data analysis indicated that the dendrites of 5-HT neurons possessed dense spherical varicosities intensively crossing 5-HT neurons in medulla We characterized the PICs in 5-HT neurons and unveiled the mechanism underlying upregulation of excitability of 5-HT neurons through serotonergic modulation of PICs This study provided insight into channel mechanisms responsible for the serotonergic modulation of serotonergic neurons in brainstem especially the persistent inward currents (PICs) which regulate the neuronal excitabilities have not been well-studied Although PICs have been studied intensively in many types of neurons the biophysical parameters and modulatory properties of PICs in medullar 5-HT neurons are still missing we discovered large amounts of small varicosities in the dendrites of 5-HT neurons in medulla it remains unknown about the implication of morphological characteristics for potential serotonergic modulation of 5-HT neurons Using ePet-EYFP mice, in this study we characterized PICs in 5-HT neurons of medulla with electrophysiological and pharmacological properties. We also explored functional role of the PICs in regulating neuronal excitability as well as serotonergic modulation of the PICs in 5-HT neurons. Our data showed that 5-HT enhanced PICs in medullar 5-HT neurons in ePet-EYFP mice. Preliminary data was published in abstract form (Cheng et al., 2019b; Dai and Cheng, 2019) Experiments were performed in accordance with the East China Normal University Laboratory Animal Center and all procedures were in accordance with protocols approved by the Animal Experiment Ethics Committee (Ethics No The experiments were carried out on neonatal ePet-EYFP mice (P3–P6) crossed by ePet-cre mice (The Jackson Laboratory 012712) with R26-stop-EYFP mice (The Jackson Laboratory Animals were exposed to a 12 h light/dark cycle and had free access to food and water and incubated at room temperature (20–22°C) for 60 min recover in recording ACSF (A) The transverse slices were collected from the medulla indicated by dash lines (B) One slice cut from the sections shows the EYFP+ serotonin (5-HT) neurons with enhanced yellow fluorescent proteins in parapyramidal region (PPR) and midline raphe nuclei (MRN) areas (C) Measurement of biophysical parameters of PICs by the voltage bi-ramp from −70 to 50 mV (D) Measurement of biophysical parameters (recruitment currents and difference ΔI) from repetitive firing induced by current bi-ramp with a duration of 10 s (E) Distribution of 5-HT neurons with PICs in medulla (top) Proportions of PICs (solid) and Non-PICs (open) recorded from PPR and MRN 5-HT neurons (bottom) (F) Statistic results of the onset and amplitude of PICs in PPR (n = 107) and MRN (n = 91) (G) Four patterns of PICs in 5-HT neurons of medulla (G1) a-PIC only with counterclockwise hysteresis (G2) a-PIC > d-PIC with counterclockwise hysteresis of PICs (G4) d-PIC > a-PIC with clockwise hysteresis of PICs Slices were then transferred to a recording chamber mounted in the stage of an upright Olympus BX50 microscope fitted with differential interference contrast (DIC) optics and epifluorescence. The chamber was perfused with recording ACSF at rate of 2 ml/min, bubbled with 95% O2 and 5% CO2. The EYFP+ 5-HT neurons were identified at X40 magnification using epifluorescence with a narrow band YFP cube (Figure 1B) The visualized EYFP+ neurons were patched with glass pipette electrodes The pipette electrodes were pulled from borosilicate glass (1B150F-4; WPI) with an electrode puller (P-1000; Sutter Instrument) and had resistances of 6–8 MΩ when filled with intracellular solution and pCLAMP 10.7 (all from Molecular Devices) were used for data acquisition Data were low-pass filtered at 3 kHz and sampled at 10 kHz Whole cell patch recordings were made in voltage-clamp mode with 85% capacitance compensation and current-clamp mode with bridge balance Electrophysiological data were analyzed with Axon Clampfit (10.7) Unpaired t-test (Graphpad Prism 8) was performed to compare the PIC parameters 5-HT neurons in PPR and MRN Paired t-test (Graphpad Prism 8) was used to analyze the effect of blockers on PIC parameters and the effect of 5-HT on neuronal membrane properties The current trace between Io and Ip was fitted by the Boltzmann equation f(V) = 1/{1 + exp[(Vmid – V)/Vc]} for determination of kinetics of PIC (Vmid and Vc) the AP parameters were calculated from the first spike of firings evoked by current bi-ramp Cells selected for data analysis must meet the following conditions: stable resting membrane potential between −55 and −70 mV and time for intracellular recording ≥ 20 min Some cells were labeled with 3% tetramethylrhodamine in the recording pipettes The photos of labeled neurons were taken immediately by a Nikon Eclipse Ni fluorescence microscopy with a Nikon DS-Ri2 color digital camera at 540–580 nm and 465–495 nm excitation wavelengths Recording ACSF (μM) for voltage clamp: NaCl (125) Recording ACSF (μM) for current clamp: NaCl (125) Intracellular solution (μM) for voltage clamp: K-gluconate (135) Intracellular solution (μM) for current clamp: K-gluconate (135) The pH of these solutions was adjusted to 7.3 with HCl Osmolarity was adjusted to 305 mOsm by adding sucrose to the solution Drugs: 10 μM Tetraethylammonium chloride (TEA Sigma-Aldrich) in the recording solutions was used to block the potassium current MCE) was used as an antagonist for transient sodium current and 25 μM nimodipine (HY-B0265 MCE) for L-type calcium current Sigma-Aldrich) was used as an agonist for 5-HT receptors The liquid conjunction potential was calculated as 10.4 mV with pH value adjusted to 7.3 by KOH, osmolarity adjusted to 310 mosM by sucrose, and the presence of 10 μM TEA in the recording solution. This value was not corrected in this study, in order to make our data comparable to those from our previous study of PICs (Dai and Jordan, 2010; Cheng et al., 2020) Incomplete space clamp is a problem for almost all studies using whole cell patch-clamp techniques (Dai and Jordan, 2011; Cheng et al., 2020) Any voltage-dependent current could be contaminated by the unclamped currents Incidents of distortion of the inward currents by poor space clamp were observed in the present study These included repetitive spikes (unclamped spikes) in voltage ramp delayed inward currents (longer time to reach peak) Recordings with any of these phenomena were excluded for calculation of PIC parameters in this study Based on our recording protocol (see section “Materials and Methods”) the PICs could be classified as an ascending PIC (a-PIC) evoked in the rising phase of the voltage bi-ramp and a descending PIC (d-PIC) generated in the falling phase of the bi-ramp Although PIC has been described in this way in many studies the ascending and descending PICs are actually an artificial description of the PICs Statistical results showed that 96% of the 5-HT neurons (191/198) displayed the counterclockwise hysteresis of PIC and 4% of the 5-HT neurons (7/198) showed the clockwise hysteresis of PIC Since there is no blocker specifically for TDR_PIC in this study we defined the “Ca_PIC + TDR_PIC” as PICs recorded with TTX “Na_PIC + TDR_PIC” as PICs with nimodipine and TDR_PIC as PICs with TTX and nimodipine These results implicated that the Na_PIC accounted for 25% of the composite PIC (A1) Overlapped current traces recorded by voltage ramps in control (gray) and application of 2 μM TTX (black) (A2) Summary diagrams show the onset and amplitude of PICs recorded in control and presence of 1–2 μM TTX (n = 20) (A3) The half-maximal activations (Vmid) of the PICs were calculated as −27.1 mV for control (open circles (A4) Summary diagrams show the Vmid of PICs recorded in control and presence of 1–2 μM TTX (n = 6) (B1) Overlapped current traces recorded by voltage ramps in control (gray) and application of 25 μM Nimodipine (black) (B2) Summary diagrams show the onset and amplitude of PICs recorded in control and presence of 25 μM Nimodipine (n = 26) (B3) The Vmid were calculated as −27.9 mV for control (open circles) and −25.7 mV for Nimodipine (B4) Summary diagrams show the Vmid of PICs recorded in control and presence of 25 μM Nimodipine (n = 9) (C1) Overlapped current traces recorded by voltage ramps in control (gray) and application of 1 μM TTX and 25 μM Nimodipine (black) (C2) Summary diagrams show the onset and amplitude of PICs recorded in control and presence of 1–2 μM TTX and 25 μM Nimodipine (n = 15) the Vmid were calculated for PICs (open circles) and TDR_PIC (n = 5) (C4) TDR_PIC was not changed after the calcium was removed from recording artificial cerebrospinal fluid (ACSF) but was completely blocked after complete removal of sodium from the recording solution These results indicated that Ca_PIC accounted for 30% of the composite PIC The kinetics of TDR_PIC determined by the Boltzmann function indicated that the half-maximal activation of TDR_PIC was −11.9 ± 2 mV (n = 5) to infer the effect of putative PICs modulation on 5-HT neurons firing To determine the contribution of multiple PICs to the excitability of 5-HT neurons we recorded the 5-HT neurons in current-clamp mode with triangle current ramps (duration of 10 s and holding current of 0) and used concentrations of drugs similar to those used in voltage-clamp mode This current protocol induced a slow depolarization and repolarization of membrane potential similar to those produced by voltage protocol for measurement of PICs (see section “Materials and Methods”) These results suggested that Ca_PIC prolonged the discharge of 5-HT neurons especially in the falling phase of the bi-ramp current Contribution of multiple PICs to the firing properties of 5-HT neurons (A) Contribution of Ca_PIC to the firing properties of 5-HT neurons (A1) Overlapped voltage traces recorded by current ramp in control (gray) and application of 25 μM nimodipine (black) (A2) Instantaneous firing frequency/current relationship (iF-I relation) for both control and nimodipine condition Depolarizing phase of the ramp represented by closed circles (control black closed circles) and repolarizing phase represented by open circles (control (A3) Graphs show the maximal frequency in control (gray circles) and in the presence of 25 μM nimodipine (black circles) (A4) Graphs show the ΔI in control (gray circles) and in the presence of 25 μM nimodipine (black circles) (B) The effects of Na_PIC on the firing properties of 5-HT neurons (B1) Overlapped voltage traces recorded by current ramp in control and application of 2 μM Riluzole (B2) Instantaneous firing frequency/current relationship for both control (gray circles) and Riluzole (black circles) condition (B3) Graphs show the maximal frequency in control (gray circles) and in the presence of 2 μM Riluzole (black circles) (B4) Graphs show the ΔI in control (gray circles) and in the presence of 2 μM Riluzole (black circles) (C) Contribution of TDR_PIC to the firing properties (C1) Overlapped voltage traces recorded by current ramp in control and application of 2 μM Riluzole and 25 μM nimodipine (C2) Instantaneous firing frequency/current relationship for both control (gray circles) and Riluzole and Nimodipine (black circles) condition (C3) Graphs show the maximal frequency in control (gray circles) and in the presence of 2 μM Riluzole and 25 μM nimodipine (black circles) (B4) Graphs show the ΔI in control (gray circles) and in the presence of 2 μM Riluzole and 25 μM nimodipine (black circles) The increment of ΔI was not statistically significant These data suggested that blocked Na_PIC by riluzole decreased excitability of 5-HT neurons These results suggested that TDR_PIC contributed to regulation of excitability of 5-HT neurons (A1) Two 5-HT neurons labeled with intracellular tetramethylrhodamine and located in PPR The dendrites of the neurons with large spherical varicosities crossing the dendrites of the neurons (arrow) (A2) Tetramethylrhodamine filled a 5-HT neuron located in PPR with large spherical varicosities (B1,B2) Two 5-HT neurons located in MRN with large spherical varicosities It might be surmised that the 5-HT neurons in medulla exert a widespread, diffuse influence in their nearby areas. However, the self-regulating effects of 5-HT neurons in medulla remain unclear. The effects of 5-HT on the PICs in spinal motoneurons and interneurons have been reported in many studies (Dai and Jordan, 2010; Revill et al., 2019) These studies demonstrated an enhancement of PICs by 5-HT we further showed that activation of serotonergic receptors in 5-HT neurons enhanced PICs by hyperpolarizing PICs onset and/or increasing PICs amplitude (A1) Overlapped current traces recorded by voltage ramps in control (black) and 20 μM 5-HT (red) (A2) Summary diagrams show the onset and amplitude of PICs recorded in control and presence of 15–20 μM 5-HT (n = 12) (A3) 5-HT significantly hyperpolarized the Vmid (B) The 5-HT modulation of Na_PIC + TDR_PIC (B1) Overlapped current traces recorded by voltage ramps in application of Nimodipine (25 μM (B2) Summary diagrams show the onset and amplitude of Na_PIC + TDR_PIC recorded in control and presence of 15–20 μM 5-HT (n = 12) (B3) 5-HT significantly hyperpolarized the Vmid (C) The 5-HT modulation of Ca_PIC + TDR_PIC (C1) Overlapped current traces recorded by voltage ramps in control (black) and 20 μM 5-HT (red) (C2) Summary diagrams show the onset and amplitude of Ca_PIC + TDR_PIC recorded in control and presence of 15–20 μM 5-HT (n = 9) (C) 5-HT did not significantly change the Vmid (D1) Overlapped current traces recorded by voltage ramps in control (black) and 20 μM 5-HT (red) (D2) Summary diagrams show the onset and amplitude of TDR_PIC recorded in control and presence of 15–20 μM 5-HT (n = 18) (D3) 5-HT significantly hyperpolarized the Vmid of TDR_PIC control: −6.7 ± 4 mV; 5-HT: −11.1 ± 5 mV These results implicated that serotonergic modulation of Na_PIC + TDR_PIC in 5-HT neurons mainly targeted the voltage threshold for activation of the compound currents the gating property of persistent sodium channels These results suggested that serotonergic modulation of Ca_PIC + TDR_PIC in 5-HT neurons mainly concentrated on the amplitude the availability of channels mediating the compound currents These results suggested that serotonergic modulation of TDR_PIC in 5-HT neurons targeted at both activation kinetics and availability of the sodium channels mediating the TDR_PIC 5-HT modulation of firing properties of 5-HT neurons (A1) Repetitive firing evoked by bi-ramp current injected (10 s duration) into a 5-HT neuron (black) A 10 μM 5-HT was then applied to the recording solution (red) (A2) Instantaneous firing frequency/current relationship for both control and 5-HT conditions (A3–A5) Values measured for recruitment current decruitment current and ΔI in control (black) and bath application of 15 μM 5-HT (red) (B1–B6) Summary diagrams show 5-HT-induced significant changes in the membrane properties including resting membrane potential (RMP) action potential height (AP height) and afterhyperpolarization depth (AHP depth) recorded in control and presence of 15 μM 5-HT (n = 11) 5-HT effects on membrane properties of serotonin neurons There was no significant different in ΔI These results suggested that 5-HT enhanced repetitive firing of 5-HT neurons by prolonging the Na_PIC + TDR_PIC-induced firing The effect of 5-HT on repetitive firing properties of 5-HT neurons with regulation of Na_PIC + TDR_PIC (A1–C1) Repetitive firing with regulation of Na_PIC + TDR_PIC Ten micrometers 5-HT was then applied to the recording solution (red) (A2–C2) Instantaneous firing frequency/current relationship recorded for control (black) and 5-HT (red) (A3–C3) Recruitment current measured for control (black) and 5-HT (red); (A4–C4) Decruitment current measured for control (black) and 5-HT (red) (A5–C5) ΔI calculated for control (black) and 5-HT (red) these results implicated that 5-HT increased repetitive firing of 5-HT neurons by extending the Ca_PIC + TDR_PIC-regulated firing These results suggested that 5-HT could increase repetitive firing of 5-HT neurons by enhancing the TDR_PIC In the present study we systematically studied the PICs in 5-HT neurons of medulla in ePet-EYFP mice and characterized PICs on the basis of their electrophysiological and ionic properties Using electrophysiological and pharmacological approaches we demonstrated that PICs in 5-HT neurons consisted of Ca_PIC We further explored the functional contribution of these three types of PICs to the firing properties of 5-HT neurons we studied serotonergic modulation of multiple PICs in 5-HT neurons Our data showed that activation of 5-HT receptors in 5-HT neurons enhanced multiple components of the PICs in terms of hyperpolarization of PIC onset and/or increase of PIC amplitude This study suggested that 5-HT facilitated repetitive firing of 5-HT neurons by modulating multiple PICs especially their modulatory properties by serotonin are still missing The present study suggests that PIC has a relatively small effect on repetitive firing of 5-HT neurons of medulla our data showed that the proportion of Na_PIC and Ca_PIC in 5-HT neurons was about 25 and 30% less than the composite PIC suggesting that the TDR_PIC might play a significant role in the discharge of 5-HT neurons suggesting that TDR_PIC did not induce prolonged repetitive firing in falling phase of bi-ramp currents with respect to the rising phase Our study suggested that TDR_PIC was an unique sodium current which contributed to maintenance of repetitive firing of 5-HT neurons at higher voltage range suggesting that the serotonergic modulation of serotonergic neurons in medulla may not be different from serotonergic modulation of spinal neurons in terms of regulation of membrane properties The modulatory difference between medullar and spinal neurons should be shown in their different functional roles the same modulation of PICs appeared to have relatively smaller effect on the excitability of 5-HT neurons we suggest that serotonergic modulation of PICs only partially contributed to enhancement of excitability of 5-HT neurons in medulla For the first time we demonstrated that TDR_PIC contributed to regulation of neuronal excitability which could be amplified by 5-HT These results implicated putative self-regulatory loop of serotonergic system in brainstem this issue was not investigated in the present study we could expect that serotonergic modulation of 5-HT neurons in medulla could be mediated through activation of 5-HT1A and 5-HT2B receptors for regulating neuronal excitability and activation of 5-HT7 receptors for generation of locomotion A further study is required to investigate this issue Ca_PIC and TDR_PIC in 5-HT neurons of medulla 5-HT enhanced the multiple PICs in terms of hyperpolarization of onset and/or increase of amplitude 5-HT upregulated the excitability of 5-HT neurons through serotonergic modulation of PICs in 5-HT neurons All datasets generated for this study are included in the article/supplementary material further inquiries can be directed to the corresponding author/s The animal study was reviewed and approved by the East China Normal University Laboratory Animal Center YD and YC conceived and designed the research and RG approved the final version of the manuscript This study was supported by the National Nature Science Foundation of China (Grant No: 31571222) to YD and the Contingent Construction Funds of East China Normal University (No: 11000-5154C1-15068) to YD We thank the ECNU Multifunctional Platform for Innovation (011) for animal mold breeding Spatiotemporal correlation of spinal network dynamics underlying spasms in chronic spinalized mice Plateau potentials in sacrocaudal motoneurons of chronic spinal rats Dual serotonin (5-HT) projections to the nucleus accumbens core and shell: relation of the 5-HT transporter to amphetamine-induced neurotoxicity Dendritic L-type calcium currents in mouse spinal motoneurons: implications for bistability Modulation of NMDA-mediated intrinsic membrane properties of ascending commissural interneurons in neonatal rat spinal cord “Multiple components of persistent inward currents with serotonergic modulation in serotonergic neurons of medulla in ePet-EYFP mice,” in Proceedings of the 13th Biennial Conference of Chinese Neuroscience Society (CNS 2019) P-079 Google Scholar Sequential activation of multiple persistent inward currents induces staircase currents in serotonergic neurons of medulla in ePet-EYFP mice Action potential-independent and pharmacologically unique vesicular serotonin release from dendrites A comparison of motor patterns induced by N-methyl-D-aspartate acetylcholine and serotonin in the in vitro neonatal rat spinal cord CrossRef Full Text | Google Scholar Dahlström Evidence for the existence of monoamine containing neurons in the central nervous system CrossRef Full Text | Google Scholar Electrophysiological and pharmacological properties of locomotor activity-related neurons in cfos-EGFP mice “Serotonergic modulation of tetrodotoxin- and riluzole-resistant persistent inward current in serotonergic neurons in the medulla of ePet-EYFP mice,” in Proceedings of the 13th Biennial Conference of Chinese Neuroscience Society (CNS 2019) P-078 Google Scholar Motoneuron output regulated by ionic channels: a modeling study of motoneuron frequency-current relationships during fictive locomotion Multiple patterns and components of persistent inward current with serotonergic modulation in locomotor activity–related neurons in Cfos-EGFP mice and riluzole-resistant persistent inward current: novel sodium channels in rodent spinal neurons Characterization of serotonergic neurons in the medulla of ePet-EYFP mice (Abstract) Google Scholar 5-HT(2B) receptors are required for serotonin-selective antidepressant actions Serotonin 5-HT2B receptors are required for 3,4-methylenedioxymethamphetamine-induced hyperlocomotion and 5-HT release in vivo and in vitro Calcium sensitivity and cooperativity of permeabilized rat mesenteric lymphatics Evidence from computer simulations for alterations in the membrane biophysical properties and dendritic processing of synaptic inputs in mutant superoxide dismutase-1 motoneurons Simulation of Ca2+ persistent inward currents in spinal motoneurones: mode of activation and integration of synaptic inputs Fernandez-Fernandez Activation of TREK currents by riluzole in three subgroups of cultured mouse nodose ganglion neurons Knockdown of L calcium channel subtypes: differential effects in neuropathic pain Functional characterization of 5-HT1A and 5-HT1B serotonin receptor signaling through G-protein-activated inwardly rectifying K(+) channels in a fluorescence-based membrane potential assay Morphological and electrophysiological properties of serotonin neurons with NMDA modulation in the mesencephalic locomotor region of neonatal ePet-EYFP mice Three-week treadmill exercise enhances persistent inward currents and upregulates the excitability of dorsal raphe serotonin neurons in ePet-EYFP mice Serotonin research: contributions to understanding psychoses L-type Ca2+ channel facilitation mediated by phosphorylation of the beta subunit by CaMKII Persistent sodium currents and repetitive firing in motoneurons of the sacrocaudal spinal cord of adult rats Persistent inward currents in spinal motoneurons and their influence on human motoneuron firing patterns Hyperexcitable dendrites in motoneurons and their neuromodulatory control during motor behavior Persistent inward currents in motoneuron dendrites: implications for motor output Ca++ dependent bistability induced by serotonin in spinal motoneurons Serotonin-induced bistability of turtle motoneurones caused by a nifedipine-sensitive calcium plateau potential Calcium conductance and firing properties of spinal motoneurones in the turtle Ionic basis for serotonin-induced bistable membrane properties in guinea pig trigeminal motoneurons Persistent sodium current mediates the steep voltage dependence of spatial coding in hippocampal pyramidal neurons Control and role of plateau potential properties in the spinal cord A comparison of the subsecond dynamics of neurotransmission of dopamine and serotonin The critical role of persistent sodium current in hippocampal gamma oscillations Distribution of networks generating and coordinating locomotor activity in the neonatal rat spinal cord in vitro: a lesion study Adjustable amplification of synaptic input in the dendrites of spinal motoneurons in vivo Persistent sodium and calcium currents cause plateau potentials in motoneurons of chronic spinal rats Spinal 5-ht7 receptors are critical for alternating activity during locomotion: in vitro neonatal and in vivo adult studies using 5-ht7 receptor knockout mice Stimulation of the parapyramidal region of the neonatal rat brain stem produces locomotor-like activity involving spinal 5-HT7 and 5-HT2A receptors CrossRef Full Text | Google Scholar Dual serotoninergic projections to forebrain in the rat: morphologically distinct 5-HT axon terminals exhibit differential vulnerability to neurotoxic amphetamine derivatives Early delivery and prolonged treatment with nimodipine prevents the development of spasticity after spinal cord injury in mice Electrophysiological evidence for postsynaptic 5-HT1A receptor control of dorsal raphe 5-HT neurones CrossRef Full Text | Google Scholar Role of selective serotonin reuptake inhibitors in psychiatric disorders: a comprehensive review Facilitation of somatic calcium channels can evoke prolonged tail currents in rat hypoglossal motoneurons LFP oscillations in the mesencephalic locomotor region during voluntary locomotion Recruitment of motor neuronal persistent inward currents shapes withdrawal reflexes in the frog Serotonin immunoreactivity is contained in one physiological cell class in the rat rostral ventromedial medulla Contribution of intrinsic motoneuron properties to discharge hysteresis and its estimation based on paired motor unit recordings: a simulation study Synaptic control of the shape of the motoneuron pool input-output function Somato-Dendritic regulation of raphe serotonin neurons: a key to antidepressant action Postnatal development of persistent inward currents in rat XII motoneurons and their modulation by serotonin Somatodendritic localization of 5-HT1A and preterminal axonal localization of 5-HT1B serotonin receptors in adult rat brain doi: 10.1002/(SICI)1096-9861(20000207)417:23.3.CO;2-1 The role of serotonin in reflex modulation and locomotor rhythm production in the mammalian spinal cord CrossRef Full Text | Google Scholar Midbrain serotonergic neurons are central pH chemoreceptors Depolarization-induced facilitation of a plateau-generating current in ventral horn neurons in the turtle spinal cord Selective inhibition of the serotonin transporter in the treatment of depression: Sertraline Google Scholar Serotonin in psychiatry: in vitro disease modeling using patient-derived neurons An evaluation of paired motor unit estimates of persistent inward current in human motoneurons Ca1.2 and CaV1.3 neuronal L-type calcium channels: differential targeting and signaling to pCREB Localization of L-type calcium channel Ca(V)1.3 in cat lumbar spinal cord–with emphasis on motoneurons Serotonin modulates the properties of ascending commissural interneurons in the neonatal mouse spinal cord Persistent sodium currents participate in fictive locomotion generation in neonatal mouse spinal cord Ge R and Dai Y (2021) Serotonergic Modulation of Persistent Inward Currents in Serotonergic Neurons of Medulla in ePet-EYFP Mice Copyright © 2021 Cheng, Song, Ge and Dai. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) *Correspondence: Yue Dai, eWRhaUB0eXh4LmVjbnUuZWR1LmNu Calcitonin is the principal biochemical marker in MTC; serum calcitonin levels are used for detection, staging, postoperative management, and prognosis. The higher that the calcitonin levels are above normal, the greater the likelihood of MTC; basal levels of >100 pg/mL have been found to have 100% positive predictive value for MTC. [12] Very rarely patients with clinically apparent MTC may not have elevated calcitonin levels Occult MTC is rare, but clinically significant. If calcium stimulation testing cutoff data become well-validated, calcitonin screening is likely to be more widely used in the diagnostic workup for thyroid nodules in the United States. [13] Machens et al found that in RET carriers who are at risk for MTC but have not yet undergone treatment, calcitonin levels can be used to determine the need for lymph node dissection. [14] In their study of 308 RET carriers all patients with node-positive MTC had elevated basal calcitonin levels (91.4 pg/mL or higher); no patients with normal pretherapy calcitonin levels had lymph node metastasis These researchers suggest that unless clinical evidence indicates a need for it RET carriers with normal pretherapeutic basal calcitonin levels may forgo lymph node dissection a pentagastrin-induced rise in calcitonin secretion has been used to diagnose MTC; however pentagastrin is not available in the United States and DNA testing for RET has replaced this diagnostic method in familial cases However pentagastrim stimulation testing is used in European countries to further delineate extent of disease. In addition to occurring in medullary thyroid cancer (MTC) elevated calcitonin results may also be seen in patients with any of the following: the presence of heterophilic antibodies to calcitonin can falsely elevate serum calcitonin levels serum calcitonin concentration falls slowly in some patients with the nadir not being reached for several months calcitonin levels begin to rapidly decline within the first postoperative hour normal calcitonin levels within the first few weeks may indicate biochemical remission Elevated levels in the immediate postoperative period do not necessarily indicate persistent disease Carcinoembryonic antigen (CEA) is not a specific biomarker for MTC, and assessment of CEA levels is not useful for early detection of MTC. Serum CEA levels are useful for evaluating disease progression in patients with clinically evident MTC and for monitoring patients following thyroidectomy. [3] Elevated CEA levels can also occur in patients with any of the following: Consider a 24-hour urinalysis for catecholamine metabolites (eg, vanillylmandelic acid [VMA], metanephrine) to rule out concomitant pheochromocytoma in patients with MEN type 2A or 2B. Pheochromocytoma must be treated before MTC. [3] Obtain screening for the development of familial MTC in family members of patients with a history of MTC or MEN 2A or 2B Screen all family members for missense mutation in RET in leukocytes Finding a RET mutation in an asymptomatic family member should lead to discussion and pursuit of a prophylactic total thyroidectomy (see Treatment) Patients in whom medullary thyroid carcinoma (MTC) is diagnosed or suspected on the basis of fine needle aspiration findings or calcitonin levels should undergo preoperative ultrasonography to detect lymph node metastases. The study should be performed by an experienced operator and should include the superior mediastinum and the central and lateral neck compartments. [3] Patients with regional lymph node involvement or calcitonin levels >400 pg/mL should undergo preoperative computed tomography (CT) scanning of the chest and neck, as well as three-phase, contrast-enhanced, multidetector liver CT or contrast-enhanced magnetic resonance imaging (MRI) to detect metastatic disease. [3] The liver is the most common site of metastases in patients with MTC occurring in approximately 45% of patients with advanced disease Liver metastases are best identified with three-phase contrast-enhanced liver CT or contrast-enhanced liver MRI. The sensitivity of FDG-PET scanning for detecting metastatic disease is variable but improves with higher calcitonin levels (sensitivity 78% for basal calcitonin value above 1000 pg/mL versus 20% for levels below 1000 pg/mL in one study Imaging with 111-In-octreotide or 99m-Tc-DMSA is not currently recommended for routine initial screening for metastatic disease Fine-needle aspiration (FNA) yields cytologic information, allowing diagnosis of MTC. [16] The sensitivity of FNA is improved by the addition of immunohistochemical staining for calcitonin medullary thyroid carcinoma (MTC) resembles a well-circumscribed off-white nodule with a rough texture it contains nests of round or ovoid cells without follicle development because these cells originate from the calcitonin-producing parafollicular C cells of the thyroid A fibrovascular stroma is usually intercalated between cells immunohistochemical diagnosis of MTC can be made by demonstrating calcitonin using radioactive calcitonin antiserum against MTC cells The American Joint Committee on Cancer (AJCC) uses a different tumor-node-metastasis (TNM) classification for medullary thyroid carcinoma than for differentiated and anaplastic thyroid cancer. [17] See the tables below Table 1. TNM Classification for Medullary Thyroid Carcinoma (Open Table in a new window) Tumor size ≤ 2 cm in greatest dimension and is limited to the thyroid Tumor > 1 cm but ≤ 2 cm in greatest dimension limited to the thyroid or any tumor with gross extrathyroidal extension invading only strap muscles Moderately advanced disease; Any size tumor with gross extrathyroidal extension invading subcutaneous soft tissues Very advanced disease; Any size tumor with extension toward the spine or into nearby large blood vessels gross extrathyroidal extension invading prevertebral fascia or encasing the carotid artery or mediastinal vessels Regional lymph nodes are the central compartment Metastases to level VI or VII (pretracheal or prelaryngeal/Delphian or upper mediastinal) lymph nodes; can be unilateral or bilateral disease or contralateral neck lymph nodes (levels I Table 2. Stage Grouping for Medullary Thyroid Carcinoma (Open Table in a new window) Boucai L, Zafereo M, Cabanillas ME. Thyroid Cancer: A Review. JAMA. 2024 Feb 6. 331 (5):425-435. [QxMD MEDLINE Link] Tao Z, Deng X, Guo B, Ding Z, Fan Y. Subgroup analysis of steadily increased trends in medullary thyroid carcinoma incidence and mortality in the USA, 2000-2020: a population-based retrospective cohort study. Endocr Relat Cancer. 2024 May 1. 31 (5):890-6. [QxMD MEDLINE Link]. [Full Text] [Guideline] Wells SA Jr, Asa SL, Dralle H, et al. Revised American Thyroid Association guidelines for the management of medullary thyroid carcinoma. Thyroid. 2015 Jun. 25 (6):567-610. [QxMD MEDLINE Link]. [Full Text] Verga U, Fugazzola L, Cambiaghi S, Pritelli C, Alessi E, Cortelazzi D, et al. Frequent association between MEN 2A and cutaneous lichen amyloidosis. Clin Endocrinol (Oxf). 2003 Aug. 59(2):156-61. [QxMD MEDLINE Link]. [Full Text] Agrawal N, Jiao Y, Sausen M, et al. Exomic sequencing of medullary thyroid cancer reveals dominant and mutually exclusive oncogenic mutations in RET and RAS. J Clin Endocrinol Metab. 2013 Feb. 98 (2):E364-9. [QxMD MEDLINE Link]. [Full Text] Cancer Stat Facts: Thyroid Cancer. National Cancer Institute: Surveillance, Epidemiology and End Results Program. Available at https://seer.cancer.gov/statfacts/html/thyro.html Cancer Facts & Figures 2024. American Cancer Society. Available at https://www.cancer.org/content/dam/cancer-org/research/cancer-facts-and-statistics/annual-cancer-facts-and-figures/2024/2024-cancer-facts-and-figures-acs.pdf [Guideline] Filetti S, Durante C, Hartl D, Leboulleux S, Locati LD, Newbold K, et al. Thyroid cancer: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up†. Ann Oncol. 2019 Dec 1. 30 (12):1856-1883. [QxMD MEDLINE Link]. [Full Text] [Guideline] National Comprehensive Cancer Network. NCCN Clinical Practice Guidelines in Oncology: Thyroid Carcinoma. NCCN.org. Available at https://www.nccn.org/professionals/physician_gls/pdf/thyroid.pdf Rohmer V, Vidal-Trecan G, Bourdelot A, et al. Prognostic factors of disease-free survival after thyroidectomy in 170 young patients with a RET germline mutation: a multicenter study of the Groupe Francais d'Etude des Tumeurs Endocrines. J Clin Endocrinol Metab. 2011 Mar. 96(3):E509-18. [QxMD MEDLINE Link] Rowland KJ, Jin LX, Moley JF. Biochemical Cure after Reoperations for Medullary Thyroid Carcinoma: A Meta-analysis. Ann Surg Oncol. 2014 Sep 19. [QxMD MEDLINE Link] Costante G, Meringolo D, Durante C, Bianchi D, Nocera M, Tumino S, et al. Predictive value of serum calcitonin levels for preoperative diagnosis of medullary thyroid carcinoma in a cohort of 5817 consecutive patients with thyroid nodules. J Clin Endocrinol Metab. 2007 Feb. 92(2):450-5. [QxMD MEDLINE Link]. [Full Text] Ahmed SR, Ball DW. Clinical review: Incidentally discovered medullary thyroid cancer: diagnostic strategies and treatment. J Clin Endocrinol Metab. 2011 May. 96(5):1237-45. [QxMD MEDLINE Link]. [Full Text] Machens A, Lorenz K, Dralle H. Individualization of lymph node dissection in RET (rearranged during transfection) carriers at risk for medullary thyroid cancer: value of pretherapeutic calcitonin levels. Ann Surg. 2009 Aug. 250(2):305-10. [QxMD MEDLINE Link] Trimboli P, Giovanella L, Valabrega S, Andrioli M, Baldelli R, Cremonini N, et al. Ultrasound features of medullary thyroid carcinoma correlate with cancer aggressiveness: a retrospective multicenter study. J Exp Clin Cancer Res. 2014 Oct 25. 33(1):87. [QxMD MEDLINE Link]. [Full Text] Chang TC, Wu SL, Hsiao YL. Medullary thyroid carcinoma: pitfalls in diagnosis by fine needle aspiration cytology and relationship of cytomorphology to RET proto-oncogene mutations. Acta Cytol. 2005 Sep-Oct. 49(5):477-82. [QxMD MEDLINE Link] Retevmo (selpercatinib) [package insert]. Indianapolis, IN: Eli Lilly and Company. September 2024. Available at [Full Text] Maxwell JE, Sherman SK, O'Dorisio TM, Howe JR. Medical management of metastatic medullary thyroid cancer. Cancer. 2014 Nov 1. 120 (21):3287-301. [QxMD MEDLINE Link]. [Full Text] Chatal JF, Campion L, Kraeber-Bodéré F, Bardet S, Vuillez JP, Charbonnel B, et al. Survival improvement in patients with medullary thyroid carcinoma who undergo pretargeted anti-carcinoembryonic-antigen radioimmunotherapy: a collaborative study with the French Endocrine Tumor Group. J Clin Oncol. 2006 Apr 10. 24 (11):1705-11. [QxMD MEDLINE Link] Ye L, Santarpia L, Gagel RF. Targeted Therapy for Endocrine Cancer: The Medullary Thyroid Carcinoma Paradigm. Endocr Pract. 2009 Jun 22. 1-24. [QxMD MEDLINE Link] Wells SA, Robinson RF, Gagel H, Dralle JA, Fagin M, Santoro E, et al. Vandetanib (VAN) in locally advanced or metastatic medullary thyroid cancer (MTC): A randomized, double-bind phase III trial (ZETA). J Clin Oncol. 2010. 28:(suppl: abstr 5503. [Full Text] Wells SA Jr, Robinson BG, Gagel RF, Dralle H, Fagin JA, Santoro M, et al. Vandetanib in patients with locally advanced or metastatic medullary thyroid cancer: a randomized, double-blind phase III trial. J Clin Oncol. 2012 Jan 10. 30(2):134-41. [QxMD MEDLINE Link] Solomon B, Rischin D. Progress in molecular targeted therapy for thyroid cancer: vandetanib in medullary thyroid cancer. J Clin Oncol. 2012 Jan 10. 30(2):119-21. [QxMD MEDLINE Link] Hadoux J, et al; LIBRETTO-531 Trial Investigators. Phase 3 Trial of Selpercatinib in Advanced RET-Mutant Medullary Thyroid Cancer. N Engl J Med. 2023 Nov 16. 389 (20):1851-1861. [QxMD MEDLINE Link] Withdrawn | Cancer Accelerated Approvals. U.S. Food & Drug Administration. Available at https://www.fda.gov/drugs/resources-information-approved-drugs/withdrawn-cancer-accelerated-approvalsAVRETO.pdf Ducic Y, Oxford L. Transcervical elective superior mediastinal dissection for thyroid carcinoma. Am J Otolaryngol. 2009 Jul-Aug. 30(4):221-4. [QxMD MEDLINE Link] Ahmed SR, Ball DW. Incidentally Discovered Medullary Thyroid Cancer: Diagnostic Strategies and Treatment. J Clin Endocrinol Metab. 2011 Feb 23. [QxMD MEDLINE Link] [Guideline] Kloos RT, Eng C, Evans DB, Francis GL, Gagel RF, Gharib H, et al. Medullary thyroid cancer: management guidelines of the American Thyroid Association. Thyroid. 2009 Jun. 19(6):565-612. [QxMD MEDLINE Link]. [Full Text] Laure Giraudet A, Al Ghulzan A, Aupérin A, Leboulleux S, Chehboun A, Troalen F, et al. Progression of medullary thyroid carcinoma: assessment with calcitonin and carcinoembryonic antigen doubling times. Eur J Endocrinol. 2008 Feb. 158(2):239-46. [QxMD MEDLINE Link]. [Full Text] Ito Y, Onoda N, Okamoto T. The revised clinical practice guidelines on the management of thyroid tumors by the Japan Associations of Endocrine Surgeons: Core questions and recommendations for treatments of thyroid cancer. Endocr J. 2020 Apr 9. [QxMD MEDLINE Link]. [Full Text] [Guideline] Filetti S, Durante C, Hartl DM, Leboulleux S, Locati LD, Newbold K, et al. ESMO Clinical Practice Guideline update on the use of systemic therapy in advanced thyroid cancer. Ann Oncol. 2022 Jul. 33 (7):674-684. [QxMD MEDLINE Link]. [Full Text] Within the first year of life or the first months of life based upon specialist and parental discussions The ability to identify and preserve or transplant parathyroid glands determines level VI dissection then annually; begin screening for pheochromocytoma at age 11 yr to be determined on the basis of serum Ctn Begin screening for pheochromocytoma at age 11 When serum Ctn becomes elevated or in childhood to avoid lengthy evaluation period Annual follow-ups thereafter if serum Ctn is normal or undetectable Begin screening for pheochromocytoma at age 16 yr Billings ClinicDisclosure: Nothing to disclose University of Nebraska Medical Center College of Pharmacy; Editor-in-Chief Medscape Drug ReferenceDisclosure: Received salary from Medscape for employment Kayla Krause, BA MD Candidate, Pennsylvania State University College of MedicineDisclosure: Nothing to disclose. Medscape Reference gratefully acknowledges the contributions of Debra J Graham, MD, to previous versions of this article. Volume 15 - 2024 | https://doi.org/10.3389/fimmu.2024.1442906 Various types of professional immune cells first emerge in fish and likely represent the primordial form and functions Recent advancements revealed the direct connection between the central nervous system and the immune system in the mammalian brain the specifics of brain-immune networks in the fish and the underlying mechanisms of teleost’s brain against pathogen infection have not been fully elucidated we investigated the distribution of markers representing cerebral cells associated with protection and professional lymphocytes in the seven major components of the Nile tilapia brain through RNA-Seq assay and observed the most dominant abundance in the medulla oblongata The subsequent challenge test revealed the non-specific cytotoxic cells (NCCs) exhibited the strongest response against streptococcal infection of the brain The presence of NCCs in the brain was then confirmed using immunofluorescence and the cytotoxic effects usually induced by NCCs under infection were determined as well these findings contribute significantly to comprehending the mechanism of fish neuroimmune interaction and enhancing our understanding of its evolutionary development and response patterns of professional immune cells in fish brains against stimulation remain unclear Therefore, in this study, we aimed to assess the distribution of immune-related cells in the tilapia brain and identify the cerebral and professional defenders involved in bacterial infection induced by Streptococcus agalactiae, which was well-recorded in the fish neuro-immune study since this bacterial infection usually leads to typical meningitis that was hallmarked by the clinical phenotype such as exophthalmia (21–24) Our findings revealed that cerebral cells associated with protection were predominantly located in the medulla oblongata of the fish brain Subsequent evaluation under challenge testing demonstrated that the NCC population exhibited the strongest response as confirmed by the presence of NCCRP1-positive cells and assessments of cytotoxicity these results indicate that the central antibacterial immunity of fish brains occurs in the medulla oblongata and is mediated by NCCs Gene expression abundances were calculated and normalized to fragments per kilobase of transcript per million mapped reads (FPKM) Differentially expressed genes (DEGs) were identified using DESeq2 (version 1.26.0) with the following criteria: |log2(foldchange)| ≥ 1 Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were conducted through the KEGG Automatic Annotation Server (KAAS) In addition, based on our previous study on the characterization of tilapia head kidney leukocytes (HKLs) through RNA-Seq in 2022 (25), the geometric mean of three universal housekeeping genes—β-actin, ef1a, and gapdh (26–28)—were used to normalize the expression abundance of both the HKL and brain cDNA libraries The preserved S. agalactiae strain ZQ0910 (29) of serotype III was reactivated by incubation in brain-heart infusion broth at 28°C overnight The bacterial culture was then harvested through centrifugation at 4000 × g for 5 minutes The bacterial cells were subjected to three successive washes with phosphate-buffered saline (PBS) and were ultimately resuspended in PBS for subsequent experiments A total of 20 fish were intraperitoneally injected with 100 μL of S three parallel individuals were collected and sacrificed at 0 and brain samples were obtained using a previously described protocol for RNA extraction and cDNA synthesis cDNAs were synthesized using the PrimeScript™ RT reagent kit with gDNA Eraser from TaKaRa (Dalian, China). Quantitative real-time PCR (qRT−PCR) was performed with TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) from TaKaRa (Dalian, China) and the QuantStudio 6 Flex Real-Time PCR System from Thermo Fisher Scientific (Waltham, USA). Reference genes, including β-actin, ef1a, and gapdh, were utilized for normalization (26–28) A rabbit anti-On-NCCRP1 polyclonal antibody was generated using our established protocol beginning in 2023 (31) two healthy New Zealand White rabbits (~2 kg) were immunized on day 0 with a mixture of On-NCCRP1 protein (400 μg in 750 μL of PBS) and Freund’s complete adjuvant (750 μL) using emulsification the rabbits were immunized with On-NCCRP1 protein (300 μg in 750 μL of PBS) and Freund’s incomplete adjuvant (750 μL) again and the antibodies were purified through an affinity chromatography assay using protein A/G agarose beads HKL preparation was carried out following previous research from 2020 to 2023 (25, 31, 32) healthy fish were collected and sacrificed The head kidney tissue was then cut and passed through a 40-μm cell strainer (Greiner Bio-One GmbH The resulting cell suspension was placed in Leibovitz’s L-15 medium (Thermo Fisher Scientific The cells were layered onto a 34%/51% Percoll gradient (Solarbio China) and centrifuged using a swing rotor (400 × g the cells located at the surface of the 51% Percoll layer were gently aspirated and resuspended in PBS for use in subsequent experiments Total protein from HKLs and brain components was extracted with a protein extraction kit (BC3710 10 μg of protein sample was loaded onto a 12% SDS−PAGE gel and transferred to a PVDF membrane (Merck The membrane was then blocked with a quick blocking buffer (Beyotime followed by incubation with a primary antibody After the membranes were washed three times with Tris-buffered saline containing 0.1% Tween-20 (TBST) they were incubated with a secondary antibody HRP-labeled goat anti-rabbit IgG (H+L) (A0208 at a dilution ratio of 1:1000 for 30 minutes the antigen−antibody complexes were detected using the DAB Horseradish Peroxidase Color Development Kit (P0203 a rabbit anti-β-actin monoclonal antibody (dilution ratio of 1:20000) (AC026 China) was used to determine the abundance of the reference protein the positive bands obtained from the western blot analysis were transformed into gray values by ImageJ (version 1.54g) For the hematoxylin and eosin (H&E) staining and immunofluorescence (IF) assay, the procedures described in our previous work (25, 33) were followed the whole brains of healthy fish were isolated and fixed in Dietrich’s fixative for 24 hours The brain was then dehydrated in a series of graded alcohol solutions Serial sections (8 μm thick) were rehydrated stained with an H&E staining kit (C0105S Selective sections representing typical structures (25) were rehydrated followed by heat-induced antigen retrieval using a matched solution (P0085 The samples were then blocked and incubated with the primary antibody rabbit anti-On-NCCRP1 (dilution ratio of 1:200) for 1.5 hours the samples were incubated with the secondary antibody Cy3 goat anti-rabbit IgG (H+L) (dilution ratio of 1:500) (AS007 the samples were observed and photographed after staining the cell nucleus with 2-(4-amidinophenyl)-6-indolecarbamidine dihydrochloride (DAPI) All the data are presented as the means ± standard deviations (SDs) Tukey’s HSD test was utilized to analyze significant differences through Prism software (version 8.0) and significant differences (p < 0.05) are indicated by different letters TB tools (version 1.108) were used to construct heatmaps USA) were used to construct and design the final panel Figure 1 Heterogeneity of seven components of the tilapia brain. (A) Top five KEGG annotations of seven components of the tilapia brain. A diagram of the tilapia brain was generated in our previous study (25) (B) The number of DEGs among seven components of the tilapia brain was obtained through 21 pairwise comparisons including the most DEGs that existed between the cerebellum and posterior medulla oblongata and the fewest DEGs were detected between the anterior and posterior medulla oblongata Figure 2 Expression profiles of immune-related genes in HKL and seven components of the tilapia brain detected through RNA-Seq. The RNA-Seq data for tilapia HKL were reported in our previous study (25) and the adjusted FPKM values for HKL and the brain were clustered and presented through a heatmap The outermost branched sample (HKL) and the remainder (brain) were distinguished by a red line Figure 3 Expression profiles of immune-related markers in seven components of the tilapia brain Heatmaps showing the clustering of acknowledged marker genes for tilapia lymphocyte subpopulation identification and cerebral defender characteristics including hematopoietic stem cells (HSCs) or common lymphoid progenitors (CLPs) nonspecific cytotoxic cells (NCCs) or cytotoxic T cells (CTLs) Figure 4 Expression patterns of inflammatory factors and immune pathways associated with seven components of the tilapia brain after S The relative expression of four inflammatory factors and six key genes involved in different immune pathways was detected via qRT−PCR the expression level of the seven components of the tilapia brain at 0 h with the most abundant transcripts was set as 100 to calculate the relative expression of the remaining samples Different letters indicate significant differences (p < 0.05) the candidates commonly used for adaptive immune cell characterization such as CD79a and IgM for B cells and CD3 and CD4 for T cells were minimally influenced by bacterial infection little change in the expression of astrocyte and microglial markers was observed except for a marker of microglia (TMEM119) Figure 5 Expression patterns of immune-related markers in seven components of the tilapia brain after S The relative expression of ten markers belonging to five types of lymphocytes and astrocyte and microglial markers was detected via qRT−PCR These positive signals were predominantly located on the surface of these tissues with scarce signals observed in other brain components The corresponding H&E staining results and the presence of NCCRP1 (red) and nuclei (blue) in each section detected by IF are displayed on the right Since the discovery of increasing cytotoxic effects mediated by NCCs or NCCRP1 protein in 2021 and 2022 (39, 40), it has become necessary to examine the cytotoxic effects and cell death levels during S. agalactiae infection. The findings showed that six common cytotoxicity effectors were activated to varying degrees, with the perforin and interferon genes being particularly prominent (Figure 7) the activation of apoptosis executors (Caspase3 and Caspase9) and pyroptosis executors (Caspase1 and GsdmE) was minor while the most significant activation was observed in the cerebellum and medulla oblongata Figure 7 Expression pattern of cytotoxic factors and markers of apoptosis and pyroptosis in seven components of the tilapia brain subjected to S The relative expression of six cytotoxic factors and four markers of the apoptosis/pyroptosis process was detected via qRT−PCR the noticeable discrepancy in the number of DEGs emphasized the significant heterogeneity present These findings collectively underscore the immunological significance of the medulla oblongata in the tilapia brain suggesting the activation of inflammation due to the stimulation of macrophages in the brain further supporting the involvement of NCCs in dominant antibacterial immunity in the tilapia brain our study provides insight into the distribution of professional and autochthonous defenders in the tilapia brain and identifies the primary immune cells involved in combating streptococcal infection These findings suggest that the complex neuroimmune connection observed in mammals was already emerging in the tilapia brain This research significantly contributes to our understanding of the evolutionary development of neuroimmune mechanisms from fish to humans The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: https://www.ncbi.nlm.nih.gov/ The animal study was approved by Ethics Committee of Guangdong Ocean University The study was conducted in accordance with the local legislation and institutional requirements This work was supported by Shandong Provincial Natural Science Foundation (Grant ZR2022QC194 to XH) National Natural Science Foundation of China (Grant 32303065 to XH) Research Fund for Lin He’s Academician Workstation of New Medicine and Clinical Translation in Jining Medical University (Grant JYHL2021MS21 to XH) and College Students’ Innovation Training Program (Grant cx2023085z to XH) We would like to thank the reviewers for their kind and helpful comments on the original manuscript The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fimmu.2024.1442906/full#supplementary-material Fragments per kilobase of transcript per million mapped reads; HKL Nonspecific cytotoxic cell receptor protein 1; NK Revisiting the mechanisms of CNS immune privilege PubMed Abstract | CrossRef Full Text | Google Scholar PubMed Abstract | CrossRef Full Text | Google Scholar Immune cell compartmentalization for brain surveillance and protection Neuroimmunology in 2017: The central nervous system: privileged by immune connections PubMed Abstract | CrossRef Full Text | Google Scholar Functional roles of reactive astrocytes in neuroinflammation and neurodegeneration Immunity against bacterial infection of the central nervous system: An astrocyte perspective Transforming the understanding of brain immunity PubMed Abstract | CrossRef Full Text | Google Scholar The role of peripheral immune cells in the CNS in steady state and disease PubMed Abstract | CrossRef Full Text | Google Scholar Structural and functional features of central nervous system lymphatic vessels PubMed Abstract | CrossRef Full Text | Google Scholar Functional characterization of the dural sinuses as a neuroimmune interface CrossRef Full Text | Google Scholar Immune system and immune responses in fish and their role in comparative immunity study: a model for higher organisms Main components of fish immunity: An overview of the fish immune system CrossRef Full Text | Google Scholar CrossRef Full Text | Google Scholar PubMed Abstract | CrossRef Full Text | Google Scholar PubMed Abstract | CrossRef Full Text | Google Scholar Using zebrafish to understand reciprocal interactions between the nervous and immune systems and the microbial world CrossRef Full Text | Google Scholar A comprehensive profile of the tilapia (Oreochromis niloticus) circular RNA and circRNA-miRNA network in the pathogenesis of meningoencephalitis of teleosts Brain histopathology in red tilapia Oreochromis sp experimentally infected with Streptococcus agalactiae serotype III Meningitis caused by Streptococcus agalactiae in Nile tilapia (Oreochromis niloticus): Infection and inflammatory response Strategies to enhance tilapia immunity to improve their health in aquaculture CrossRef Full Text | Google Scholar Serotonin system is partially involved in immunomodulation of Nile tilapia (Oreochromis niloticus) immune cells Selection and evaluation of stable reference genes for quantitative real-time PCR in the head kidney leukocyte of Brain transcriptome response to Streptococcus agalactiae infection and the heterogeneous regulation of neuropeptides on immune response in tilapia doi: 10.1016/j.aquaculture.2022.738222 Evaluation of reference genes for quantitative real-time RT-PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus) Complete genome sequence of Streptococcus agalactiae ZQ0910 a pathogen causing meningoencephalitis in the GIFT strain of Nile tilapia (Oreochromis niloticus) expression and functional analysis of non-specific cytotoxic cell receptor protein 1 in Nile tilapia (Oreochromis niloticus) Involvement of CD27 in innate and adaptive immunities of Nile tilapia (Oreochromis niloticus) Single-cell RNA-seq reveals different subsets of non-specific cytotoxic cells in teleost Vasoactive intestinal peptide (VIP) protects Nile tilapia (Oreochromis niloticus) against Streptococcus agalatiae infection A single-cell transcriptome profiling of anterior kidney leukocytes from Nile tilapia (Oreochromis niloticus) A new understanding of TMEM119 as a marker of microglia PubMed Abstract | CrossRef Full Text | Google Scholar Blood GFAP as an emerging biomarker in brain and spinal cord disorders Establishment of an astrocyte-like cell line from the brain of tilapia (Oreochromis niloticus) for virus pathogenesis and a vitro model of the blood–brain barrier A novel C-type lectin (CLEC12B) from Nile tilapia (Oreochromis niloticus) is involved in host defense against bacterial infection Transferrin mediated NCC killing activity through NCCRP-1 in Nile tilapia (Oreochromis niloticus) CrossRef Full Text | Google Scholar Fish natural killer enhancing factor-A (NKEF-A) enhance cytotoxicity of nonspecific cytotoxic cells against bacterial infection A single-cell resolution gene expression atlas of the larval zebrafish brain Single-cell RNA-seq landscape midbrain cell responses to red spotted grouper nervous necrosis virus infection A telencephalon cell type atlas for goldfish reveals diversity in the evolution of spatial structure and cell types Functional and genetic analysis of choroid plexus development in zebrafish Ciliary beating compartmentalizes cerebrospinal fluid flow in the brain and regulates ventricular development Two phenotypically and functionally distinct microglial populations in adult zebrafish In situ and transcriptomic identification of microglia in synapse-rich regions of the developing zebrafish brain Live-imaging of astrocyte morphogenesis and function in zebrafish neural circuits SP protects Nile tilapia (Oreochromis niloticus) against acute Streptococcus agalatiae infection Immune cell trafficking from the brain maintains CNS immune tolerance Organ-specific features of natural killer cells PubMed Abstract | CrossRef Full Text | Google Scholar Nonspecific cytotoxic cells as effectors of immunity in fish CrossRef Full Text | Google Scholar PubMed Abstract | CrossRef Full Text | Google Scholar Averting inflammation by targeting the cytokine environment PubMed Abstract | CrossRef Full Text | Google Scholar Citation: Hou X and Li Q (2024) Medulla oblongata and NCCs are central defenders against Streptococcus agalactiae infection of the tilapia brain Received: 03 June 2024; Accepted: 18 June 2024;Published: 01 July 2024 Copyright © 2024 Hou and Li. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY) *Correspondence: Xitan Hou, aG91eGl0YW5AMTI2LmNvbQ==; Qi Li, Vmlja3lxaTEwMTVAMTYzLmNvbQ== †These authors have contributed equally to this work personalized website to manage your care (formerly myMDAnderson) If you have questions about MD Anderson’s appointment process our information page may be the best place to start Find information and resources for current and returning patients Learn about clinical trials at MD Anderson and search our database for open studies The Lyda Hill Cancer Prevention Center provides cancer risk assessment Your gift will help support our mission to end cancer and make a difference in the lives of our patients Our personalized portal helps you refer your patients and communicate with their MD Anderson care team As part of our mission to eliminate cancer MD Anderson researchers conduct hundreds of clinical trials to test new treatments for both common and rare cancers Choose from 12 allied health programs at School of Health Professions View open postdoctoral and other research trainee positions Learn about our graduate medical education residency and fellowship opportunities Dana Reeves was preparing for several milestones Her daughter was getting ready to graduate from high school Her husband was about to retire from the military And her family was preparing to move from Germany back to the United States Something she hadn’t planned for? A medullary thyroid cancer diagnosis In 2006, Dana was diagnosed with sarcoidosis an inflammatory disease in which groups of cells form tiny growths “It was built into our military orders that I had to be checked yearly for sarcoidosis,” she says “After I received a great checkup from my doctor I asked for bloodwork to provide to my civilian doctor since we were about to retire from the military.” The bloodwork revealed something odd in Dana’s parathyroid gland She was referred to an endocrinologist in Germany “Once he started the ultrasound, he said, ‘You have a lump on the right side of your thyroid and I’m pretty sure it’s cancer,’” she recalls Dana had a biopsy the next day. Pathology reports confirmed that she had stage III medullary thyroid cancer. and I didn’t want her to have a memory of her mom suffering with cancer,” says Dana “My husband and I grabbed each other’s hands We just relied on what we’d always had – our faith.” After receiving her diagnosis The doctor did not feel comfortable treating the advanced cancer and recommended a thyroid cancer surgeon in Florida Dana was transported by a military medical airlift to Florida on April 22 and had surgery the next day “My calcitonin levels were at 2,200 – up from 1,200 a month earlier That’s how fast the cancer was growing,” she says But my surgeon discovered that it was just located in my right thyroid.” Dana had a total thyroidectomy with a central neck dissection The surgeon removed Dana’s entire thyroid as well as 17 lymph nodes Dana had returned to Germany when her surgeon called with the news that all the cancer was gone “I asked him, ‘Where do I go from here?’ I told him I was moving back to Texas, and I’d never received any specialty care other than for sarcoidosis,” she says. “Without hesitating, he said I should see Dr. Mimi Hu at MD Anderson and he’d treated me so well that I trusted what my surgeon said But not before seeing her daughter graduate high school and celebrating her husband’s retirement from 24 years in the military It was centrally located to her daughter’s college You get in and do your bloodwork and scans and see the doctor all in the same day,” says Dana who now only comes once a year for checkups her nurses and the entire crew at MD Anderson have been phenomenal The nurses make you feel like you’re their only patient Because Dana no longer has a thyroid, she takes an oral synthetic thyroid hormone called levothyroxine daily. When her levels are off, sometimes she experiences fatigue or a change in mood “When that happens, I just log into MD Anderson’s portal and tell them that I think my levels are off,” says Dana. “They’ll send me a lab slip through MyChart then I’ll visit a local lab and my results are sent to MD Anderson My care team will tweak my dosage as needed.” Dana’s also dealt with both weight loss and weight gain since her surgery and gone into early menopause “I literally went into surgery at my goal weight and came home 10 pounds heavier,” she says. “I’ve probably gained 30 pounds in this journey of back and forth and up and down but I will take a little bit of weight gain over having cancer any day.” Dana is thankful for the care she has received at MD Anderson “Even though I have a family doctor locally Dana’s most recent checkup was in February and Hu’s nurse practitioner Rebekah Puls was going over the results “I remember telling my husband that I think it had been five years since my diagnosis and wondered at what point do they cut you loose,” says Dana Hu entered the room and shared some wonderful news “Dr. Hu said, ‘Mrs. Reeves, your levels for five years have not only been stable, they’ve also been undetectable. I wanted to let you know that we’re going to move you from cancer patient to cancer survivor,’” recalls Dana my wish was to see my daughter graduate high school Dana was presented with her survivorship certificate and Hu explained what it meant and what Dana’s care might look like going forward She is excited about transitioning to survivorship “I’m happy to share my experience because now that I’m on the other side of it I can give somebody hope and reassurance that they can get through this,” she says and they will walk with you through every stage.” Request an appointment at MD Anderson online or call 1-877-632-6789. an error occurred processing your subscription request Our patients depend on blood and platelet donations Show your support for our mission through branded merchandise © 2025 The University of Texas MD Anderson Cancer Center Metrics details Neurotransmitters are key modulators in neuro-immune circuits and have been linked to tumor progression expresses neurotransmitter calcitonin gene-related peptide (CGRP) is insensitive to chemo- and radiotherapies and the effectiveness of immunotherapies remains unknown a comprehensive analysis of the tumor microenvironment would facilitate effective therapies and provide evidence on CGRP’s function outside the nervous system we compare the single-cell landscape of MTC and papillary thyroid cancer (PTC) and find that expression of CGRP in MTC is associated with dendritic cell (DC) abnormal development characterized by activation of cAMP related pathways and high levels of Kruppel Like Factor 2 (KLF2) correlated with an impaired activity of tumor infiltrating T cells A CGRP receptor antagonist could offset CGRP detrimental impact on DC development in vitro Our study provides insights of the MTC immunosuppressive microenvironment and proposes CGRP receptor as a potential therapeutic target Although the role of neurotransmitters in modulating tumor progression is gaining increasing attention key evidence is mainly from in vitro and animal studies at the moment probably due to difficulties in obtaining human samples and the lack of an adequate disease model TKI treatment is accompanied by a significant high incidence rate of adverse reactions (38.9–72%) along with the common issue of resistance to long-term treatment needing long-term follow-up and deeper mechanistic studies the investigation of novel therapeutic targets for MTC is of paramount importance would provide direct human evidence on the impact of neurotransmitter CGRP on tumors and their microenvironment elucidating the underlying mechanism could also facilitate the discovery of potential therapeutic targets for MTC we conduct single-cell RNA sequencing analysis of tumors and peripheral blood mononuclear cells (PBMC) from 7 patients with MTC and 8 with PTC reporting an immunosuppressive microenvironment of MTC at single-cell resolution Malignant cell-secreting CGRP can disrupt the development of intratumoral dendritic cells (DC) by hindering the downregulation of the negative regulator Kruppel Like Factor 2 (KLF2) The current study provides insights into the immunosuppressive microenvironment of MTC and human evidence for the impact of neurotransmitter CGRP on tumors proposing the CGRP receptor as a promising therapeutic target for MTC The left panel showed the experimental design of single-cell RNA-sequencing (scRNA-seq) as the discovery cohort The right panel showed the type of validation experiments and multi-immunohistochemical staining (mIHC) released under a Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International license B Uniform manifold approximation and projection (UMAP) visualization of 228,400 cells from tumors and adjacent normal tissues C Heatmap showing the expression patterns of marker genes in major cell types D Cell type proportions of immune cells and non-immune cells Each stacked bar represents one cancer type E Heatmap showing the distribution ratio of major cell types in PTC and MTC F Bar graph showing the predicted immune score of PTC (28 samples from our cohort and 502 samples from TCGA public dataset) and 8 samples MTC in the bulk-RNA data The box plot illustrates the interquartile range in relation to the median while the middle lines represent the median and the lower and upper hinges denote the 25–75% interquartile range (IQR) with whiskers extending up to a maximum of 1.5 times IQR P-value was determined using two-sided Wilcoxon rank-sum test G IHC staining of CD45 in the tumor region of PTC and MTC (left panel) Dot plot shows the proportion of CD45+ cells in PTC and MTC (right panel) P-values from two-tailed Student’s t test were represented Source data are provided as a Source Data file The single-cell atlas suggested that MTC could be recognized as an immune “cold” tumor A Differentially expressed genes and enrichment pathways of malignant cells between PTC and MTC were shown Dot size and bar length represent the average Log2 (fold change) of genes and pathways B Violin plot showing the high expression of CALCA in MTC tumor cells The box inside illustrates the interquartile range in relation to the median Calculated by two-sided Wilcoxon rank-sum test the CALCA transcripts and CGRP transcripts were counted by TPM in tumor and peripheral tissue of PTC and MTC and plotted as bars MTC_T (n = 8) and PTC_T (n = 9 in calcitonin and n = 6 in CGRP) represents tumors of MTC and PTC MTC_P (n = 7 in calcitonin and n = 4 in CGRP) represents peripheral thyroid tissue of MTC P-value was determined using one-way ANNOVAR test IHC staining for calcitonin and CGRP was shown These images are representative image from PTC group (n = 3) and MTC group (n = 3) E Kaplan–Meier curve showing the disease-free survival (DFS) of MTC patients grouped by the intensity of CGRP expression in the tumor region MTC patients with high CGRP expression were characterized by yellow color while patients with low expression were characterized by blue color F CALCA-CALCRL ligand-receptor interaction between tumor cell and all immune cell types was shown by chord plot in MTC (top panel) and PTC (bottom panel) G Scatter plot showing cell-cell interaction pairs between tumor cell and DC The dotted line indicates the same interaction score H Heatmap showing the expression of CALCRL in all types of immune cells I Heatmap showing the expression of RAMP1 in all types of immune cells the percentage of CALCRL- positive CD11c+ cells in PTC (n = 9) and MTC (n = 9) tumor regions A Heatmap showing expression correlation of gene programs in DCs across tumor and normal tissue samples from PTC and MTC patients and clustered by column Based on the correlated-expression relationship modules consisting of gene programs were defined and characterized by immune pathways (enriched by the top gene signature of each module) PTC and MTC represent tumors of PTC and MTC respectively PTC_P represents normal thyroid tissue of PTC and MTC_P represents normal thyroid tissue of MTC B Heatmap showing the distribution ratio of DC modules in PTC and MTC C Heatmap showing the correlation coefficient between module gene signature scores and DC antigen-presenting and co-stimulatory scores Calculated by Spearman or Pearson’s correlation test co-stimulatory signatures were calculated in DCs between PTC and MTC and shown in violin plots and the lower and upper hinges denote the 25-75% interquartile range (IQR) E Multiplex immunofluorescence (mIHC) image showing HLA-DR and CD86 expression on CD11c+ cells in PTC (n = 9) and MTC (n = 9) tumor regions (left panel) Bar graph shows the proportion of HLA-DR+ and CD86+ DCs in PTC and MTC calculated by two-sided Student’s t-test F Left panel shows the pseudotime trajectory of CD14+ monocytes and DCs derived from Monocle2 The right panel showing DCs from PTC and MTC along the trajectory G The trajectory of DCs was colored by the score of the co-stimulatory gene signature Monocytes are shown in gray without score calculation H The trajectory was colored by cell state I Pseudo-time expression of the genes CD80 and CD40 along the trajectories 1 and 2 These results indicated the impaired development and co-stimulatory function of DCs in MTC and also supported that the CGRP-secreted MTC tumor cells are likely an important factor contributing to DC differentiation impairment A The Monocle-based trajectory analysis coordinates were utilized to import state information into CellOracle for further analysis Re-calculated of pseudotime trajectory and converted into a 2D pseudotime gradient vector B Expression of KLF2 projected onto trajectory C Pseudo-time expression of KLF2 along trajectories 1 and 2 D CellOracle KLF2 knockout simulations showing cell-state transition vectors along trajectory E KLF2 KO simulation with perturbation scores calculated according to the change in vector direction after knockout compared to the original vector direction A negative score (in purple color) indicates that TF knockout delays or blocks differentiation while a positive score (in green color) suggests promotion of differentiation F Cell type proportions of KLF2+ and KLF2- DCs in MTC and PTC G Violin plot showing the co-stimulatory score of KLF2+ and KLF2- DCs in MTC H Violin plot showing the KLF2 expression in PTC and MTC DCs I Scatter plot showing the correlation relationship between KLF2 expression and the co-stimulatory score of DCs at the sample level (n = 28) r indicates the correlation coefficient calculated by Spearman correlation test J Plots showing the expression of KLF2 in the tumor or in the peripheral normal tissue of PTC and MTC along the trajectory MTC_T and PTC_T represents tumors of MTC and PTC MTC_P and PTC_P represents peripheral thyroid tissue of MTC and PTC These data suggested that the dynamic change of KLF2 might contribute to the development of intra-tumoral DCs in MTC Monocytes isolated from PBMC were cultured and induced into immature DCs by specific cytokines After inducing maturation by cytokine cocktail for 24 h DCs were harvested for RNA extraction and flow cytometry analysis B Real-time PCR analysis of KLF2 transcripts at day 0,2,4 and 6 during DC induction (n = 3 for each timepoint) The box illustrates the interquartile range in relation to the median P value between groups in one day was calculated by unpaired student’s t test C Real-time PCR analysis of KLF2 transcripts at day 6 during DC in different groups (n = 3 for each group) The data was presented as mean ± Standard deviation (SD) P values between groups were calculated by one-way ANNOVAR D Representative flow cytometry histogram and increasing degrees of mean fluorescence intensity (MFI) of co-stimulatory markers CD80 CD86 and HLA-DR expressed on DCs (n = 3 for each group) All experiments were performed independently for three times these results revealed that CGRP secreted by tumor cells could drive an abnormal development of intra-tumoral DCs by cAMP pathway activation and preventing the loss of KLF2 CGRP receptor could be a potential therapeutic target for MTC in which CGRP receptor antagonists might be able to restore functional DCs A Re-clustering of T cells is shown in the UMAP plot annotated with subpopulations B Number of differentially expressed genes (DEGs) between MTC- and PTC- derived CD8+T cells cytotoxic and dysfunctional gene expression of CD8+ T cells between MTC and PTC The boxplot illustrates the interquartile range in relation to the median D Dot plot showing the expression of naive-like cytotoxic and dysfunctional genes in CD8+ T cells of PTC and MTC E Bar graph showing the proportions of T cell receptor (TCR) expansion levels in MTC and PTC X represents the clonal size of the TCR clonotypes F Scatter plot of cross-tissue clonal expansion analysis was shown for patients with tumor sample adjacent normal thyroid tissue sample and blood sample Dots were sized for blood clonal size and colored according to tissue expansion pattern Equal cell proportions were indicated by diagonal lines and the absence or presence of clones within compartments were separated by other lines G Heatmap showing the distribution ratio of CD8+ T cell subpopulations in PTC and MTC H Violin plot showing the gene scores of naive-like cytotoxic and dysfunctional in differentially distributed subpopulations of CD8+ T cells I Density plot showed the distribution of CD8+ T cell subpopulations along the pseudo time trajectory (upper-left panel) Heatmap showed the changing gene expression over time (lower-left panel) Pathway enrichment analysis was displayed in a bubble plot showing the differential pathway activity of genes located at the beginning and end of the trajectory The dot size represented gene counts and the color represented -Log10(p-value) (lower-right panel) these results revealed an immunosuppressive microenvironment in MTC characterized by a less active status of CD8+ T cells The lack of significant differences in macrophages between the two types of tumors suggested that macrophages may not be the primary cell population leading to significantly different immune-responses in MTC and PTC A Circle plot showing the cell-cell interaction strength of CD86 (left panel) and CD80 (right panel) between T cells and other immune cell types in PTC (green) and MTC (red) B Scatter plot showing the correlation relationship between CGRP expression and the Immune score the dysfunctional score of CD8+T cell and the co-stimulatory score of DCs in tumor bulk-RNA data (n = 14) C Schematic representation of CGRP-induced immunosuppressive tumor microenvironment in MTC key evidence was mainly from in vitro and animal studies and the working mechanism underlying how CGRP modulates DC functions in humans remains largely unclear The lack of a proper model is a major obstacle since neuron-secreting CGRP mostly participates in chronic inflammatory diseases of the skin respiratory system or gastrointestinal tract in which obtaining lesions and healthy tissue controls may be difficult in humans due to ethical issues MTC patients with high expression of CGRP had worse DFS suggesting that CGRP may play an important role and may serve as a potential prognostic marker for MTC Comparison of distribution showed that all types of immune cells decreased in MTC tumor but an increase was still observed compared to adjacent normal tissue This suggests that MTC is an “immune-cold” tumor rather than an “immune-excluded” tumor that suppresses immune cell function and migration through peripheral stromal cells Our pseudotime analysis suggested that the development of DCs in MTC was quite different from that in PTC indicating that the CGRP may drive an abnormal development of DCs Our pseudotime analysis suggested that KLF2 expression gradually decreased along with the normal developmental process of DCs as observed in PTC KLF2 expression level dropped at a much slower pace in MTC These findings were subsequently validated by experiments whether CGRP induces an increase in KLF2 levels and affects DCs function through the activation of the cAMP pathway remains unknown Our experimental results demonstrated that KLF2 was quickly down-regulated during a differentiation process from monocytes to DCs whereas the presence of CGRP slowed down the loss of KLF2 and finally disrupted the development of competent DCs When we use the cAMP inhibitor SQ22536 to suppress downstream cAMP pathway activation the expression of KLF2 influenced by CGRP decreased and the suppressed DC function was restored it is worth exploring whether the application of RET kinase inhibitors can effectively suppress CGRP levels and thereby reverse the immunosuppressive microenvironment of MTC sampling a tumor from a patient receiving selpercatinib would be an invaluable resource to demonstrate reversibility of the putative effects of CGRP on DCs in MTC it would be interesting to know whether CGRP modulates the microenvironment of these tumors as well we have generated a comprehensive single-cell atlas of MTC demonstrating the crucial role of neurotransmitter CGRP in shaping an immunosuppressive tumor microenvironment CGRP drives an abnormal development of intratumoral DCs by activation of cAMP pathway and preventing the loss of the transcription factor KLF2 These results may facilitate the development of effective therapies for MTC and provide human evidence of CGRP’s function outside the nervous system The study was approved by the Institutional Research Ethics Committee of The First Affiliated Hospital of Sun Yat-sen University ([2021]109) including to publish clinical information potentially identifying individuals Surgical samples of seven MTC and eight PTC for single-cell RNA sequencing were collected from the First Affiliated Hospital of Sun Yat-sen University. Clinical information of patients and the results of the statistical analysis were listed in Supplementary Data 5 Pathological paraffin section samples for IHC and mIHC were collected from the First Affiliated Hospital of Sun Yat-sen University and Sun Yat-sen University Cancer Center including a 120 MTC and 61 age- and sex-matched PTC patients All patients were pathologically confirmed by experienced pathologists Fresh thyroid tissue samples were collected from surgery immediately and cut into 1-2 mm pieces after washing by PBS Tissue samples in small pieces were then digested with Tumor Dissociation Kit (cat# 130-095-929 Miltenyi Biiotec) or Trypsin (cat# 25300062 The cell suspension was collected after filtration through 70 μm MACS SmartStrainer (cat# 130-098-462 Miltenyi Biotec) and 30 μm MACS SmartStrainer (cat# 130-098-458 eBioscienceTM) was used to lyse red blood cells on ice after centrifugation at 400 x g for 6 min the collected cells were counted by AO/PI and the concentration was adjusted to 500–1300 cells/μL for library preparation Peripheral blood mononuclear cells were isolated using Ficoll-Paque PREMIUM (cat# 17544203 Cytiva) at 1800 x rpm for 30 min centrifugation We then collected the central medium of cells and lysed RBCs by RBC Lysis we followed the manufacturer’s instructions for “Chromium Next GEM Single Cell 5’ Reagent Kits to capture cells per library” (10x Genomics We added appropriate volume of nuclease-free water and the corresponding volume of single cell suspension for each sample tube After running for Gel Bead-In Emulsions (GEMs) generation and cell barcoding GEMs were used for reverse transcription incubation 5’ gene expression libraries and V(D)J libraries were constructed according to the manufacturer’s standard in the 10x Genomics protocol (Single Cell 5’ Reagent Kits v5.2 User Guide) All libraries were pooled and sequenced on Novaseq™ 6000 (Illumina X2 was considered as chi-square value in the following equation where \({fe}\) referred to expected cell numbers and \({fo}\) referred to observed cell numbers in a specific cell cluster The ratio was calculated by observed cell numbers and expected cell numbers Pathways with p value < 0.05 were considered as significantly enriched Reclustering of DCs from tumors and peripheral thyroid tissues according to tumor type was performed as above Modules consisting of gene programs were defined and characterized by immune pathways (enriched by the top gene signature of each module) Since we aimed to discover MTC specific gene expression programs by cNMF we decided to use cNMF-reclustering instead of PCA for further DCs analysis we performed correlation analysis between the gene signatures of cNMF-derived DC modules and two functional scores of DCs Further correlation analysis was performed between KLF2 expression and co-stimulatory score cAMP related pathways activation score of DCs For the correlative analysis between the activation score of CD8+T cells and the co-stimulatory function of DCs we used the same methodology as described above Correlation analysis was performed by Pearson’s test or Spearman’s test To reveal possible cell-cell communication we applied R package CellChat (v1.1.3) to detect significant ligand-receptor pairs in MTC and PTC CellChat data were merged using the “mergeCellChat” function We used “netVisual_bubble” function in displaying specific ligand-receptor interactions while “subsetCommunication” function was used to extract interaction scores of ligand-receptor pairs in both MTC and PTC Using Monocle2 R package82 we inferred a developmental trajectory of CD8+T cells and DCs We imported sequencing data into Monocle2 as CellDataSet class we applied negative biominal distribution to count data and selected differentially expressed genes in cell populations we performed reversed graph embedding algorithm and ordered cells in pseudo time with lower dimensional expression data Trajectories of CD8+ T cells and DCs were constructed to show the developmental process of cells the differentially expressed genes along pseudotime development was analyzed by “differentialGeneTest” function and divided into two groups according to distributed location on trajectory Single-cell data of monocytes and DCs was used in CellOracle analysis We used the DDRTree dimensions analyzed by Monocle2 instead of recalculating cell developmental trajectory The key transcription factors of each group were identified based on overlapped transcriptional factors of degree centrality betweenness centrality and eigenvector centrality The final selection of key transcription factors required to meet the following criteria: 1) Specific to State1 and without a significant role in State2; 2) Considered to be key transcription factors in MTC tumor Simulating the effects of perturbing KLF2 on gene expression in monocytes and DCs involved setting the expression of the KLF2 to 0 CellOracle then utilized the simulated gene expression changes to predict the trajectory of cellular transition Single-cell RNA data were processed using the Single-Cell Toolkit vdj function (v.6.1.1 10x Genomics Inc) to assemble VDJ receptor sequences The filtered_contig_annotations.csv outputs from the samples were used for downstream analysis We removed TCR α- and β-chain nucleotide sequences that did not meet the following criteria: (1) full-length; (2) with a valid cell barcode; (3) matched α/β chains If more than one TCRα/β chains were detected in one cell only the clonotype with the highest expression was retained The median value of the cytotoxic score was chosen as a cut-off criterion to select cytotoxic T cells for further analysis We identified cells with identical CDR3 amino acid sequence as clonal cells that derived from the same T cell clonotype T cell clonotypes were called normal tissue singlet when having one cell in normal adjacent thyroid tissue but none in tumor while clonotypes that having more than one cell in normal adjacent thyroid tissue but none in tumor were called normal tissue multiplets clonotypes with one cell in tumor but none in normal thyroid tissue were called Tumor singlet while clonotypes with more than one cell in tumor but none in normal thyroid tissue were called tumor multiplets Dual-expanded clones represented clonotypes that had at least one cell in both normal thyroid tissue and tumor Clonotypes from blood samples were identified according to the same criteria as tumor and normal thyroid tissue whether they had cells in normal tissue or tumor To analyze alternative transcriptional splicing product of CALCA we use salmon to align and recognized calcitonin and CGRP transcript A high score represented high expression of genes that corresponding to a more active immune response FFPE blocks were cut into 5 μm-thick sections which were blocked with 10% normal goat serum for 30 min after deparaffinization The following antibodies were used as primary antibodies: anti-CD45 antibody (CST13917 Cell Signaling Technology) as primary anti-bodies The primary antibodies were incubated respectively overnight and then subsequently probed with secondary antibodies (DAKO DAB kit) All slides were scanned with KF-PRO Slide Scanner (Kfbio we used Qupath (v0.3.0) for initial processing and positive cell counting Image J software was used to analyzed expression intensity of CGRP We randomly selected 5 region of tumor and corrected the light density of each region we chose Identified the stained-positive region by using segmentation in HIS mode we selected measurement-IOD/ area (cm2) to calculate average of density (AOD) value Keep the parameters unchanged and repeated all the steps for 5 regions and finally calculated the average of density of each sample Slides of FFPE blocks were dewaxed in xylene then rehydrated for 5 min in a graded series of 100% 80% and 70% ethanol and fixed in 10% neutral buffered formalin Six marker panel was composed of anti-CGRP antibody (CST14959S we stained the slides with PANO 7-plex IHC kit slides were boiled in pH 9.0 Tris-EDTA buffer (Solarbio primary antibodies were sequentially incubated for 30 min at 37 °C and then incubated with HRP-conjugated Ms + Rb secondary antibody and enhanced tyramide signal with Opal for fluorescence microscopy detection Our marker panel was combined with fluorescent dyes as follows: anti-CGRP + Opal620 anti-CALCRL +Opal650 and anti-CD11c +Opal690 the slides were microwaved and stained with 4’ −6’-diamidino-2-phenylindole (DAPI TissueFAXS platform (TissueGnostics) were used in the acquisition of multispectral images set at 20 nm wavelength intervals from 420–720 nm with the same exposure time for fluorescence spectra acquisition Unmixed by spectral libraries established from images of single-staining images Multispectral images were process by the StrataQuest (TissueGnostics) software Cells with a specific phenotype were identified and quantified using the TissueQuest software when detection cut-offs were set according to positive controls PBMCs were isolated from whole-blood samples of healthy donors using Ficoll-Paque PREMIUM after density centrifugation Monocytes were isolated from PBMCs using EasySep™ Human CD14 Positive Selection Kit II (STEMCELL cat#17858) according to the manufacturer’s protocol and cultured in RPMI 1640 medium (0.5 × 106 cells/ mL) supplemented with 20 ng/ml IL-4 and 30 ng/ml GM-CSF Monocytes were incubated for 6 days at 37 °C and 5% CO2 condition and the culture medium was changed every other day we used conventional DC maturation method including 24 h stimulation with cocktail (2000 IU/mL IL-6 PBMCs were isolated according to the steps mentioned above CD8+T cells were isolated from PBMCs using EasySep™ Human CD8+ T Cell Isolation Kit (STEMCELL cat#17953) according to the manufacturer’s protocol and cultured in RPMI 1640 medium (0.5 × 106 cells/ mL) supplemented with 50 ng/mL IL-2 and Dynabeads™ Human T-Activator CD3/CD28 (Invitrogen) CD8+T cells were incubated for 4 days at 37 °C and 5% CO2 condition and the culture medium was changed every other day Pharmingen™ Leukocyte Activation Cocktail was added and cultured for 4 h to promote the expression of CD8+T cell functional molecules before flow cytometry we conducted preliminary experiments using concentrations of 100 nM we selected a concentration of 200 nM Rimegepant 25 μM Rolipram was added 30 min to control group and CGRP group to inhibit phosphodiesterase and prevent the degradation of intracellular cAMP before treatment 400 nM CGRP was added to the treatment group and cultured for 30 min DCs were lysed and ELISA experiments were performed according to the official instructions of the cAMP Assay Kit (Competitive ELISA we monitored fluorescence increase at Ex/Em = 540/590 nm (cutoff 570 nm) using a Thermo Scientific Varioskan Lux microplate reader in top read mode Trizol reagent (Invitrogen) was used to isolate total RNA from DCs from in vitro experiments cDNA was synthesized using PrimeScript™ RT Master Mix (Takara) The specific primer was synthesized as follows: β-actin (forward =5′- CATGTACGTTGCTATCCAGGC-3′ reverse =5′-CTCCTTAATGTCACGCACGAT-3′); KLF2 (forward=5′-CTACACCAAGAGTTCGCATCTG-3′ PCR was performed in triplicate using Taq Pro Universal SYBR qPCR Master Mix (Vazyme) in the LightCycler 480 real time PCR system (Roche) All results are expressed in arbitrary units relative to β-actin RNA expression CD8+T cells were isolated as mentioned above and then labelled with carboxyfluorescein succinimidyl ester (CFSE; Invitrogen) in the presence of recombinant IL-2 and CD3/CD28 dynabeads for 4 days CD8+T cells with or without CD3/CD28 dynabeads was used as positive or negative control CFSE signal was acquired by flow cytometry using FACS Fortessa X-20 (BD Biosciences) 102 MTC patients with prognostic information were divided into high and low groups according to the median value of CGRP expression intensity and their clinical information was provided in Supplementary Data 7 Disease-free survival was analyzed with a two-sided log-rank test with the hazard ratio (HR) and two-sided 95% CIs based on a Cox proportional-hazards model and the associated Kaplan-Meier survival estimates using R package Survival (v3.2.11) and Survminer (v0.4.9) All data analyses were performed in R 4.0.2 and statistical significance was defined as a two-tailed P value of less than 0.05 by Wilcoxon test or t-test as description in comparison of two groups ANNOVAR was used to compare more than two groups in experimental data Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article Nociceptor neurons affect cancer immunosurveillance Cancer cells co-opt nociceptive nerves to thrive in nutrient-poor environments and upon nutrient-starvation therapies Biology-guided precision medicine in rare cancers: Lessons from sarcomas and neuroendocrine tumours Pattern of nodal metastasis for primary and reoperative thyroid cancer Long-term clinical and biochemical follow-up in medullary thyroid carcinoma: a single institution’s experience over 20 years Predicting Outcomes in Sporadic and Hereditary Medullary Thyroid Carcinoma over Two Decades Cancer treatment and survivorship statistics Revised American Thyroid Association guidelines for the management of medullary thyroid carcinoma a phase III trial of cabozantinib in patients with radiographically progressive medullary thyroid carcinoma Phase 3 Trial of Selpercatinib in Advanced RET-Mutant Medullary Thyroid Cancer Cabozantinib in progressive medullary thyroid cancer Efficacy and Safety of Vandetanib in Progressive and Symptomatic Medullary Thyroid Cancer: Post Hoc Analysis From the ZETA Trial Vandetanib in patients with locally advanced or metastatic medullary thyroid cancer: a randomized Expression of calcitonin gene-related peptide in medullary thyroid cancer Integrated proteogenomic characterization of medullary thyroid carcinoma Very low expression of PD-L1 in medullary thyroid carcinoma Comprehensive Immune Profiling of Medullary Thyroid Cancer Applying high-dimensional single-cell technologies to the analysis of cancer immunotherapy Censi, S., Manso, J. & Mian, C. Other markers of medullary thyroid cancer, not only calcitonin. Eur. J. Endocrinol. 188, https://doi.org/10.1093/ejendo/lvac009 (2023) Integrated genomic characterization of papillary thyroid carcinoma Single-Cell Transcriptome Analysis Reveals Inter-Tumor Heterogeneity in Bilateral Papillary Thyroid Carcinoma Lu, L. et al. Anaplastic transformation in thyroid cancer revealed by single-cell transcriptomics. J. Clin. Invest. 133, https://doi.org/10.1172/JCI169653 (2023) Delineating copy number and clonal substructure in human tumors from single-cell transcriptomes A single-cell and spatially resolved atlas of human breast cancers Revealing the transcriptional heterogeneity of organ-specific metastasis in human gastric cancer using single-cell RNA Sequencing Single-cell atlas of tumor cell evolution in response to therapy in hepatocellular carcinoma and intrahepatic cholangiocarcinoma IL-1beta(+) macrophages fuel pathogenic inflammation in pancreatic cancer Glioblastoma remodelling of human neural circuits decreases survival Dissecting the immune suppressive human prostate tumor microenvironment via integrated single-cell and spatial transcriptomic analyses Alternative production of calcitonin and CGRP mRNA is regulated at the calcitonin-specific splice acceptor Molecular simulations reveal the impact of RAMP1 on ligand binding and dynamics of calcitonin gene-related peptide receptor (CGRPR) heterodimer Regulation of signal transduction by calcitonin gene-related peptide receptors Specific induction of cAMP in Langerhans cells by calcitonin gene-related peptide: relevance to functional effects Negative regulation of TLR responses by the neuropeptide CGRP is mediated by the transcriptional repressor ICER The neuropeptide calcitonin gene-related peptide affects allergic airway inflammation by modulating dendritic cell function Tumor Dendritic Cells (DCs) Derived from Precursors of Conventional DCs Are Dispensable for Intratumor CTL Responses Dissecting cell identity via network inference and in silico gene perturbation Wittner, J. & Schuh, W. Kruppel-like Factor 2 (KLF2) in Immune Cell Migration. Vaccines (Basel) 9, https://doi.org/10.3390/vaccines9101171 (2021) Dendritic Cell KLF2 Expression Regulates T Cell Activation and Proatherogenic Immune Responses Transendothelial migration of lymphocytes mediated by intraendothelial vesicle stores rather than by extracellular chemokine depots Peripheral T cell expansion predicts tumour infiltration and clinical response Parga-Vidal, L. et al. Hobit identifies tissue-resident memory T cell precursors that are regulated by Eomes. Sci. Immunol. 6, https://doi.org/10.1126/sciimmunol.abg3533 (2021) Roles of Hopx in the differentiation and functions of immune cells Huang, C. et al. Sirpalpha on tumor-associated myeloid cells restrains antitumor immunity in colorectal cancer independent of its interaction with CD47. Nat Cancer, https://doi.org/10.1038/s43018-023-00691-z (2024) Conserved pan-cancer microenvironment subtypes predict response to immunotherapy Calcitonin gene-related peptide: key regulator of cutaneous immunity Regulation of Langerhans cell function by nerves containing calcitonin gene-related peptide Nociceptive Sensory Fibers Drive Interleukin-23 Production from CD301b+ Dermal Dendritic Cells and Drive Protective Cutaneous Immunity Calcitonin Gene-Related Peptide Negatively Regulates Alarmin-Driven Type 2 Innate Lymphoid Cell Responses Changes in calcitonin gene RNA processing during growth of a human medullary thyroid carcinoma cell line Immune Checkpoint Inhibitors: New Weapons Against Medullary Thyroid Cancer Distinct Immune Gene Programs Associated with Host Tumor Immunity and Chemoimmunotherapy in Resectable NSCLC Predictive correlates of response to the anti-PD-L1 antibody MPDL3280A in cancer patients Calcitonin gene-related peptide decreases expression of HLA-DR and CD86 by human dendritic cells and dampens dendritic cell-driven T cell-proliferative responses via the type I calcitonin gene-related peptide receptor The myeloid transcription factor KLF2 regulates the host response to polymicrobial infection and endotoxic shock Efficacy of Selpercatinib in RET-Altered Thyroid Cancers The RET kinase inhibitor NVP-AST487 blocks growth and calcitonin gene expression through distinct mechanisms in medullary thyroid cancer cells an Oral Calcitonin Gene-Related Peptide Receptor Antagonist RSV Promotes Epithelial Neuroendocrine Phenotype Differentiation through NODAL Signaling Pathway Calcitonin gene-related peptide in small cell lung carcinomas Synthesis of alpha- and beta-calcitonin gene-related peptide by a human pheochromocytoma Significance of serum calcitonin gene-related peptide levels in prostate cancer patients receiving hormonal therapy Calcitonin and calcitonin gene-related peptide in the human prostate gland Production of calcitonin gene related peptide calcitonin and PTH-related protein by a prostatic adenocarcinoma Young, M. D. & Behjati, S. SoupX removes ambient RNA contamination from droplet-based single-cell RNA sequencing data. Gigascience 9, https://doi.org/10.1093/gigascience/giaa151 (2020) Integrated analysis of multimodal single-cell data sensitive and accurate integration of single-cell data with Harmony Single-Cell Transcriptomic Analysis of Primary and Metastatic Tumor Ecosystems in Head and Neck Cancer Landscape of Infiltrating T Cells in Liver Cancer Revealed by Single-Cell Sequencing clusterProfiler 4.0: A universal enrichment tool for interpreting omics data Molecular signatures database (MSigDB) 3.0 The Gene Ontology resource: enriching a GOld mine Gene ontology: tool for the unification of biology Single-cell landscape of the ecosystem in early-relapse hepatocellular carcinoma CD8(+) T cell states in human cancer: insights from single-cell analysis Tumour heterogeneity and intercellular networks of nasopharyngeal carcinoma at single cell resolution A Critical Role of CD40 and CD70 Signaling in Conventional Type 1 Dendritic Cells in Expansion and Antitumor Efficacy of Adoptively Transferred Tumor-Specific T Cells Irradiation enhances human T-cell function by upregulating CD70 expression on antigen-presenting cells in vitro Kotliar, D. et al. Identifying gene expression programs of cell-type identity and cellular activity with single-cell RNA-Seq. Elife 8, https://doi.org/10.7554/eLife.43803 (2019) Reversed graph embedding resolves complex single-cell trajectories fastp: an ultra-fast all-in-one FASTQ preprocessor Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype Robust enumeration of cell subsets from tissue expression profiles GSVA: gene set variation analysis for microarray and RNA-seq data CGRP Regulates Nucleus Pulposus Cell Apoptosis and Inflammation via the MAPK/NF-kappaB Signaling Pathways during Intervertebral Disc Degeneration Download references These authors contributed equally: Yingtong Hou These authors jointly supervised this work: Yihao Liu Center of Hepato-Pancreato-Biliary Surgery Department of Gastroenterology and Hepatology Nature Communications thanks James Fagin and the other reviewer(s) for their contribution to the peer review of this work Download citation DOI: https://doi.org/10.1038/s41467-024-49824-7 Sign up for the Nature Briefing: Cancer newsletter — what matters in cancer research All content on this site: Copyright © 2025 Elsevier B.V. Metrics details Few studies have investigated the impact of primary tumor resection (PTR) on patients with distant metastasis medullary thyroid carcinoma (DMMTC) This population-based study aims to assess the application of PTR in DMMTC patients DMMTC Patients diagnosed between 2010 and 2020 were included through the Surveillance Logistic regression analysis identified driving factors of surgical decision-making and Cox regression were utilized to compare overall survival (OS) and disease-specific survival (DSS) between surgical and non-surgical groups Subgroup analyses were performed to determine optimal surgical indications Extrathyroidal extension and N1 stage emerged as independent factors promoting the surgical decision PSM-adjusted survival analyses revealed significant advantages in both OS and DSS for the surgical group subgroup analyses indicated that except for patients aged ≥ 65 years or with multiple metastasized sites (> 1) PTR significantly improves prognosis in selected DMMTC patients The decision to undergo PTR in other patients should be based on a comprehensive assessment of the disease and family discussions for potential survival benefits Routine primary tumor resection is not universally recommended for all DMMTC patients obtaining data on DMMTC patients diagnosed between 2010 and 2020 through the SEER database aimed to assess the application of primary tumor resection in DMMTC patients and further explore the optimal indications for resection via subgroup analysis The inclusion criteria for this study are as follows: (1) ‘Primary site label’ variable was set to C73.9: thyroid (2) Pathological types were identified using the ‘ICD3-O-3’ variable: medullary thyroid carcinoma (8345 (3) Distant metastasis was ascertained using variables: “CS mets at dx(2004–2015)” (4) The “Diagnostic Confirmation” variable was used to include only microscopically confirmed cases The exclusion criteria for this study are as follows: (1) Cases of Autopsy and Death certificates only were excluded by the “Type of reporting source” variable (2) Patients with no information about whether the primary tumor surgery were performed (3) Patients who were diagnosed before January 2010 or after December 2020 (Due to the year limit of the specific metastatic sites variables and consideration of mature follow-up period) Cohort characteristics comprised demographic features (sex clinicopathological characteristics (tumor size ‘Median household income’ were employed to determine sex marital status and household median income Age was divided into categorical variables: 0–44 Clinicopathological characteristics were primarily identified and categorized using ‘CS Tumor/lymph node (2004–2015)’ and ‘EOD Primary tumor/lymph node (2018 +)’ Surgery data were extracted from the ‘Rx Summ-Surg Prim site’ variable and reason for non-surgical treatment were extracted from ‘Reason no cancer-directed surgery’ Previous tumor history was identified from ‘First malignant primary indicator’ The specific metastatic sites were identified from ‘SEER Combined Mets at DX-bone/brain/liver/lung’ Distant lymph nodes metastasis was extracted from ‘CS mets at dx (2004–2015)’ and ‘Mets at DX-Distant LN (2016 +)’ metastasized sites registered as unknown in SEER database were defined as no or no evidence Outcome data were gathered from “Survival months” “Vital status recode” and “SEER case-specific death classification” variables 238 patients were included in the study cohort The flowchart of this study is depicted in Fig.S1 Considering some variables with missing data have potential impact on prognosis and surgical decision-making and directly deleting these missing values or defining them simply as unknown (about 58 cases) might greatly affect the efficacy of the statistical test the ‘Mice’ package was employed for multiple imputation of missing data the ‘Matchit’ package was applied for propensity score matching (PSM) in the study cohort to reduce the baseline difference PSM utilized nearest neighbor caliper matching income) were included in PSM formula in order to reduce potential inter-group bias in underlying diseases Fisher's precision probability test was used to calculate the baseline difference between the two groups Logistic regression analysis predicted the likelihood of surgical decision-making The Kaplan–Meier method and log-rank test compared the overall survival (OS) and the disease-specific survival (DSS) Cox regression analysis was used to identify risk factors for death Variables with p < 0.15 in univariate analysis or with potential prognostic impact on outcomes were incorporated into multivariate analysis and stepwise regression using the backward method identified the optimal model All statistical analyses were conducted using R (version 4.3.1) and SPSS (version 25 All tests were two-tailed with α defined as 0.05 Table 1 displays the baseline characteristics of the SEER cohort Among the 238 DMMTC patients diagnosed between 2010 and 2020 122 (51.3%) underwent primary tumor resection The median follow-up duration was 19.5 months with a total of 147 deaths recorded during the follow-up period The predominant age group among DMMTC patients was 45–64 years (46.2%) Primary tumor characteristics predominantly included tumors ≥ 40 mm (36.6%) Metastases primarily occurred in the bone (54.6%) with 41.6% of patients having multi-organ metastases Non-surgical patients were more treated with chemotherapy (56.0%) the surgical rate for DMMTC remained steady despite the advancement in diagnostic years The predominant reason cited for not undergoing surgery in 93.9% of non-surgical patients was “not recommended by surgeon” Among DMMTC patients who underwent primary tumor resection Multivariate logistic regression analysis, as shown in Table 2 indicates that patients with extrathyroidal extension (OR = 2.19 p = 0.009) were more likely to be treated with primary tumor resection p < 0.001) emerged as an independent factor for undergoing non-surgical treatment Outcomes of patients with DMMTC by whether underwent surgery or not DMMTC: Distant metastasis medullary thyroid carcinoma; PSM: Propensity score match Disease-specific survival of patients with DMMTC by underwent surgery or not in different subgroups DMMTC: Distant metastasis medullary thyroid carcinoma; DSS: Disease-specific survival; ETE: Extrathyroidal extension Subsequent multivariate cox regression analysis in various subgroups revealed that except those subgroups mentioned in the preceding paragraph (patients aged ≥ 65 years, tumors ≤ 20 mm, patients with multiple metastasized sites), surgery served as an independent protective factor against disease-specific mortality in all the subgroups. (Table 5) Disease-specific survival of patients with DMMTC by underwent surgery or not in different age subgroups DMMTC: Distant metastasis medullary thyroid carcinoma; DSS: Disease-specific survival In a retrospective cohort study of 238 Distant Metastasis Medullary Thyroid Carcinoma (DMMTC) cases we explored the implementation of primary tumor resection and the factors driving surgical decision We assessed the effects of primary tumor resection versus non-surgical treatment on DMMTC patients’ prognosis and delved into the optimal indications for primary tumor resection This study is the first to use PSM to highlight and validate the positive prognostic influence of primary tumor resection in selected DMMTC patients augmenting the detailed indications and optimal age cutoff of surgical benefit While the study's methodology is commendable it is essential to consider the potential for bias due to unadjusted potential underlying disease status insufficient follow-up period in newly diagnosed patients in recent 3 years and a small cohort size resulting from stringent exclusion criteria the omission of patients with incomplete data in specific subgroup analyses could skew the determination of the most suitable candidates Our study is the first to use PSM to identify primary tumor resection as an independent protective factor against death in DMMTC patients The 1-year DSS rate for surgical patients after PSM is 81.3% the median disease-specific survival time notably improved from 15 months in the non-surgical group to 60 months in the surgical group It is worth mentioning that after PSM corrected the potential bias of underlying disease status and grouping imbalance the median disease-specific survival decreased from 85 to 60 months in the surgery group while the median disease-specific survival did not change significantly in the non-surgery group our subgroup analysis challenges this conventional recognition Our results showed that apart from patients aged ≥ 65 years with multiple metastasized sites or with tumors ≤ 20 mm primary tumor resection enhanced the DSS in nearly all other subgroups which means that the recommended indication for primary tumor resection should be relaxed rather than limited to palliative surgery for local progression This suggests that for patients over 65 years old the protective effect of surgical treatment remains uncertain Considering that the sample size of patients in this subgroup was relatively small (N = 56) and the survival curves showed that the prognosis of the surgery group was obviously better we speculated that the small sample size might lead to statistical insignificance it is considered that there are DMMTC patients with small primary tumors but serious metastases in clinical practice Prospective cohort studies or clinical trials in the future are needed to further determine the benefit of surgery in this subgroup of patients our study advocates for primary tumor resection in DMMTC patients aged < 64 and with single metastasized site to achieve significant survival benefits clinicopathological characteristics and overall health should be considered comprehensively to decide whether to perform primary tumor resection for potential survival benefit or with multiple metastasized sites (> 2) primary tumor resection may have no benefit We speculated that the combination of primary tumor resection and targeted therapy may further enhance the prognostic impact of primary tumor resection on DMMTC patients neoadjuvant targeted therapy or even primary tumor resection for DMMTC patients is rarely mentioned in published trials This needs to be further carried out in future randomized clinical trials or prospective cohort studies especially in several groups where primary tumor resection cannot effectively improve prognosis in order to find the optimal treatment for DMMTC patients The implementation rate of primary tumor resection in DMMTC patients remained stable between 2010 and 2020 Extrathyroidal extension and lymph node metastases are the driving factors for undergoing surgery while multiple metastasized sites (> 1) is the sole independent promoting factor for undergoing non-surgical treatment PSM-adjusted survival analyses indicate that primary tumor resection significantly improved the OS and DSS in DMMTC patients Further subgroup analyses advocate for primary tumor resection in DMMTC patients aged < 64 clinicopathological characteristics and overall health should be considered comprehensively to decide whether to perform primary tumor resection for potential survival benefits The data of this study could be obtained from the SEER program for free access Wells, S. A. Jr. et al. Revised american thyroid association guidelines for the management of medullary thyroid carcinoma. Thyroid 25(6), 567–610. https://doi.org/10.1089/thy.2014.0335 (2015) Angelousi, A., Hayes, A. R., Chatzellis, E., Kaltsas, G. A. & Grossman, A. B. Metastatic medullary thyroid carcinoma: a new way forward. Endocr. Relat. Cancer 29(7), R85–R103. https://doi.org/10.1530/ERC-21-0368 (2022) Kotwal, A., Erickson, D., Geske, J. R., Hay, I. D. & Castro, M. R. Predicting outcomes in sporadic and hereditary medullary thyroid carcinoma over two decades. Thyroid 31(4), 616–626. https://doi.org/10.1089/thy.2020.0167 (2021) Opsahl, E. M. et al. Trends in diagnostics, surgical treatment, and prognostic factors for outcomes in medullary thyroid carcinoma in Norway: A nationwide population-based study. Eur. Thyroid J. 8(1), 31–40. https://doi.org/10.1159/000493977 (2019) Randle, R. W. et al. Trends in the presentation, treatment, and survival of patients with medullary thyroid cancer over the past 30 years. Surgery 161(1), 137–146. https://doi.org/10.1016/j.surg.2016.04.053 (2017) Filetti, S. et al. Thyroid cancer: ESMO clinical practice guidelines for diagnosis, treatment and follow-up†. Annals Oncol. 30(12), 1856–1883. https://doi.org/10.1093/annonc/mdz400 (2019) Haddad, R. I. et al. Thyroid carcinoma, version 2.2022, NCCN clinical practice guidelines in oncology. J. Natl. Compr. Canc. Netw. 20(8), 925–951. https://doi.org/10.6004/jnccn.2022.0040 (2022) Luo, W. & Zhang, T. Primary tumor resection enhances the survival of pancreatic neuroendocrine carcinoma patients with liver metastasis under the definition of 2019 WHO classification. J. Cancer Res. Clin. Oncol. 149(11), 9201–9212. https://doi.org/10.1007/s00432-023-04847-3 (2023) He, Y. et al. Primary tumor resection improves survival benefit of stage IVB cervical carcinoma: A new perspective. J. Cancer Res. Clin. Oncol. 149(13), 11013–11023. https://doi.org/10.1007/s00432-023-04988-5 (2023) Zheng, M., Li, Y., Li, T., Zhang, L. & Zhou, L. Resection of the primary tumor improves survival in patients with gastro-entero-pancreatic neuroendocrine neoplasms with liver metastases: A SEER-based analysis. Cancer Med. 8(11), 5128–5136. https://doi.org/10.1002/cam4.2431 (2019) Warschkow, R. et al. Improved survival after primary tumor surgery in metastatic breast cancer: A propensity-adjusted, population-based SEER trend analysis. Ann. Surg. 263(6), 1188–1198. https://doi.org/10.1097/sla.0000000000001302 (2016) Patel, T. D. et al. Utility of surgery radiotherapy in distant metastatic head and neck squamous cell carcinoma: A population-based approach. Otolaryngol. Head Neck Surg. 154(5), 868–874. https://doi.org/10.1177/0194599815627637 (2016) Tarantino, I. et al. Prognostic relevance of palliative primary tumor removal in 37,793 metastatic colorectal cancer patients: A population-based, propensity score-adjusted trend analysis. Ann. Surg. 262(1), 112–120. https://doi.org/10.1097/sla.0000000000000860 (2015) Sahli, Z. T., Canner, J. K., Zeiger, M. A. & Mathur, A. Association between age and disease specific mortality in medullary thyroid cancer. Am. J. Surg. 221(2), 478–484. https://doi.org/10.1016/j.amjsurg.2020.09.025 (2021) Rubin, D. B. Estimating causal effects from large data sets using propensity scores. Ann. Internal Med. 127(8 Pt 2), 757–763. https://doi.org/10.7326/0003-4819-127-8_part_2-199710151-00064 (1997) Mathew, G. et al. STROCSS 2021: Strengthening the reporting of cohort, cross-sectional and case-control studies in surgery. Int. J. Surg. 96, 106165. https://doi.org/10.1016/j.ijsu.2021.106165 (2021) Wilhelm, A. et al. Disease-specific survival trends for patients presenting with Differentiated thyroid cancer and distant metastases in the United States, 1992–2018. Thyroid 33(1), 63–73. https://doi.org/10.1089/thy.2022.0353 (2023) Shindo, M. L. et al. Management of invasive well-differentiated thyroid cancer: An American Head and Neck Society consensus statement AHNS Consensus Statement. Head Neck 36(10), 1379–1390. https://doi.org/10.1002/hed.23619 (2014) Simoes-Pereira, J. et al. Avidity and outcomes of radioiodine therapy for distant metastasis of distinct types of differentiated thyroid cancer. J. Clin. Endocrinol. Metab. 106(10), e3911–e3922. https://doi.org/10.1210/clinem/dgab436 (2021) Liu, C. Q. et al. Survival outcome and optimal candidates of primary tumor resection for patients with metastatic medullary thyroid cancer. J. Clin. Endocrinol. Metab. https://doi.org/10.1210/clinem/dgae214 (2024) Vuong, H. G., Le, M. K., Hassell, L., Kondo, T. & Kakudo, K. The differences in distant metastatic patterns and their corresponding survival between thyroid cancer subtypes. Head Neck 44(4), 926–932. https://doi.org/10.1002/hed.26987 (2022) Kiesewetter, B., Riss, P., Scheuba, C. & Raderer, M. How I treat medullary thyroid cancer. ESMO Open 6(3), 100183. https://doi.org/10.1016/j.esmoop.2021.100183 (2021) Wells, S. A. Jr. et al. Vandetanib in patients with locally advanced or metastatic medullary thyroid cancer: a randomized, double-blind phase III trial. J. Clin. Oncol. 30(2), 134–141. https://doi.org/10.1200/JCO.2011.35.5040 (2012) Wirth, L. J. et al. Efficacy of selpercatinib in RET-altered thyroid cancers. N Engl. J. Med. 383(9), 825–835. https://doi.org/10.1056/NEJMoa2005651 (2020) Subbiah, V. et al. Pralsetinib for patients with advanced or metastatic RET-altered thyroid cancer (ARROW): A multi-cohort, open-label, registrational, phase 1/2 study. Lancet Diabetes Endocrinol. 9(8), 491–501. https://doi.org/10.1016/S2213-8587(21)00120-0 (2021) Li, D. et al. Anlotinib in locally advanced or metastatic medullary thyroid carcinoma: A randomized, double-blind phase IIB trial. Clin. Cancer Res. 27(13), 3567–3575. https://doi.org/10.1158/1078-0432.CCR-20-2950 (2021) Zhao, X. et al. Surgery after BRAF-directed therapy is associated with improved survival in BRAF(V600E) mutant anaplastic thyroid cancer: A single-center retrospective cohort study. Thyroid 33(4), 484–491. https://doi.org/10.1089/thy.2022.0504 (2023) Download references The authors would like to thank the SEER program for the study cohort These authors contributed equally: Zixia Tao and Xianzhao Deng Shanghai Sixth People’s Hospital Affiliated to Shanghai Jiao Tong University School of Medicine Data curation: Z.T.&X.D.; Formal analysis: Z.T.; Methodology: Z.T.; Writing-original draft: Z.T.; Validation: X.D.&Z.D.; Writing-review &editing: X.D.; Investigation: Z.D.&B.G.; Supervision: B.G.&Y.F.; Conceptualization: Y.F Download citation DOI: https://doi.org/10.1038/s41598-024-68458-9 University of Iowa researchers have uncovered a brain rhythm in the brain stem of sleeping infant rats that mirrors the rhythm in the cerebral cortex The discovery reveals the origin of long-distance communication in the developing brain and opens a new path to understanding the connection between a fundamental brain rhythm and breathing a finding that could inform our understanding of sleep-related breathing disorders in children Prior research has shown that sleep can be divided into two general phases: active sleep and quiet sleep quiet sleep grows in importance and is characterized by a slow cortical rhythm a graduate student in the Department of Psychological and Brain Sciences who works in the laboratory of Professor Mark Blumberg She used 12-day-old rats to explore the parts of the brain responsible for the developmental emergence of quiet sleep the researchers found that the rats’ delta rhythm was expressed in a small region of the medulla that had earlier been implicated in the regulation of quiet sleep The team also discovered that the delta wave in the rats’ medulla was synchronized with the delta wave in the cerebral cortex and that both rhythms were coordinated with breathing the medulla and cortex — at opposite ends of the brain — are already communicating at the age when the delta rhythm is first expressed and both rhythms are affected by breathing Because breathing is also regulated in the medulla these findings suggest that the systems that regulate breathing and sleep act together to influence the expression of the delta rhythm in the infant brain. “Understanding sleep and respiratory interactions early in life is relevant for understanding how certain sleep disorders “CSA is common in young children and premature infants and is often linked to sudden infant death syndrome We hope to explore further the brain mechanisms that underlie sleep-dependent respiratory control in early development." “Coincident development and synchronization of sleep-dependent delta in the cortex and medulla,” was published online in the journal Current Biology on May 20 Study co-authors include Greta Sokoloff and Brett Dwyer from Iowa and Jangjin Kim from Kyungpook National University in South Korea. The research was funded by the National Institutes of Health. Admin Login Metrics details but whether they play a causal role in REM sleep generation remains unclear Here we show that a GABAergic (γ-aminobutyric-acid-releasing) pathway originating from the ventral medulla powerfully promotes REM sleep in mice Optogenetic activation of ventral medulla GABAergic neurons rapidly and reliably initiated REM sleep episodes and prolonged their durations whereas inactivating these neurons had the opposite effects Optrode recordings from channelrhodopsin-2-tagged ventral medulla GABAergic neurons showed that they were most active during REM sleep (REMmax) and during wakefulness they were preferentially active during eating and grooming dual retrograde tracing showed that the rostral projections to the pons and midbrain and caudal projections to the spinal cord originate from separate ventral medulla neuron populations Activating the rostral GABAergic projections was sufficient for both the induction and maintenance of REM sleep which are probably mediated in part by inhibition of REM-suppressing GABAergic neurons in the ventrolateral periaqueductal grey These results identify a key component of the pontomedullary network controlling REM sleep The capability to induce REM sleep on command may offer a powerful tool for investigating its functions Prices may be subject to local taxes which are calculated during checkout Regularly occurring periods of eye motility Recherches sur les structures nerveuses et les mécanismes responsables des différentes phases du sommeil physiologique electroencephalogram patterns during behavioral sleep in the cat Sleep cycle oscillation: reciprocal discharge by two brainstem neuronal groups Localization of the GABAergic and non-GABAergic neurons projecting to the sublaterodorsal nucleus and potentially gating paradoxical sleep onset Evidence that neurons of the sublaterodorsal tegmental nucleus triggering paradoxical (REM) sleep are glutamatergic A putative flip-flop switch for control of REM sleep Optogenetic activation of cholinergic neurons in the PPT or LDT induces REM sleep Activity of medullary reticular formation neurons in the unrestrained cat during waking and sleep Activités unitaires spécifiques du sommeil paradoxal dans la formation réticulée bulbaire chez le chat non-restreint and other neurons of the pontomedullary reticular formation and raphe after paradoxical sleep deprivation and recovery Localization of the brainstem GABAergic neurons controlling paradoxical (REM) sleep Role of the lateral paragigantocellular nucleus in the network of paradoxical (REM) sleep: an electrophysiological and anatomical study in the rat Optogenetic identification of a rapid eye movement sleep modulatory circuit in the hypothalamus Evolving the lock to fit the key to create a family of G protein-coupled receptors potently activated by an inert ligand c-Fos as a transcription factor: a stressful (re)view from a functional map serotonergic and other neurons in the medial medullary reticular formation for sleep-wake states studied by cytotoxic lesions in the cat The brain nucleus locus coeruleus: restricted afferent control of a broad efferent network Activity of norepinephrine-containing locus coeruleus neurons in behaving rats anticipates fluctuations in the sleep-waking cycle Efferent connections of the ventral medulla oblongata in the rat An inhibitory mechanism in the bulbar reticular formation REM sleep without atonia after lesions of the medial medulla Carbachol microinjections in the mediodorsal pontine tegmentum are unable to induce paradoxical sleep after caudal pontine and prebulbar transections in the cat Modification of paradoxical sleep following transections of the reticular formation at the pontomedullary junction Inactivation of the pons blocks medullary-induced muscle tone suppression in the decerebrate cat Rostral brainstem contributes to medullary inhibition of muscle tone Tuning arousal with optogenetic modulation of locus coeruleus neurons Norepinephrine effects on spinal motoneurons GABAergic neurons in prepositus hypoglossi regulate REM sleep by its action on locus coeruleus in freely moving rats The role of hypocretins (orexins) in sleep regulation and narcolepsy The Mouse Brain in Stereotaxic Coordinates 3rd edn Dissecting local circuits: parvalbumin interneurons underlie broad feedback control of olfactory bulb output Optetrode: a multichannel readout for optogenetic control in freely moving mice Quantitative measures of cluster quality for use in extracellular recordings Download references Popescu for the help with in vivo physiology the University of North Carolina Virus Core for supplying AAV This work was supported by EMBO and Human Frontier Science Program postdoctoral fellowships (to F.W.) performed all optogenetic stimulation experiments and optrode recordings performed a subset of pharmacogenetic experiments and fluorescence microscopy provided viral reagents for rabies-mediated trans-synaptic experiments and all authors participated in the revision of the manuscript The authors declare no competing financial interests and behavioural data have been archived in the Department of Molecular and Cell Biology Mean EEG spectrogram and EMG amplitude before and after laser onset (averaged across all trials with laser onset falling on NREM sleep) Mean EEG spectrogram and EMG amplitude before and after spontaneous REM onset outside laser stimulation periods (only REM episodes with duration >70 s were included) Comparison of EEG power spectra during spontaneous (grey) and laser-induced (blue) REM sleep Brain states in all trials from five mice aligned by time of laser stimulation (top) and probability of wake Laser stimulation caused no significant change in the probability of any brain state (P > 0.34 for trials in which laser onset fell on NREM sleep Trials in which laser onset fell on wakefulness 120 s) in VGLUT2-Cre mice injected with AAV expressing ChR2–eYFP into the vM (n = 3 mice) Laser stimulation caused a significant increase in wakefulness (P < 0.001 bootstrap) and decrease in NREM sleep (P < 0.001) Mean durations of REM sleep episodes with and without laser stimulation Each pair of dots represents data from one mouse Laser stimulation shortened the duration of REM sleep episodes (n = 3 mice 120 s) at different laser powers (colour coded) Laser stimulation caused no significant effect (P > 0.99) Laser stimulation had no significant effect (P > 0.99) Laser stimulation caused a significant reduction in the transition probability (P < 0.001) indicating that during wakefulness vM GABAergic neuron activity has a wake-maintenance effect Laser stimulation had no significant effect on any transition probability (P > 0.05) Brain states in a control (vehicle injection) and a CNO session from an example mouse The recording session started 20 min after vehicle or CNO injection Probability of each brain state during the first 2.5 h of the recording session after injection of vehicle (grey) or two dosages of CNO (different shades of blue) *P < 0.05; **P < 0.01; one-way analysis of variance with post hoc Dunnett’s test but during the second half of the recording session (2.5–5 h) There was no significant difference between control and CNO at any dosage (P > 0.12) Latency of first REM sleep episode (from the beginning of each recording session) Frequency of REM episodes during the first 2.5 h of the recording session Duration of REM episodes during the first 2.5 h of the session The reduction of REM sleep caused by pharmacogenetic inactivation of vM GABAergic neurons appears to be due to the reduction of frequency rather than duration of REM episodes Mean firing rates of vM GABAergic neurons at REM onset period in which firing rate was significantly higher than baseline (P < 0.05 Wilcoxon signed-rank test); baseline was defined as the average firing rate during the 10 s intervals 60 s before and after REM sleep 120 s) in GAD2-Cre mice injected with AAV expressing ChR2–eYFP into the vM (n = 8 mice) Laser stimulation caused a significant increase in eating (P = 0.008 but in control mice expressing eYFP (n = 4 mice) Firing rates of unidentified units in the three brain states Gray bar represents average over units (n = 24) relative firing rates of the units across brain states The firing rates of each unit were normalized by its maximum normalized firing rates across different wakeful behaviours Mean firing rates of unidentified vM neurons at REM onset Mean firing rates of unidentified vM neurons at REM offset Fluorescence image of ChR2–eYFP expressing neurons in the vM of a GAD2-Cre mouse injected with Cre-inducible AAV Superposition of eYFP expression and glycine staining 94% (273/289) of eYFP-expressing cells were glycine positive (n = 3 mice) The video shows 3 laser stimulation trials including 1 min before and after each laser stimulation period In the first two trials the animal was in NREM sleep at laser onset EMG amplitude and hypnogram are shown on the right Laser stimulation periods are depicted by the blue shading on the top right and additionally indicated as a blue square in the upper right corner of the movie frame; 10x speedup The video shows two recording periods of an identified unit During the first period the animal was asleep during the second period he was awake and engaged in multiple behaviors (ET – eating hypnogram and firing rate are shown on the right The time points of single spikes are represented as vertical lines on the bottom left Laser stimulation periods (15 or 30 Hz) are shown as blue shadings along with the firing rate and are indicated by a blue square within the movie frame; 10x speedup Reprints and permissions Download citation Current Neurology and Neuroscience Reports (2023) Previous attempts to understand the contribution of specific brain regions to the promotion and maintenance of rapid eye movement (REM) sleep the type of sleep during which most instances of dreaming occur have mainly relied on transection or lesion-based studies Yang Dan and colleagues use optogenetics to demonstrate that activation of GABAergic neurons in the ventral medulla can reliably induce REM sleep and prolong the duration of REM episodes in mice The ability to control REM sleep at a high temporal precision should provide a useful tool for the study of its functions Metrics details Understanding the neural mechanisms underlying sleep state transitions is a fundamental goal of neurobiology and important for the development of new treatments for insomnia and other sleep disorders brain circuits controlling this process remain poorly understood Here we identify a population of sleep-active glutamatergic neurons in the ventrolateral medulla (VLM) that project to the preoptic area (POA) Microendoscopic calcium imaging demonstrate that these VLM glutamatergic neurons display increased activity during the transitions from wakefulness to Non-Rapid Eye Movement (NREM) sleep Chemogenetic silencing of POA-projecting VLM neurons suppresses NREM sleep whereas chemogenetic activation of these neurons promotes NREM sleep we show that optogenetic activation of VLM glutamatergic neurons or their projections in the POA initiates NREM sleep in awake mice our findings uncover an excitatory brainstem-hypothalamic circuit that controls the wake-sleep transitions These findings suggest that VLPO neurons might be involved in sleep maintenance whereas other neurons may be responsible for sleep initiation we sought to identify neuronal populations that might contribute to the transitions from wakefulness to sleep (i.e. Using c-Fos activity approach and retrograde labeling we identified a population of POA-projecting glutamatergic neurons in the ventrolateral medulla that are active in response to repeated wake–sleep transitions we further demonstrated that a subset of medulla glutamatergic neurons are preferentially active during NREM sleep We then selectively inhibited and activated these medulla neurons in mice and examined the effects of these manipulations on sleep transitions We found that inhibition of POA-projecting medulla neurons disrupts the transitions from wakefulness to sleep activation of these medulla glutamatergic neurons reliably induces the wake–sleep transitions These results demonstrate a previously unknown brainstem-hypothalamic circuit that controls wake–sleep transitions Red box indicated the region of fluorescence images Quantitation of c-Fos+ cells in the VLM in each group (n = 3 mice for control d Triple fluorescence in situ hybridization (FISH) of Fos and neuronal markers in the VLM of a SD mouse (n = 2 mice) vesicular glutamate transporter 2; Slc32a1 Arrows indicated the overlapped cells between Fos and Slc17a6 a Schematic of microendoscopic calcium imaging in the VLM Tungsten wires attached to the GRIN lens were used to stabilize the field of view activity map of an example imaging session in a Vglut2-Cre mouse b An example showing brain states (gray for wake and representative calcium traces (DF/F) in an imaging session enlarged window showing calcium activity in 3 cells (#6 as a NREM sleep active cell) during wake–sleep transition c Quantification of calcium activity of NREM sleep active cells (n = 11 neurons from 4 mice two-sided paired t-test) in each brain state quantification of calcium activity during the transitions from wakefulness (W) to NREM sleep (N) in the NREM sleep active cells in panel c quantification of calcium activity during the NREM-to-wake transitions in the NREM active cells (n = 11 neurons from 4 mice a Schematic illustrating retrograde labeling experiments in Ai9 reporter mice injected with AAVrg-hSyn.Cre.WPRE.hGH in the preoptic area (POA) maximum-intensity z stack of POA-projecting neurons in the whole mouse brain cleared with CUBIC and imaged with light-sheet fluorescent microscopy (a representative example from 3 mice) The dashed-line box illustrating the anterior and posterior boundaries used for reconstruction of coronal and horizontal views on the right Maximum-intensity z stack of POA-projecting neurons in the optically sliced coronal sections of the brainstem Maximum-intensity z stack of POA-projecting neurons in the optically sliced horizontal sections of the brainstem Mouse brain figures in b and d adapted from Allen mouse brain atlas c Three-dimensional reconstruction of POA-projecting medulla neurons in the perspective respectively (from Bregma −6.0 mm to −8.0 mm) d Fluorescence images of cFos immunostaining (green) and tdTomato expression (red) in the VLM (blue box on the coronal section) of a sleep-deprived Ai9 mouse injected with AAVrg-Cre in the POA (n = 2 mice) Arrows indicated the co-stained cells of cFos and tdTomato a Monosynaptic retrograde tracing from the POA to VLM in GAD2-Cre mice The POA of GAD2-Cre animals were infected with AAV-FLEX-G(N2C)-mKate and AAV-FLEX-TVA-mCherry followed by infection with RABV-ΔG-GFP-EnvA fluorescence image of the injection site in the POA Enlarged view of the region in the white box showing starter cells labeled by mCherry (red) Rabies-labeled cells labeled by GFP (green) Rabies-labeled cells in the VLM indicated by GFP expression (green) AAV-DIO-ChR2-eYFP was injected unilaterally in the VLM AAV-mDlx-mRuby2 injected contralaterally in the POA of Vglut2-Cre mice Recordings were performed in mRuby+ cells in the POA while light stimulation was delivered to activate ChR2-expressing VLM glutamatergic axons Fluorescence images showing expression of mRuby and ChR2-eYFP in the POA (n = 6 mice) c Excitatory post-synaptic potentials (EPSPs) evoked by optogenetic stimulation (blue line or baseline) and after (right) glutamatergic receptor antagonists CNXQ (10 μM) and DL-AP5 (10 μM) Each trace represents averaged response across 5 sweeps in one cell Cells with pharmacological block are highlighted in red d Quantitation of average EPSP amplitudes (n = 8 cells from 6 Vlgut2-Cre mice 4 cells with pharmacological block are used for the bar graph and statistical comparison a Schematic of chemogenetic inhibition AAVrg-Cre was bilaterally injected in the POA and AAV9-hSyn-DIO-hM4D(Gi)-mCherry was bilaterally injected in the VLM of wild-type mice Fluorescence images of coronal sections in the VLM (blue boxes above) showing bilateral expression of inhibitory DREADDs (n = 8 mice) Mouse brain figure adapted from Allen mouse brain atlas b Schematic of drug administration and sleep recording c Wake time per hour over a 12-h time window following CNO (1 mg/kg red circles) and saline (black circles) treatments quantitation of the total wake time (P = 0.011) bout durations (P = 0.016 without two outliers) over 3-h after treatments d Quantitation of hourly NREM sleep time over 12-h and bout durations (P = 0.869) over 3-h after CNO and saline treatments e Quantitation of hourly REM sleep time over 12-h and bout durations (P = 0.129) over 3-h after CNO and saline treatments a Schematic of chemogenetic activation AAVrg-Cre was bilaterally injected in the POA AAV-DIO-hM3D(Gq)-mCherry was unilaterally injected in the VLM of wild-type mice Fluorescence image of a coronal section in the VLM (blue box above) showing expression of excitatory DREADDs (n = 8 mice) quantitation of the total wake time (P = 0.001) bout durations (P = 0.032) over 3-h after treatments and bout durations (P = 0.517) over 3-h after CNO and saline treatments and bout durations (P = 0.797) over 3-h after CNO and saline treatments a coronal section (adapted from Allen mouse brain atlas) fluorescence image of VLM (blue box) in a Vglut2-Cre mouse injected with AAV-DIO-ChR2-eYFP (n = 13 mice) Dashed box indicates the placement of optical fiber Amb nucleus ambiguus; IO inferior olivary complex b Representative EEG spectrogram and EMG trace in a 2-h session with photostimulation (20 Hz during and after laser stimulation (white dash lines) in awake animals (n = 14) d Brain states in no light animals (n = 10) e Scatter plots and distributions of bout durations and relative delta power during NREM sleep (n = 14 animals) P = 0.588) and relative delta power (bottom f Quantification of transition probability from wakefulness to NREM sleep induced by optogenetic activation (n = 14 animals for Vglut2-Cre with light **P < 0.0006 between Vglut2+light and control P = 0.286 between Vglut2+light and CaMKII) g Optogenetic stimulation of POA-projecting VLM neurons AAV-DIO-ChR2-eYFP injected in VLM in wild-type mice and after laser stimulation (66 trials from 3 mice) g are presented as mean ± 95% bootstrap confidence intervals h Quantitation of wake–sleep transition probability under different frequencies of laser stimulation (2 min these results excluded the first possibility and supported that nonspecific activation might be involved in offset phenomenon observed in Vglut2-Cre mice a Schematic of anterograde tracing experiment AAV1-CAG-FLEX-tdTomato (red) was unilaterally injected in the VLM (bottom) of Vglut2-Cre mice (n = 5 mice) b Fluorescence image of a coronal section (Bregma 0) illustrating axonal terminals (red) in the POA (enlarged in the middle d Brain states (upper) and probability (bottom) before and after laser stimulation of VLM glutamatergic terminals in the POA of awake animals (n = 7) e Bout durations (upper) and relative delta power (bottom) in optogenetic-induced and natural NREM sleep (n = 7 animals possibly due to the viral spread into the adjunct region the co-existence of REM sleep-promoting and NREM sleep-promoting neurons in the medulla raises the possibility of interactions among these neurons and highlights the importance of the medulla in sleep regulation It will be also important to identify the inputs of these VLM glutamatergic neurons effort should be put on neurons involved in wake/sleep regulation to examine how NREM-promoting VLM neurons are activated during and prior to NREM sleep and how they are inhibited during other brain brains such as somnogens released from glial cells in the region might also be equally important to understand the sleep initiation process such functional studies of inputs and outputs of VLM neurons will yield mechanistic insight into sleep state transitions and maintenance All procedures were carried out in accordance with the US National Institute of Health (NIH) guidelines for the care and use of laboratory animals and approved by the Animal Care and Use Committees of Columbia University Both male and female adult mice (8–20 weeks old) were used for all experiments The following mouse lines were used in the current study: C57BL/6J (JAX 000664) Mice were housed in 12-hour light-dark cycles (lights on at 07:00 a.m temperatures of 65–75 °F with 40–60% humidity) with free access to food and water AAV1-EF1α-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA AAV1-mDlx-NLS-mRuby2 were obtained from Addgene AAV1-EF1a-FLEX-TVA-mCherry from UNC vector core AAV1-FLEX-2A-G(N2C)-mKate and RABV-ΔG -GFP-EnvA Mice were anaesthetized with a mixture of ketamine and Xylazine (100 and 10 mg kg−1 then placed on a stereotaxic frame with a closed-loop heating system to maintain body temperature the skin was incised to expose the skull and a small craniotomy (~0.5 mm in diameter) was made on the skull above the regions of interest A solution containing 50–200 nl viral construct was loaded into a pulled glass capillary and injected into the target region using a Nanoinjector (WPI) Thorlabs) were implanted into the target region with the tip 0.4 mm above the virus injection site for optogenetic manipulation a reference screw was inserted into the skull on top of the cerebellum EEG recordings were made from two screws on top of the cortex 1 mm from midline 1.5 mm anterior to the bregma and 1.5 mm posterior to the bregma Two EMG electrodes were bilaterally inserted into the neck musculature EEG screws and EMG electrodes were connected to a PCB board which was soldered with a 5-position pin connector All the implants were secured onto the skull with dental cement (Lang Dental Manufacturing) the animals were returned to home-cage to recover for at least two weeks before any experiment 150–200 nl AAVrg-hSyn.Cre.WPRE.hGH was unilaterally or bilaterally injected into the ventrolateral preoptic area (VLPO 200 nl mix of AAV-FLEX-G(N2C)-mKate and AAV-FLEX-TVA-mCherry (1:1) was unilaterally injected into the VLPO of Gad2-Cre mice 200 nl RABV-ΔG-GFP-EnvA was unilaterally injected into the same VLPO 50 nl AAV1-CAG-FLEX-tdTomato was unilaterally injected into the ventrolateral medulla (VLM The ventral coordinates listed above are relative to the pial surface 200 nl AAV9-hSyn-DIO-hM4D(Gi)-mCherry was bilaterally injected in VLM 200 nl AAVrg-hSyn.Cre.WPRE.hGH was bilaterally injected into the VLPO of C57BL/6J mice 200 nl AAV8-hSyn-DIO-hM3D(Gq)-mCherry was unilaterally injected into the VLM 200 nl AAV1-EF1α-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA was unilaterally injected into the VLM an optical fiber implanted 0.4 mm on top of the viral injection site in Vglut2-cre mice 200 nl AAV1-EF1α-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA was unilaterally injected into the VLM of Vglut2-Cre mice and an optical fiber was implanted in the POA In in vivo pharmacological inhibition experiments Vglut2-Cre mice were unilaterally injected with AAV1-DIO-ChR2-EYFP and implanted with an optical fiber in the VLM then implanted with a double guide cannula (26 gauge P1 Technologies) bilaterally above the POA A metal head-post was attached during surgery for head fixation during the intracranial infusion 250 nl AAV1-mDlx-mRuby2 was unilaterally injected in the VLPO 250 nl AAV1-DIO-ChR2-eYFP was contralaterally injected in the VLM of Vglut2-Cre mice 200 nl AAV9-CaMKIIa-ChR2-eYFP was unilaterally injected in the VLM 200 nl AAV1-FLEX-GCaMP6s was contralaterally injected in the VLPO An optical fiber was implanted 0.2 mm above the VLPO injection site 200 nl AAV1-FLEX-GCaMP6f was unilaterally injected in the VLM of Vglut2-Cre mice Inscopix) was implanted 0.2 mm above the injection site the cover was removed to expose the GRIN lens and a miniaturized fluorescence microscope (Inscopix) was lowered over the implanted GRIN lens until the GCaMP6f fluorescence was visible under illumination with the microscope’s LED The microscope’s baseplate was then secured to the skull with dental cement darkened with carbon powder for subsequent attachment of the microscope to the head we did not observe any gross behavioral abnormality and these mice exhibited normal sleep–wake cycles delta frequency (0.5–4 Hz) activity and low EMG activity; REM: high power at theta frequencies (6–9 Hz) and low EMG activity) Semi-auto classification was validated manually by trained experimenters Relative delta power was calculated by dividing the delta power in the 2-s bins by the total EEG power averaged across the recording session photometric data were further normalized across animals using Z-score calculation we used the first NREM sleep episode (if existed) following laser stimulation in 15-min time windows (5 min before laser 10 min after laser) as optogenetic-induced sleep used all NREM sleep episodes from 15-min time windows between laser stimulation (at least 15 min away from previous or next stimulation) in the same recording sessions as natural sleep and calculated bout durations and relative delta power of NREM sleep episodes The identified events were reviewed along with calcium imaging video by an experimenter and motion-induced artifacts were excluded for further analysis To compare the activity in different brains states we used the integrated area under curve (AUC) of detected events and normalized it to the durations (in minute) of each state The N-W or R-W selectivity index was calculated as: where AUCa and AUCb refer to AUC activity in brain state a (e.g. with 0 indicating no selectivity between two states For the analysis of calcium activity during the transitions (Fig. 2d) we calculated AUC activity in the NREM active cells before and after wake-to-NREM or NREM-to-wake transitions 30-s NREM for W-N transitions) was used for quantification Transitions with less than 30s-episodes in either state were excluded for analysis After habituation for 12 h in the testing chamber C57BL/6J mice expressing hM4Di or hM3Dq in the VLM were injected with saline (day 1) and CNO (day 2 1 mg/kg body weight) intraperitoneally (i.p.) at the same time of the days Injections were performed in light cycles (10:00 a.m.) for chemogenetic inhibition and in dark cycles (9:30–10:00 PM) for chemogenetic activation wild type mice without viral injection were treated with CNO and saline either in light cycles or dark cycles Sleep recording started at least 1 h before saline injection and lasted 24 h after CNO injection EEG and EMG in the time window (0–12 h after CNO or saline injection) were used for data analysis mice were habituated and tested with photostimulation in a behavioral chamber for overnight (pre-test) the selective AMPA receptor antagonist NBQX (5 mg/ml in 0.9% NaCl Tocris Bioscience) was bilaterally infused into the POA using two 1 µl microsyringes (Hamilton) and two internal cannulas (P1 Technologies) inserted into the double guide cannula that implanted above the POA The infusion rate was approximately 0.04 µl/min controlled by a syringe pump (Harvard Apparatus) mice were moved back to the chamber for further optogenetic experiments The first laser stimulation started 30 min after drug infusion A total of 6–8 trials in the first 4 h was used for data analysis The voxel size of both sample data and reference template were scaled to 6.5 μm and structure labeling were performed in Imaris (version 9.6 Tissue sections were incubated with guinea pig c-Fos antibody (1:1000 Fluorescently tagged secondary antibodies (Alexa-488 donkey anti-guinea pig cat#706-545-148) were used to visualize Fos expression All sections were imaged using a Zeiss 810 confocal microscope Cell counting (brain sections from AP-6.5 mm to AP-7.2 mm) was performed manually in ImageJ In optogenetic stimulation experiments (Supplementary Fig. 14) Vglut2-Cre mice were injected with AAV-DIO-ChR2-eYFP unilaterally in the VLM Mice were kept in the recording chamber for additional 40 minutes after stimulation then perfused for c-Fos staining as described above The injection site and other sleep/wake related brain regions were examined for c-Fos expression and fresh frozen brains were sectioned at 20 μm thickness using a cryostat FISH was performed using RNAscope Multiplex Fluorescent Assay V2 (Advanced Cell Diagnostics) Reagents: Fos in situ hybridization probe: cat# 316921 Slc17a6 in situ hybridization probe: cat# 319171 Slc32a1 in situ hybridization probe: cat# 319191 Tyrosine hydroxylase (TH) in situ hybridization probe: cat# 317621 (Advanced Cell Diagnostics) Images were acquired using a Zeiss 810 confocal microscope Viral expression and placement of optical implants were verified at the termination of the experiments using DAPI counterstaining of 100 μm coronal sections (Prolong Gold Antifade Mountant with DAPI Cell numbers were counted manually in ImageJ mice were quickly decapitated under isoflurane sedation Brains were placed in artificial cerebral spinal fluid (aCSF) Coronal slices (300 µm) containing the POA were cut on a vibratome (Leica VT1200) in sucrose cutting solution containing 2.5 mM KCl Slices were then transferred to aCSF containing 126 mM NaCl and 10 mM d-glucose bubbled with 95% O2 and 5% CO2 Slices were incubated at 34 ± 1 °C for 30 min before resting at room temperature prior to the experiment Regular pipette intracellular solution contained 127 mM potassium gluconate and 8.1 mM biocytin adjusted to pH 7.3–7.4 with KOH Inhibitory GABAergic cells in the POA were located using the presence of mRuby fluorescence Cells were targeted approximately 20–100 µm from the slice surface Patch-clamp Scientifica MicroStar micromanipulators were controlled using LinLab2 software (Scientifica) Recordings were performed in juxtacellular or whole-cell mode with MultiClamp 700B amplifiers (Molecular Devices) in the current clamp or voltage clamp mode at 34 ± 1 °C bath temperature Data acquisition was performed through an Axon Digidata 1550B (Molecular Devices) connected to a PC running pClamp 11 (Molecular Devices) Recordings were sampled at 10 kHz and filtered with a 2-kHz Bessel filter Patch pipettes were pulled with a Flaming/Brown micropipette puller P-80PC (Sutter Instruments) and had an initial resistance of 3–8 MΩ Series resistance was automatically compensated at 15 MΩ The membrane potential values given were not corrected for the liquid junction potential which was approximately −16 mV Cells were stimulated with blue LED light through a 40× water-immersion objective using pE-300ultra (CoolLED Limited) at approximately ~18.8 mW Stimulation protocols comprised of 10 sweeps of paired pulses at 2 and 60 Hz delivered with a light on time of 1 ms 6-cyano-7-nitro-quinoxaline-2,3-dione (CNQX; 10 μM) and DL-2-Amino-5-phosphonopentanoic acid (DL-AP5; 10 μM) was bath applied in some recordings Unitary excitatory post-synaptic potentials (EPSPs) and post-synaptic currents (EPSCs) were analyzed using custom Matlab scripts EPSPs or EPSCs were considered if the absolute value is >2 times of the standard deviation of the baseline Baseline was calculated as the mean of 10 ms prior to the stimulation or pre-synaptic action potential Amplitudes were found at the maximum or minimum point within a 1.5–18 ms time window after the stimulation onset Lower- or upper-bounds of detection windows were adjusted when necessary The rise time was determined as the time interval encompassing 20–80% of the amplitude Latencies were determined by calculating the onset time of the PSP or PSC and subtracting the stimulation onset This onset time represented the intersection of the line at baseline and the line through the 20% and 80% amplitude points No statistical methods were used to predetermine sample size and investigators were not blinded to group allocation No method of randomization was used to determine how animals were allocated to experimental groups Mice in which post hoc histological examination showed viral targeting or fiber implantation was in the wrong location were excluded from analysis and Mann–Whitney U-test were used and indicated in the respective Figure legends Values are tested against normal distributions using the Kolmogorov–Smirnov test with statistical significance set at p < 0.05 Further information on research design is available in the Nature Research Reporting Summary linked to this article All other raw data supporting the findings of this study are available from the corresponding author upon request. Data will be delivered within 2–4 weeks once requested. Source data are provided with this paper Custom scripts for calcium imaging (https://doi.org/10.5281/zenodo.6870710), EEG/EMG (https://doi.org/10.5281/zenodo.6870666), and behavioral analysis (https://doi.org/10.5281/zenodo.6870689) have been deposited in Zenodo and cited in the references Circuit-based interrogation of sleep control The sleep switch: hypothalamic control of sleep and wakefulness Brain stem reticular formation and activation of the EEG The hypocretins: hypothalamus-specific peptides with neuroexcitatory activity Orexins and orexin receptors: a family of hypothalamic neuropeptides and G protein-coupled receptors that regulate feeding behavior Activation of ventrolateral preoptic neurons during sleep Neuronal activity in the preoptic hypothalamus during sleep deprivation and recovery sleep Effect of NMDA lesion of the medial preoptic neurons on sleep and other functions Effect of lesions of the ventrolateral preoptic nucleus on NREM and REM sleep Galanin neurons in the ventrolateral preoptic area promote sleep and heat loss in mice The GABAergic parafacial zone is a medullary slow wave sleep-promoting center Identification and characterization of a sleep-active cell group in the rostral medullary brainstem Xu, M. et al. Basal forebrain circuit for sleep-wake control. Nat. Neurosci. https://doi.org/10.1038/nn.4143 (2015) Identification of preoptic sleep neurons using retrograde labelling and gene profiling Identification of a population of sleep-active cerebral cortex neurons A role for cortical nNOS/NK1 neurons in coupling homeostatic sleep drive to EEG slow wave activity Zhang, Z. et al. An excitatory circuit in the perioculomotor midbrain for non-REM sleep control. Cell. https://doi.org/10.1016/j.cell.2019.03.041 (2019) Control of non-REM sleep by midbrain neurotensinergic neurons Sleep regulation by neurotensinergic neurons in a thalamo-amygdala circuit Selective activation of the extended ventrolateral preoptic nucleus during rapid eye movement sleep Sleep-waking discharge patterns of ventrolateral preoptic/anterior hypothalamic neurons in rats Counterpointing the functional role of the forebrain and of the brainstem in the control of the sleep-waking system A hypothalamic switch for REM and non-REM sleep Miniaturized integration of a fluorescence microscope Hindbrain double-negative feedback mediates palatability-guided food and water consumption Locomotor speed control circuits in the caudal brainstem Advanced CUBIC protocols for whole-brain and whole-body clearing and imaging Afferents to the ventrolateral preoptic nucleus Innervation of histaminergic tuberomammillary neurons by GABAergic and galaninergic neurons in the ventrolateral preoptic nucleus of the rat Monosynaptic circuit tracing with glycoprotein-deleted rabies viruses Rabies virus CVS-N2c(DeltaG) strain enhances retrograde synaptic transfer and neuronal viability A viral strategy for targeting and manipulating interneurons across vertebrate species Lhx6-positive GABA-releasing neurons of the zona incerta promote sleep Neural correlates of variations in event processing during learning in central nucleus of amygdala The coding of valence and identity in the mammalian taste system Medullary circuitry regulating rapid eye movement sleep and motor atonia Ventral medullary control of rapid eye movement sleep and atonia Control of REM sleep by ventral medulla GABAergic neurons Peng, Y. EEG analysis tools (version 2022). Zenodo. https://doi.org/10.5281/zenodo.6870666 (2022) Natural neural projection dynamics underlying social behavior Peng, Y. Video tracking and optogenetic control (3.18). Zenodo. https://doi.org/10.5281/zenodo.6870689 (2022) Peng, Y. Calcium imaging analysis tools. Zenodo. https://doi.org/10.5281/zenodo.6870710 (2022) Automated analysis of cellular signals from large-scale calcium imaging data subcortical and deep brain neural circuit dynamics during naturalistic mammalian behavior with head-mounted microscopes and chronically implanted lenses Fast online deconvolution of calcium imaging data Whole-brain imaging with single-cell resolution using chemical cocktails and computational analysis elastix: a toolbox for intensity-based medical image registration Fast parallel image registration on CPU and GPU for diagnostic classification of Alzheimer’s disease Sweet and bitter taste in the brain of awake behaving animals Download references We thank Charles Zuker at Columbia University for his support in the early stage of the study for his help with microendoscopic imaging experiments We thank Xiaoke Chen at Stanford University for the gift of the retrograde virus We acknowledge the Cellular Imaging Core at the Columbia Zukerman Institute for access to their facility This work was supported by startup funds from Columbia University to Y.P. Columbia University Precision Medicine Initiative to Y.P and by the Swiss National Science Foundation Postdoctoral Fellowship to J.S Vagelos College of Physicians and Surgeons Department of Biochemistry and Molecular Biophysics performed histology and circuit tracing experiments performed slice recording experiments and analysis performed rabies-based tracing experiments Nature Communications thanks Ramalingam Vetrivelan, Michael Lazarus and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Peer reviewer reports are available Download citation DOI: https://doi.org/10.1038/s41467-022-32461-3 Journal of Comparative Physiology B (2024) Metrics details there is a persistent debate regarding the localization of GABA/glycine neurons responsible for hyperpolarizing somatic motoneurons during paradoxical (or REM) sleep (PS) resulting in the loss of muscle tone during this sleep state Combining complementary neuroanatomical approaches in rats we first show that these inhibitory neurons are localized within the ventromedial medulla (vmM) rather than within the spinal cord We then demonstrate their functional role in PS expression through local injections of adeno-associated virus carrying specific short-hairpin RNA in order to chronically impair inhibitory neurotransmission from vmM rats display PS without atonia associated with abnormal and violent motor activity concomitant with a small reduction of daily PS quantity These symptoms closely mimic human REM sleep behavior disorder (RBD) a prodromal parasomnia of synucleinopathies Our findings demonstrate the crucial role of GABA/glycine inhibitory vmM neurons in muscle atonia during PS and highlight a candidate brain region that can be susceptible to α-synuclein-dependent degeneration in RBD patients disentangling neuronal networks responsible for muscle atonia during PS may help to understand RBD pathogenesis Combining the use of short-hairpin RNAs against vGAT with innovative behavioral analyses we demonstrate that impairment of GABA/glycine vmM neurotransmission in the rat is sufficient to mimic the major symptoms of human RBD we validate a pre-clinical RBD model providing new opportunities for clinical research to improve patient treatment and to study mechanisms responsible for medication-induced RBD GABA/glycine neurons of the ventromedial medulla (vmM) are specifically active during PS rebound a Photomicrographs comparing the distribution in RMg (upper row) GiV (middle row) and 7–8 sp Rexed’s layer of lumbar spinal cord (SC lower row) of GlyT2+ neurons expressing c-Fos in control (PSC first column) and in rats submitted to a PS deprivation (PSD third column) or a protocol of forced locomotion (STEP Neurons expressing c-Fos were colored in brown (nuclear staining arrowheads) whereas GlyT2+ neurons were colored in blue (cytoplasmic staining Notice that the number of double-labeled neurons c-Fos+/GlyT2+ (arrows) in RMg (top line) and GiV (middle line) is higher during PSR compared to the 3 other experimental conditions numerous c-Fos+/GlyT2+ neurons were found quite only in STEP rats n = 4 STEP) illustrating the percentage of c-Fos+ that were also GABA/glycine in nature (c-Fos+/GlyT2+) encountered within the vmM and lumbar SC for each experimental condition d Drawings of sections showing the distribution of single c-Fos+ (black dots) and double-labeled c-Fos+/GlyT2+(red dots) neurons in the same representative PSR rat within the RMg and GiV (c frontal sections) and lumbar SC at T13-L2 levels (d Kruskal–Wallis tests followed by Mann–Whitney U tests *p < 0,05 compared to PSC GiA gigantocellular reticular nucleus (pars alpha) GiV gigantocellular reticular nucleus (pars ventral) SLD pontine sublaterodorsal tegmental nucleus These new functional data suggest that glycine inhibitory neurons that are specifically activated during PS hypersomnia are localized within the vmM the activation of spinal glycine interneurons is likely independent of the vigilance states and related Neurons of the vmM specifically activated during PS send direct projections to the lumbar motoneurons a Drawing illustrating the experimental paradigm with a FG injection in lumbar motoneurons at spinal L1–L2 levels in rats allowed to sleep recover (PSR) after a 72-h deprivation of PS using the flower-pot method (n = 4) b–d Photomicrographs at high magnification of sections at the level of RMg (b) and 7–8 sp Rexed’s layers at lumbar SC (d) double immunostained for c-Fos and FG in a representative PSR rat Neurons expressing c-Fos were colored in black (nuclear staining arrowheads) whereas FG+ neurons were colored in brown(cytoplasmic staining Notice the massive numbers of double-labeled neurons c-Fos+/FG+ (arrows) in RMg and GiV compared to lumbar SC where scattered if any c-Fos+/FG+ cells are seen after PS recovery e Percentage of c-Fos+ neurons in the vmM that are retrogradely labeled after a FG injection in the lumbar SC (PSR n = 4 f Drawings of two frontal medulla sections illustrating the bilateral distribution of single FG+ (violet circles) and double-labeled c-Fos+/FG+ neurons (red dots) in the RMg and GiV in the same PSR rat g Photomicrograph overview of one horizontal lumbar section at the level of 7–8 sp Rexed’s layers showing fibers emanating from transducted GABA/glycine vmM neurons with AAV as immunolabeled for mCherry (black fibers) Notice the very high density of mCherry immunolabeled fibers surrounding the soma of lumbar motoneurons (brown cytoplasmic staining) often in close apposition with them suggesting that vmM neurons have direct synaptic contacts with somatic motoneurons Scale bars: 40 µm in b–d; 50 µm in g overview and 20 µm in enlarged square our data indicate that the vmM contains numerous GABA/glycine neurons that send inhibitory monosynaptic inputs to lumbar motoneurons and that are specifically recruited during PS These neurons likely appear the best candidate for inducing the hyperpolarization of brainstem and spinal motoneurons underlying muscle atonia during PS we inactivated inhibitory vmM neurons by local injections of AAV-shRNA targeting vGAT the vesicular GABA/glycine transporter in freely moving adult rats Verification of the genetic inactivation of endogenous vGAT mRNA and native vGAT protein in GABA/glycine vmM neurons a Scheme of the in vivo experiments: AAV-shRNA injections were made in three points to genetically inactivate GABA/glycine neurons present bilaterally in the GiV and GiA and the midline RMg and to trace anterogradely their efferent projections of transducted neurons until the lumbar spinal cord c Drawings reporting the location and the extent of AAV injection sites at day 30 post-injection for each Ctrl-shRNA (b n = 7) treated rat considered for the physiological study The injection spreading was demarcated by the spontaneous mCherry fluorescence the AAV injections covered the largest part of the vmM and avoided the LPGi laterally and Gi dorsally e Low power photomicrographs of the RMg/GiA (d) and the GiV (e) in a representative control rat showing the high number of transducted neurons after AAV injection i Photomicrographs of adjacent sections treated for vGAT mRNA ISH Notice the high number of strongly labeled neurons in RMg and GiV indicating that the expression of vGAT mRNA is normal g Photomicrographs of vmM sections taken from a representative vGAT-shRNA rat after the ISH labeling of vGAT mRNAs Note the absence of labeled neurons in RMg j Confocal photomicrographs comparing in representative Ctrl-shRNA (left) and vGAT-shRNA (right) rats the expression in lumbar motoneurons pool of the native vGAT protein (green middle panels) in synaptic terminals emanating from transducted vmM neurons (mCherry the vGAT protein is expressed in axons and synaptic terminals (arrows) emanating from vmM neurons in Ctrl-shRNA rats (yellow bottom left panel) but is virtually absent in vGAT-shRNA rats (bottom right panel) Loss of muscle atonia during PS after the genetic inactivation of GABA/glycine vmM neurons b Histogram comparing the daily percentages of W vGAT-shRNA (filled bars) rats at day 30 after AAV injections Notice the significant reduction of the PS episode duration in vGAT-shRNA vs c Normalized mean power spectrum in a control (black) and experimental (red) rats showing no differences in EEG during PS between both groups e Raw polysomnographic recordings during PS of two representative Ctrl-shRNA (d) and vGAT-shRNA rats (e) showing the loss of muscle atonia (arrows) concomitant to a strong increase of phasic twitches on nuchal EMG after the genetic inactivation of GABA/glycine vmM neurons f Dot plots comparing mean EMG values during PS and SWS episodes (bars) in Ctrl-shRNA (open circles) vs Dashed lines connect SWS with PS mean values for each animal Control rats show an expected diminution of mean EMG values during PS compared to preceding SWS (i.e. mean EMG values are comparable during PS and SWS unraveling the loss of atonia during PS PS EMG is significantly increased in vGAT-shRNA rats compared to PS EMG in Ctrl-shRNA congeners g Dot plots represented in decibels showing that PS/SWS ratio of mean EMG values is increased in experimental (filled circles) vs *p < 0,05 compared to Ctrl-shRNA; Wilcoxon signed rank test #p < 0,05 compared to mean EMG values during SWS suggesting that physiological effects are specific to PS These data indicate that a state of PS without atonia was induced in rats after the genetic inactivation of GABA/glycine neurotransmission from vmM neurons RBD-like behaviors are displayed during PS after the genetic inactivation of GABA/glycine vmM neurons b Examples of captured video images of representative Ctrl-shRNA (a) and vGAT-shRNA rats (b) Each red point corresponds to a gray color changed pixel between two successive images (see Materials and Methods sections) The density and location of red points respectively reflect intensity of rat’s movements and body territories where they occurred c Histogram comparing in both rat groups the mean actimetry per second of SWS and PS calculated by counting the number of changed pixels between two successive video images due to animal movements Oneiric movements appear only during PS in vGAT-shRNA rats e Histograms comparing in bot rat groups the mean number of motor events per PS bout (d) and the mean duration of motor events (in seconds f Histogram showing the percentage of PS time with movements in both rat groups Note that all actimetry parameters calculated thanks to video recordings and that directly reflect the movements displayed by rats during PS are significantly higher in vGAT-shRNA vs *p < 0,05; **p < 0,005 compared to Ctrl-shRNA h Activity maps of one representative Ctrl-shRNA (g) and vGAT-shRNA rats (h) illustrating EMG nuchal changes and actimetric phasic events during SWS SWS and PS episodes are sorted vertically from the highest (top blue values) mean muscle tone combined with actimetry events The SWS episodes preceding PS are sorted in the same order as their related PS episodes The x-axis represents the episode duration normalized between 0 and 2π Notice the increase of muscle tone and actimetry motor events during PS in vGAT-shRNA animals and the higher probability of movement occurrence during the last third of PS bouts the loss of muscle atonia during PS after the genetic inactivation of GABA/glycine vmM neurons facilitates the occurrence of abnormal and intense motor enactments in experimental rats vGAT-shRNA rats depicted standard weight increases and normal locomotor activity during waking Abnormal motor events were absent during SWS our data indicate that inhibitory neurons of vmM are essential for muscle atonia during PS since their inactivation favors oneiric-like motor behaviors during a state of PS without atonia Our goal was to confront both hypotheses using complementary anatomical both anterograde and retrograde tract-tracing data convincingly show that GABA/glycine neurons in vmM send projections to lumbar motoneurons and are activated during PS In contrast to spinal interneurons that appear primarily engaged during walking the genetic inactivation of GABA/glycine neurotransmission in vmM neurons is sufficient to disrupt muscle atonia during PS and to elicit abnormal oneiric motor behaviors without any effect during waking and SWS These new data demonstrate that the GABA/glycine pre-motoneurons essential for muscle atonia during PS are located in the vmM rather than the spinal cord they validate a reproducible pre-clinical RBD model in rodents providing a new translational research approach for disease management mostly avoiding the GiV where the largest contingent of inhibitory neurons expressing c-Fos during PS is located These findings de facto eliminate a primary role for spinal inhibitory pre-motoneurons in PS atonia supported also by their expression of c-Fos during forced locomotion but not during PS hypersomnia Determining whether vmM neurons are indeed specifically targeted in human RBD is a challenge of major clinical relevance to understand the etiology of this disorder Our reproducible pre-clinical rat model provides an experimental method to tackle these basic questions and to design alternative pharmacological treatments Charles River Laboratories) were housed individually in Plexiglas barrels (30 cm diameter 40 cm height) under a constant 12-h light/dark cycle and temperature (23 ± 1 °C) Extra Labo) and water were available ad libitum Microiontophoretic ejection of Fluorogold (FG) in lumbar motoneurons: Under anesthesia (Ketamine/Xylazine A hole was drilled in the right L2 apophysis to lower (−2.2 mm) a glass micropipette (7–10 μm external tip diameter) backfilled with 1% FG solution (Sigma-Aldrich) Once connected to a CS4 current generator (Transkinetics) a constant current (+1 μA) was delivered for 15 min These rats (n = 4) were sacrificed after 10 days of recovery four stainless-steel epidural electrodes (Anthogyr) were screwed to the skull over frontal (AP Two gold-coated electrodes were inserted in between neck muscles for a differential EMG recording Electrode leads were finally connected to a miniature plug (Plastics One) and securely fixed to the skull using acrylic Superbond (Sun Medical Co) and dental Paladur cement (Heraeus Kuzler) Rats were sacrificed at day 30 post-surgery The shvGAT sequence used was TCGACGTCAAGAAGTTTCCTA The virus titer was 4.5 × 1012 particles/ml for both AAV-shCtrl-mCherry and AAV-shvGAT-mCherry After recovery from surgery during 5–7 days rats were connected to the acquisition set-up and continuously recorded Unipolar EEG and bipolar EMG signals were amplified (MCP+ Alpha-Omega) and analog-to-digital (sampling rate 520.8 Hz) converted using a 1401 Plus interface (CED) we used digital black/white cameras (GigE PoE 1200 × 900; Elvitec) managed by Streampix 6 (NorPix) Three experimental sleep groups of rats were made: control (PSC n = 4 for tract-tracing and n = 6 for c-Fos/GlyT2 experiments) food and water were available ad libitum and the barrels were cleaned daily To compare the distribution of glycine neurons expressing c-Fos during PS and during locomotion a fourth experimental group was shaped with rats (STEP n = 4) trained to walk during 4 days with a daily incremental duration on a treadmill (Simplex II the rats were sacrificed after 120 min of forced walking Serial free-floating coronal sections (25 μm-thick for the tract-tracing studies and 30 μm-thick for ISH) were made from brainstem and horizontal sections (30-μm-thick) from lumbar cords (T13-L2) Combined c-Fos immunostaining and GlyT2 mRNA ISH: The antisense and sense digoxigenin-labeled probes against mRNA for GlyT2 were synthesized as described above and STEP rats were first revealed for c-Fos immunohistochemistry using DAB-Ni technique they were then treated with GlyT2 probe as above for vGAT ISH Double mCherry/vGAT immunofluorescence: Free-floating lumbar sections were incubated simultaneously with rabbit IgG against vGAT (1:5000; cat #131003 Synaptic Systems) and rat IgG against mCherry (1:50,000) and then in a mixture of secondary antibodies tagged with Alexa Fluor 488 and 594 (1:500; cat #A21206 and A21209 Once mounted on slides coverslipped Fluoromount (Vector Labs) sections were analyzed using a TCS-Sp5X Confocal Fluorescence Microscope (Leica) at a resolution of 1024×1024 pixels/frame with an objective ×63 (0.5 µm image thickness) to eliminate potential posture changes of the animal between SWS and following PS that could induce biased EMG modifications A mean spectrum was generated for each vigilance state with standard frequency ranges of EEG rhythms (δ Activity maps: To visually illustrate the continuous modification of EMG muscle tone and actimetry distribution during SWS and PS for each control and treated rats we classified all SWS and PS episodes in function of their respective mean values (from higher to lower values) high EMG activity) was normalized to the 5th and 99.5th percentile of SWS values The x-axis of activity maps is the episodes duration normalized between 0 and 2π The actimetry motor events are represented by red dots as described before (see “Actimetry”) data extracted from activity maps were used to analyze in vGAT-shRNA rats the distribution of these actimetry motor events along the duration of each PS episode normalized by one-third duration and PS episodes were computed for each animal of both groups and double-labeled c-Fos+/FG+ neurons in coronal brainstem sections taken at 150 μm intervals (from AP −10.1 to −13.3 mm to Bregma) of four PSR rats with a FG injection in lumbar cord We also bilaterally mapped c-Fos+ and c-Fos+/GlyT2+ neurons in brainstem and lumbar sections (every 150 μm) of 19 rats (4 PSC Sections were drawn and labeled cells plotted with an Axioskop microscope (Zeiss) equipped with a motorized X–Y-sensitive stage and a color video camera connected to a image analysis system (Mercator; ExploraNova) Cells of each type (single or double-labeled) were counted for each brainstem area considered and exported using Mercator (ExploraNova) When a structure was present on several sections neurons were counted in Rexed’s layers 10 sp containing motoneurons and 7–8 sp containing interneurons Because of the modest number of animals in each experiment non-parametric statistical tests were used For the comparison of vigilance states and the number of labeled neurons across PSC followed by Mann–Whitney U tests to identify pairwise differences baseline (for c-Fos/FG protocol) was analyzed with a Wilcoxon signed rank test statistical differences in state quantities EMG quantification and actimetry between Ctrl-shRNA and vGAT-shRNA groups were also determined with a Mann–Whitney U test All statistics were performed using StatView software and a significant effect was considered when p < 0.05 We state about our adherence to the ARRIVE guidelines (3Rs) relative to experimental research using animals All experiments were conducted in accordance to the European Community Council Directive for the use of research animals (86/609/EEC Protocols and procedures used were approved by the local Ethical Committee (C2EA-55 Lyon I) and the Ministère de l’Enseignement Supérieur et de la Recherche (DR-2014–37) The authors declare that all relevant experimental data supporting the present study and illustrated in Figures and Supplementary Files are available from the corresponding author upon request Chronic behavioral disorders of human REM sleep: a new category of parasomnia REM sleep behavior disorder: motor manifestations and pathophysiology Markers of neurodegeneration in idiopathic rapid eye movement sleep behaviour disorder and Parkinson’s disease Rapid eye movement sleep behavior disorder: current knowledge and future directions Idiopathic REM sleep behaviour disorder in the development of Parkinson’s disease Rapid eye movement sleep behavior disorder and neurodegenerative disease Evidence that glycine mediates the postsynaptic potentials that inhibit lumbar motoneurons during the atonia of active sleep Intracellular recording of lumbar motoneuron membrane potential during sleep and wakefulness Behavioral state-specific inhibitory postsynaptic potentials impinge on cat lumbar motoneurons during active sleep The postsynaptic inhibitory control of lumbar motoneurons during the atonia of active sleep: effect of strychnine on motoneuron properties Identification of the transmitter and receptor mechanisms responsible for REM sleep paralysis Genetic inactivation of glutamate sublaterodorsal nucleus recapitulates REM sleep behavior disorder A glycinergic projection from the ventromedial lower brainstem to spinal motoneurons An ultrastructural double labeling study in rat [Neuronal activity specific to paradoxical sleep in the bulbar reticular formation in the unrestrained cat] Alternating vigilance states: new insights regarding neuronal networks and mechanisms New aspects in the pathophysiology of rapid eye movement sleep behavior disorder: the potential role of glutamate Brainstem and spinal cord circuitry regulating REM sleep and muscle atonia Arousal effect of caffeine depends on adenosine A2A receptors in the shell of the nucleus accumbens The inhibition of the dorsal paragigantocellular reticular nucleus induces waking and the activation of all adrenergic and noradrenergic neurons: a combined pharmacological and functional neuroanatomical study Localization of the neurons active during paradoxical (REM) sleep and projecting to the locus coeruleus noradrenergic neurons in the rat Cholinergic and noncholinergic brainstem neurons expressing Fos after paradoxical (REM) sleep deprivation and recovery A temporally controlled inhibitory drive coordinates twitch movements during REM sleep Motor control during sleep and wakefulness: clarifying controversies and resolving paradoxes Brainstem glycinergic neurons and their activation during active (rapid eye movement) sleep in the cat Renshaw cells are inactive during motor inhibition elicited by the pontine microinjection of carbachol The lateral hypothalamic area controls paradoxical (REM) sleep by means of descending projections to brainstem GABAergic neurons Origins of the glycinergic inputs to the rat locus coeruleus and dorsal raphe nuclei: a study combining retrograde tracing with glycine immunohistochemistry A brainstem inflammatory lesion causing REM sleep behavior disorder and sleepwalking (parasomnia overlap disorder) Neurodegenerative disease status and post-mortem pathology in idiopathic rapid-eye-movement sleep behaviour disorder: an observational cohort study Insights into REM sleep behavior disorder pathophysiology in brainstem-predominant Lewy body disease Clinicopathologic correlations in 172 cases of rapid eye movement sleep behavior disorder with or without a coexisting neurologic disorder A novel animal model offers deeper insights into REM sleep behaviour disorder The coeruleus/subcoeruleus complex in rapid eye movement sleep behaviour disorders in Parkinson’s disease Idiopathic rapid eye movement sleep behaviour disorder: diagnosis and the need for neuroprotective interventions Stages in the development of Parkinson’s disease-related pathology Differential c-Fos expression in cholinergic and GABAergic cell groups of the pontomesencephalic tegmentum after paradoxical sleep deprivation and recovery Download references Warm thanks to Annabelle Bouchardon and Denis Ressnikoff from CIQLE facility for confocal microscopy Yoan Chérasse for the AAV production and Anne-Laure Morel for ISH experiments Schmidt for providing valuable edition of this manuscript Université Claude Bernard Lyon I and the Agence Nationale de la Recherche (OPTOREM received PhD grants from Ministère de l’Education Supérieure et de la Recherche and Association France Parkinson was supported by grants from Association France Parkinson and Société Francaise de Recherche et Médecine du Sommeil (SFRMS) Neuroscience Research Center of Lyon - CRNL International Institute for Integrative Sleep Medicine collected and analyzed the anatomical data SA helped for the surgery and animal caring designed the iconography and wrote the manuscript Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations Download citation DOI: https://doi.org/10.1038/s41467-017-02761-0 Metrics details Supraspinal brain regions modify nociceptive signals in response to various stressors including stimuli that elevate pain thresholds The medulla oblongata has previously been implicated in this type of pain control but the neurons and molecular circuits involved have remained elusive Here we identify catecholaminergic neurons in the caudal ventrolateral medulla that are activated by noxious stimuli in mice these neurons produce bilateral feed-forward inhibition that attenuates nociceptive responses through a pathway involving the locus coeruleus and norepinephrine in the spinal cord This pathway is sufficient to attenuate injury-induced heat allodynia and is required for counter-stimulus induced analgesia to noxious heat Our findings define a component of the pain modulatory system that regulates nociceptive responses All data are deposited in an open-source database at https://doi.org/10.5061/dryad.kkwh70s82 Descending control of nociception: specificity A neural circuit for the suppression of pain by a competing need state 2-deoxy-d-glucose-induced decrements in operant and reflex pain thresholds Surgery in the rat during electrical analgesia induced by focal brain stimulation Pain reduction by focal electrical stimulation of the brain: an anatomical and behavioral analysis Touch and tactile neuropathic pain sensitivity are set by corticospinal projections The ventrolateral medulla of the rat is connected with the spinal cord dorsal horn by an indirect descending pathway relayed in the A5 noradrenergic cell group Optoactivation of locus ceruleus neurons evokes bidirectional changes in thermal nociception in rats Functional dichotomy in spinal- versus prefrontal-projecting locus coeruleus modules splits descending noradrenergic analgesia from ascending aversion and anxiety in rats Redefining noradrenergic neuromodulation of behavior: impacts of a modular locus coeruleus architecture Viral-genetic tracing of the input–output organization of a central noradrenaline circuit Expression of c-Fos-like protein as a marker for neuronal activity following noxious stimulation in the rat Hindbrain structures involved in pain processing as revealed by the expression of c-Fos and other immediate early gene proteins Characterization of inhibition of the spinal nociceptive tail-flick reflex in the rat from the medullary lateral reticular nucleus Spinal monoaminergic receptors mediate the antinociception produced by glutamate in the medullary lateral reticular nucleus Brainstem areas tonically inhibiting dorsal horn neurones: studies with microinjection of the GABA analogue piperidine-4-sulphonic acid The location of brainstem neurones tonically inhibiting dorsal horn neurones of the cat Descending projections from the caudal medulla oblongata to the superficial or deep dorsal horn of the rat spinal cord Transgenic mice for intersectional targeting of neural sensors and effectors with high specificity and performance AAV-mediated anterograde transsynaptic tagging: mapping corticocollicular input-defined neural pathways for defense behaviors Dorsal horn projection targets of ON and OFF cells in the rostral ventromedial medulla Structure of long-range direct and indirect spinocerebellar pathways as well as local spinal circuits mediating proprioception The spino(trigemino)pontoamygdaloid pathway: electrophysiological evidence for an involvement in pain processes Collateral axonal projections from the A1 noradrenergic cell group to the paraventricular nucleus and bed nucleus of the stria terminalis in the rat Characterization of coeruleospinal inhibition of the nociceptive tail-flick reflex in the rat: mediation by spinal alpha 2-adrenoceptors Noradrenergic innervation of somatosensory thalamus and spinal cord A ventrolateral medulla-midline thalamic circuit for hypoglycemic feeding The subcellular organization of neocortical excitatory connections A6 (locus coeruleus) and A7 noradrenergic cell groups in rats Improved monosynaptic neural circuit tracing using engineered rabies virus glycoproteins Conditional single vector CRISPR/SaCas9 viruses for efficient mutagenesis in the adult mouse nervous system Differential mediation of descending pain facilitation and inhibition by spinal 5HT-3 and 5HT-7 receptors 5-HT7 receptor activation inhibits mechanical hypersensitivity secondary to capsaicin sensitization in mice Diffuse noxious inhibitory controls (DNIC) supraspinal involvement and theoretical implications Effects on dorsal horn convergent neurones in the rat The whole body receptive field of dorsal horn multireceptive neurones Inhibition of spinal nociceptive information by stimulation in midbrain of the cat is blocked by lidocaine microinjected in nucleus raphe magnus and medullary reticular formation A brainstem-spinal cord inhibitory circuit for mechanical pain modulation by GABA and enkephalins Identifying local and descending inputs for primary sensory neurons Samineni, V. K. et al. Divergent modulation of nociception by glutamatergic and GABAergic neuronal subpopulations in the periaqueductal gray. eNeuro https://doi.org/10.1523/ENEURO.0129-16.2017 (2017) Dissociation of the opioid receptor mechanisms that control mechanical and heat pain Distinct subsets of unmyelinated primary sensory fibers mediate behavioral responses to noxious thermal and mechanical stimuli TRPV1-lineage neurons are required for thermal sensation Identification of early RET+ deep dorsal spinal cord interneurons in gating pain Dorsal horn circuits for persistent mechanical pain Dorsal horn parvalbumin neurons are gate-keepers of touch-evoked pain after Nerve Injury Identification of spinal circuits transmitting and gating mechanical pain Diffuse noxious inhibitory controls and nerve injury: restoring an imbalance between descending monoamine inhibitions and facilitations Brainstem modulation of nociceptor-driven withdrawal reflexes Activation and deactivation kinetics of alpha 2A- and alpha 2C-adrenergic receptor-activated G-protein-activated inwardly rectifying K+ channel currents Independent optical excitation of distinct neural populations A novel behavioral assay for measuring cold sensation in mice Sources of off-target expression from recombinase-dependent AAV vectors and mitigation with cross-over insensitive ATG-out vectors Download references Henry for their help in collecting preliminary data This work was supported by the intramural research program of the NIDCR project ZIADE000721-20 (to M.A.H.) and National Institute of Mental Health National Institute of Dental and Craniofacial Research/NIH Unit on the Neurobiology of Affective Memory wrote and edited the paper with input from all authors carried out and analyzed slice physiological experiments All other studies were performed and analyzed by X.G Nature Neuroscience thanks Gregory Scherrer and the other Related to Fig. 2 Heatmap traces from 3 individual animals to tail clip Responses to mild mechanical with brush to hind-paw (B) von Frey filament on plantar surface of hind-paw (C) localized heating (Hargreaves test on plantar surface of hind-paw) (D) only modest increases in intracellular calcium in cVLMTH neurons; n = 6 mice data are represented as mean results (blue) ± SEM (grey) Quantification of the AUC for measurements are shown to the right of each data set and showed that compared to baseline responses GCaMP6s responses were not significantly different whiskers are determined by maximum and minimum Related to Fig. 2A Injection of AAV22-hSyn-DIO -GFP into TH-CreER mice did not alter CNO evoked behavioral responses in Hargreaves tests withdrawal latencies were significantly increased after chemogenetic activation of cVLMTH neurons (CNO administration) compared to saline injected mice (L and R indicate left and right hind-paws respectively) p = 0.0004 for L and p < 0.0001 for R hind-paws; n = 8 female mice There were no significant differences in responses between male and female mice p = 0.63 for L and p = 0.95 for R hind-paws two-sided unpaired t-testdata are presented as mean ± SEM Hargreaves test responses of mice before and after administration of tamoxifen (to induce translocation of CreERT2 and recombination) were not significantly different p = 0.42 for L and p = 0.089 for R hind-paws For both male and female mice withdrawal latencies were significantly decreased after chemogenetic inhibition of cVLMTH neurons (CNO administration) compared to saline injected mice p = 0.041 for L and p = 0.023 for R hind-paws; n = 8 female mice p = 0.0026 for L and p = 0.0033 for R hind-paws Hargreaves test responses of mice before and after administration of tamoxifen The were no significant differences between treatment groups p = 0.30 for L and p = 0.078 for R hind-paws A–F Analysis of behavioral responses in TH-CreER mice injected unilaterally in the cVLM with AAV2-hSyn-DIO-hM3D(Gq)-mCherry and tested in behavioral assays following chemogenetic activation of cVLMTH-neurons (CNO) Number of scratching bouts over 30 minutes to intradermal injection of chloroquine (200 µg) in the nape of the neck was not significantly different between treatment groups (±CNO) n = 8 mice Threshold responses to von Frey filament stimulation was not significantly different between treatment groups (±CNO) n = 8 mice p = 0.095 for L and p = 0.80 for R hind-paws Mechanical pinch responses (Randal Selitto method) were not significantly different between treatment groups (±CNO) n = 8 mice Latencies for withdrawal in plantar reflex responses to cold stimulation were not significantly different between treatment groups (±CNO) n = 8 mice p = 0.11 for L and p = 0.796 for R hind-paws, Motor coordination was not significantly different between treatment groups (±CNO) n = 8 mice Core body temperature measured with a rectal thermal probe was not significantly different between treatment groups (±CNO) n = 5 mice A–F Analysis of behavioral responses in TH-CreER mice injected unilaterally in the cVLM with AAV2-hSyn-DIO-hM4D(Gi)-mCherry and tested in behavioral assays following chemogenetic inhibition of cVLMTH neurons (CNO) Number of scratching bouts over 30 minutes to intradermal injection of chloroquine (200 µg) in the nape of the neck was not significantly different between treatment groups (±CNO) n = 6 mice Threshold responses to von Frey filament stimulation was not significantly different between treatment groups (±CNO) n = 11 mice p = 0.30 for L and p = 0.55 for R hind-paws Mechanical pinch responses (Randal Selitto method) were not significantly different between treatment groups (±CNO) n = 6 mice Latencies for withdrawal in plantar reflex responses to cold stimulation were not significantly different between treatment groups (±CNO) n = 5 mice p = 0.64 for L and p = 0.08 for R hind-paws, Motor coordination was not significantly different between treatment groups (±CNO) n = 5 mice p = 0.28 for light ON and p = 0.13 for R hind-paws Core body temperature measured with a rectal thermal probe was not significantly different between treatment groups (±CNO) n = 6 mice Related to Fig. 3 Representative images of the pattern of fiber projections from TH-Cre mice injected in the cVLM with AAV9-hSyn-DIO-mCherry-2A-SybGFP showing synaptic boutons (green) on projecting axons and TH-staining of LC-neurons (blue) Representative image of a sagittal section of the hindbrain showing cVLMTH neuron projections to the LC Representative images of the pattern of fiber projections of TH-Cre mice injected in the cVLM with AAV2-Syn-DIO-TVA-mCherry Representative image of a coronal section of the midbrain showing cVLMTH neuron projections to the PVT and PVN Section through midbrain showing cVLMTH neuron projections to the BNST Section of the hindbrain showing cVLMTH neuron projections to the PAG Related to Figs. 5–6 Feeding behavior was measured during optogenetic stimulation of VLM terminals in either the LC or in the pPVT Food intake was quantified in well-fed mice prior to during and after light stimulation (30 min The stimulation protocol consisted of 30 mins in which light stimulation alternated between 1 min ‘light ON’ (20 Hz) and 2 min ‘light OFF’ bouts Plot of individual performance on feeding behavior during the pre-test stimulation and post-test for ChR2 (VLM-ChR2) mice Quantification of feeding behavior during VLM-LC and VLM–pPVT stimulation for ChR2 mice Group comparisons: Pre-Test vs Stimulation Hargreaves behavioral responses to optogenetic stimulation of VLM terminals in the PVT of TH-Cre mice injected bilaterally with AAV-FLEX-Chrimson Stimulation did not significantly alter hind-paw withdrawal latency p = 0.42 and p = 0.28 for L and R respectively cVLMTH neurons project collaterally to the PVT and the LC Retrograde tracers were injected into the PVT (CTB magenta) and the LC (Fluoro-Gold (FG) green) Quantification of results from three animals CTB&FG/CTB only + FG only + CTB&FG = 25.6 ± 9.1 mean ± SEM Representative image of the cVLM showing PVT-projecting cVLMTH neurons (TH+CTB+) LC-projecting cVLMTH neurons (TH+FG+) and PVT/LC projecting cVLMTH neurons (TH+CTB+FG+) Glutamate receptors antagonists NBQX and AP5 inhibit cVLMTH-mediated optogenetic responses in the LC but β-adrenergic receptor antagonist Propranolol did not Z-scores were calculated by using the mean and standard deviation of baseline fluorescence before optical stimulation Data are presented as the average intensity peak of jGCaMP7s fluorescence relative to baseline fluorescence Peak intensity of jGCaMP7s fluorescence for ACSF and for ACSF with glutamate receptor antagonists Related to Fig. 7 Experimental paradigm used to examine the influence of spinal cord NA on cVLMTH neuron induced antinociceptive effects Optogenetic activation of cVLMTH neuron fiber terminals in the LC induced increased withdrawal latencies in Hargreaves test which were significantly attenuated by intrathecal administration of yohimbine p = 0.0001 for L and p = 0.017 for R hind-paws respectivelytwo-sided paired t-test Serotonin 5-hydroytryptamine type 3 (5-HT3) receptor antagonist ondansetron (suggested to be responsible for descending facilitation of pain from the RVM) had no effect on CNO-induced pronociception elicited by chemogenetic inhibition of cVLMTH neuron p = 0.49 for L and p = 0.17 for R hind-paws 5-hydroytryptamine type 7 (5-HT7) receptor agonist for the descending inhibition of pain from the RVM) also did not affect CNO-induced pronociception p = 0.59 for L and p = 0.0.20 for R hind-paws,two-sided paired t-test Related to Fig. 8 Representative example of calcium responses of cVLMTH neurons from a single mouse to repeated noxious heat stimulation (on a hot plate; temperature ramps indicated above trace) before and after injection of capsaicin counter-stimulus into the fore paw (indicated with red arrow) A 1-hour rest period was included between naïve and counter-stimulus trials Behavioral responses to heat challenge (heat ramp to 55 °C) on a hot plate before and after injection of capsaicin in the forepaw; latency to first lick (left columns) There was a significant difference between trial groups for first lick (±capsaicin) Averaged in vivo photometry responses of cVLMTH neurons for three trials (averaged) before and after a 1-hour rest period to heat challenges (3 x heat ramp to 55 °C) on a hot plate showed that averaged responses were not altered to repeated noxious thermal insult or by the 1-hour rest period Download citation DOI: https://doi.org/10.1038/s41593-023-01268-w Metrics details thymic tuft cells express the canonical taste transduction pathway and IL-25 they are unique in their spatial association with cornified aggregates ability to present antigens and expression of a broad diversity of taste receptors Some thymic tuft cells pass through an Aire-expressing stage and depend on a known AIRE-binding partner the taste chemosensory protein TRPM5 is required for their thymic function through which they support the development and polarization of thymic invariant natural killer T cells and act to establish a medullary microenvironment that is enriched in the type 2 cytokine These findings indicate that there is a compartmentalized medullary environment in which differentiation of a minor and highly specialized epithelial subset has a non-redundant role in shaping thymic function Generation of diversity in thymic epithelial cells Intestinal tuft cells: epithelial sentinels linking luminal cues to the immune system Lineage tracing and cell ablation identify a post-Aire-expressing thymic epithelial cell population Promiscuous gene expression in thymic epithelial cells is regulated at multiple levels Lymphotoxin signals from positively selected thymocytes regulate the terminal differentiation of medullary thymic epithelial cells TGF-β type II receptor expression in thymic epithelial cells inhibits the development of Hassall’s corpuscles in mice Organization of thymic medullary epithelial heterogeneity: implications for mechanisms of epithelial differentiation The intestinal epithelium tuft cells: specification and function Tuft-cell-derived IL-25 regulates an intestinal ILC2-epithelial response circuit orchestrate parasite type 2 immunity in the gut Intestinal epithelial tuft cells initiate type 2 mucosal immunity to helminth parasites The intestinal tuft cell nanostructure in 3D Cholinergic chemosensory cells in the trachea regulate breathing Bitter triggers acetylcholine release from polymodal urethral chemosensory cells and bladder reflexes Cholinergic epithelial cell with chemosensory traits in murine thymic medulla Cholinergic chemosensory cells of the thymic medulla express the bitter receptor Tas2r131 Murine intestinal cells expressing Trpm5 are mostly brush cells and express markers of neuronal and inflammatory cells Transduction of bitter and sweet taste by gustducin and umami tastes: different receptor cells sharing similar signaling pathways Aire controls the differentiation program of thymic epithelial cells in the medulla for the establishment of self-tolerance a novel autoimmune regulator interaction partner modulates promiscuous gene expression in medullary thymic epithelial cells Tissue-specific distribution of iNKT cells impacts their cytokine response Steady-state production of IL-4 modulates immunity in mouse strains and is determined by lineage diversity of iNKT cells Skn-1a (Pou2f3) specifies taste receptor cell lineage Projection of an immunological self shadow within the thymus by the Aire protein Specific expression of lacZ and cre recombinase in fetal thymic epithelial cells by multiplex gene targeting at the Foxn1 locus A robust and high-throughput Cre reporting and characterization system for the whole mouse brain Full-length RNA-seq from single cells using Smart-seq2 featureCounts: an efficient general purpose program for assigning sequence reads to genomic features Human haematopoietic stem cell lineage commitment is a continuous process Bayesian approach to single-cell differential expression analysis Download references Locksley and Steinmetz laboratories for helpful discussions; K Tetramers were from the NIH Tetramer Core Facility Pou2f3−/− mice were from the DTCC-KOMP2 Consortium from The Canadian Mouse Mutant Repository Biostatistics support was provided by the UCSF Functional Genomics Core This work was supported by NIH grant R01 AI097457 (C.N.M. and M.S.A.); Larry Hillblom Foundation 2017-D-012-FEL (I.P.); NIH Medical Scientist Training Program grant T32 GM007618 to UCSF (I.S.K.); NSF GRFP DGE 1656518 (K.L.W.); NSF GRFP DGE 1656518 (A.R.R.); NIH grant R37 AI039560 (H.W and K.A.H.); Damon Runyon Cancer Research Foundation DRG-2162-13 (J.v.M.); Howard Hughes Medical Institute (J.v.M and R.M.L.); Sandler Asthma Basic Research Center (A.C.F. and R.M.L.); German Cancer Research Center (K.R.); European Research Council grant ERC-2012-AdG (B.K.); NIH grant U01 DK107383 (A.V.P and M.S.A.); NIH grant P01 HG00020527 (L.M.S.); NIH grant R01 AI026918 (R.M.L.); NIH Diabetes Research Center grant P30 DK063720 (A.C.F. and Single Cell Analysis Center); NIH Shared Instrument Grant 1S10OD021822-01 (Single Cell Analysis Center) Rodewald and the other anonymous reviewer(s) for their contribution to the peer review of this work Present address: Pionyr Immunotherapeutics Department of Laboratory Medicine and Pathology Biological Imaging Development Center and Department of Pathology designed and performed experiments and analysed data conceived and designed experiments with C.N.M. performed thymocyte flow cytometry and analysed data provided Flare25 and Trpm5−/− mice and analysed data with R.M.L designed and performed single-cell RNA-seq and analysed data with L.M.S designed and performed F1 experiments and analysed data with K.A.H designed and performed flow cytometry on thymic Hipk2-knockout mTECs and analysed data with B.K designed and performed biostatistical analysis of RNA-seq data and analysed data with D.J.E designed and performed quantitative immunofluorescence image analysis designed and performed human mTEC experiments designed and performed immunofluorescence experiments and analysed data directed the study and wrote the manuscript with C.N.M Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations a, Heat map of Aire and representative Aire-dependent TSAs in pre-, early-, late- and post-Aire populations as defined in Fig. 1a Heat map of differentially expressed genes with a FDR < 0.01 and |fold change| > 8 Columns are organized by unsupervised hierarchical clustering (union of all comparisons) with a dendrogram representing similarity between clustered columns Note that the early- and late-Aire-expressing populations are grouped Representative confocal maximum projections (25 μm) of immunofluorescence staining of thymic slices at low magnification KRT5 (red) and KRT10 (green) (left) and KRT5 (red) and DCLK1 (green) (right) showing medullary localization of KRT10 and DCLK1 Region was selected for presence of multicellular DCLK1bright cell clumps as indicated by white arrows n = 3 mice; images are representative of three independent experiments Stitched confocal maximum projection (77 μm) of immunofluorescence staining of semi-thick (200 μm) thymic slice from a C57BL/6 mouse at low magnification Small rectangles indicate volumes selected for quantitative image analysis from this slice Expanded area of image from a indicated in lower left corner with KRT10 signal converted into surfaces and DLCK1 signal converted to centre of intensity coordinates Pair correlation function (PCF) analysis of 12 identically sized regions of interest (586 × 272 × 77 µm) from three different stitched thymic slices (n = 3 thymic slices) Results are presented as a histogram for a range of distances from KRT10 surfaces and are interpreted as follows: g = 1 indicates a spatial distribution that follows a random Poisson distribution illustrated by a dashed line and grey envelope; g < 1 indicates regularity in the distribution; g > 1 indicates clustering Schematic representation of the PCF analysis The PCF counts the number of objects from a surface at a radial distance (r) and compares this number to the expected number of events for a random Poisson-distributed population at this distance Representative immunohistochemistry of neonatal (21-day-old) human thymus stained for DCLK1 or isotype control Arrows point to individual DCLK1bright cells or clusters Flow cytometry plot from enzymatically digested prenatal human thymus (22.3 gestational weeks) gated on CD45−EPCAM+ TECs showing intracellular DCLK1 or isotype control Note that human DCLK1+ events are approximately 3.5% of prenatal TECs Data are representative of two independent experiments Expression of major MHC-II genes and Cd74 in small-intestinal tuft cells Expression of minor MHC-II genes in thymic tuft cells Expression of Tas2r family members in thymic tuft cells The red line corresponds to a cut-off of 5 reads per million; data for which the mean ± s.d fall above this cut-off are indicated with an asterisk a, Correlation plot of Tas2r genes in single Flare25 tuft cells as analysed in Fig. 2f Colour and circle size represent pairwise correlation value Empirical cumulative distribution function (ECDF) plot of pairwise gene expression correlation of single Flare25 tuft cells Red points represent Tas2r genes that were significantly highly correlated compared to the background gene set (P < 0.05) List of correlated Tas2r gene pairs from b and their corresponding empirical P values Histograms of total read counts (left) or features (right) for each single cell Red represents Flare25 thymic tuft cells and blue represents Flare25;Aire−/− thymic tuft cells Cells with fewer than 100,000 reads or 750 detected features were discarded from further analysis Scatter plot of total features versus mitochondrial read percentage Triangles and circles denote cells from two separate sorts Cells with more than 10% of their reads mapping to mitochondrial genes were discarded from further analysis as indicated by the black line Analysis of thymus from Kn2 BALB/cByJ × AireDTR C57BL/6 F1 mice or AireDTR transgene-negative F1 controls treated for 9 days with diphtheria toxin Immunofluorescence staining of thin thymic sections for KRT10 (red) and DCLK1 (green) Counts of CD11c−CD45−EPCAM+ mTECs and DCLK1+ tuft cells in non-transgenic control thymus (n = 9 mice) or F1 thymus (n = 12 mice) Flow cytometry plots gated on TCRβintCD1d+ iNKT cells showing intracellular PLZF and RORγt staining for iNKT subset analysis NKT2 (PLZF+RORγt−) and NKT17 (PLZF−RORγt+) in non-transgenic control thymus (n = 35 mice) or F1 thymus (n = 23 mice) Flow cytometry plots gated on TCRβ+CD8+ single-positive thymocytes showing intracellular EOMES staining counts of EOMES+ cells in non-transgenic control thymus (n = 20 mice) or F1 thymus (n = 18 mice) Flow cytometry plots gated on splenic TCRβintCD1d+ iNKT cells showing intracellular PLZF and RORγt staining for iNKT subset analysis NKT2 (PLZF+RORγt−) and NKT17 (PLZF−RORγt+) counts of NKT1 and NKT17 in C57BL/6 control (n = 5 mice) or Pou2f3−/− (n = 4 mice) mice Download citation DOI: https://doi.org/10.1038/s41586-018-0345-2 Nature Reviews Gastroenterology & Hepatology (2024) Metrics details neural progenitors are temporally patterned to sequentially generate a variety of neural types In Drosophila neural progenitors called neuroblasts temporal patterning is regulated by cascades of Temporal Transcription Factors (TTFs) known TTFs were mostly identified through candidate approaches and may not be complete many fundamental questions remain concerning the TTF cascade initiation we use single-cell RNA sequencing of Drosophila medulla neuroblasts of all ages to identify a list of previously unknown TTFs and experimentally characterize their roles in temporal patterning and neuronal specification Our study reveals a comprehensive temporal gene network that patterns medulla neuroblasts from start to end the speed of the cascade progression is regulated by Lola transcription factors expressed in all medulla neuroblasts Our comprehensive study of the medulla neuroblast temporal cascade illustrates mechanisms that may be conserved in the temporal patterning of neural progenitors These studies together suggest that TTF-dependent temporal patterning may be a general mechanism a A schematic drawing of the developing Drosophila medulla at the third instar larval stage A neurogenesis wave (pink arrow) spreads from medial (M) to lateral (L) and sequentially converts NE cells into NBs NBs from the youngest to the oldest are aligned on the lateral to medial axis The earliest-born neurons of each NB lineage are located closest to the medulla neuropil The later-born neurons are located at more and more superficial layers b The strategy and workflow of the scRNA-seq of FACS sorted medulla NBs Medulla NBs are uniquely labeled by the combination of SoxNGal4>UAS- RedStinger (red) and E(spl)mγGFP (green) This brain is also stained with Phalloidin (blue) Dissected larval brains were dissociated into single-cell suspension and subjected to FACS sorting to enrich medulla NBs Then 10x V3 Single-Cell libraries were generated using the sorted cells c The sequenced cells were partitioned into 15 clusters using Seurat and visualized on UMAP plots d The estimated cell-cycle phase of each sequenced cell was visualized on UMAP plots e Pseudotime trajectories were generated using Monocle3 with the purple color stands for the earliest pseudotime and yellow color stands for the latest pseudotime f The expression patterns of known TTFs (Hth and Tll) verify the pseudotime trajectories g The expression patterns of newly identified TTFs visualized on UMAP plots h Heatmaps showing the expression levels of three classes of TFs across the pseudotime Temporal TFs include known and newly identified TTFs; NBTFs include Dpn and Lola that are expressed in NBs of all ages; other TFs include four TFs that show a temporal expression profile The expression levels are visualized as a percentage of the maximum observed expression across all cells additional regulators and molecular mechanisms may be involved to achieve the proper regulation of the cascade The Drosophila medulla represents a great system to study temporal patterning using scRNA-seq because at a single time point during development we can obtain a continuous population of NBs of all ages we can use known TTFs to mark the relative neuroblast age and verify the inferred pseudotime trajectory Applying scRNA-seq to Drosophila medulla NBs enables us to capture all temporal stages and to reveal the gradual change of neuroblast transcriptome with single-cell-cycle resolution We report the identification of a list of previously unknown TTFs including SoxNeuro (SoxN) There are extensive cross-regulations among these TTFs and known TTFs that generally follow the rule that earlier TTFs are required to activate later TTFs and later TTFs repress earlier TTFs Our study reveals a comprehensive temporal patterning cascade: Hth+SoxN+dmrt99B->Opa->Ey+Erm->Ey+Opa->Slp+Scro->D->B-H1&2->Tll that controls the sequential generation of different neural types by regulating the expression of specific neuronal transcription factors Gcm instead of Tll is required for both the transition from neurogenesis to gliogenesis and the cell-cycle exit in pursuit of the mechanism behind the regulation of the temporal cascade we find that the timely progression of the TTF temporal cascade requires Lola transcription factors expressed in all NBs After quality control and filtering for NBs our data contained 3074 cells expressing between 261 and 6409 genes with a median of 3682 expressed genes per cell the observed correlation between the pseudotime and cell-cycle phase distribution is likely to be of biological significance: it is possible that the duration of G1 phase relative to other cell-cycle phases is decreasing as NBs age These results suggest that the trends we observed correlate with neuroblast age and are not dependent on the changes in the cell-cycle phase distribution or we are lacking effective reagents (Hbn) we did not include these TFs in further analysis In all images of this and the following figures The large white arrow from left to right indicates the NB age from the youngest to the oldest White dashed lines indicate clone margin unless otherwise noted a–a”’ SoxN protein (red) is expressed before NB formation and in the youngest NBs (marked by Dpn in green) before Ey (blue) and this expression domain is indicated by a white bracket and examples are indicated by small white arrows b’ In SoxNNC14 mutant clones marked by GFP (green) Bsh (magenta) is lost (in 12 out of 12 clones) c–c” In ey-RNAi clones marked by GFP (green) and SoxN (red) expands into older NBs (in 11 out of 11 clones) d–d” Dmrt99B::GFP (green) is expressed before NB formation and in the young NBs (NBs marked by Dpn in red) until early Slp (blue) stage e–e” In Dmrt99B-RNAi clones marked by GFP (green) Bsh (magenta) is lost (in seven out of seven clones) f’ In Dmrt99B-RNAi clones marked by GFP (green) Opa (red) is lost or greatly reduced (16 out of 16 clones) White arrows indicate the two stripes of Opa expression in NBs g A schematic model showing the three NE TTFs and their cross-regulations with NB TTFs SoxN is another TTF that determines the first temporal stage together with Hth neither SoxN nor Hth is required to turn on the expression of later TTFs In summary, SoxN, Dmrt99B, and Hth are three TTFs that are first turned on in the NE and all of them are required for the first temporal fate, but only loss of Dmrt99B prevented the progression of the subsequent temporal cascade (Fig. 2g) it is possible that partial redundancy may exist within these three TTFs a–a” Opa protein (magenta) is expressed in two stripes of NBs (marked by Dpn in green) b−b” The first stripe of Opa (red) is downregulated as Ey (blue) is upregulated while the second stripe of Opa overlaps with the Ey stripe in NBs (marked by Dpn in green) c–c” The second stripe of Opa (red) is downregulated as Slp (blue) is upregulated in NBs (marked by Dpn in green) Opa (red) is lost in the center domain (cOPC and Slp2 (green) are also mostly lost in the same domain (in 11 out of 11 brains) e At a slightly deeper focal plane in a vsxGal4 > opa-RNAi brain where we can see the oldest NBs delayed activation of Slp2 (green) can be observed (in 8 out of 11 brains) f–g’ opa-RNAi is driven by optixGal4 in mOPC indicated by a white bracket (only one side of mOPC is shown in this image) Hth (green) is expanded into older NBs in mOPC (in three out of three brains) Hth expression (green) is expanded into the later-born progeny and Runt (red) expressing neurons are lost (in three out of three brains) h’ In ey-RNAi clones marked by GFP (green) Opa expression (red) is de-repressed in the gap and also expanded into older NBs (in 15 out of 15 clones) i’ In slp mutant clones marked by GFP (green) Opa expression (red) is expanded into older NBs (white arrows) (in eight out of eight clones) j–j”’ Erm::V5 protein (blue) is expressed in two stripes one before the NB (marked by Dpn in green) formation (arrowhead) and the other (white arrow) is between the two Opa stripes (red) k’ In erm1 mutant clones marked by GFP (green) Opa expression (red) is de-repressed in the gap (white arrows) (in 13 out of 13 clones) l’ In opa-RNAi clones marked by GFP (green) Erm::V5 expression (red) is lost in NBs (in nine out of nine clones) m’ In ey-RNAi clones marked by GFP (green) Erm::V5 expression (red) is expanded into older NBs (in 14 out of 14 clones) but the level is lower than that of the wild-type part of the Erm stripe n’ In erm-RNAi clones marked by GFP (green) Kn (magenta) expressing neurons are lost on the dorsal side (in 15 out of 15 clones) but still present on the ventral side (in 13 out of 14 clones) A white dashed line separates the dorsal vs o A schematic showing the regulatory network among early TTFs and the neuron fates generated at each stage p’ In erm-RNAi clones marked by GFP (green) neurons expressing Dfr (red) but not Dac (blue) are lost and the remaining neurons express both Dfr and Dac thus appear purple (in 13 out of 15 clones) q’ In erm1 mutant clones marked by GFP (green) and the remaining neurons expressing both Dfr and Dac thus appear purple (in 11 out of 13 clones) r–r” In opa-RNAi clones marked by GFP (green) neurons expressing both Dfr (red) and Dac (blue) are lost but neurons expressing only Dfr are expanded (in eight out of eight clones) Erm is also required for the production of Kn-expressing neurons in the dorsal medulla but Kn-expressing neurons were still present in the ventral medulla with loss of Erm and a possible reason is that another population of Kn+ neurons not dependent on Erm is generated in the ventral medulla only e’ In scro-RNAi (BDSC 29387) clones marked by GFP (green) Sox102F (red) expressing neurons are not generated (15 out of 17 clones show a complete loss) g–g” The expression of BarH1 (blue) and BarH2::GFP (green) in NBs h’ In D-RNAi clones marked by GFP in green BarH1 expression (red) is lost (in nine out of nine clones) i–i” In BarH1 and BarH2 double RNAi clones marked by GFP (green) and D expression (blue) is expanded (in 15 out of 15 clones) j A schematic showing the regulatory network among late TTFs: Scro and the neuron fates generated at each stage Our scRNA-seq data suggest that these precursors are the medulla NBs at the final stage rather than a separate group of dedicated glial precursors a–a” The expression of Tll (red) and Gcm::GFP (green) in NBs b–b”’ The staining of Gcm-GFP (green) and PH3 (blue) in NBs marked by Dpn (red) The arrow is pointing at an NB of the final stage going through mitosis c–c” In gcm mutant clones (marked by GFP in green) ectopic NBs marked by Dpn (blue) and Tll (red) are present in a deep progeny focal plane along with ectopic Tll+ progeny surrounding the ectopic NBs (in 17 out of 17 clones) d–d”’ In gcm-RNAi clones (marked by GFP in green) more NBs marked by Dpn (blue) and Tll (red) are present along with ectopic Tll+ progeny surrounding the ectopic NBs (in 25 out of 25 clones) e–e”’ In gcm-RNAi clones (marked by GFP in green) the number of Tll (red) and Dac (blue) double-positive cells is increased at a deep progeny focal plane (in 16 out of 16 clones) Dap (magenta) is lost (in nine out of nine clones) Dap (blue) is ectopically activated (in 10 out of 10 clones) h–h”’ In BarH1 and BarH2 double RNAi clones marked by β-Gal (blue) Gcm-GFP (green) is absent (in five out of five clones) i–j’ The expression of Dpn (blue) and Nerfin-1::GFP (green) in a cross-sectional view The rightmost NB is the oldest NB that turns on Nerfin-1 (arrow) j–j’ A zoomed-in image of the outlined region in i The asterisk indicates the center of the medulla neuropil and the white dashed line indicates the position where mng should be aligned mng continuously aligns the medulla neuropil and the migrating mng stream is indicated by a white arrow only scattered mng is observed (in five out of five brains) m At a focal plane slightly deeper than the surface focal plane most NBs marked by Dpn in an eyGal4 control brain are located at the surface of the medulla many ectopic NBs marked by Dpn is present inside the medulla (in five out of five brains) Tll+ (red) progeny (white arrows) are only generated around the surface NBs while no Tll+ cells are observed in the middle of the brain p At a comparably deep progeny focal plane Tll (red) expressing progeny continue to be produced throughout the brain (in six out of six brains) q A schematic showing the regulatory network that are crucial for the final-stage NBs Asterisk for Nerfin-1 indicates that the exact location of Nerfin-1’s action is still not certain Gcm may be the critical regulator that functions in promoting gliogenesis and cell-cycle exit suggesting that Gcm is sufficient to promote gliogenesis and induce Dap expression this set of data support that Gcm is the final TTF required for the switch to gliogenesis and for ending the temporal cascade possibly through activating Dap another possibility for the loss of glia is that the transient expression of Nerfin-1 in newly born glia is required to prevent them from transforming back to NBs Finally, we examined whether Nerfin-1 regulates Gcm expression. With loss of Nefin-1, Gcm-GFP was still expressed in the oldest NBs (Supplementary Fig. 12d–d”’) suggesting that Gcm expression does not depend on Nerfin-1 Gcm and possibly Nerfin-1 act to promote gliogenesis and cell-cycle exit Our scRNA-seq analysis enabled us to identify a fairly complete temporal cascade from start to end How is the speed of the TTF cascade progression regulated and does it involve any other factors that are not TTFs we screened through some TFs that are not expressed in a TTF manner but in all NBs longitudinals lacking (lola) that participates in the temporal cascade regulation a–a” The expression of Dpn (red) and Lola-F (blue) in a cross-sectional view b’ The expression of Lola-T::GFP (green) and Lola-F (blue) in a cross-sectional view c’ The expression of Lola-K::GFP (green) and Ase (blue) marks both NBs and GMCs in a cross-sectional view d–e’ lola RNAi (BDSC35721) is driven by optixGal4 in mOPC indicated by white brackets Hth (green) is expanded into older NBs (d) and later-born progeny (e whereas Runt neurons (red) are mostly lost (e) (in five out of five brains) f–f”’ In lola-RNAi clones (VDRC 101925) marked by GFP (green) the second stripe of Opa (red) is activated in the 5th to 7th NB marked by Dpn (blue) (in 19 out of 19 brains) while its activation happens in the 3rd or 4th NB in wild-type regions Erm-V5 (red) is activated in the 3rd or 4th NB marked by Dpn(blue) (in 16 out of 16 clones) the activation of Ey (red) is observable in the 4th or 5th NB marked by Dpn (blue) (in 19 out of 19 clones) while wild-type Ey expression starts in the 2nd or 3rd NB Slp2 (red) is activated in the 7th to 9th NB marked by Dpn (blue) (in 24 out of 24 clones) j A schematic showing the function of Lola in regulating the temporal cascade Loss of Lola causes slowing down of the temporal progression only seven NBs were shown because later TTFs were not examined these phenotypes may not be solely the result of losing the isoform combination of Lola in NBs since in neurons a different combination of Lola isoforms exists and may also be required for neuron fates the requirement of Lola in TTF cascade progression suggests that genes that are expressed in all NBs could also contribute to the regulation of temporal patterning a A schematic drawing showing the relative expression patterns of the medulla TTFs The expression of Scro is indicated only by its transcriptional pattern Em has a stripe in the transition zone from NE to NB Different isoform compositions of Lola are indicated by different colors The number of NE and NB cells does not indicate the actual number of cell cycles they go through b A schematic model summarizing the regulation networks of the medulla TTF cascade and TTFs identified in this study are in blue Extensive cross-regulations were identified between these TTFs which generally follow the rule that a TTF is required to activate the next TTF (green arrows) and repress the previous TTF (red flat-headed arrows) This TTF cascade controls the sequential generation of different neural types by regulating the expression of neuronal transcription factors and examples of neural types were also indicated Note: not all neural fates generated in a certain stage are shown Lola proteins modulate the speed of temporal progression of the NB TTF cascade Gcm and possibly Nerfin-1 promote gliogenesis and the cell-cycle exit to end the temporal progression Cross-regulations are based on mutant phenotypes and are not necessarily direct regulations Given the essential role of Dmrt99B in initiating temporal patterning in medulla neuroblast it will be interesting to investigate whether its mammalian orthologs play conserved roles in the temporal patterning of cortical progenitors As neural progenitors often switch to produce glia at the end of the lineage it is possibly a general mechanism that factors required for the switch to gliogenesis are also required for the mitotic exit to end the temporal progression The location of those ectopic NBs indicates that they are likely the oldest NBs unable to exit the cell cycle Nerfin-1 may function through a different mechanism in the final-stage NBs which is not dependent on the downregulation of Notch signaling we showed that Nerfin-1 is not required for Gcm expression and it remains to be determined whether Gcm regulates Nerfin-1’s expression in this process we observed complex cross-regulations among TTFs that form temporal gene networks The model for the cross-regulations between medulla TTFs was that each TTF activates the next TTF and inhibits the previous TTF from the Ey stage to the end of the cascade exhibiting a simple combination of feedforward activation and feedback repression based on the experimental evidence we produced as well as inferred from the scRNA-seq data the cross-regulations among TTFs are more complex One TTF is not necessarily repressed by the very next TTF while Dmrt99B is likely to be repressed by Slp or later TTFs The complexity of their cross-regulation is a way to increase the number of combinations of TTFs in aging NBs thereby increasing the number of possible neuron fates determined along with the temporal progression the overall trend that early TTFs activate late TTFs and late TTFs repress early TTFs remains valid Loss of Zbtb20 causes the temporal transitions to be delayed further and further very similar to the loss of lola phenotype in our system it is possible that lola/Zbtb20 play conserved roles in the temporal patterning of neural progenitors the entire life of a medulla neuroblast from the beginning to the end was revealed in this study Our comprehensive study of the medulla neuroblast temporal cascade illustrated mechanisms that may be conserved in the temporal patterning of neural progenitors The single-cell RNA-sequencing data provide a plethora of information that allows further exploration of the mechanisms of temporal patterning to generate the E(spl)mγGFP; SoxNGal4 UAS-RedStinger/TM6B stock SoxNNC14 mutation (BDSC 9938) was recombined onto FRT40A chromosome heat-shocked once at 37 °C for 40 min at 1st instar larval stage and then grown at 25 °C for 3 days before dissection of the wandering 3rd instar larvae heat-shocked once at 37 °C for 1 h at 1st instar larval stage Females of yw, hs-Flp1.22;; FRT80B, eyBAC, Ubi-GFP/TM6B,Tb; eyJ5.71 were crossed to males with genotype hs-Flp1.22;; FRT80B; eyJ5.71/In(4)ciD (ref. 18) heat-shocked once at 37 °C for 1 h at first instar larval stage Clones in larvae that lacked both GFP fluorescence and staining with an anti-Ey antibody were further analyzed virgin females of yw hs-FLP; act>y+>Gal4 UAS GFP/CyO; UAS-DCR2/TM6B were crossed with males of each of the RNAi lines heat-shocked once at 37 °C for 8 min at 1st instar larval stage and transferred to 29 °C for 3 days before dissection of the wandering 3rd instar larvae The progeny were grown at 25 °C until 1st instar larval stage and transferred to 29 °C for 3 days before dissection of the wandering third instar larvae UAS-lines used include UAS-Scro-3XHA (FlyORF Virgin females of yw hs-FLP; act>y+>Gal4 UAS GFP/CyO were crossed with males of each of the UAS lines and transferred to 29 °C for 3 days (UAS-Scro) or 2 days (UAS-Gcm) before dissection of the wandering 3rd instar larvae lola-T::GFP (flybase name: lola.GR-GFP) (BDSC: 38661) lola-K::GFP (flybase name: lola.I-GFP) (BDSC: 38662) 120 third instar larvae of the genotype E(spl)mγGFP; SoxNGal4 UAS-RedStinger/TM6B were washed with PBS twice Each of the brains was dissected on ice in complete Schneider’s culture medium (Schneider’s Insect medium The dissected brains were directly transferred into a glass dish on ice containing Dulbecco’s phosphate-buffered saline (DPBS) and then the supernatant (mainly DPBS) was replaced by 1 mL TrypLE with 1 mg/mL collagenase I and 1 mg/mL papain The brains were then incubated for 10 min at 30 °C After removal of the dissociation solution the brains were carefully washed with complete Schneider’s culture medium once and with DPBS twice The brains were disrupted in 1.4 ml of DPBS with 0.04% bovine serum albumin (BSA) by manual pipetting using a P1000 and then 0.4 ml of DPBS with 0.04% BSA was added to make a total volume of 1.8 mL The cell suspension was filtered through the cell strainer cap into a 5 mL BDFalcon FACS tube FACS sorting was done immediately after on BD FACS ARIA II with gentle settings (85 μm nozzle and low pressure of 20 psi) DAPI was added before sorting to distinguish live/dead cells GFP and RFP double-positive cells were selected and sorted into DPBS with 0.04% BSA For immunohistochemistry of unsorted cells or sorted cells after concentration the cell suspension was placed onto a coated (poly-d-lysine) dish for 30 min After fixation with 4% formaldehyde for 10 min the coverslip was washed four times with PBS The primary antibodies were incubated for 2 h and were washed three times with PBS with Tween 20 (PBST) The secondary antibodies were incubated for 30 min The cells were mounted in mounting medium and imaged on Zeiss confocal Single-cell 3′-cDNA libraries were prepared and sequenced at the DNA Services laboratory of the Roy J Carver Biotechnology Center at the University of Illinois at Urbana-Champaign FACS sorted cells were immediately concentrated by centrifugation at 500 × g for 5 min then an additional 800 × g for 5 min to a 40 μl volume This entire volume was used as input for the 10x library The single-cell suspension was converted into an individually barcoded cDNA library with the Chromium Next GEM Single-Cell 3′ single-index kit version 3 from 10X Genomics (Pleasanton CA) following the manufacturer’s protocols a sequencing library compatible with Illumina chemistry was constructed The final library was quantitated on Qubit and the average size was determined on the AATI Fragment Analyzer (Advanced Analytics The final library was diluted to 5 nM concentration and further quantitated by qPCR on a Bio-Rad CFX Connect Real-Time System (Bio-Rad Laboratories The final library was sequenced on one lane of an Illumina NovaSeq 6000 S1 flowcell (exp1) or a half lane of an Illumina NovaSeq 6000 S4 flowcell Basecalling and demultiplexing of raw data were done with the mkfastq command of the software Cell Ranger 3.1.0 (10x Genomics) Libraries were sequenced to a depth of 2,019,439,522 total reads (1st exp.) and 2,760,057,420 total reads (2nd exp.) corresponding to 6548 cells with a 1821 median UMI counts per cell (1st exp) and 5343 cells with 7508 median UMI counts per cell (2nd exp) These cells that do not express Dpn also do not express mira Although some of them do express SoxN and E(spl)mgamma these are expressed at only very low levels 95% of the dpn- cells show fewer than eight reads of SoxN and 4 reads of E(spl)gamma these cells are not medulla NBs and are excluded from the analysis Cells were also excluded if 10% or more of their reads came from mitochondrial genes 3065 cells were excluded because they had mitochondrial read percentages of 10% or higher the median percentage was 13.78% and the mean was 16.23% This left 777 cells from the first experiment and 2302 cells from the second experiment We also tested setting the mitochondrial read threshold to 20% but this appeared to introduce too much confounding into the analysis: most of the cells with high mitochondrial percentage cluster together by themselves and It is possible that this clustering is driven by confounding factors reflected in the high mitochondrial percentages Data from both experiments were combined into a single analysis A batch correction was performed using the standard integration workflow in Seurat each dataset was first separately normalized and the top 2000 most variable features were identified These features were then used to find integration anchors after which the data were combined using the IntegrateData function five outlier cells with large numbers of counts were removed The remaining 3074 cells were scaled and centered for downstream analysis Gene expression levels were visualized with the FeaturePlot function Differentially expressed genes were identified using the FindAllMarkers function with an FDR cutoff of 0.05 Commercially available antibodies include: sheep anti-GFP (1:500 Rat anti-Histone H3 (phospho S28) antibody (1:500 These antibodies are provided by the Developmental Studies Hybridoma Bank (DSHB): mouse anti-eyeless (1:10) and fixed in 4% formaldehyde for 30 min on ice Brains were washed and then incubated in primary antibody solution overnight at 4 °C washed three times and incubated in secondary antibody solution overnight at 4 °C Images are acquired using a Zeiss Confocal Microscope Figures are assembled using Photoshop and Illustrator at least three brains were imaged for each experiment Three brains are sufficient because wild-type expression patterns are always consistent between different brains For loss of function or gain of function experiments the numbers of animals or clones analyzed are included in each figure’s legends No statistical approach was used to predetermine sample size Samples sizes were determined following standards in the field and our previous experience Clonal experiments have internal controls: we compared gene expression in and outside of the clones in the same sample and only draw conclusions when consistent results are obtained For quantification of mng number in eyGal4 and eyGal4>Nerfin-1 RNAi brains mng marked by Repo were counted on representative focal planes in five brains per genotype and the p value is calculated using a two-sided student’s t test Further information on research design is available in the Nature Research Reporting Summary linked to this article Customized codes used for analyzing the scRNA-seq data are available at Zenodo under https://doi.org/10.5281/zenodo.5813627 [https://zenodo.org/record/5813627#.YdUc4WjMJPZ] Lin, S. & Lee, T. Generating neuronal diversity in the Drosophila central nervous system. Dev. Dyn. https://doi.org/10.1002/dvdy.22739 (2012) Allan, D. W. & Thor, S. Transcriptional selectors, masters, and combinatorial codes: regulatory principles of neural subtype specification. Wiley Interdiscip. Rev. Dev. Biol. https://doi.org/10.1002/wdev.191 (2015) Holguera, I. & Desplan, C. Neuronal specification in space and time. Science https://doi.org/10.1126/science.aas9435 (2018) Sagner, A. & Briscoe, J. Establishing neuronal diversity in the spinal cord: a time and a place. Development https://doi.org/10.1242/dev.182154 (2019) Doe, C. Q. Temporal Patterning in the Drosophila CNS. Annu. Rev. Cell Dev. Biol. https://doi.org/10.1146/annurev-cellbio-111315-125210 (2017) Miyares, R. L. & Lee, T. Temporal control of Drosophila central nervous system development. Curr. Opin. Neurobiol. https://doi.org/10.1016/j.conb.2018.10.016 (2019) Isshiki, T., Pearson, B., Holbrook, S. & Doe, C. Q. Drosophila neuroblasts sequentially express transcription factors which specify the temporal identity of their neuronal progeny. Cell https://doi.org/10.1016/S0092-8674(01)00465-2 (2001) Kambadur, R. et al. Regulation of POU genes by castor and hunchback establishes layered compartments in the Drosophila CNS. Genes Dev. https://doi.org/10.1101/gad.12.2.246 (1998) Brody, T. & Odenwald, W. F. Programmed transformations in neuroblast gene expression during Drosophila CNS lineage development. Dev. Biol. https://doi.org/10.1006/dbio.2000.9829 (2000) Grosskortenhaus, R., Pearson, B. J., Marusich, A. & Doe, C. Q. Regulation of temporal identity transitions in drosophila neuroblasts. Dev. Cell https://doi.org/10.1016/j.devcel.2004.11.019 (2005) Grosskortenhaus, R., Robinson, K. J. & Doe, C. Q. Pdm and Castor specify late-born motor neuron identity in the NB7-1 lineage. Genes Dev. https://doi.org/10.1101/gad.1445306 (2006) Baumgardt, M., Karlsson, D., Terriente, J., Díaz-Benjumea, F. J. & Thor, S. Neuronal subtype specification within a lineage by opposing temporal feed-forward loops. Cell https://doi.org/10.1016/j.cell.2009.10.032 (2009) Maurange, C., Cheng, L. & Gould, A. P. Temporal transcription factors and their targets schedule the end of neural proliferation in Drosophila. Cell https://doi.org/10.1016/j.cell.2008.03.034 (2008) Liu, Z. et al. Opposing intrinsic temporal gradients guide neural stem cell production of varied neuronal fates. Science https://doi.org/10.1126/science.aad1886 (2015) Ren, Q. et al. Stem cell-intrinsic, seven-up-triggered temporal factor gradients diversify intermediate neural progenitors. Curr. Biol. https://doi.org/10.1016/j.cub.2017.03.047 (2017) Syed, M. H., Mark, B. & Doe, C. Q. Steroid hormone induction of temporal gene expression in drosophila brain neuroblasts generates neuronal and glial diversity. Elife https://doi.org/10.7554/eLife.26287 (2017) Pahl, M. C., Doyle, S. E. & Siegrist, S. E. E93 integrates neuroblast intrinsic state with developmental time to terminate mb neurogenesis via autophagy. Curr. Biol. https://doi.org/10.1016/j.cub.2019.01.039 (2019) Temporal patterning of Drosophila medulla neuroblasts controls neural fates Suzuki, T., Kaido, M., Takayama, R. & Sato, M. A temporal mechanism that produces neuronal diversity in the Drosophila visual center. Dev. Biol. https://doi.org/10.1126/science.aad1886 (2013) Bertet, C. et al. Temporal patterning of neuroblasts controls notch-mediated cell survival through regulation of hid or reaper. Cell https://doi.org/10.1016/j.cell.2014.07.045 (2014) Bayraktar, O. A. & Doe, C. Q. Combinatorial temporal patterning in progenitors expands neural diversity. Nature https://doi.org/10.1038/nature12266 (2013) Eroglu, E. et al. SWI/SNF complex prevents lineage reversion and induces temporal patterning in neural stem cells. Cell https://doi.org/10.1016/j.cell.2014.01.053 (2014) Abdusselamoglu, M. D., Eroglu, E., Burkard, T. R. & Knoblich, J. A. The transcription factor odd-paired regulates temporal identity in transit-amplifying neural progenitors via an incoherent feed-forward loop. Elife https://doi.org/10.7554/eLife.46566 (2019) Maurange, C. Temporal patterning in neural progenitors: from Drosophila development to childhood cancers. DMM Dis. Model Mech. https://doi.org/10.1242/dmm.044883 (2020) Oberst, P., Agirman, G. & Jabaudon, D. Principles of progenitor temporal patterning in the developing invertebrate and vertebrate nervous system. Curr. Opin. Neurobiol. https://doi.org/10.1016/j.conb.2019.03.004 (2019) Elliott, J., Jolicoeur, C., Ramamurthy, V. & Cayouette, M. Ikaros confers early temporal competence to mouse retinal progenitor cells. Neuron https://doi.org/10.1016/j.neuron.2008.08.008 (2008) Mattar, P., Ericson, J., Blackshaw, S. & Cayouette, M. A conserved regulatory logic controls temporal identity in mouse neural progenitors. Neuron https://doi.org/10.1016/j.neuron.2014.12.052 (2015) Clark, B. S. et al. Single-cell RNA-seq analysis of retinal development identifies NFI factors as regulating mitotic exit and late-born cell specification. Neuron https://doi.org/10.1016/j.neuron.2019.04.010 (2019) Liu, S. et al. Foxn4 is a temporal identity factor conferring mid/late-early retinal competence and involved in retinal synaptogenesis. Proc. Natl. Acad. Sci. USA https://doi.org/10.1073/pnas.1918628117 (2020) Alsiö, J. M., Tarchini, B., Cayouette, M. & Livesey, F. J. Ikaros promotes early-born neuronal fates in the cerebral cortex. Proc. Natl. Acad. Sci. USA https://doi.org/10.1073/pnas.1215707110 (2013) Naka, H., Nakamura, S., Shimazaki, T. & Okano, H. Requirement for COUP-TFI and II in the temporal specification of neural stem cells in CNS development. Nat. Neurosci. https://doi.org/10.1038/nn.2168 (2008) Pearson, C. A. et al. Foxp1 regulates neural stem cell self-renewal and bias toward deep layer cortical fates. Cell Rep. https://doi.org/10.1016/j.celrep.2020.01.034 (2020) Chen, B., Schaevitz, L. R. & McConnell, S. K. Fezl regulates the differentiation and axon targeting of layer 5 subcortical projection neurons in cerebral cortex. Proc. Natl. Acad. Sci. USA https://doi.org/10.1073/pnas.0508732102 (2005) Chen, B. et al. The Fezf2-Ctip2 genetic pathway regulates the fate choice of subcortical projection neurons in the developing cerebral cortex. Proc. Natl. Acad. Sci. USA https://doi.org/10.1073/pnas.0804918105 (2008) Telley, L. et al. Temporal patterning of apical progenitors and their daughter neurons in the developing neocortex. Science https://doi.org/10.1126/science.aav2522 (2019) Single cell transcriptomics reveals spatial and temporal dynamics of gene expression in the developing mouse spinal cord Sagner, A. et al. Temporal patterning of the central nervous system by a shared transcription factor code. bioRxiv https://doi.org/10.1101/2020.11.10.376491 (2020) Yasugi, T., Umetsu, D., Murakami, S., Sato, M. & Tabata, T. Drosophila optic lobe neuroblasts triggered by a wave of proneural gene expression that is negatively regulated by JAK/STAT. Development https://doi.org/10.1242/dev.019117 (2008) Yasugi, T., Sugie, A., Umetsu, D. & Tabata, T. Coordinated sequential action of EGFR and Notch signaling pathways regulates proneural wave progression in the Drosophila optic lobe. Development https://doi.org/10.1242/dev.048058 (2010) Egger, B., Gold, K. S. & Brand, A. H. Notch regulates the switch from symmetric to asymmetric neural stem cell division in the Drosophila optic lobe. Development https://doi.org/10.1242/dev.051250 (2010) Naidu, V. G. et al. Temporal progression of Drosophila medulla neuroblasts generates the transcription factor combination to control T1 neuron morphogenesis. Dev. Biol. https://doi.org/10.1016/j.ydbio.2020.05.005 (2020) Soustelle, L. & Giangrande, A. Novel gcm-dependent lineages in the postembryonic nervous system of Drosophila melanogaster. Dev. Dyn. https://doi.org/10.1002/dvdy.21232 (2007) Jeong, H. & Tiwari, V. K. Exploring the complexity of cortical development using single-cell transcriptomics. Front. Neurosci. https://doi.org/10.3389/fnins.2018.00031 (2018) Bates, A. S., Janssens, J., Jefferis, G. S. & Aerts, S. Neuronal cell types in the fly: single-cell anatomy meets single-cell genomics. Curr. Opin. Neurobiol. https://doi.org/10.1016/j.conb.2018.12.012 (2019) Konstantinides, N., Degabriel, S. & Desplan, C. Neuro-evo-devo in the single cell sequencing era. Current Opinion in Systems Biology https://doi.org/10.1016/j.coisb.2018.08.001 (2018) Lopes, A., Magrinelli, E. & Telley, L. Emerging roles of single-cell multi-omics in studying developmental temporal patterning. Int. J. Mol. Sci. https://doi.org/10.3390/ijms21207491 (2020) Butler, A., Hoffman, P., Smibert, P., Papalexi, E. & Satija, R. Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nat. Biotechnol. https://doi.org/10.1038/nbt.4096 (2018) McInnes, L., Healy, J. & Melville, J. UMAP: uniform manifold approximation and projection for dimension reduction. arXiv https://arxiv.org/abs/1802.03426 (2018) Kirchner, R. & Barrera, V. Tinyatlas. 18d88dfGitHub (https://github.com/hbc/tinyatlas/blob/master/cell_cycle/Drosophila_melanogaster.csv) (2019) Trapnell, C. et al. The dynamics and regulators of cell fate decisions are revealed by pseudotemporal ordering of single cells. Nat. Biotechnol. https://doi.org/10.1038/nbt.2859 (2014) Qiu, X. et al. Reversed graph embedding resolves complex single-cell trajectories. Nat. Methods https://doi.org/10.1038/nmeth.4402 (2017) Cao, J. et al. The single-cell transcriptional landscape of mammalian organogenesis. Nature https://doi.org/10.1038/s41586-019-0969-x (2019) Intracellular trafficking of Notch orchestrates temporal dynamics of Notch activity in the fly brain Downregulation of Notch mediates the seamless transition of individual Drosophila neuroepithelial progenitors into optic medullar neuroblasts during prolonged G1 Genomic analysis of mouse retinal development Hens, K. et al. Automated protein-DNA interaction screening of Drosophila regulatory elements. Nat. Methods https://doi.org/10.1038/nmeth.1763 (2011) Formation of neuroblasts in the embryonic central nervous system of Drosophila melanogaster is controlled by SoxNeuro Bahrampour, S., Gunnar, E., Jonsson, C., Ekman, H. & Thor, S. Neural lineage progression controlled by a temporal proliferation program. Dev. Cell https://doi.org/10.1016/j.devcel.2017.10.004 (2017) Arefin, B., Parvin, F., Bahrampour, S., Stadler, C. B. & Thor, S. Drosophila Neuroblast Selection Is Gated by Notch, Snail, SoxB, and EMT Gene Interplay. Cell Rep. https://doi.org/10.1016/j.celrep.2019.11.038 (2019) Ferrero, E., Fischer, B. & Russell, S. SoxNeuro orchestrates central nervous system specification and differentiation in Drosophila and is only partially redundant with Dichaete. Genome Biol. https://doi.org/10.1186/gb-2014-15-5-r74 (2014) Lee, T. & Luo, L. Mosaic analysis with a repressible cell marker (MARCM) for Drosophila neural development. Trends Neurosci. https://doi.org/10.1016/S0166-2236(00)01791-4 (2001) Hasegawa, E. et al. Concentric zones, cell migration and neuronal circuits in the Drosophila visual center. Development https://doi.org/10.1242/dev.058370 (2011) The Drosophila mushroom body is a quadruple structure of clonal units each of which contains a virtually identical set of neurones and glial cells Henry, G. L., Davis, F. P., Picard, S. & Eddy, S. R. Cell type-specific genomics of Drosophila neurons. Nucleic Acids Res. https://doi.org/10.1093/nar/gks671 (2012) Fontana, J. R. & Crews, S. T. Transcriptome analysis of Drosophila CNS midline cells reveals diverse peptidergic properties and a role for castor in neuronal differentiation. Dev. Biol. https://doi.org/10.1016/j.ydbio.2012.09.010 (2012) Koromila, T. et al. Odd-paired is a pioneer-like factor that coordinates with zelda to control gene expression in embryos. Elife https://doi.org/10.7554/eLife.59610 (2020) Soluri, I. V., Zumerling, L. M., Parra, O. A. P., Clark, E. G. & Blythe, S. A. Zygotic pioneer factor activity of odd-paired/zic is necessary for late function of the drosophila segmentation network. Elife https://doi.org/10.7554/eLife.53916 (2020) Lee, H., Stultz, B. G. & Hursh, D. A. The Zic family member, odd-paired, regulates the Drosophila BMP, decapentaplegic, during adult head development. Development https://doi.org/10.1242/dev.02807 (2007) Hursh, D. A. & Stultz, B. G. Odd-paired: the drosophila Zic gene. Adv. Exp. Med. Biol. https://doi.org/10.1007/978-981-10-7311-3_3 (2018) Erclik, T. et al. Integration of temporal and spatial patterning generates neural diversity. Nature https://doi.org/10.1038/nature20794 (2017) Weng, M., Golden, K. L. & Lee, C. Y. dFezf/Earmuff maintains the restricted developmental potential of intermediate neural progenitors in Drosophila. Dev. Cell https://doi.org/10.1016/j.devcel.2009.12.007 (2010) Janssens, D. H. et al. Earmuff restricts progenitor cell potential by attenuating the competence to respond to self-renewal factors. Dev. https://doi.org/10.1242/dev.106534 (2014) Koe, C. T. et al. The Brm-HDAC3-Erm repressor complex suppresses dedifferentiation in Drosophila type II neuroblast lineages. Elife https://doi.org/10.7554/eLife.01906 (2014) Rives- Quinto, N. et al. Sequential activation of transcriptional repressors promotes progenitor commitment by silencing stem cell identity genes. Elife https://doi.org/10.7554/elife.56187 (2020) Courgeon, M. & Desplan, C. Coordination between stochastic and deterministic specification in the Drosophila visual system. Science https://doi.org/10.1126/science.aay6727 (2019) Yoo, S. et al. Knock-in mutations of scarecrow, a Drosophila homolog of mammalian Nkx2.1, reveal a novel function required for development of the optic lobe in Drosophila melanogaster. Dev. Biol. https://doi.org/10.1016/j.ydbio.2020.02.008 (2020) Zaffran, S., Das, G. & Frasch, M. The NK-2 homeobox gene scarecrow (scro) is expressed in pharynx, ventral nerve cord and brain of Drosophila embryos. Mech. Dev. https://doi.org/10.1016/S0925-4773(00)00298-7 (2000) Higashijima, S. I. et al. Dual Bar homeo box genes of Drosophila required in two photoreceptor cells, R1 and R6, and primary pigment cells for normal eye development. Genes Dev. https://doi.org/10.1101/gad.6.1.50 (1992) Hayashi, T., Kojima, T. & Saigo, K. Specification of primary pigment cell and outer photoreceptor fates by BarH1 homeobox gene in the developing Drosophila eye. Dev. Biol. https://doi.org/10.1006/dbio.1998.8959 (1998) Hosoya, T., Takizawa, K., Nitta, K. & Hotta, Y. Glial cells missing: a binary switch between neuronal and glial determination in drosophila. Cell https://doi.org/10.1016/0092-8674(95)90281-3 (1995) Jones, B. W., Fetter, R. D., Tear, G. & Goodman, C. S. glial cells missing: a genetic switch that controls glial versus neuronal fate. Cell https://doi.org/10.1016/0092-8674(95)90280-5 (1995) Glide directs glial fate commitment and cell fate switch between neurones and glia Chotard, C., Leung, W. & Salecker, I. glial cells missing and gcm2 cell autonomously regulate both glial and neuronal development in the visual system of Drosophila. Neuron https://doi.org/10.1016/j.neuron.2005.09.019 (2005) Froldi, F. et al. The transcription factor Nerfin-1 prevents reversion of neurons into neural stem cells. Genes Dev. https://doi.org/10.1101/gad.250282.114 (2015) Xu, J. et al. Prevention of medulla neuron dedifferentiation by nerfin-1 requires inhibition of notch activity. Development https://doi.org/10.1242/dev.141341 (2017) The Scalloped and Nerfin-1 transcription factors cooperate to maintain neuronal cell fate Dinges, N., Morin, V., Kreim, N., Southall, T. D. & Roignant, J. Y. Comprehensive characterization of the complex lola locus reveals a novel role in the octopaminergic pathway via tyramine beta-hydroxylase regulation. Cell Rep. https://doi.org/10.1016/j.celrep.2017.11.015 (2017) Southall, T. D., Davidson, C. M., Miller, C., Carr, A. & Brand, A. H. Dedifferentiation of neurons precedes tumor formation in lola mutants. Dev. Cell https://doi.org/10.1016/j.devcel.2014.01.030 (2014) Kumamoto, T. et al. Foxg1 coordinates the switch from nonradially to radially migrating glutamatergic subtypes in the neocortex through spatiotemporal repression. Cell Rep. https://doi.org/10.1016/j.celrep.2013.02.023 (2013) Okamoto, M. et al. Cell-cycle-independent transitions in temporal identity of mammalian neural progenitor cells. Nat. Commun. https://doi.org/10.1038/ncomms11349 (2016) Muralidharan, B. et al. LHX2 interacts with the NuRD complex and regulates cortical neuron subtype determinants Fezf2 and Sox11. J. Neurosci. https://doi.org/10.1523/JNEUROSCI.2836-16.2016 (2017) Chaharbakhshi, E. & Jemc, J. C. Broad-complex, tramtrack, and bric-à-brac (BTB) proteins: Critical regulators of development. Genesis https://doi.org/10.1002/dvg.22964 (2016) Tonchev, A. B., Tuoc, T. C., Rosenthal, E. H., Studer, M. & Stoykova, A. Zbtb20 modulates the sequential generation of neuronal layers in developing cortex. Mol. Brain https://doi.org/10.1186/s13041-016-0242-2 (2016) Pfeiffer, B. D. et al. Tools for neuroanatomy and neurogenetics in Drosophila. Proc. Natl. Acad. Sci. USA https://doi.org/10.1073/pnas.0803697105 (2008) Almeida, M. S. & Bray, S. J. Regulation of post-embryonic neuroblasts by Drosophila Grainyhead. Mech. Dev. https://doi.org/10.1016/j.mod.2005.08.004 (2005) Sato, A. & Tomlinson, A. Dorsal-ventral midline signaling in the developing Drosophila eye. Development https://doi.org/10.1242/dev.02786 (2007) Lin, S., Huang, Y. & Lee, T. Nuclear receptor unfulfilled regulates axonal guidance and cell identity of Drosophila mushroom body neurons. PLoS One https://doi.org/10.1371/journal.pone.0008392 (2009) Cohen, B., McGuffin, M. E., Pfeifle, C., Segal, D. & Cohen, S. M. apterous, A gene required for imaginal disc development in Drosophila encodes a member of the LIM family of developmental regulatory proteins. Genes Dev. https://doi.org/10.1101/gad.6.5.715 (1992) Lun, A. T. L. et al. EmptyDrops: distinguishing cells from empty droplets in droplet-based single-cell RNA sequencing data. Genome Biol. https://doi.org/10.1186/s13059-019-1662-y (2019) Haghverdi, L., Lun, A. T. L., Morgan, M. D. & Marioni, J. C. Batch effects in single-cell RNA-sequencing data are corrected by matching mutual nearest neighbors. Nat. Biotechnol. https://doi.org/10.1038/nbt.4091 (2018) Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists Ma, Y. et al. Gene regulatory functions of Drosophila Fish-hook, a high mobility group domain Sox protein. Mech. Dev. https://doi.org/10.1016/S0925-4773(98)00050-1 (1998) Jinushi-Nakao, S. et al. Knot/collier and cut control different aspects of dendrite cytoskeleton and synergize to define final arbor shape. Neuron https://doi.org/10.1016/j.neuron.2007.10.031 (2007) Charlton-Perkins, M. et al. Prospero and Pax2 combinatorially control neural cell fate decisions by modulating Ras- and Notch-dependent signaling. Neural Dev. https://doi.org/10.1186/1749-8104-6-20 (2011) Download references We thank the Flow Cytometry Facility and the DNA Services Laboratory and the High-Performance Computing in Biology Group of the Roy J Carver Biotechnology Center at the University of Illinois at Urbana-Champaign for FACS sorting and for construction and sequencing of the 10x V3 Single-Cell libraries and initial analysis of the sequencing data and for providing the corresponding method part for generous gifts of antibodies and fly stocks We thank the Bloomington Drosophila Stock Center and TriP at Harvard Medical School (NIH/NIGMS R01-GM084947) for fly stocks and reagents We would like to thank the NSF-Simons Center for Quantitative Biology at Northwestern University for supporting this project as a Pilot grant and also the National Eye Institute for grant support (Grant 1 R01 EY026965-01A1 to XL) Department of Cell and Developmental Biology University of Illinois at Urbana-Champaign University of Illinois at Urbana–Champaign participated in some experiments and data discussion Nature Communications thanks Makoto Sato and the other anonymous reviewers for their contribution to the peer review of this work Download citation DOI: https://doi.org/10.1038/s41467-022-28915-3 Metrics details elicit organism-wide counter-regulatory responses whose purpose is to restore glucose homeostasis while catecholamine neurons of the ventrolateral medulla (VLMCA) are thought to orchestrate these responses the circuit and cellular mechanisms underlying specific counter-regulatory responses are largely unknown optogenetic and behavioral approaches to interrogate the circuit mechanisms by which VLMCA neurons orchestrate glucoprivation-induced food seeking behavior we found that VLMCA neurons form functional connections with nucleus accumbens (NAc)-projecting neurons of the posterior portion of the paraventricular nucleus of the thalamus (pPVT) optogenetic manipulations revealed that while activation of VLMCA projections to the pPVT was sufficient to elicit robust feeding behavior in well fed mice inhibition of VLMCA–pPVT communication significantly impaired glucoprivation-induced feeding while leaving other major counterregulatory responses intact Collectively our findings identify the VLMCA–pPVT–NAc pathway as a previously-neglected node selectively controlling glucoprivation-induced food seeking by identifying the ventrolateral medulla as a direct source of metabolic information to the midline thalamus our results support a growing body of literature on the role of the PVT in homeostatic regulation the precise downstream neural circuits controlling these responses and in particular glucoprivation-induced feeding a Schematic of virus injections strategy used to examine putative forebrain areas that had robust axonal inputs of VLMCA neurons and that project to the NAc b Representative images of a sagittal brain slice showing the distribution of VLMCA projections NAc-projecting neurons (Retro-tdTomato) and TH immunoreactivity (anti-TH) across various forebrain regions c Representative images showing magnifications of the areas depicted in b White arrows depict regions of dense Syp-GFP expression a Schematic of ChR2-expressing and control viral vector injections as well as optical fiber implantation for optogenetic activation VLMCA fibers in the pPVT b Representative image of ChR2 expression in the VLM of TH-IRES-Cre mice and ChR2-labeled terminals in the pPVT c Schematic of the experimental design and the stimulation protocol used to measure feeding behavior during optogenetic stimulation of VLM terminals in the pPVT The stimulation protocol consisted of 30 min in which light stimulation alternated between 1 min “light ON” (20 Hz) and 2 min “light OFF” bouts d Plot of individual performance on feeding behavior during the pre-test e Quantification of feeding behavior during VLMCA–pPVT stimulation for ChR2 mice f Plot of individual performance on feeding behavior during the pre-test g Quantification of feeding behavior during VLMCA–pPVT stimulation for control mice whiskers are determined by 5th and 95th percentiles our findings suggest that VLMCA projections to the pPVT drive robust feeding behavior in mice a Schematic of the viral vector strategy and optical fiber placement used for selectively expressing GCaMP6s in NAc-projecting neurons of the pPVT and red-shifted channelrhodopsin-2 (ChrimsonR-tdTomato) in catecholaminergic neurons of the VLM of TH-IRES-Cre mice b Representative images from a TH-IRES-Cre mouse expressing ChrimsonR-tdTomato in the VLM c Representative images of the pPVT showing axonal projections from the VLM (ChrimsonR-tdTomato; left) GCaMP6s expression in pPVT–NAc neurons (middle) and overlay image showing colocalization between the projections from ChrimsonR-expressing VLM neurons and GCaMP6s-expressing pPVT–NAc neurons (right) d Average GCaMP6s responses from pPVT–NAc neurons in ChrimsonR-expressing (purple) and tdTomato-expressing (black) animals subjected to light stimulation e Quantification of food intake during VLMCA–pPVT stimulation for both ChrimsonR and tdTomato showing increases in feeding after stimulation in well-fed ChrimsonR expressing mice f Heatmap showing individual trial GCaMP6s responses to light stimulation (561 nm at 20 Hz) from both ChrimsonR-expressing and tdTomato-expressing (control) mice g Left: Quantification of light-evoked changes in GCaMP6s fluorescence in pPVT–NAc neurons from mice expressing ChrimsonR in VLMCA neurons Right: Quantification of light-evoked changes in GCaMP6s fluorescence in pPVT–NAc neurons from mice expressing tdTomato in VLMCA neurons these findings demonstrate that activation of the VLMCA–pPVT pathway is associated with increases in pPVT neuronal activity and a robust feeding phenotype these results lend further support to the idea that VLMCA projections excite pPVT–NAc neurons a Schematic of the viral vector strategy and optical fiber placement used for selectively expressing GCaMP6s in NAc-projecting neurons of the pPVT mice awaited in the trigger zone for an auditory cue (8 KHz Mice then ran to the reward zone to retrieve a liquid food reward c Heatmap of GCaMP6s responses from pPVT–NAc neurons during performance of individual trials of the foraging task GCaMP6s responses were time-locked to cue onset and trials were sorted by latency to complete a trial Yellow dots represent first nose-poke into the food-port d Average GCaMP6s responses from pPVT–NAc neurons during the foraging task Gray bar indicates the delivery of auditory cue during trial initiation Trial inclusion criteria was set to trials performed under 10 s noted by the red dotted line e Quantification of the changes in GCaMP6s fluorescence in pPVT–NAc neurons during the onset of trial performance in the foraging task f Heatmap of GCaMP6s responses from pPVT–NAc neurons during feeding bouts in the foraging task GCaMP6s responses were time-locked to first nose-poke into the food-port g Average GCaMP6s responses from pPVT–NAc neurons during feeding bouts in the foraging task Gray line signals first nose-poke into the food-port h Quantification of the changes in GCaMP6s fluorescence in pPVT–NAc neurons during the onset of feeding in the foraging task a Representative trace showing the effect of light stimulation (blue lines) on GCaMP6s fluorescence of pPVT–NAc neurons (black line) Notice that initiation of food intake (red lines) was immediately followed by decreases in the fluorescence of the GCaMP6s signal (depicted with black arrowheads) b Average GCaMP6s response from pPVT–NAc neurons following the onset of a feeding bout (illustrated by the black arrow) c Heatmap of individual trials GCaMP6s responses to the initiation of feeding bouts from ChrimsonR-expressing mice d Quantification of feeding bouts onset changes in GCaMP6s fluorescence in pPVT–NAc neurons a Schematic of the stereotaxic injections for selective expression of halorhodopsin (eNpHR) and control viral vectors in VLMCA neurons using of TH-IRES-Cre mice as well as optical fiber implantation for optogenetic inhibition of VLMCA projections to the pPVT b Representative image of eNpHR-mCherry expression in the VLM (left) of TH-IRES-Cre mice and eNpHR-mCherry terminals in the pPVT (right) c Quantification of food intake 2 h after 2DG administration TH-IRES-Cre mice expressing eNpHR or control virus were injected with 2DG and immediately subjected to photoinhibition of VLMCA–pPVT terminals for the first hour of the 2 hr test (light on) VLMCA–pPVT inhibition suppressed 2DG induced increases in feeding behavior d Quantification of blood glucose levels after 2DG administration in TH-IRES-Cre mice expressing either eNpHR or a control virus in VLMCA neurons VLMCA–pPVT inhibition had no effect on 2DG-mediated adrenal medullary hyperglycemia e Quantification of blood CORT levels after 2DG administration in TH-IRES-Cre mice expressing either eNpHR or a control virus in VLMCA neurons VLMCA–pPVT inhibition had no effect on 2DG increases in corticosterone secretion f Quantification of food intake for 2 h immediately after overnight food restriction TH-IRES-Cre mice expressing either eNpHR or a control virus were food restricted overnight and then immediately given access to food while subjected to photoinhibition of VLMCA–pPVT synapses VLMCA–pPVT inhibition had no effect on feeding behavior after overnight food restriction Whereas the biologically relevant circumstances that lead to direct recruitment of the PVT by this mechanism are not fully understood our study expands the role of the PVT in metabolic regulation metabolic information can be directly communicated to it by hindbrain catecholaminergic cells in addition to the intrinsic glucose-sensing mechanisms of PVT neurons the existence of parallel hypothalamus–PVT and VLMCA–pPVT circuits may constitute fail-safe mechanisms that ensure appropriate adaptation to metabolic status Future studies should aim define the precise circuit and cellular mechanisms by which the pPVT–NAc pathway coordinates reward-related behaviors All procedures were approved by the National Institute of Mental Health Animal Care and Use Committees performed following the Guide for the Care and Use of Laboratory Animals TH-IRES-Cre mice (European Mouse Mutant Archive; stock number: EM:00254; backcrossed five generations with C57Bl/6NJ mice) and C57BL/6NJ strain mice (The Jackson Laboratory) were used in this study Mice were housed under a 12-h light–dark cycle (6 a.m light) at temperature of 70–74 °F and 40–65% humidity Animals were randomly allocated to the different experimental conditions reported in this study AAV2/5-Ef1a-DIO hChR2(E123T/T159C)-EYFP and AAV9-hSyn-FLEX-GCaMP6s-WPRE-SV40 were produced by the Vector Core of the University of Pennsylvania AV9-hSyn-DIO-mCherry-2A-SyneGFP and AAV2-Syn-DIO-GFP were produced by the Vector Core of the University of North Carolina AAV5-Syn-FLEX-ChrimsonR-tdTomato (Addgene plasmid # 62723) and AAV2-hSyn-DIO-hM4Di-mCherry AAV2-hSyn-DIO-hM3D(Gq)-mCherry were produced by Addgene AAV2(retro)-CAG-iCre (Addgene plasmid # 81070) was produced by Vector Biolabs AAV9-EF1a-FLEX-TVA-mCherry (Addgene plasmid # 38044) and AAV9-CAG-FLEX-RG (Addgene plasmid # 38043) were produced by Vigene Biosciences EnvA-SAD-ΔG-eGFP (Addgene plasmid # 32635) was produced by the Viral Vector Core of the Salk Institute for Biological Studies AAV2-retro-CAG-tdTomato-WPRE is a gift from Dr All viral vectors were stored in aliquots at −80°C until use 2-Deoxy-D-glucose (Tocris catalog# 4515) was used at a 500 mg/Kg dose catalog# BML-NS105) was used at a 10 mg/Kg dose when used in combination with the inhibitory DREADDs virus and a dose of 0.75 mg/Kg in combination with the excitatory DREADDs virus Propranolol hydrochloride (Tocris catalog# 0624) at a concentration of 30 µM was used to block beta adrenergic receptors in acute brain slices validated for application (ABE457 and 2250) and specie (2250); and anti-TH (1:1000 Fluorophore-conjugated secondary antibodies (conjugated with goat anti-rabbit Alexa Fluor-488 (A-11008) and goat anti-chicken Alexa Fluor-647 (A-21449)) were purchased from ThermoFisher Scientific and used at a 1:500 dilution Antibodies were diluted in PBS with 10% NGS and PBST For additional information on the validation of the antibodies used All stereotaxic surgeries were conducted as described in our animal study protocol Mice were first anesthetized with a Ketamine/Xylazine solution and an AngleTwo stereotaxic device (Leica Biosystems) was used for viral injections at the following stereotaxic coordinates: pPVT and −3.30 mm vertical from cortical surface (at a 6° angle) NAc and −4.54 mm vertical from cortical surface; VLM and −5.30 mm vertical from cortical surface AAVs were injected at a total volume of 0.1–0.15 μl in the VLM All other AAVs were injected at approximately 1–1.5 μl AAVs were allowed 2–3 weeks for maximal expression Optical fibers with diameters of 200 μm (0.48 NA) and 400 μm (0.66 NA) were used for optogenetics and fiber photometry experiments These fibers were implanted over the pPVT immediately after viral injections (coordinate: –1.60 mm from Bregma and −2.90 mm vertical from cortical surface) and cemented using C&B Metabond Quick Adhesive Cement System (Parkell Inc.) and Jet Brand dental acrylic (Lang Dental Manufacturing Co. Mice received subcutaneous injections with metacam (meloxicam 1–2 mg/kg) for analgesia and anti-inflammatory purposes postoperatively and were allowed to recover on a heating pad where they were constantly monitored To trace monosynaptic inputs onto NAc-projecting neurons of the PVT we used the pseudotyped rabies virus20 to limit monosynaptic rabies tracing to NAc-projecting neurons of the PVT we first injected ~1 µl of the AAV2(retro)-CAG-iCre bilaterally into the NAc of C57BL/6NJ mice a virus mixture containing AAV9-EF1a-FLEX-TVA-mCherry and AAV9-CAG-FLEX-RG at a 1:1 ratio was injected into the pPVT (total volume ~1.5 ul) to enable expression of the following components in a Cre-dependent manner: a red fluorescent reporter termed TVA; and the rabies envelope glycoprotein (G) Two weeks later mice were injected in the same pPVT location with the pseudotyped rabies virus EnvA-SAD-ΔG-eGFP (1.5 μl) Pseudotyping consisted in replacing the envelope glycoprotein G of the rabies virus with an avian envelope termed EnvA This G-deficient rabies virus can only infect cells that express the TVA receptor thereby conferring genetic specificity to the method complementation of the pseudotyped rabies virus with envelope glycoprotein in the TVA-expressing cells as described above allows the generation of infectious particles which in turn can trans-synaptically spread to presynaptic neurons One week after pseduotyped rabies injection brain tissues were collected and subjected to analysis and their brains quickly removed and chilled in ice-cold dissection buffer (110.0 mM choline chloride Coronal sections (300 μm thick) containing the pPVT were cut in dissection buffer using a VT1200S automated vibrating-blade microtome (Leica Biosystems) and were subsequently transferred to incubation chamber containing artificial cerebrospinal fluid (ACSF) (118 mM NaCl slices were transferred to room temperature (20–24 °C) and were constantly perfused with ACSF Whole-cell patch-clamp recordings from pPVT neurons were obtained with Multiclamp 700B amplifiers (Molecular Devices) under visual guidance with an Olympus BX51 microscope with transmitted light illumination Current clamp recordings were made with an internal solution containing: 130 mM K-Gluconate Recorded signals were low-pass filtered at 1 kHz and acquired at a sampling rate of 10 kHz using pCLAMP 10 (Molecular Devices) For patch-clamp recordings of VLMCA-mediated responses in pPVT neurons first ChR2 was expressed in the VLM of TH-Cre mice following the above described methods Optogenetic stimulation was done using an LED illuminator (pE-300 white; CoolLED Ltd.) directly connected to the epifluorescence port of the Olympus BX51 microscope Blue light pulses 1 ms long where delivered at 20 Hz for a duration of 5 s Data from patch-clamp whole-cell recordings were analyzed using Calmpfit (pCLAMP10 suite we used a custom-ordered fiber photometry Mini Cube (Doric Lenses) equipped with three excitation and two emission ports the system is integrated with two continuous sinusoidally modulated LED (DC4100 ThorLabs) at 473 nm (211 Hz) and 405 nm (531 Hz) that served as light source to excite GCaMP6s and an isosbestic autofluorescence signal Optogenetic manipulations were allowed via a third excitation port (555–570 nm) Fluorescence signals were collected by the same fiber implant that was coupled to a 400 μm optical patch-cord (0.48 NA) and focused onto two separate photoreceivers (2151 Newport Corporation) connected to the emission ports of the Mini Cube An RZ5P acquisition system (Tucker-Davis Technologies; TDT) equipped with a real-time signal processor and controlled by a software interface (Synapse version 92) was used to control the LEDs and also to independently demodulate the fluorescence signal due to 473 nm and 405 nm excitation The LED intensity (ranging 10–15 μW) at the interface between the fiber tip and the animal was constant throughout the session All photometry experiments were performed in behavioral chambers (Coulbourn Instruments) and video recorded using video cameras installed above each behavioral chamber TTL pulses recorded by the same system were used to annotate the occurrence of behavioral manipulations a least-squares linear fit to the 405 nm signal to align it to the 470 nm signal was first applied The resulting fitted 405 nm signal was then used to normalize the 473 nm as follows: ΔF/F = (473 nm signal − fitted 405 nm signal)/fitted 405 nm signal changes in fluorescence after stimulation or after feeding were determined by the area under the ΔF/F curve TH-IRES-Cre mice injected with either Cre-dependent ChR2 or Cre-dependent tdTomato (control) in the VLM and an optical fiber placed above the pPVT were behaviorally tested 3 weeks later mice were tethered with an optical patch cord and placed in an open-field box (45 × 45 × 40 cm) where they were given access to 20 mg food pellets for 30 min (Pre-test) mice received light stimulation with a blue laser tuned at 473 nm at a frequency of 20 Hz (10 ms width) for 30 min using a 1 min “ON” 2 min “OFF” protocol The stimulation protocol used was based on preliminary studies showing constant stimulation produced significant decreases in locomotion (described in the main text) mice were given another 30 min with access to food (Post-test) For Th-IRES-Cre mice that expressed ChrimsonR virus in lieu of ChR2 but the stimulation protocol was identical to the one used for ChR2 expressing mice and timing of feeding epochs were quantified using a custom designed feeding experimentation device (FED3) (provided by Alexxai Kravitz) For assessing 2DG-evoked feeding and using halorhodopsin (eNpHR) light stimulation was achieved using a yellow laser (561 nm) delivered in 5 s ‘light ON’ / 5 s ‘light OFF’ intervals for 1 hr This photoinhibition protocol was used to avoid off-target influences of prolonged optogenetic activation (i.e. The power of both the blue and yellow lasers for all experiments was 5–10 mW The foraging track consisted of an elevated long linear chamber (150 × 32 × 25 L × W × H in cm) that was divided into 3 zones: trigger zone The ends of the track were designated as the trigger zone and reward zone This task consisted of 60 min sessions of self-paced trials food restricted (85% FFW) mice were trained to wait in the trigger zone for an auditory cue that signaled reward availability Mice were then required to run from the trigger zone to the reward zone to retrieve a food reward (strawberry Ensure) mice returned to the trigger zone to initiate another trial The movement of the mice was tracked with an overhead camera and by digital distance sensors 15 cm (Pololu Robotics and Electronics) located throughout the track and at the entrance of the reward Video tracking was performed using Ethovision XT 12 (Noldus) software Strawberry Ensure solution was delivered through a liquid dispenser (Med-associates Inc.) localized at the end wall of reward zone Experimental schedule and data acquisition were implemented through the Abet II software for operant control (Lafayette Instruments Neuroscience) and through the Whisker multimedia software (Lafayette Instruments Neuroscience) TH-IRES-Cre mice expressing ChR2 or control virus in the VLM and implanted with an optical fiber in the pPVT were first handled for at least 3 consecutive days Mice were connected to the fiber patch-cord then tested for place aversion using a real-time place aversion paradigm mice were allowed to explore a shuttle box containing two adjacent (50 cm×30 cm) chambers for 10 mins to establish a side preference one side was chosen randomly for optical stimulation such that constant blue light at a frequency of 20 Hz (10 ms width) and a power of 5–10 mW was delivered upon entry of the preferred chamber The cumulative time spent in different areas of the shuttle box during baseline and stimulation was tracked and quantified using ANY-maze (version 5) behavioral tracking software The EZM testing apparatus was made of light-gray plastic and consists of a round path area with 200 cm in circumference The maze divided into four 50 cm areas (two closed areas and two open areas) and was elevated 50 cm above the floor The path was 4 cm wide and open areas had a 0.5 cm lip while close areas had a 10 cm wall enclosure on each section comprised of four 50 cm sections (two opened and two closed) TH-IRES-Cre mice expressing ChR2 in VLM and fiber placed in pPVT and their respective controls were connected to the optical patch-cord and positioned in the intersection of an open and closed arm Mice were allowed to explore the maze freely for 10 min Animals received 20 Hz (10 ms width and 5–10 mW power) photostimulation 1 min “ON” The cumulative time spent in the closed and open arms of the maze during stimulation was tracked and quantified using ANY-maze behavioral tracking software OFT testing was performed in a square enclosure (50 × 50 cm) We connected TH-IRES-Cre mice to fiber optics and allowed them to roam freely for 10 min Mice received photostimulation at a frequency of 20 Hz (10 ms width and 5–10 mW power) The cumulative time spent in different areas of the open field apparatus (corners vs center) during stimulation was tracked Prior to the initiation of the experiments mice were habituated and handled daily for 5 days The day after the last habituation session mice were injected with either saline or 2DG and immediately subjected to optogenetic silencing of the VLMCA–pPVT pathway using eNpHR and a photoinhibition protocol identical as those used for the 2DG experiments (light delivered using 5 s ‘light ON’ / 5 s ‘light OFF’ intervals for 1 hr; 5–10 mW power) One hour after 2DG injection and optogenetic silencing blood samples were collected via a small incision in the tip of the subject’s tail and blood glucose levels were measured using a Care Touch Diabetes Testing Kit additional blood samples were collected into a heparinized SafeCrit plastic tube (Tris Sample Processing) Serum was gathered after and centrifuged using a CritSpin® Micro-Hematocrit Centrifuge for 2 min Corticosterone protein levels from serum were determined using a DetectX® CORTICOSTERONE Enzyme Immunoassay Kit (Arbor Assays) by following manufacturer’s protocol serum was dissociated with dissociation reagent for 10 min at room temperature Standards and samples were added into 96-well microplates and followed by adding DetectX® corticosterone conjugate as well as DetectX® conticosterone antibody wells were washed four times with 300 μl washer buffer A TMB substrate solution was added into the wells for an additional 30-min incubation without shaking and yielded a blue color which turned to yellowish when the Stop Solution was added The optical density of each well was detected using a microplate reader set at 450 nm and the plate reader’s built-in 4PLC software calculated corticosterone concentration for each well All data were analyzed using Origin Pro 2016 (OriginLab Corp) All statistical tests are indicated when used No assumptions or corrections were made prior to data analysis All cell counting experiments and behavioral testing were performed by an experimenter blind to the experimental condition are typically the same or exceed those estimated by power analysis (power = 0.80 For combined optogenetic and fiber photometry experiments For fiber photometry experiment in the reward foraging task For optogenetic experiments used to assess aversive and anxiety-like behavior All experiments were replicated at least once Further information on research design is available in the Nature Research Reporting Summary linked to this article All the data that support the findings presented in this study are available from the corresponding author upon reasonable request. Source data are provided with this paper Glucose counterregulation: prevention and correction of hypoglycemia in humans Hindbrain glucoregulatory mechanisms: critical role of catecholamine neurons in the ventrolateral medulla Hindbrain catecholamine neurons control multiple glucoregulatory responses The forebrain is not essential for sympathoadrenal hyperglycemic response to glucoprivation Immunotoxin lesion of hypothalamically projecting norepinephrine and epinephrine neurons differentially affects circadian and stressor-stimulated corticosterone secretion Selective pharmacogenetic activation of catecholamine subgroups in the ventrolateral medulla elicits key glucoregulatory responses A central catecholaminergic circuit controls blood glucose levels during stress Efferent projections of the A1 catecholamine cell group in the rat: an autoradiographic study C1-3 adrenergic medullary neurones project to the paraventricular thalamic nucleus in the rat Efferent projections of rat rostroventrolateral medulla C1 catecholamine neurons: implications for the central control of cardiovascular regulation Paraventricular thalamus projection neurons integrate cortical and hypothalamic signals for cue-reward processing Meffre, J. et al. Orexin in the posterior paraventricular thalamus mediates hunger-related signals in the nucleus accumbens core. Curr. Biol. https://doi.org/10.1016/j.cub.2019.07.069 (2019) A proposed hypothalamic-thalamic-striatal axis for the integration of energy balance The development and application of optogenetics Orexin in the posterior paraventricular thalamus mediates hunger-related signals in the nucleus accumbens core Placing the paraventricular nucleus of the thalamus within the brain circuits that control behavior Ascending caudal medullary catecholamine pathways drive sickness-induced deficits in exploratory behavior: brain substrates for fatigue Collateralization of projections from the paraventricular nucleus of the thalamus to the nucleus accumbens Glucose-responsive neurons of the paraventricular thalamus control sucrose-seeking behavior Viral-genetic tracing of the input-output organization of a central noradrenaline circuit Evidence for adrenaline neurons in the rat brain noradrenergic (A1 and A2) and adrenergic neurons Rapid binge-like eating and body weight gain driven by zona incerta GABA neuron activation Injections of muscimol into the paraventricular thalamic nucleus redundant circuit organization for homeostatic control of feeding behavior Coordinated reductions in excitatory input to the nucleus accumbens underlie food consumption Calretinin neurons in the midline thalamus modulate starvation-induced arousal Involvement of thalamic paraventricular nucleus in the anticipatory reaction under food restriction in the rat Activation of the central nervous system in obese Zucker rats during food deprivation Weight loss after obesity is associated with increased food motivation and faster weight regain in mice Immunotoxic destruction of distinct catecholamine subgroups produces selective impairment of glucoregulatory responses and neuronal activation NTS catecholamine neurons mediate hypoglycemic hunger via medial hypothalamic feeding pathways D’Agostino, G. et al. Appetite controlled by a cholecystokinin nucleus of the solitary tract to hypothalamus neurocircuit. Elife 5, https://doi.org/10.7554/eLife.12225 (2016) Nucleus of the solitary tract serotonin 5-HT2C receptors modulate food intake Roman, C. W., Derkach, V. A. & Palmiter, R. D. Genetically and functionally defined NTS to PBN brain circuits mediating anorexia. Nat. Commun. 7, https://doi.org/10.1038/ncomms11905 (2016) Brainstem nutrient sensing in the nucleus of the solitary tract inhibits feeding The paraventricular thalamus controls a central amygdala fear circuit A temporal shift in the circuits mediating retrieval of fear memory Thalamic regulation of sucrose seeking during unexpected reward omission A thalamic input to the nucleus accumbens mediates opiate dependence Campus, P. et al. The paraventricular thalamus is a critical mediator of top-down control of cue-motivated behavior in rats. Elife 8, https://doi.org/10.7554/eLife.49041 (2019) Paraventricular thalamus balances danger and reward Choi, E. A., Jean-Richard-Dit-Bressel, P., Clifford, C. W. G. & McNally, G. P. Paraventricular thalamus controls behavior during motivational conflict. J. Neurosci. https://doi.org/10.1523/JNEUROSCI.2480-18.2019 (2019) A basal ganglia circuit for evaluating action outcomes Defining hypoglycaemia: what level has clinical relevance Changes in mood during acute hypoglycemia in healthy participants An exploration of the aversive properties of 2-deoxy-D-glucose in rats and safety profile of 2-deoxy-2-glucose (2DG) in adult rats Contributions of the paraventricular thalamic nucleus in the regulation of stress anatomically and functionally distinct cell types segregate across anteroposterior axis of paraventricular thalamus McGinty, J. F. & Otis, J. M. Heterogeneity in the paraventricular thalamus: the traffic light of motivated behaviors. Front. Behav. Neurosci. 14, https://doi.org/10.3389/fnbeh.2020.590528 (2020) Prefrontal cortex output circuits guide reward seeking through divergent cue encoding Paraventricular thalamus: gateway to feeding Paraventricular thalamic control of food intake and reward: role of glucagon-like peptide-1 receptor signaling The paraventricular thalamus is a critical thalamic area for wakefulness Dynamic salience processing in paraventricular thalamus gates associative learning Lucantonio, F., Su, Z., Chang, A. J., Bari, B. A. & Cohen, J. Y. Punishment history biases corticothalamic responses to motivationally-significant stimuli. https://doi.org/10.1101/2020.04.06.027888 (2020) Threshold doses of 2-deoxy-D-glucose for hyperglycemia and feeding in rats and monkeys Download references Beas for his assistance in the design of a script that facilitated the data analysis of the calcium imaging experiments and the NIMH IRP Rodent Behavioral Core for their help with the affective behavioral tests This work was supported by the NIMH Intramural Research Program (1ZIAMH002950 to B.S.B.) and NIDCR Intramural Research Program (M.H.) National Institute of Dental and Craniofacial Research National Institute of Diabetes and Digestive and Kidney Diseases performed anatomical and immunohistochemical studies and stereotaxic injections for all experiments performed electrophysiological experiments performed all the blood collection for glucose and CORT measurements provided critical reagents and suggestions Peer review information Nature Communications thanks James Otis and the other Download citation DOI: https://doi.org/10.1038/s41467-020-19980-7 Metrics details The thymus’ key function in the immune system is to provide the necessary environment for the development of diverse and self-tolerant T lymphocytes While recent evidence suggests that the thymic stroma is comprised of more functionally distinct subpopulations than previously appreciated the extent of this cellular heterogeneity in the human thymus is not well understood Here we use single-cell RNA sequencing to comprehensively profile the human thymic stroma across multiple stages of life pericytes and endothelial cells are identified as potential key regulators of thymic epithelial cell differentiation and thymocyte migration In-depth analyses of epithelial cells reveal the presence of ionocytes as a medullary population while the expression of tissue-specific antigens is mapped to different subsets of epithelial cells This work thus provides important insight on how the diversity of thymic cells is established and how this heterogeneity contributes to the induction of immune tolerance in humans It is however unknown how these observations translate to human thymic development where evidence of bipotent TEPCs is lacking and knowledge of postnatal tissue regulation is minimal Here we use single-cell RNA sequencing (scRNA-seq) to investigate cellular heterogeneity in the human thymic microenvironment at different time points during development we identify candidate pathways that regulate TEC fate commitment and uncover previously uncharacterized TEC markers we confirm the presence of distinct mTEC subsets (AIRE+ identify ionocytes as a subset of epithelial cells present in the human thymic medulla and provide the first transcriptomic characterization of rare populations of thymic ciliated cells and neuronal cells we analyze the expression of disease-relevant genes in the epithelial compartment in an effort to better understand how immune tolerance is established in the human thymus this work advances our understanding of human TEC development and provides an unbiased resource to study human TEC heterogeneity and its relevance to human autoimmune diseases a Workflow of tissue preparation for single-cell transcriptome profiling of human thymic stromal cells CD45-negative cells were enriched using magnetic-activated cell sorting (MACS) or fluorescence-activated cell sorting (FACS) b Stacked bar graph of cell-type frequencies in each sample c UMAP visualization of thymic stromal cells colored by age group d UMAP visualization of thymic stromal cells colored by cell types e UMAP visualization of the expression of known marker genes used for cell cluster identification f Heatmap showing average expression of soluble factors g Violin plots showing feature gene expression in human fetal thymus (hFT) human postnatal thymus (hPT) or adult thymus h Immunofluorescence analysis of fibronectin (FN) and K15+ immature TECs/mTECs (green) expression in human fetal thymus (hFT) Arrows point to blood vessels with high expression of FN in the cortex (c) and medulla (m) Staining was repeated twice with similar results i UMAP and violin plots showing expression of the activin ligand (INHBA) and inhibitor (FST) in human fetal thymus (hFT) Our analysis thus revealed that human mesenchyme and pericytes likely play complementary roles in supporting thymopoiesis by providing factors critical for TEC development or through expression of chemokines and adhesion molecules that regulate migration of hematopoietic progenitors a UMAP visualization of epithelial cells colored by age group b UMAP visualization of epithelial cells colored by cell types c UMAP visualization of the expression of known marker genes used for cell cluster identification d Heatmap showing the average expression of known marker genes in each epithelial cluster e UMAP visualization of epithelial subsets in fetal f Immunofluorescence staining of AIRE+ (green) K5+ (red) mTEChi cells in postnatal and adult tissues g Thymic tissue from a 13-year-old donor was stained with CD8 (green) and CD4 (red) antibodies to visualize thymocytes together with a wide spectrum cytokeratin antibody to identify epithelial cells (blue) Staining in f and g was repeated twice with many donors with similar results b UMAP visualization of immature TECs colored by cell type (a) or age (b) c Heatmap showing the expression of marker genes in each immature TEC (imm d Dot plot of immature TEC gene expression in human fetal thymus (hFT) e Expression of CDH13 in epithelial subsets was confirmed by immunofluorescence analysis of human fetal thymus and human adult thymus Staining was repeated three times with similar results a Heatmap showing the expression of newly identified marker genes in each epithelial cluster b Violin plots of KRT15 expression in all TECs and in immature TECs c Immunofluorescence analysis of KRT15 expression in postnatal human thymus KRT8 (blue) and KRT5 (green) are also included as markers of TECs Dotted line indicates the separation between cortex (c) and medulla (m) A higher magnification showing that KRT15 is expressed at low levels in KRT8+KRT5+ immature TECs and at higher level in mTECs is shown in the right panels Medullary area is marked with “m” while cortical area is marked with “c” Arrows point to examples of KRT8+KRT5+ immature TECs and KRT5 expression in TECs isolated from adult thymus e Violin plots of ASCL1 expression in mTEC lo and cTEC hi f Immunofluorescence analysis of human fetal thymus demonstrating that ASCL1 (green) is expressed in KRT15hi (red) mTECs ASCL1 expression is also detected in the cortex of fetal thymus (arrows) Dotted line marks the separation between cortex (c) and medulla (m) g Immunofluorescence analysis of postnatal thymus showing that expression of ASCL1 (red) in the thymic medulla partially overlaps with AIRE (green) 20 μm Arrows point to double positive mTECs h Ascl1-lineage trace (RFP) in TECs at 36 h (n = 3 mice) and 5 weeks (n = 3 mice) post-tamoxifen (TAM) treatment Percentage of RFP-labeled Aire+ TECs is shown Expression of RFP in TECs from Cre-negative mice is also presented as negative control (n = 7 mice) and g was repeated at least three times with similar results suggesting activity of ASCL1 rather than expression as part of a promiscuous gene expression program implying that cells that maintain the pool of Aire+ mTEChi are not expressing Ascl1 These data thus suggest that Ascl1+ mTEClo and Ascl1+ mTEChi are likely replenished from a pool of Ascl1-negative cells a Velocity field projected on the UMAP plots of fetal b Dot plot depicting the relative level of expression of Notch signaling ligands c Immunofluorescence staining of human fetal thymus showing expression of HES1 (red) in medullary KRT15+ TECs (green) d–f Dot plots depicting the relative level of expression of selected TNF Superfamily (d) or Toll-like receptor signaling pathway (f) genes confirming that Notch signaling is active in these TECs The Notch inhibitor DLK1 was also detected in cTECs while DLK2 was found in immature TECs implying that Notch signaling is reduced in these cells was considerably higher in neuroendocrine and myoid cells indicating that Notch activity is actively blocked in these epithelial subsets in addition to its critical role in T cell specification the regulation of Notch signaling likely affects cell fate outcomes in the epithelial compartment our analysis thus revealed important information on the process of cell fate commitment in the epithelial compartment and myelin-expressing cells sub-clustering b UMAP visualization of the expression of marker genes used for cell cluster identification c Immunofluorescence analysis of human fetal and postnatal thymus confirming the presence of ionocytes positive for KRT8 (red) and CFTR (green) or TRPM2 (green) and CFTR (red) in the medulla d Immunohistochemistry staining for ionocytes (CFTR) e Immunofluorescence analysis showing co-staining of desmin-expressing myoid cells (green) with a wide spectrum cytokeratin antibody (red) in human fetal thymus f UMAP visualization of SOX2 expression in medullary epithelial cells h Immunofluorescence staining for SOX2 in postnatal and adult thymus confirms expression of this transcription factor in the medulla A subset of SOX2+ cells (green) co-expressed KRT8 (red) (g) or KRT5 (red) and/or KRT10 (blue) (h) h was repeated at least twice with similar results While many genes were similar between thymic and pulmonary ionocytes (251 genes out of 500) the overlap between thymic tuft cells and pulmonary tuft-like cells was less pronounced (85 genes out of 500) many of the genes that were unique to human thymic tuft cells were also found in murine thymic tuft cells (GNAT3 GFI1B as well as the taste receptor genes TAS1R3 suggesting that the cells are more similar to their murine counterpart than tuft-like cells found in the human respiratory tract The observation that SOX2 is found in many cells including most cells forming Hassall’s corpuscles is intriguing since this factor is often a marker of long-lived postnatal progenitor populations suggesting these structures might be more dynamic than previously appreciated a UMAP visualization of the average expression of tissue-specific antigens (TSA score) in medullary epithelial cells b UMAP visualization of the expression of genes that positively correlate with a high TSA score in AIRE+ or corneocyte-like mTECs c UMAP plots showing the expression of antigens eliciting autoantibodies in APS-1 patients d Feature plots of antigens eliciting autoantibodies in type 1 diabetes and myasthenia gravis patients Our in-depth analysis of epithelial populations identified ionocytes as an additional subset of medullary epithelial cells and provided transcriptome information for rare subsets including ciliated and Schwann cells that had only been described in histological analyses It is intriguing that our analysis identified pericytes as the main source of activin A Additional studies will be required to evaluate the role of this understudied population of stromal cells in regulating TEC differentiation our analysis also revealed that myoid cells express high levels of follistatin thus providing insight into why conditions such as myasthenia gravis suggesting that there might be a common precursor that can give rise to both epithelial and myoid cells Our transcriptome data showing a branching point between neuroendocrine and myoid cells as well as co-expression of epithelial and myoid markers by immunofluorescence in fetal tissue support this idea Our work thus provides additional insight on the origin of epithelial subsets found in the human thymus it is possible that this pathway helps establish and maintain quiescence in TEPCs by upregulating HES1 to a level where it constantly suppresses expression of differentiation factors like ASCL1 expression of AChR and TTN in our dataset was much higher in myoid cells compared to AIRE+ mTECs supporting the idea that myoid cells are the main source of muscle antigens in the human thymic medulla Our analysis thus provides additional information on the regulation of disease-relevant TSAs in the human thymus we created reference transcriptome maps for individual stromal cell types across multiple stages of life to better understand how the thymic microenvironment is established and maintained in aging In addition to advancing our knowledge of human thymic development this study provides evidence of greater heterogeneity among medullary TECs than was previously appreciated This work also offers a platform to study the expression of disease-relevant antigens in different thymic subsets thus providing insight on the relevance of this heterogeneity to the induction of immune tolerance and human autoimmune diseases Human fetal thymic tissues were obtained from 19 to 23 gestational-week specimens under the guidelines of the Committee on Human Research (UCSF IRB)-approved protocols from the Department of Obstetrics elective termination of pregnancy with written informed consent for fetal tissue donation to biomedical research Consent for tissue donation was obtained by clinical staff after the decision to pursue termination was reached by patients Personal Health Information and Medical Record Identifiers/access is at no point available to researchers and no such information is associated with tissue samples at any point Pediatric tissues were obtained from patients undergoing corrective cardiothoracic surgery in accordance with protocols approved by the UCSF Human Research Protection Program Institutional Review Board (IRB #17-22928) Written informed consent was obtained from the patient’s parents or Legally Authorized Representatives before sample collection Human adult thymic tissues were acquired from research-consented deceased organ donors at the time of organ acquisition for clinical transplantation through an IRB-approved research protocol with Donor Network West the organ procurement organization for Northern California All donors were free of chronic disease and cancer and were negative for hepatitis B/C and HIV Tissues were collected after the clinical procurement process was completed and stored and transported in University of Wisconsin (UW) preservation media on ice and delivered at the same time as organs for transplantation The study does not qualify as human subjects research as tissue samples were obtained from de-identified deceased individuals without associated personal health information (PHI) Demographic and clinical data were extracted from de-identified materials provided by Donor Network West Mice were maintained in the University of California San Francisco (UCSF) specific pathogen-free animal facility in accordance with the guidelines established by the Institutional Animal Care and Use Committee (IACUC) and Laboratory Animal Resource Center Mice were maintained at a constant humidity between 30 and 70% and temperature 68 and 79 °F under a 12-h light/dark cycle and had free access to food and water All experimental procedures were approved by the Laboratory Animal Resource Center at UCSF Mice aged 12–15 weeks were used for the lineage tracing experiments regardless of their sex Tamoxifen (Sigma-Aldrich) was dissolved in corn oil (Sigma-Aldrich) and one 4 mg dose was administered by oral gavage with flexible plastic feeding tubes (Instech) All mice were euthanized by CO2 inhalation followed by cervical dislocation according to IACUC guidelines Thymic tissues placed in RPMI (ThermoFisher) containing 100 μg/ml DNase I (Roche) were cut into small pieces using scissors Tissue pieces were transferred into a gentleMACS C tube (Miltenyi) containing 10 ml of RPMI with DNAse The gentleMACS Program m_spleen_02 was run three times Thymic fragments were separated from the thymocytes-rich supernatant by centrifugation Remaining fragments were transferred back to C tube with fresh RPMI with DNAse before running program m_spleen_01 The supernatant was removed and replaced with 10 ml of digestion medium containing 100 μg/ml DNase I and 100 μg/ml Liberase TM (Sigma-Aldrich) in RPMI Tubes were moved to a 37 °C water bath and fragments were triturated every 5 min to mechanically aid digestion tubes were spun briefly to pellet undigested fragments and the supernatant was discarded Fresh digestion medium or accumax (Stemcell Technologies) was added to remaining fragments and the digestion was repeated for another 15–30 min until most pieces were digested Supernatant from this second round of digestion was transferred to a tube containing cold MACS buffer (0.5% BSA 2 mM EDTA in PBS) to stop the enzymatic digestion a third round of enzymatic digestion was performed on remaining fragments using accumax for an additional 5–10 min Cells were pooled with the supernatant from the previous round of digestion and were passed through a 40-μm filter (Falcon) Some samples were treated with 2 ml of ACK lysing buffer (Lonza) for 5 min prior to stromal enrichment single cells from digested tissue were resuspended in MACS buffer containing 10 μM of the ROCK inhibitor Y-27632 (Tocris) Human CD45 MicroBeads (Miltenyi) were used to deplete immune cells according to the manufacturer’s instructions with the following modification: 5 μL of CD45 MicroBeads per 107 total cells were added instead of 20 μL LD columns were used for depletion and the CD45-negative fraction was collected in MACS buffer Stromal cells from adult thymus were enriched using fluorescence-activated cell sorting (FACS) Blocking was done with human Fc receptor binding inhibitor monoclonal antibody (eBioscience) followed by staining for 20 min using human-specific antibodies against EPCAM (Clone 9C4 cells were washed and resuspended in FACS buffer containing DAPI Pre-gating was first done for live cells based the DAPI stain and CD45+ cells in each sample was determined by flow cytometric analysis or by calculating the ratio of cells in epithelial clusters or other clusters over the total number of cells in the single-cell RNA-seq dataset The average expression level of scored genes was visualized using UMAP previously generated using Scanpy To quantify the association between specific TSAs and the TSA score for AIRE+ and corneocyte-like mTECs a Spearman correlation coefficient with associated p value was calculated using the spearmanr function from the SciPy statistical package The list was filtered to keep genes expressed in at least five cells that had positive correlation coefficients >0.15 and p values < 0.25 Supplementary Data tables were prepared using Microsoft Excel The raw count matrix and annotated matrix for epithelial cells from the Park et al. dataset were downloaded from the Zenodo repository (https://doi.org/10.5281/zenodo.3711134) The dataset was processed through the same pipeline and combined with our epithelial dataset using Scanpy Batch alignment was performed using the BBKNN algorithm Clustering was performed using the Leiden algorithm with a resolution of 0.51 and results were visualized using UMAP Sub-clustering was performed by isolating clusters of interest with Scanpy and using the Leiden algorithm with the resolution set at 0.25 for mTECs and 0.1 for ionocytes/tuft cells Characteristic gene signatures were identified by testing for differential expression of tuft cells against ionocytes using a t-test with overestimated variance implemented in the tl.rank_genes_groups function of Scanpy The matrices were size-normalized to the median of total mRNA molecules across all cells Genes were selected based on a threshold of a minimum of 20 expressed counts for both spliced and unspliced mRNA The top 2000 highly variable genes were kept for further downstream analysis Nearest neighbor graphs were calculated with 30 neighbors based on the normalized gene expression matrices from the original analysis Velocity estimations were calculated using the standard scVelo pipeline and the resulting velocity graphs were projected onto the UMAPs previously generated using Scanpy Further information on research design is available in the Nature Research Reporting Summary linked to this article Single-cell RNA-sequencing analysis were done using publicly available pipelines as described in the Methods Clonal analysis reveals a common progenitor for thymic cortical and medullary epithelium Formation of a functional thymus initiated by a postnatal epithelial progenitor cell Generation of both cortical and Aire(+) medullary thymic epithelial compartments from CD205(+) progenitors Aire-expressing thymic medullary epithelial cells originate from β5t-expressing progenitor cells Dynamic spatio-temporal contribution of single β5t+ cortical epithelial precursors to the thymus medulla and BMP4 signaling regulates postnatal thymic epithelial progenitor cell differentiation during aging Thymic tuft cells promote an IL-4-enriched medulla and shape thymocyte development Single-cell mapping of the thymic stroma identifies IL-25-producing tuft epithelial cells Diversity in medullary thymic epithelial cells controls the activity and availability of iNKT cells CCR7 signals are essential for cortex-medulla migration of developing thymocytes A cell atlas of human thymic development defines T cell repertoire formation BBKNN: fast batch alignment of single cell transcriptomes Impaired development of the thymic primordium after neural crest ablation Differential requirement for mesenchyme in the proliferation and maturation of thymic epithelial progenitors Modulation of Bmp4 signalling in the epithelial-mesenchymal interactions that take place in early thymus and parathyroid development in avian embryos FSP1(+) fibroblast subpopulation is essential for the maintenance and regeneration of medullary thymic epithelial cells Production of BMP4 by endothelial cells is crucial for endogenous thymic regeneration Wnt glycoproteins regulate the expression of FoxN1 Evidence for an early role for BMP4 signaling in thymus and parathyroid morphogenesis Bmp4 and Noggin expression during early thymus and parathyroid organogenesis BMP signaling is required for normal thymus development A novel Foxn1(eGFP/+) mouse model identifies Bmp4-induced maintenance of Foxn1 expression and thymic epithelial progenitor populations Cooperative interaction of BMP signalling and Foxn1 gene dosage determines the size of the functionally active thymic epithelial compartment BMP4 acts upstream of FGF in modulating thymic stroma and regulating thymopoiesis Thymus-homing precursors and the thymic microenvironment Cell adhesion and migration are regulated at distinct stages of thymic T cell development: the roles of fibronectin Galectin-3 modulates carbohydrate-dependent thymocyte interactions with the thymic microenvironment Alternative NF-κB signaling regulates mTEC differentiation from podoplanin-expressing precursors in the cortico-medullary junction Lymphotoxin β receptor regulates the development of CCL21-expressing subset of postnatal medullary thymic epithelial cells Single-cell RNA-sequencing resolves self-antigen expression during mTEC development Revisiting the road map of medullary thymic epithelial cell differentiation Striated muscle fibres differentiate in monolayer cultures of adult thymus reticulum Single-cell transcriptomics reveals spatial and temporal turnover of keratinocyte differentiation regulators FOXN1 (GFP/w) reporter hESCs enable identification of Integrin-β4 and EpCAM as markers of human PSC-derived FOXN1(+) thymic epithelial progenitors The C8/144B monoclonal antibody recognizes cytokeratin 15 and defines the location of human hair follicle stem cells Long-lived keratin 15+ esophageal progenitor cells contribute to homeostasis and regeneration Mouse intestinal Krt15+ Crypt cells are radio-resistant and tumor initiating Proneural genes and the specification of neural cell types A novel function of the proneural factor Ascl1 in progenitor proliferation identified by genome-wide characterization of its targets An achaete-scute homologue essential for neuroendocrine differentiation in the lung Deletional tolerance mediated by extrathymic Aire-expressing cells Li, J. et al. NOTCH1 signaling establishes the medullary thymic epithelial cell progenitor pool during mouse fetal development. Development https://doi.org/10.1242/dev.178988 (2020) Liu, D. et al. Canonical Notch signaling controls the early thymic epithelial progenitor cell state and emergence of the medullary epithelial lineage in fetal thymus development. Development https://doi.org/10.1242/dev.178582 (2020) RANK signals from CD4(+)3(−) inducer cells regulate development of Aire-expressing epithelial cells in the thymic medulla Sequential phases in the development of Aire-expressing medullary thymic epithelial cells involve distinct cellular input The tumor necrosis factor family receptors RANK and CD40 cooperatively establish the thymic medullary microenvironment and self-tolerance The cytokine RANKL produced by positively selected thymocytes fosters medullary thymic epithelial cells that express autoimmune regulator Limitation of immune tolerance-inducing thymic epithelial cell development by Spi-B-mediated negative feedback regulation Fezf2 orchestrates a thymic program of self-antigen expression for immune tolerance Epithelial and dendritic cells in the thymic medulla promote CD4+Foxp3+ regulatory T cell development via the CD27-CD70 pathway Thymic epithelial cells require p53 to support their long-term function in thymopoiesis in mice Toll-like receptor signaling in thymic epithelium controls monocyte-derived dendritic cell recruitment and Treg generation Morphology and distribution of cystic cavities in the normal murine thymus Cell surface topography of thymic microenvironments A revised airway epithelial hierarchy includes CFTR-expressing ionocytes A single-cell atlas of the airway epithelium reveals the CFTR-rich pulmonary ionocyte Dissecting the cellular specificity of smoking effects and reconstructing lineages in the human airway epithelium The sox family of transcription factors: versatile regulators of stem and progenitor cell fate Projection of an immunological self shadow within the thymus by the aire protein Anderson, M. S. & Su, M. A. AIRE expands: new roles in immune tolerance and beyond. Nat Rev Immunol https://doi.org/10.1038/nri.2016.9 (2016) caused by mutations in a novel gene featuring two PHD-type zinc-finger domains Population and single-cell genomics reveal the Aire dependency and distribution of self-antigen expression in thymic epithelia Lessons from primary immunodeficiencies: Autoimmune regulator and autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy Biologically indeterminate yet ordered promiscuous gene expression in single medullary thymic epithelial cells Kernfeld, E. M. et al. A single-cell transcriptomic atlas of thymus organogenesis resolves cell types and developmental maturation. Immunity https://doi.org/10.1016/j.immuni.2018.04.015 (2018) Wnt-1 and Wnt-4 regulate thymic cellularity Zeng, Y. et al. Single-cell RNA sequencing resolves spatiotemporal development of pre-thymic lymphoid progenitors and thymus organogenesis in human embryos. Immunity 1–26, https://doi.org/10.1016/j.immuni.2019.09.008 (2019) Wnt4 regulates thymic cellularity through the expansion of thymic epithelial cells and early thymic progenitors Elevated levels of Wnt signaling disrupt thymus morphogenesis and function Exogenous insulin-like growth factor 1 enhances thymopoiesis predominantly through thymic epithelial cell expansion Development of the thymus requires signaling through the fibroblast growth factor receptor R2-IIIb Keratinocyte growth factor (KGF) enhances postnatal T-cell development via enhancements in proliferation and function of thymic epithelial cells Atypical thymoma (WHO B3) with neuroendocrine differentiation: report of a case Neuroendocrine differentiation in thymic carcinomas: a diagnostic pitfall: an immunohistochemical analysis of 27 cases Neuroendocrine differentiation in thymic epithelial tumors with special reference to thymic carcinoma and atypical thymoma Massive thymic hyperplasia with myoid cell differentiation Thymic carcinosarcoma consisting of squamous cell carcinomatous and embryonal rhabdomyosarcomatous components Report of a case and review of the literature Sueda, R. & Kageyama, R. Regulation of active and quiescent somatic stem cells by Notch signaling. Dev. Growth Differ. https://doi.org/10.1111/dgd.12626 (2019) Oscillations of MyoD and Hes1 proteins regulate the maintenance of activated muscle stem cells Signaling through BMPR-IA regulates quiescence and long-term activity of neural stem cells in the adult hippocampus Id4 promotes the elimination of the pro-activation factor Ascl1 to maintain quiescence of adult hippocampal stem cells Deficiency of the autoimmune regulator AIRE in thymomas is insufficient to elicit autoimmune polyendocrinopathy syndrome type 1 (APS-1) Clinical and serologic parallels to APS-I in patients with thymomas and autoantigen transcripts in their tumors Thymoma and paraneoplastic myasthenia gravis Antibody to acetylcholine receptor in myasthenia gravis Ascl1 (Mash1) defines cells with long-term neurogenic potential in subgranular and subventricular zones in adult mouse brain SCANPY: large-scale single-cell gene expression data analysis Spatial reconstruction of single-cell gene expression data Generalizing RNA velocity to transient cell states through dynamical modeling Download references We would like to thank members of the Anderson and Hebrok laboratories for helpful discussions and M Cheng for critical reading of the manuscript We would like to acknowledge the donors and their families who generously donated thymic tissue for this study as well as the expert technical assistance from the personnel of the Institute for Human Genetics Core Imaging and flow cytometry experiments were supported by resources from the UCSF Diabetes and Endocrinology Research Center (DRC) and UCSF Flow Cytometry Core (NIH Diabetes Research Center grant P30 DK063720) was supported by a T32 FAVOR training grant (project ID: 1T32AI125222-01) was supported by a National Institute of General Medical Sciences (NIGMS) Molecular and Cellular Immunology Program award (grant #T32AI00733430) was supported by an Achievement Rewards for College Scientists (ARCS) Foundation Scholar Award was supported by the UCSF Sandler Fellows PSSP grant and the ASTS-Astellas Fellowship in Transplantation grant and adult thymic tissue acquisition was courtesy of an approved research grant with Donor Network West T.D.B was supported by an award from the Burroughs Wellcome Fund Preterm Birth Initiative and NIH grant K08 HD067295 This work was supported by a UCSF Diabetes Center Innovation Award to A.V.P Department of Epidemiology & Biostatistics Bakar Institute for Computational Health Sciences Department of Bioengineering and Therapeutic Sciences Broad Center of Regeneration Medicine and Stem Cell Research Division of Neonatology and the Children’s Health & Discovery Initiative Tissue acquisition was coordinated by J.L.B. Tissue preparation and sequencing was performed and supervised by J.L.B. Analysis of scRNA-seq data was done by J.L.B. Lineage-tracing experiments were designed and performed by C.N.M Immunofluorescence experiments were done by J.C. Peer review information Nature Communications thanks Avinash Bhandoola Download citation DOI: https://doi.org/10.1038/s41467-021-21346-6 Metrics details Plasma noradrenaline levels increase with aging and this could contribute to the sympathetic overactivity that is associated with essential hypertension and the metabolic syndrome The underlying cause of this rise in noradrenaline is unknown but a clue may be that mercury increases noradrenaline output from the adrenal medulla of experimental animals We therefore determined the proportion of people from 2 to 104 years of age who had mercury in their adrenal medulla Mercury was detected in paraffin sections of autopsied adrenal glands using two methods of elemental bioimaging autometallography and laser ablation-inductively coupled plasma-mass spectrometry Mercury first appeared in cells of the adrenal medulla in the 21–40 years group and increased progressively in frequency in older age groups until it was detected in 90% of samples from people aged over 80 years the proportion of people having mercury in their adrenal medulla increases with aging Mercury could alter the metabolism of catecholamines in the adrenal medulla that leads to the raised levels of plasma noradrenaline in aging This retrospective autopsy study was not able to provide a definitive link between adrenal mercury but future functional human and experimental studies could provide further evidence for these associations The cause of this decreased adrenaline output remains unknown Pathways for mercury-induced increased noradrenaline and decreased adrenaline output by binding to and inhibiting the cofactor S-adenosyl-l-methionine (SAM) in the adrenal medulla reduces the ability of catechol-O-methyltransferase (COMT) to deactivate noradrenaline resulting in an increased output of noradrenaline Mercury binding to SAM also reduces the ability of phenylethanolamine N-methyltransferase (PNMT) to convert noradrenaline into adrenaline resulting in a decreased output of adrenaline Overactivity of central nervous system sympathetic neurons (of unknown cause) may contribute to increased sympathetic activity via elevated noradrenaline output from postganglionic neurons but it is not known if mercury is taken up by the human adrenal medulla To see if mercury in the adrenal medulla could contribute to the changes in catecholamine levels found in aging we looked for the presence of mercury and other toxic metals in the adrenal glands of people aged between 2 and 104 years Paraffin-embedded samples of adrenal glands were examined from 89 individuals who had autopsies performed in the New South Wales Department of Forensic Medicine, Sydney (Supplementary Table S1) range 2–98 years) and 33 females (mean age 59 years Clinical histories were: no major known disorder (N = 36) and one each of post-traumatic stress disorder The proportion of adrenal chromaffin cells containing AMG was categorised as ‘low’ if AMG was present in up to 25% of cells and ‘high’ if AMG was present in more than 25% of cells in at least four 200× microscopic fields To confirm that AMG in the adrenal medulla detected mercury and to look for the presence of other toxic metals seven-micron paraffin sections of 12 adrenal glands (8 AMG-positive 4 AMG-negative) were subjected to LA-ICP-MS for mercury Analyses were carried out on an NWR-193 excimer laser hyphenated to an Agilent Technologies 7700 ICP-MS LA-ICP-MS conditions were optimised on NIST 612 Trace Element in Glass CRM and the sample was ablated with a 50 µm spot size and a scan speed of 100 µm/s at a frequency of 20 Hz The data were collated into a single image file using in-house developed software and visualised using FIJI This study (X14-029) was approved by the Human Research Committee Sydney Local Health District (Royal Prince Alfred Hospital Zone) in accordance with the Declaration of Helsinki as revised in 2000 The institutional review board (the Human Research Committee Sydney Local Health District) waived the need for written informed consent from relatives of individuals studied since this was a de-identified retrospective study of autopsy tissue Patterns of AMG staining in the adrenal medulla either adjacent to nuclei (filled arrow) or within the cytoplasm (open arrow) are present in fewer than 25% of these chromaffin cells (69 year-old male) either large (filled arrow) or small (open arrow) are present in the cytoplasm of more than 25% of chromaffin cells (32 year-old male) (c) Black AMG staining is present in most chromaffin cells either as small grains dispersed in the cytoplasm (open arrow) or as these small grains accompanied by dense granules (filled arrow) (39 year-old male) Mercury in the adrenal medulla in increasing ages Mercury starts appearing in the adrenal medulla in the 21–40 years group The proportion of people with mercury in the medulla increases to 80% in the 41–60 years group and reaches a maximum of 90% in the final 81–104 years group Numbers of people in groups are above the bars The 33 females in the study had a slightly higher proportion (73%) of mercury in the adrenal medulla than the 56 males (65%) probably because females were older on average than males The proportion of people with high-AMG adrenal medulla mercury varied between the major categories of clinical diagnoses (14% for psychosis most likely due to the different average ages in these groups (30 The dotted lines outline the adrenal gland in the section the medulla is outlined by the internal dashed lines and the cortex occupies the space between the dashed and dotted lines Phosphorus LA-ICP-MS indicates the degree of cellularity No mercury is seen in adrenal glands that did not stain with AMG (A–D) Metals in both cortex and medulla are iron (A–C) Metals present selectively in the medulla are aluminium (B) and chromium (B) Aluminium is seen mostly in the zona reticularis of the cortex in (A,D) Cadmium is present mostly in the cortex in (C) thyroid tissue (containing cadmium) is present at the upper right and lymph node tissue (containing iron) at the lower left Scale = counts per second (proportional to abundance) Metals detected in both the medulla and cortex were iron (N = 8) Metals present in the cortex alone were aluminium (N = 5) The key finding of this study is that the proportion of people with mercury in their adrenal medulla increases steadily after the age of 20 years until mercury is present in the medulla of 90% or more of people over the age of 80 years This raises the possibility that mercury induces changes to catecholamine metabolism within the adrenal gland that contribute to the raised plasma noradrenaline and decreased adrenaline secretion found in aging The paravertebral sympathetic chain is seldom removed routinely at autopsy so a prospective autopsy study of people with and without hypertension would be needed to undertake an elemental analysis study of this type which may be because the aluminium moiety targets reticularis cells before toxic phosphine is released and to take continued steps to reduce workplace exposure to mercury All data generated or analysed during this study are included in this published article and its Supplementary Information files Plasma norepinephrine levels in essential hypertension Plasma catecholamines and essential hypertension Effects of sympathetic modulation in metabolic disease Human ageing and the sympathoadrenal system Adrenal catecholamine release by divalent mercury and cadmium Mechanisms of cadmium- and barium-induced adrenal catecholamine release Acute mercury poisoning (acrodynia) mimicking pheochromocytoma in an adolescent Mercury intoxication presenting with hypertension and tachycardia Mercury intoxication and arterial hypertension: Report of two patients and review of the literature Elemental mercury poisoning presenting as hypertension in a young child A case of mercury toxicity complicated by acute inflammatory demyelinating polyneuropathy Mercury poisoning presenting with hypertension: Report of 2 cases and hypertension: A systematic review and dose-response meta-analysis Accumulation and retention of mercury in the mouse An autoradiographic comparison of phenylmercuric acetate with inorganic mercury Accumulation of Hg(II) Ions in Mouse Adrenal Gland Organ and cellular distribution of inhaled metallic mercury in the rat and Marmoset monkey (Callithrix jacchus): Influence of ethyl alcohol pretreatment Traces of mercury in organs from primates with amalgam fillings Silver amplification of mercury sulfide and selenide: A histochemical method for light and electron microscopic localization of mercury in tissue Shrinkage of motor axons following systemic exposure to inorganic mercury silver and mercury in human brain and other tissues by autometallographic silver amplification All-time releases of mercury to the atmosphere from human activities Climate change and overfishing increase neurotoxicant in marine predators Mercury contents in rice and potential health risks across China Long-term exposure to methylmercury and its effects on hypertension in Minamata Short-term effect of severe exposure to methylmercury on atherosclerotic heart disease and hypertension mortality in Minamata Epidemiological studies of neurological signs and symptoms and blood pressure in populations near the industrial methylmercury contamination at Minamata Age-related accumulation of toxic metals in the human locus ceruleus Human organic anion transporter 1 mediates cellular uptake of cysteine-S conjugates of inorganic mercury Toxicological significance of renal Bcrp: Another potential transporter in the elimination of mercuric ions from proximal tubular cells Ultrastructural localization of mercury in adrenals from rats exposed to methyl mercury The lysosome as a cellular centre for signalling Heart disease and stroke statistics-2019 update: A report from the American Heart Association Prevalence of and trends in dyslipidemia and blood pressure among US children and adolescents Relationship of tachycardia with high blood pressure and metabolic abnormalities: A study with mixture analysis in three populations Postural hand tremor and incident hypertension in young to middle-aged adults: The Bogalusa heart study Adverse health effects associated with increased activity at Kilauea Volcano: A repeated population-based survey Volcanic smog and cardiometabolic health: Hawaiian hypertension? Global mercury flux from volcanic and geothermal sources Extreme air pollution conditions adversely affect blood pressure and insulin resistance: The air pollution and cardiometabolic disease study Association between long-term air pollution and increased blood pressure and hypertension in China The underlying mechanisms for development of hypertension in the metabolic syndrome Hypertension in metabolic syndrome: Vascular pathophysiology Metabolic syndrome in hypertensive patients: An unholy alliance and mercury-induced hypertension: Mechanisms and epidemiological findings Association between blood mercury level and visceral adiposity in adults Blood mercury concentration in relation to metabolic and weight phenotypes using the KNHANES 2011–2013 data Heavy metal exposure and metabolic syndrome: Evidence from human and model system studies Elemental analysis of aging human pituitary glands implicates mercury as a contributor to the somatopause Effects of human growth hormone on body composition in elderly men Association between psychosocial stress and hypertension: A systematic review and meta-analysis Pheochromocytoma: An endocrine stress mimicking disorder Biphasic effects of chromium compounds on catecholamine secretion from bovine adrenal medullary cells Distribution of bismuth in the brain after intraperitoneal dosing of bismuth subnitrate in mice: Implications for routes of entry of xenobiotic metals into the brain Interaction of four low dose toxic metals with essential metals in brain liver and kidneys of mice on sub-chronic exposure Functional zonation of the adult mammalian adrenal cortex Adrenocortical involvement in aluminium phosphide poisoning Quantitative bioimaging to investigate the uptake of mercury species in Drosophila melanogaster Dietary selenium’s protective effects against methylmercury toxicity Download references RP is supported by the Aimee Stacy Memorial and Ignacy Burnett bequests PAD is supported by Australian Research Council Discovery Project Grants DP170100036 and DP190102361 DPB is supported by an Australian Research Council Discovery Early Career Researcher Award DE180100194 School of Mathematical and Physical Sciences conceived the study and drafted the manuscript All authors reviewed the submitted manuscript Download citation DOI: https://doi.org/10.1038/s41598-021-82483-y Sign up for the Nature Briefing: Anthropocene newsletter — what matters in anthropocene research Metrics details thymic epithelial cells (TECs) create dedicated microenvironments for T cell development and selection Considering that TECs are sensitive to distinct pathophysiological conditions uncovering the molecular elements that coordinate their thymopoietic role has important fundamental and clinical implications medullary thymic epithelial cells (mTECs) play a crucial role in central tolerance suggest that mTECs depend on molecular factors linked to genome-protecting pathways but the precise mechanisms underlying their function remain unknown These observations led us to examine the role of Foxo3 as it is expressed in TECs and involved in DNA damage response Our findings show that mice with TEC-specific deletion of Foxo3 (Foxo3cKO) displayed a disrupted mTEC compartment with a more profound impact on the numbers of CCL21+ and thymic tuft mTEClo subsets Foxo3 controls distinct functional modules in the transcriptome of cTECs and mTECs under normal conditions which includes the regulation of ribosomal biogenesis and DNA damage response These changes in the TEC compartment resulted in a reduced total thymocyte cellularity and specific changes in regulatory T cell and iNKT cell development in the Foxo3cKO thymus the thymic defects observed in adulthood correlated with mild signs of altered peripheral immunotolerance in aged Foxo3cKO mice the deficiency in Foxo3 moderately aggravated the autoimmune predisposition observed in Aire-deficient mice Our findings highlight the importance of Foxo3 in preserving the homeostasis of TECs and in supporting their role in T cell development and tolerance understanding the molecular mechanisms controlling TEC homeostasis is essential for developing novel therapeutic strategies that can enhance immune reconstitution or correct insufficient T cell responses These findings suggest the possibility that promiscuous gene expression of TRAs in mTECs leads to genomic instability which requires protecting mechanisms to preserve the integrity of the medullary microenvironment the pathways controlling the balance of the mTEC niche under physiological conditions are still not fully understood In this study we examine the link between Foxo3 and the homeostasis of the TEC microenvironment These results suggest that Foxo3 expression is successfully inactivated in TECs from Foxo3cKO mice A Thymi were isolated from Foxo3Ctr (Foxo3fl/fl) and Foxo3cKO (Foxn1Cre:Foxo3fl/fl) mice at the indicated time points TECs (CD45-EpCAM+) were analysed for cTEC (Ly51+) and mTEC (UEA+) composition B mTEClo (MHCIIlowCD80low) and mTEChi (MHCIIhighCD80high) composition within total mTECs of the 10-week-old adult thymus E Expression of tuft cell marker DCLK1 within mTEClo Bar graphs show absolute cell numbers and percentages Data are representative of 2 or 3 independent experiments per time-point (n = 6National Natural Science Foundation of China (Grant No National Natural Science Foundation of China (Grant No Beijing Natural Science Foundation (Grant No.7212061)9 independent samples) *P < 0.05; **P < 0.01; ***P < 0.001 These results suggested that Foxo3 deficiency mostly affected the representation of Aire-independent TRAs These results indicate that Foxo3 has a pervasive but diverse impact in the transcriptional programs of cTECs and mTECs Annexin V+ cells in 7-AAD- (B) and Ki67+ cells (C) in cTECs mTEClo and mTEChi in Foxo3Ctr and Foxo3cKO adult thymus Data are representative of 3 independent experiments (n = 7 to 9 independent samples) and represented as mean ± SD E 10-week-old Foxo3Ctr and Foxo3cKO mice were subjected to sublethal total-body irradiation (SLTBI) and analysed at day 3 and day 21 post-irradiation 10-week-old Foxo3Ctr and Foxo3cKO untreated mice (Unt.) were also analysed mTEClo and mTEChi (D) and total thymic cellularity (E) were determined at the indicated time-points Numbers inserted above day 3 and day 21 columns depict the normalized recovery index of each population (average fold change relative to the corresponding untreated cellularity Data are representative of 2 or 3 independent experiments (n = 6–9 independent samples) and represented as mean ± SEM A Total thymic cellularity at the indicated time points B CD4 and CD8 expression on total thymocytes in the 10-week-old thymus of Foxo3Ctr and Foxo3cKO mice C CD44 and CD25 expression on Lin- CD4- CD8- DN thymocytes D CD69 and TCRβ expression on total thymocytes Data are representative of 2 to 4 independent experiments (n = 6–12 independent samples) A CD25 and Foxp3 expression on TCRβ+ CD4+ thymocytes of 10-week-old thymus of Foxo3Ctr and Foxo3cKO mice B Expression of TCRβ and reactivity with PBS57-loaded CD1d tetramer in total thymocytes PLZF+ iNKT2 and RORγt+ iNKT17 in total thymic iNKTs A Representative H&E staining of the different degrees of infiltration B Severity scores for inflammatory lymphocytic infiltration in salivary and lacrimal glands of 10 months-old Foxo3Ctr and Foxo3cKO mice as well as the challenges associated with establishing dual-deficient AireKO:Foxo3cKO mice we did not reanalyse single Foxo3cKO mice within this experimental complementary setup we did not directly compare the independent or interdependent role of Foxo3 and Aire suggesting that this exacerbation effect could be organ-specific our findings suggest that Foxo3 deficiency in TECs may predispose to failures in central tolerance ultimately leading to impaired peripheral tolerance the more pronounced effect in the mTEClo subset would align with this possibility mTEClo also include differentiated populations such as CCL21+ and Post-Aire cells possibility is that Foxo3 deficiency may render mTECs more susceptible to death The increase in annexin V+ in Foxo3cKO mTEClo and the enrichment in genes involved in DNA-damage apoptosis found in Foxo3cKO mTECs would support this hypothesis suggesting that the mTEClo subsets are more sensitive to the absence of Foxo3 Further studies that aid in deciphering the signals responsible for activating Foxo3 in TECs and determining whether the function of Foxo3 is differentially regulated in distinct c/mTEC subsets will offer insights concerning the regulation of Foxo3-dependent pathways in TECs The reduced mTEC compartment in the adult Foxo3cKO thymus was associated with fewer medullary islets which may affect the spatial organization of mTECs and their relationship with other stromal components Future studies 3D reconstruction studies of the Foxo3cKO thymus should investigate the effects of Foxo3 on the organization and position of diverse cTEC and mTEC subsets and determine their potential impact on T cell development the functional relationship between p53 and Foxo3 appears to be context-dependent Albeit Foxo3 is downregulated in p53cKO mTECs suggesting that Foxo3 may operate downstream of p53 in controlling mTEC homeostasis approximately 46% of DEGs found in Foxo3cKO mTECs were also affected by Trp53 deficiency indicating that Foxo3 and p53 control the expression of common targets in mTECs the significant number of DEGs affected only by Foxo3 deficiency infers the existence of other p53-independent mechanisms to control Foxo3 in mTECs We hypothesize that Foxo3 and p53 collaboratively control common and specific regulatory pathways within mTECs Future studies should investigate how Foxo3 controls DNA repair and cell cycle in mTECs and how these processes connect to promiscuous gene expression and the maintenance of their function presumably contributing to an immunosuppressive state for otherwise more severe autoimmunity observed in different genetic backgrounds our study underscores the important influence of Foxo3 in controlling TEC biology and function considering both biological and technical variability Apart from categorization based on genotype mice were randomly assigned to particular treatment and timepoint experimental groups sample preparation and data acquisition were conducted in a blinded manner with respect to the genotype mice received sublethal total-body irradiation (450 rads) with a Cs137 radiation source (Gammacell 1000 Experiments were performed in accordance with European guidelines for animals used for scientific purposes (Directive 2010/63/EU) Primers spanning the loxP site in intron 1 a (F 5′-AACAACCTCACACATGTGCC-3′) and b (R 5′- AGTGTCTGATACCGAAGAGC-3′) were used to detect the Foxo3fl allele The excision was detected using primers a and d (R 5′-CATGCAGTCCGAGAGATTTG-3) Intracellular detection of DCLK1 was achieved using anti-DCLK1 (DCAMKL1 followed by donkey anti-rabbit Alexa Fluor 488 (Invitrogen Apoptosis was assessed using FITC Annexin V (Biolegend no.: 420403) and Annexin V Binding Buffer (Biolegend For hematopoietic cell analysis, thymocyte samples obtained from mechanically disrupted thymus were stained for flow cytometry analysis. The complete list of antibodies can be found in Table 1 CD1d tetramers loaded with PBS57 or unloaded CD1d tetramers were obtained from the National Institutes of Health Tetramer Core Facility All intracellular staining was performed using a Foxp3 staining buffer set (eBioscience) Flow cytometry analyses were performed on an LSR Fortessa (Becton Dickinson) and cell sorting was performed on a FACS Aria II (Becton Dickinson) code and methods will be accessible under the following project number: PRJEB64863 (available upon publication) Requests for further information should be directed to and will be fulfilled by the corresponding author Paraffin-embedded tissue sections of thymus kidney and liver were stained with haematoxylin and eosin (H&E) Analysis was done on a light microscope (Olympus CX31) and images were captured using a brightfield microscope (Leica DM2000 LED) Thymic section images were processed using Fiji software Histopathology was scored in a blind and randomized fashion by four independent observers For organs in which no lymphocytic infiltration is detected in any animal of the genotypes under comparison Statistical analyses were performed using GraphPad Prism software The 2-tailed Mann-Whitney test was used for all statistical analyses Sample sizes (n) and number of experiment replications are reported in the respective figure legends Samples correspond to biological replicates Significant P-values are as follows: *P < 0.05; **P < 0.01; ***P < 0.001 Nonsignificant differences are not specified Data was deposited in the GEO database (PRJEB64863) Emerging strategies to boost thymic function AIRE: From promiscuous molecular partnerships to promiscuous gene expression FOXOs: signalling integrators for homeostasis maintenance Therapeutic strategies targeting FOXO transcription factors Suppression of ovarian follicle activation in mice by the transcription factor Foxo3a Thymic epithelial cells co-opt lineage-defining transcription factors to eliminate autoreactive T cells Thymic mimetic cells function beyond self-tolerance Functional interaction between FOXO3a and ATM regulates DNA damage response AIRE deficiency leads to impaired iNKT cell development Combined transient ablation and single-cell RNA-sequencing reveals the development of medullary thymic epithelial cells Chemokine treatment rescues profound T-lineage progenitor homing defect after bone marrow transplant conditioning in mice Interleukin-22 drives endogenous thymic regeneration in mice CD69 cell surface expression identifies developing thymocytes which audition for T cell antigen receptor-mediated positive selection Helios marks strongly autoreactive CD4+ T cells in two major waves of thymic deletion distinguished by induction of PD-1 or NF-kappaB Thymic regulatory T cells arise via two distinct developmental programs An essential role for medullary thymic epithelial cells during the intrathymic development of invariant NKT cells Transcriptional control of invariant NKT cell development Tissue-specific functions of invariant natural killer T cells Modifier loci condition autoimmunity provoked by Aire deficiency Ageing compromises mouse thymus function and remodels epithelial cell differentiation Lymphotoxin beta receptor regulates the development of CCL21-expressing subset of postnatal medullary thymic epithelial cells Aire-dependent production of XCL1 mediates medullary accumulation of thymic dendritic cells and contributes to regulatory T cell development Aire suppresses CTLA-4 expression from the thymic stroma to control autoimmunity Aire Controls Heterogeneity of Medullary Thymic Epithelial Cells for the Expression of Self-Antigens Proliferative arrest and rapid turnover of thymic epithelial cells expressing Aire Temporal lineage tracing of Aire-expressing cells reveals a requirement for Aire in their maturation program Control of cell number by Drosophila FOXO: downstream and feedback regulation of the insulin receptor pathway The Drosophila forkhead transcription factor FOXO mediates the reduction in cell number associated with reduced insulin signaling Thymus medulla consisting of epithelial islets each derived from a single progenitor Aire’s partners in the molecular control of immunological tolerance Aire controls gene expression in the thymic epithelium with ordered stochasticity Single-cell transcriptome analysis reveals coordinated ectopic gene-expression patterns in medullary thymic epithelial cells The pro-longevity gene FoxO3 is a direct target of the p53 tumor suppressor Regulation of transactivation-independent proapoptotic activity of p53 by FOXO3a p53-dependent inhibition of FKHRL1 in response to DNA damage through protein kinase SGK1 P53 negatively regulates the transcriptional activity of FOXO3a under oxidative stress The thymic medulla is required for Foxp3+ regulatory but not conventional CD4+ thymocyte development Neonatal tolerance revisited: a perinatal window for Aire control of autoimmunity Regulatory T cells generated early in life play a distinct role in maintaining self-tolerance FoxOs are critical mediators of hematopoietic stem cell resistance to physiologic oxidative stress The forkhead transcription factor FoxO regulates transcription of p27Kip1 and Bim in response to IL-2 The BH3-only protein Puma plays an essential role in cytokine deprivation induced apoptosis of mast cells FOXO3a-dependent regulation of Puma in response to cytokine/growth factor withdrawal Foxo proteins cooperatively control the differentiation of Foxp3+ regulatory T cells FoxOs cooperatively regulate diverse pathways governing neural stem cell homeostasis FoxOs are lineage-restricted redundant tumor suppressors and regulate endothelial cell homeostasis Maintenance of thymic epithelial phenotype requires extrinsic signals in mouse and zebrafish A novel method to identify Post-Aire stages of medullary thymic epithelial cell differentiation Intrathymic Deletion of IL-7 Reveals a Contribution of the Bone Marrow to Thymic Rebound Induced by Androgen Blockade Analysis of thymic stromal cell populations using flow cytometry Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 Identification of fibroblast progenitors in the developing mouse thymus GOing Bayesian: model-based gene set analysis of genome-scale data IL-15 induces antigen-independent expansion and differentiation of human naive CD8+ T cells in vitro Download references the caretakers of the animal facility and Translational Cytometry platform for technical assistance The authors also acknowledge the NIH Tetramer Core Facility This study was supported by a starting grant from the European Research Council (ERC) under the project 637843 and by FEDER - Fundo Europeu de Desenvolvimento Regional funds through the COMPETE 2020 - Operacional Programme for Competitiveness and Internationalisation (POCI) and by Portuguese funds through FCT - Fundação para a Ciência e a Tecnologia/Ministério da Ciência Tecnologia e Ensino Superior in the framework of the project PTDC/MED-IMU/1416/2020 the study was supported by funds from the 10th Edition of the “Crioestaminal” Prize awarded to N.A with the support of the Association “Viver a Ciência” (VAC) and “Crioestaminal” i3S - Instituto de Investigação e Inovação em Saúde IBMC - Instituto de Biologia Molecular e Celular ICBAS - Instituto de Ciências Biomédicas Abel Salazar wrote the manuscript; PF performed experiments and feedback on the manuscript; JJML VB provided scientific expertise; NLA conceived experiments Experiments with mice were performed in accordance with European guidelines for animals used for scientific purposes (Directive 2010/63/EU) Download citation DOI: https://doi.org/10.1038/s41419-024-06728-0 Metrics details The thymus medulla is a key site for immunoregulation and tolerance and its functional specialisation is achieved through the complexity of medullary thymic epithelial cells (mTEC) While the importance of the medulla for thymus function is clear the production and maintenance of mTEC diversity remains poorly understood using ontogenetic and inducible fate-mapping approaches we identify mTEC-restricted progenitors as a cytokeratin19+ (K19+) TEC subset that emerges in the embryonic thymus labelling of a single cohort of K19+ TEC during embryogenesis sustains the production of multiple mTEC subsets into adulthood We show K19+ progenitors arise prior to the acquisition of multiple mTEC-defining features including RANK and CCL21 and are generated independently of the key mTEC regulator we identify and define a multipotent mTEC progenitor that emerges during embryogenesis to support mTEC diversity into adult life the mechanisms that support the emergence and persistence of multiple mTEC compartments that are important for thymus function remain unclear we studied the embryonic thymus and searched for cells that might support and sustain cellular diversity within mTEC We describe the presence of a cytokeratin 19+ (K19+) TEC subset that is first detectable at E12.5 of gestation and peaks in frequency in time with the appearance of organised medullary areas We show K19+ cells arise independently of the key mTEC regulator and lack defining mTEC features including RANK Inducible fate-mapping analysis shows that embryonic K19+ cells give rise to multiple functionally distinct mTEC subsets labelling of a cohort of K19+ cells on a single gestational day is sufficient for the maintenance of mTEC diversity into adulthood our studies define a multipotent mTEC progenitor that arises during embryonic life and supports the long-term generation of mTEC diversity required to sustain thymus medulla function and examination of their developmental potential remains an important yet poorly understood area of thymus biology a Representative FACS plots showing expression of K19 by EpCAM1+ cells during ontogeny c Numbers and proportions of K19- EpCAM1+ cells d Numbers and proportion of K19+ EpCAM1+ cells (E12.5 n = 12 from three independent experiments per gestational age) a Immunofluorescence of an E15.5 thymus lobe stained for ERTR5 (turquoise) and K19 (red) b K19 expression within ERTR5- cortical regions c K19 expression within the subcapsular zone d K19 expression within ERTR5+ medullary areas Solid white lines indicate the edge of the thymus; dashed white lines indicate the boundary between cortex and medulla a Representative FACS plots showing expression of UEA1 and Ly51 by total EpCAM1+ cells K19-EpCAM1+ cells and K19+EpCAM1+ cells at E15.5 b Representative FACS plots showing expression of MHCII and CD80 to define mTECneg (MHCII-CD80-) mTECint (MHCIIintCD80int) and mTEChi (MHCIIhiCD80hi) and the corresponding expression of K19 by these subsets (upper panel) and the corresponding expression of K19 by Aire+ mTEChi (lower panel) Bar chart shows proportion of K19+ cells within mTECneg c Representative FACS plots showing expression of MHCII within UEA1-Ly51+ cells and expression of K19 by these subpopulations Bar chart shows proportion of K19+ cells within MHCII-UEA1-Ly51+ and MHCII+UEA1-Ly51+ TEC at E15.5 (n = 12 a K19Cre was induced in Krt19CreERTtdTom embryos at E15.5 via the administration of tamoxifen to pregnant mice and fate-mapped thymi were harvested at PNd0 (n = 14 Fate-mapped cells were detected within EpCAM1+ cells by flow cytometry and quantitated b Representative FACS plots and quantitation of K19-tdTom fate-mapped cells within EpCAM1+UEA1+ and EpCAM1+Ly51+ TEC c Expression of Ly51 and UEA1 by total EpCAM1+ cells K19-tdTom- EpCAM1+ cells (non-fate-mapped) and K19-tdTom+EpCAM1+ cells (fate-mapped) d Bar charts show proportions of Ly51+UEA1- and Ly51-UEA1+ cells and mTEC:cTEC ratio within non-fate-mapped and fate-mapped TEC e Bar chart shows fold change in Ly51+UEA1- and Ly51-UEA1+ cells within non-fate-mapped and fate-mapped TEC f Immunofluorescence of PNd0 thymi following K19-fate-mapping at E15.5 and ‘M’ indicate cortex and medullary areas respectively g Expression of MHCII by EpCAM1+Ly51+ fate-mapped (FM) or non-fate-mapped (Non-FM) TEC h Representative FACS plots illustrating the phenotype of fate-mapped mTEC subsets j Immunofluorescence of PNd0 thymi where K19Cre was induced at E15.5 our data suggest that fate-mapped tuft cells and Aire+ mTEC detectable at birth following Cre induction at E15.5 are both generated from immature progenitors a K19Cre was induced in Krt19CreERTtdTom embryos at E15.5 and after 24 h thymi were grafted under the kidney capsule of WT mice Thymus grafts were harvested at the equivalent of postnatal week 4 and 8 fate-mapped cells were detected within EpCAM1+ cells by flow cytometry and quantitated (n = 9 c Representative FACS plots and quantitation of K19-tdTom fate-mapped cells at 4 weeks within EpCAM1+UEA1+ and EpCAM1+Ly51+ TEC d Representative FACS plots illustrating the phenotype of fate-mapped mTEC subsets within fate-mapped thymus grafts at postnatal week 4 CCL21+ (n = 4) and tuft cells (MHCIIloCD80loDCLK1+ e Immunofluorescence of fate-mapped thymi at postnatal week 4 fate-mapped cells were detected within EpCAM1+ cells by flow cytometry and quantitated (n = 10 g Representative FACS plots and quantitation of K19-tdTom fate-mapped cells at 8 weeks within EpCAM1+UEA1+ and EpCAM1+Ly51+ TEC h Representative FACS plots illustrating the phenotype of fate-mapped mTEC subsets within fate-mapped thymus grafts at postnatal week 8 CCL21+ (n = 5) and tuft cells (MHCIIloCD80loDCLK1+ i Immunofluorescence of fate-mapped thymi at postnatal week 8 j Representative FACS plots of SSEA1 and K19 expression at E12.5 ( j) and E15.5 (k) and quantitation of K19+ SSEA-1+ TEC (n = 12 for both stages Whether this heterogeneity relates to differences in developmental potential and/or self-renewal within embryonic SSEA1+ TEC requires further examination in future studies K19-EpCAM1+ cells and K19+EpCAM1+ cells at E12.5 b Krt19CreERTtdTom embryos were fate-mapped via tamoxifen administration at E12.5 and the neonatal thymus was harvested at birth Fate-mapped cells were quantitated (n = 11 from 3 independent experiments) c Immunofluorescence of fate-mapped thymi at PNd0 d Expression of Ly51 and UEA1 by total EpCAM1+ cells and K19-tdTom+EpCAM1+ cells (fate-mapped) at PNd0 bar charts show corresponding quantitation e Representative FACS plots illustrating the phenotype of fate-mapped mTEC subsets within PNd0 fate-mapped thymus CCL21+ (n = 6) and tuft cells (MHCIIloCD80loDCLK1+ f Immunofluorescence of fate-mapped thymi at PNd0 a Proportions and numbers of Ly51-UEA1+ mTEC in E15.5 WT and Relb-/- thymus b Proportions and numbers of MHCII-CD80- mTECneg MHCIIhiCD80hi mTEChi in E15.5 WT and Relb-/- thymus c Representative FACS plots and corresponding quantitation showing K19 expression within Ly51-UEA1+MHCII-CD80-mTECneg in WT and Relb-/- thymi at E15.5 d Representative FACS plots showing expression of K19 and Relb by mTECneg a–c Infinity Flow analysis was used to impute the expression of surface markers on TEC (CD45-EpCAM1+) derived from thymi of E15.5 WT embryos a Hierarchical clustering analysis was performed on 121832 TEC and projected in a two-dimensional space using UMAP Each colour represents a specific cluster as indicated b Heatmap displays the expression of the top 5 markers upregulated in each cluster (log fold-change >0.15) c UMAP graphs and violin plots illustrating the expression of K19 and CD9 d UMAP graphs and violin plots illustrating the expression of UEA1 Colour gradient indicates expression levels in the UMAP graphs and colours in the violin plots represent the different clusters e Representative FACS plots showing expression of K19 by MHCIIloCD9hi TEC and corresponding quantitation That Ly51+ fate-mapped TEC contain both MHCII- and MHCII+ subsets may indeed provide support for both scenarios where MHCII+Ly51+ fate-mapped cells represent residual cTEC potential and MHCII-Ly51+ fate-mapped cells represent immature cTEC-like cells Further studies that aid in distinguishing functionally mature cTEC from immature cTEC-like progenitors will aid in studying the cTEC/mTEC lineage divergence that takes place during TEC development The capacity of K19+ embryonic TEC to act as a common progenitor source of mature mTEC subsets was evident in their ability to support diversity within the first mTEC cohorts in the neonatal thymus embryonic K19+ cells also supported the long-term maintenance of mTEC diversity into adulthood as indicated by the detection of diverse progeny up to a stage the equivalent of 8 weeks of postnatal age our findings identify a subset of embryonic TEC that is defined by K19 expression and which serves as a multipotent mTEC progenitor (mmTECp) population that sustains mTEC diversity in adult life it is important to point out that the inducible fate-mapping approach used in this study which limits Cre induction to a 24-h period during embryogenesis results in the labelling of a proportion (~10%) of K19+ TEC we do not make conclusions regarding the relative contribution of K19+ TEC and K19- TEC to generation of the total mTEC compartment we limit the interpretation of our data to the analysis and fate of those cells that have successfully undergone fate-mapping this allows us to make the conclusion that K19+ embryonic TEC are able to give rise to multiple functionally distinct mTEC subsets and also be capable of the long-term mTEC generation it is important to note that the major goal of our study was to examine the developmental pathways that give rise to multiple functionally important mTEC subsets we focused on progenitor potential rather than stem cell characteristics a key finding of our study is that a K19+ subset of embryonic TEC can give rise to Aire+ cells suggesting a common origin for mTEC diversity While the possible self-renewal properties of K19+ progenitors require further investigation it is perhaps interesting that at both E12.5 and E15.5 of gestation we found that approximately 40-45% of SSEA1++ cells expressed K19 While such findings suggest potential heterogeneity within the SSEA1+ embryonic TEC fraction previously shown to possess stem cell properties further experiments are required to fully examine how K19 and SSEA1 expression relates to mTEC stem and/or progenitor properties whether individual embryonic K19+ TEC have the potential to generate multiple distinct mTEC progeny or whether heterogeneity in developmental potential lies within the K19+ population Perhaps relevant to this is our finding that expression of the cell surface marker CD9 might serve as a marker for K19+ mmTECp this then excludes the need for K19 detection by cell permeabilization and so will allow for the isolation of K19+ mTEC progenitors as viable cells for future study further work is required to examine the suitability of CD9 expression our analysis of TEC heterogeneity using massively parallel flow cytometry may highlight the usefulness of this technology to examine and understand TEC heterogeneity our study reveals a population of embryonic thymic epithelial progenitors that gives rise to multiple functionally distinct mTEC populations that sustain the adult thymus medulla These findings should provide the basis for future work aimed at understanding the development and function of the medulla as a key site for T-cell development and tolerance timed matings were set up and vaginal plug detection was designated as embryonic day E0.5 Lineage tracing of K19+ cells was achieved by a single oral gavage of 4 mg Tamoxifen (VWR) in corn oil (Sigma) to pregnant mice on E12.5 or E15.5 of gestation A mixture of males and females were used throughout this study Thymic epithelial cells were isolated from embryonic thymi by digestion using 0.25% Trypsin/0.02% EDTA (Sigma Aldrich) Thymic epithelial cells from neonatal and grafted thymi were isolated by digestion using Collagenase Dispase (2.5 mg/ml Roche) and DNAse-1 (100 mg/ml Roche) Grafted thymi were depleted of CD45+ cells prior to antibody labelling using anti-CD45 microbeads (Miltenyi) and LS columns (Miltenyi) Embryonic thymic tissue from C57Bl/6 mice was snap-frozen in liquid nitrogen and mounted in OCT prior to cryosectioning Sections were acetone fixed and stained with the following antibodies: ERTR5 (van Vliet 1985); detected using goat anti-rat IgM AF647 (Invitrogen Lot no: GR3384962-1); detected using donkey anti-rabbit IgG AF555 (Invitrogen Retention of K19-tdTom in fate-mapping experiments was achieved by fixing thymus tissue in 2% PFA for 2 hours Subsequent cryosections were stained with the following antibodies: K5 AF647 (Abcam Lot no: B273843); detected using Streptavidin AF647 (Invitrogen Lot no: GR3357375-3); detected using donkey anti-rabbit IgG AF555 (Invitrogen Sections were counterstained with DAPI (Invitrogen) and mounted using prolong diamond (Invitrogen) Analysis was performed using a Zeiss LSM 880 confocal microscope and Zeiss Zen Black software Cre induction in Krt19CreERTTdTom embryos was achieved by oral gavage of 4 mg Tamoxifen (VWR) in 200l corn oil (Sigma) to pregnant mice at E12.5 or E15.5 of gestation Freshly isolated lymphoid E13.5 or E16.5 lobes from Krt19CreERTTdTom mice where tamoxifen had been administered at E12.5 or E15.5 respectively were transplanted under the kidney capsule of C57Bl/6 WT mice Grafts were recovered at the equivalent of 4 and 8 weeks post birth and were processed for flow cytometry or immunofluorescence TEC were isolated from WT E15.5 thymi by enzymatic digestion with Liberase (2.5 mg/ml Backbone staining was performed including antibodies directed against CD45 AF700 (30-F11 the stained cells were distributed across the three 96-well plates provided with the LEGENDScreen kit (Biolegend) each well containing a unique PE-labelled exploratory antibody as well as isotype controls and blanks Due to the low cell numbers obtained only ¼ of the recommended quantity of exploratory antibodies was used Plates were incubated at 4 °C for 30 min in the dark fixation was performed using the Cytofix buffer (BD Biosciences) for 1 hour at 4 °C in the dark Intracellular staining for K19 AF488 was used as additional backbone marker The range of exploratory markers was expanded to include FOXN1 PE (2/41 Cat no: 652403) which required staining in Cytoperm buffer (BD Biosciences) over-night at 4 °C in the dark cells were resuspended in 100 μl FACS buffer before analysis Values below zero were set to zero to allow for log normalisation Markers were filtered by hand to exclude T-cell related and focus on stromal cell related genes Clusters were called using a resolution of 2 Differential expression was performed using FindMarkers in Seurat Prism (GraphPad Software) was used to perform all statistical analyses Statistical tests used are noted in each figure legend Non-significant differences are not specified bar charts and error bars represent the mean ± SEM Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article The authors confirm that data supporting the findings of this study are available in the figures and supplementary figures of the paper. Source data are provided with this paper Thymic epithelial cell heterogeneity: TEC by TEC Essential role of CCL21 in establishment of central self-tolerance in T cells Medullary stromal cells synergize their production and capture of CCL21 for T-cell emigration from neonatal mouse thymus The cellular mechanism of Aire control of T cell tolerance Selection of Foxp3+ regulatory T cells specific for self antigen expressed and presented by Aire+ medullary thymic epithelial cells Distinct contributions of Aire and antigen-presenting-cell subsets to the generation of self-tolerance in the thymus Type 2 cytokines in the thymus activate Sirpalpha(+) dendritic cells to promote clonal deletion Myc controls a distinct transcriptional program in fetal thymic epithelial cells that determines thymus growth Identification of embryonic precursor cells that differentiate into thymic epithelial cells expressing autoimmune regulator Relb acts downstream of medullary thymic epithelial stem cells and is essential for the emergence of RANK(+) medullary epithelial progenitors Identification of a bipotent epithelial progenitor population in the adult thymus Multilineage potential and self-renewal define an epithelial progenitor cell population in the adult thymus Developmental dynamics of two bipotent thymic epithelial progenitor types Medullary thymic epithelial stem cells maintain a functional thymus to ensure lifelong central T cell tolerance Cutting edge: thymocyte-independent and thymocyte-dependent phases of epithelial patterning in the fetal thymus Stromal cell types in the developing thymus of the normal and nude mouse embryo Hepatic progenitor cells of biliary origin with liver repopulation capacity Cholangiocytes act as facultative liver stem cells during impaired hepatocyte regeneration Integration of single-cell transcriptomes and chromatin landscapes reveals regulatory programs driving pharyngeal organ development Aire-expressing thymic medullary epithelial cells originate from beta5t-expressing progenitor cells Thymocyte selection regulates the homeostasis of IL-7-expressing thymic cortical epithelial cells in vivo A CK19(CreERT) knockin mouse line allows for conditional DNA recombination in epithelial cells in multiple endodermal organs Tamoxifen administration in pregnant mice can be deleterious to both mother and embryo Medullary thymic epithelial stem cells: role in thymic epithelial cell maintenance and thymic involution Adult thymic epithelial cell (TEC) progenitors and TEC stem cells: Models and mechanisms for TEC development and maintenance Osteoprotegerin-mediated homeostasis of rank+ thymic epithelial cells does not limit Foxp3+ regulatory T cell development Multiorgan inflammation and hematopoietic abnormalities in mice with a targeted disruption of RelB Expression of relB is required for the development of thymic medulla and dendritic cells High-throughput single-cell quantification of hundreds of proteins using conventional flow cytometry and machine learning Klein, F. et al. Combined multidimensional single-cell protein and RNA profiling dissects the cellular and functional heterogeneity of thymic epithelial cells. bioRxiv https://doi.org/10.1101/2022.09.14.507949 (2022) Thymus medulla fosters generation of natural Treg cells and invariant NKT cells: what we learn from intrathymic migration Canonical Notch signaling controls the early thymic epithelial progenitor cell state and emergence of the medullary epithelial lineage in fetal thymus development NOTCH1 signaling establishes the medullary thymic epithelial cell progenitor pool during mouse fetal development Abrogation of Notch Signaling in Embryonic TECs Impacts Postnatal mTEC Homeostasis and Thymic Involution Serial progression of cortical and medullary thymic epithelial microenvironments RANK signals from CD4(+)3(-) inducer cells regulate development of Aire-expressing epithelial cells in the thymic medulla Download references We thank staff at the University of Birmingham Biomedical Services Unit for animal husbandry This work was supported by an MRC Programme Grant to G.A (MR/T029765/1) and a Wellcome Trust funded Collaborative Award (SynThy also received funding from the Swiss National Science Foundation (IZLJZ3_171050; 310030_184672) and the Wellcome Trust (105045/Z/14/Z) acknowledges the Oxford Health BRC for support was supported by a Swiss National Science Foundation Early Postdoc Mobility Fellowship (P2BSP3_188183) and Postdoc Mobility Fellowship (P500PB_206823) is supported by the JSPS Bilateral Programme (120219928) is supported by the Intramural Research Program of the US National Institutes of Health the National Cancer Institute and the Center for Cancer Research We thank Hans-Reimer Rodewald for anti-FOXN1 antibody Department of Paediatrics and Institute of Developmental and Regenerative Medicine Nuffield Department of Clinical Neurosciences University of Basel and University Children’s Hospital Basel Department of Biosystems Science and Engineering provided essential materials and experimental advice wrote the manuscript with input from all authors Nature Communications thanks the anonymous reviewer(s) for their contribution to the peer review of this work. Peer reviewer reports are available Download citation DOI: https://doi.org/10.1038/s41467-023-37589-4 Metrics details Breathing is highly sensitive to the PCO2 of arterial blood Although CO2 is detected via the proxy of pH CO2 acting directly via Cx26 may also contribute to the regulation of breathing Here we exploit our knowledge of the structural motif of CO2-binding to Cx26 to devise a dominant negative subunit (Cx26DN) that removes the CO2-sensitivity from endogenously expressed wild type Cx26 Expression of Cx26DN in glial cells of a circumscribed region of the mouse medulla - the caudal parapyramidal area – reduced the adaptive change in tidal volume and minute ventilation by approximately 30% at 6% inspired CO2 As central chemosensors mediate about 70% of the total response to hypercapnia CO2-sensing via Cx26 in the caudal parapyramidal area contributed about 45% of the centrally-mediated ventilatory response to CO2 Our data unequivocally link the direct sensing of CO2 to the chemosensory control of breathing and demonstrates that CO2-binding to Cx26 is a key transduction step in this fundamental process the role of direct sensing of CO2 in the regulation of breathing remains uncertain because genetic evidence linking Cx26 to the control of breathing has been lacking and the cells that could mediate direct CO2 sensing via Cx26 have not been identified we have addressed both of these issues by exploiting our knowledge of the binding of CO2 to Cx26 to devise a dominant-negative subunit (Cx26DN) that removes CO2-sensitivity from endogenous wild-type (WT) Cx26 hemichannels By using a lentiviral construct to drive the expression of Cx26DN in glial cells of the ventral medulla we have obtained evidence that links CO2-dependent modulation of Cx26 in glial cells present in a small circumscribed area of the ventral medulla to the adaptive control of breathing The grey line is drawn with a Hill coefficient of 6 suggesting that hemichannel opening to CO2 is highly cooperative c Hypothesised coassembly of Cx26WT and Cx26DN into heteromeric hemichannels that will be insensitive to CO2 because insufficient carbamate bridge formation will occur to induced channel opening a Box and whisker plots showing the difference in FRET efficiency (%E) across different connexin co-expression connexin samples FRET efficiency was calculated from background-adjusted ROIs as: %E = 100 × (cloverpost − cloverpre)/cloverpost Post hoc testing revealed all individual comparisons to be significant at ***p < 0.001 with the exception of the comparison between Cx26WT + Cx26WT and Cx26WT + Cx26DN data sets b Box and whisker plot showing mRuby2 bleaching efficiency during the acceptor depletion step While a small amount of bleaching occurred in untargeted regions (presumably due to light scattering and/or reflection) targeted ROIs received drastically greater bleaching all targeted regions showed highly similar bleaching efficiencies Bleaching efficiency was calculated from background-adjusted ROIs as: Bleaching = (1 − (mRuby2post/mRuby2pre)) the median is indicated by the horizontal line within the box and the mean is indicated by the cross within the box Range bars show minimum and maximum values This important observation shows that if Cx26DN were to form homomeric hemichannels in vivo they would have no impact on the CO2 sensitivity of cells expressing them Dye loading under 35 mmHg PCO2 (control) or 55 mmHg PCO2 (hypercapnic) conditions revealed how the CO2 sensitivity of HeLa cells stably expressing Cx26 (Cx26-HeLa cells) changes over time after transfection with Cx26DN b Representative dye-loading images of Cx26-HeLa cells at day 4 and day 6 days after cells were either untreated a or transfected with Cx26DN b the inset represents a Zero Ca2+ control to demonstrate the presence of functional hemichannels even when the HeLa cells showed no CO2-dependent dye loading d Cumulative probability distributions comparing mean pixel intensity for each condition at day 4 and day 6 (untreated Cx26-HeLa cells c; Cx26-HeLa cells transfected with Cx26DN with at least 5 independent repeats for each treatment) The cumulative distributions show every data point (cell fluorescence intensity measurement) e Median change in pixel intensity caused by 55 mmHg PCO2 and Zero Ca2+ from baseline (35 mmHg) over days 4 median pixel intensities (from 7 independent repeats) were compared using the Kruskal–Wallis ANOVA (χ2 = 9.85 p = 0.007**) and post hoc with Mann–Whitney U test (Cx26WT vs Cx26WT+Cx26DN p = 0.003***; Cx26WT+Cx26DN Zero Ca2+ vs Cx26WT+Cx26DN Each circle represents one independent replication (independent transfections and cell cultures) and the whisker is 1.5 times the interquartile range a Mice aged 11–14 weeks were bilaterally injected with lentivirus (LV) at the ventral medullary surface (VMS) to introduce either the Cx26DN or Cx26WT gene under the control of a GFAP promoter into genomic DNA Whole-body plethysmographic measurements of frequency (fR) and minute ventilation (VE) were recorded for each mouse at 0 before (week 0) and after (weeks 2 and 3) LV transduction there was a difference (two-way mixed-effects ANOVA followed by post hoc t test: VT F = 4.245 p = 0.015; p values on figure given for post hoc comparisons) in adaptive changes in tidal volume to 6% CO2 when comparing mice expressing Cx26WT (empty circles n = 12 mice) and mice expressing Cx26DN (black circles The median is indicated as a horizontal line within the box and the mean is represented by a cross within the box b Location of GFAP:Cx26 LV construct expression (green) in the sagittal plane—scale bars Bottom three images: parasagittal sections showing the location of the transduced cells (left) and examples of the cells at higher magnification (middle and right) Cells expressing GFAP:Cx26:Clover (green) at the ventral medullary surface have a morphology unlike that of astrocytes with a cell body at the very margin of the ventral surface and long processes that extend deep into the brain in the direction of respiratory nuclei The ventrolateral respiratory column lies caudal to the VII nucleus and ventral to the nucleus ambiguous (dashed ovals) Choline acetyltransferase staining (magenta) 200 µm; top-right and bottom-middle and bottom-right that only specific lysine residues in some proteins are able to be carbamylated Our data now suggest that CO2 carbamylation plays an important physiological role in the control of breathing Location of cells is shown in the coronal (a) and parasagittal (b) planes The cells are in an area ventral to the lateral reticular nucleus (LRt) and inferior olive (IO) The area reaches laterally to the same parasagittal plane as the nucleus ambiguus (NA) extends medially to the pyramids (py) SP5I spinal trigeminal nucleus interpolar part There are several ways that the respiratory and chemosensory networks could compensate for the effects of Cx26DN the most obvious being via strengthening of other chemosensory inputs such as those from the raphé a more subtle compensatory mechanism might be through upregulation of ATP receptors on the neurons downstream from the chemosensory glia in the caudal parapyramidal area It is unlikely that we transduced every chemosensitive glial cell in this area hence an upregulation of ATP receptors could maximise the effects of the non-transduced glial cells that remain chemosensitive Overexpression of Cx26WT by itself did not enhance the chemosensitivity of breathing Our construct drives the expression in GFAP+ cells which could either be part of the chemosensory network or outside of it For those glial cells within the chemosensory network it may be that the endogenous levels of expression are sufficient and additional expression of Cx26 can give no further gain of chemosensitivity—a “ceiling” effect Cx26WT expression in chemosensory cells outside of the network may be ineffective in enhancing chemosensitivity because these cells do not project to (and release ATP in) the correct locations to alter breathing and it is mechanistically simpler to understand how the CO2-gated release of ATP via Cx26 hemichannels could result in enhanced neuronal excitation and hence the adaptive changes in ventilation compared to CO2-gated loss of gap junction communication between glial cells their potential activation via release of ATP from CO2-sensitive glia in the same region gives a further mechanism by which this chemosensory signal could converge with that mediated via other chemosensory neurons (including the pH-dependent chemosensory pathway) and be propagated within the brain stem neural networks to facilitate breathing The Cx26DN transduction is clearly more effective than the prior pharmacological approach—it is highly selective and will completely remove Cx26-mediated CO2 sensitivity from the glial cells in which it is expressed our experiments were insufficiently powered to detect such a small difference and hence cannot reveal any possible contribution of Cx26 at this level of inspired CO2 A further factor in determining the overall contribution of cells that express Cx26 to respiratory control will be the way they and other populations of chemosensory cells connect to the neuronal circuits controlling breathing The caudal parapyramidal area is thus sensitive to both chemosensory stimuli and is a potential point of convergence of the CO2-mediated and pH-mediated chemosensory signals our injections of Cx26DN were too lateral to test whether Cx26 expression in more medial glial cells might also contribute to activation of the pH-sensitive raphé magnus neurons but this would be an interesting hypothesis to investigate the development of Cx26DN as a tool to remove CO2 sensitivity from endogenously expressed Cx26 has provided the first genetic evidence for the involvement of Cx26 in the control of breathing Our data provide a mechanistic link between the binding of CO2 to a structural motif on Cx26 and shows that direct sensing of CO2 by glial cells in a circumscribed area of the ventral medulla contribute nearly half of the centrally generated adaptive ventilatory response to CO2 All animal procedures were evaluated by the Animal Welfare and Ethical Review Board of the University of Warwick and carried out in strict accordance with the Animals (1986) Scientific Procedures Act of the UK under the authority of Licence PC07DE9A3 Mice were randomly assigned to their groups (Cx26WT A total of 80 mice were used in this study and RTN: Male and female mice aged 12–20 weeks were used The mice had a floxed Cx26 allele on a C57BL6 background (EMMA strain 00245) These mice were not crossed with any cre lines so had normal WT expression of Cx26 Main caudal parapyramidal experiment: C57BL6 WT male mice aged 12–17 weeks were used Very caudal experiment: C57BL6 WT Male mice aged 12–20 weeks were used HeLa DH (obtained from ECACC) and stable Cx26-expressing HeLa cells (gift from K Willecke) were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% foetal calf serum Connexin43 DNA sequence from Rattus norvegicus was purchased from Addgene (mCherry-Cx43-7 gifted by Michael Davidson) and subcloned into a PUC 19 vector such that the transcript would form a fusion protein with whichever fluorophore we engineered to be 3′ (downstream) of Cx43 (as with Cx26 constructs) Dominant-negative mutant Cx26 (Cx26DN) DNA with R104A K125R mutations was produced through two steps Cx26 DNA with the K125R mutation and omitted STOP codon (to allow for fusion proteins) was synthesised by Genscript USA from the Cx26 sequence (accession number NM_001004099.1) and subsequently subcloned into a PUC 19 vector such that the transcript would form a fusion protein with mCherry at the C-terminus of Cx26 the R104A mutation was introduced by Agilent Quikchange site-directed mutagenesis using PUC19-Cx26(K125R) DNA as the template Primer sequences for the mutagenesis were as follows: Cx26(R104A) forward 5′ GGC CTA CCG GAG ACA CGA AAA GAA AGC GAA GTT CAT GAA GG 3′ Cx26(R104A) reverse 5′ CCT TCA TGA ACT TCG CTT TCT TTT CGT GTC TCC GGT AGG CC 3′ Design and characterisation of the Clover and mRuby2 protein fluorophores used in these experiments was published by ref. 36 mRuby2 DNA was purchased from Addgene (mRuby2-C1 gifted by Michael Davidson) and subcloned into a PUC 19 vector so that it was 3′ of whichever connexin we engineered to be 5′ (upstream) of mRuby2 Clover DNA was a gift from Sergey Kasparov Bristol and was subcloned into a PUC 19 vector so that it was 3′ of whichever connexin we engineered to be 5′ (upstream) of Clover HeLa cells were transiently transfected with 0.5 μg of DNA of each pCAG–connexin–fluorophore construct to be co-expressed (1 μg total) using the GeneJuice transfection agent protocol (Merck Millipore) This was bubbled with 95%O2/5% CO2 and had a final pH of ~7.4 This was bubbled with sufficient CO2 (approximately 9% HeLa-DH cells were plated onto coverslips and transfected with Cx26DN Dye-loading experiments were performed 24–72 h after transfection For experiments involving co-expression of Cx26DN and Cx26WT HeLa cells that stably expressed Cx26WT were transfected with Cx26DN Dye loading was performed over a 3-day period cells washed in control aCSF were then exposed to either control or hypercapnic solution containing 200 μM 5(6)-carboxyfluorescein (CBF) for 10 min cells were returned to control solution with 200 μM CBF for 5 min before being washed in control solution without CBF for 30–40 min to remove excess extracellular dye A replacement coverslip of HeLa cells was used for each condition mCherry staining was imaged to verify Cx26 expression cells were imaged by epifluorescence (Scientifica Slice Scope (Scientifica Ltd Cairn Research OptoLED illumination (Cairn Research Limited Hamamatsu ImageEM EMCCD camera (Hamamatsu Photonics K.K. regions of interest (ROIs) were drawn around individual cells and the mean pixel intensity for each ROI was obtained The mean pixel intensity of the background fluorescence was also measured in a representative ROI and this value was subtracted from the measures obtained from the cells This procedure was used to subtract the background fluorescence from every pixel of all of the images displayed in the figures At least 40 cells were measured in each condition and the mean pixel intensities were plotted as cumulative probability distributions The experiments were replicated independently (independent transfections) at least five times for each Cx26 variant and condition All experiments performed at room temperature HeLa cells co-transfected with Cx-Clover (donor) and Cx-mRuby2 (acceptor) 72 h after transfection were washed 3× with phosphate-buffered saline (PBS) fixed with 4% paraformaldehyde (PFA) for 20–30 min FRET studies were carried out within 2 weeks of fixation They examined with a Zeiss LSM 710 Confocal microscope; C-Apochromat ×63/1.20 W Korr M27 Two channels were recorded: 495–545 nm (clover) and 650–700 nm (mRuby2) and images were acquired sequentially with 458- and 561-nm argon lasers Imaging parameters for the clover channel are as follows: power Imaging parameters for the mRuby2 channel are as follows: power Photobleaching was performed using the 561-nm laser (as it only excites mRuby2) for 80 frames at 100% power Image acquisition was as follows: ROIs were selected and drawn including a background region and an ROI that was not to be bleached; pre-bleaching images were acquired for each channel; mRuby2 was photobleached; post-bleaching images were acquired for each channel Acquisition parameters were kept identical across samples to allow comparison of results Pixel intensities from each background-adjusted ROI were used to calculate FRET efficiency (E) and donor–acceptor distance (R) as follows: Colocalisation threshold calculations were carried out in ImageJ using the Costes method73: 100 iterations omitting zero–zero pixels in threshold calculation LV constructs were produced and packaged by Cyagen Biosciences (USA) using the third-generation packing system as confirmed by quantitative PCR on genomic DNA extracted from the infected cells Anaesthesia was induced by inhalation of isoflurane (4%) The mouse was then placed on a thermocoupled heating pad (TCAT-2LV Physitemp) to maintain body temperature at 33 °C and headfixed into a stereotaxic frame A face mask was used to maintain anaesthesia (isoflurane 0.05 mg/kg) before surgery to stop pleural effusion Adequacy of anaesthesia was assessed by respiratory rate 2 mg/kg) and postoperative Buprenorphine (intraperitoneal If any animal showed signs of pain in the days following surgery additional analgesia was administered as required No animals displaying signs of pain or receiving analgesia were used in plethysmographic recordings To maintain consistent placement of the injection pipette the intra-aural line was adjusted so that bregma was level to a point on the skull 2 mm caudal to bregma Two small holes were made in the interparietal plate to allow for bilateral injection of virus particles via a micropipette lowered into the correct position via a stereotaxic manipulator A total of 350–400 nl of undiluted virus or saline was injected per side of the brain; the experimenter was blind to the injection solution Co-ordinates (mm) relative to bregma were: RTN: 5.7 and 5.9 caudal (two injections per side of brain) injection arm at 9° to vertical; caudal parapyramidal area: 5.95 caudal injection arm at 0° to vertical; very caudal area: 6.2 caudal injection arm at 0° to vertical; pilot experiment: 5.9 caudal Co-ordinates were confirmed by post hoc immunostaining for viral-driven expression of fluorophores Data were only included from mice whose injection sites were within the correct location Mice were culled by overdose of isoflurane or intraperitoneal injection of sodium pentobarbital (>100 mg/kg) and transcardially perfused with PFA (4%) The brain was harvested and post-fixed in 4% PFA for 24 h at 4 °C (to further increase tissue fixing) before being transferred to 30% sucrose (for cryoprotection) until the brain sunk to the bottom of the sucrose—usually ~2–3 days mounted with Tissue-Tek optimum cutting temperature compound (Sakura Finetek) and cut either sagittally or coronally at 40 μm on a cryostat (Bright Instruments) free-floating sections were incubated at room temperature overnight in PBS containing 0.1% Triton X-100 (Sigma-Aldrich UK) (0.1% PBS-T) and the appropriate primary antibodies: goat anti-choline acetyltransferase (1:100) (Merck UK Sections were then washed in PBS for 6 × 5 min before incubation at room temperature for 2.5–4 h in 0.1% PBS-T containing the appropriate secondary antibodies: donkey anti-goat Alexa Fluor 594 (1:250) (abcam goat anti-rabbit Alexa Fluor 594 (1:250) (abcam and goat anti-chicken Alexa Fluor 488 (1:250) (abcam sections were again washed in PBS for 6 × 5 min before mounting onto polylysine-coated slides (Polysine Mounted slices were left to dehydrate overnight before applying coverslips using either Aqua-Poly/Mount (Polysciences Inc. Germany) or Fluoroshield with 4,6-diamidino-2-phenylindole (Sigma-Aldrich and during any period of incubation or washing a pressure transducer to detect the breathing movements of the mouse and gas inlets and outlets to permit gas flow through the chamber A heated (via a water bath) mixture of O2 (~20%) and CO2 (0–9%) flowed through the chamber regulated to a rate of 1 l/min The amount of O2 and CO2 in the mixture was measured Pressure signals were recorded with an NL108T2 – Disposable Physiological Pressure Transducer (Digitimer) amplified and filtered using the NeuroLog system connected to a 1401 interface and acquired on a computer using the Spike2 software (Cambridge Electronic Design) Airflow measurements were used to calculate: tidal volume (VT: signal trough at the end of expiration subtracted from the peak signal during inspiration converted to ml following calibration with a 1-ml syringe) respiratory frequency (fR: breaths per minute) and minute ventilation (VE) (calculated as VT × fR) The temperature inside the plethysmograph was maintained at ~31 °C The experimenter was only unblinded to the identity of the injected virus once acquisition and analysis of all plethysmographic recordings had been performed Further statistical details can be found in the relevant figure legends Further information on research design is available in the Nature Research Reporting Summary linked to this article All data generated or analysed during this study are included in this published article. The source data used to generate the charts in the paper are provided in Supplementary Data 1–3 Respiratory Physiology: The Essentials 9th edn (Wolters Kluwer Health Regions of respiratory chemosensitivity on the surface of the medulla Ventilatory response to alterations of H+ ion concentration in small areas of the ventral medullary surface A superficial substrate on the ventral surface of the medulla oblongata influencing respiration Respiratory response to hypoxia and hypercapnia after elimination of central chemosensitivity Central chemosensitivity and the reaction theory Responses of respiratory modulated and tonic units in the retrotrapezoid nucleus to CO2 Respiratory control by ventral surface chemoreceptor neurons in rats Purinergic P2 receptors modulate excitability but do not mediate pH sensitivity of RTN respiratory chemoreceptors The 2008 Carl Ludwig Lecture: Retrotrapezoid nucleus Regulation of breathing by CO(2) requires the proton-activated receptor GPR4 in retrotrapezoid nucleus neurons Evidence for central chemoreception in the midline raphe Chemosensitivity of rat medullary raphe neurones in primary tissue culture Serotonergic neurons as carbon dioxide sensors that maintain pH homeostasis Impaired respiratory and body temperature control upon acute serotonergic neuron inhibition Functional and developmental identification of a molecular subtype of brain serotonergic neuron specialized to regulate breathing dynamics The retrotrapezoid nucleus and central chemoreception TASK-2 channels contribute to pH sensitivity of retrotrapezoid nucleus chemoreceptor neurons signalling properties and central effects of G-protein coupled receptor 4 Astrocytes control breathing through pH-dependent release of ATP Respiratory responses to medullary hydrogen ion changes in cats: different effects of respiratory and metabolic acidoses Differential effects of CO2 and H+ as central stimuli of respiration in the cat Redefining the components of central CO2 chemosensitivity–towards a better understanding of mechanism 3rd Localization of connexin26 and connexin32 in putative CO(2)-chemosensitive brainstem regions in rat Connexin hemichannel-mediated CO2-dependent release of ATP in the medulla oblongata contributes to central respiratory chemosensitivity CO2-dependent opening of connexin 26 and related beta connexins CO2 directly modulates connexin 26 by formation of carbamate bridges between subunits Structural determinants of CO2-sensitivity in the β connexin family suggested by evolutionary analysis The connexin26 human mutation N14K disrupts cytosolic intersubunit interactions and promotes channel opening Aminosulfonate modulated pH-induced conformational changes in connexin26 hemichannels Conformational changes in surface structures of isolated connexin 26 gap junctions Evolutionary adaptation of the sensitivity of connexin26 hemichannels to CO2 ATP is a mediator of chemosensory transduction in the central nervous system Regulation of ventral surface CO2/H+-sensitive neurons by purinergic signalling Improving FRET dynamic range with bright green and red fluorescent proteins Connexin interaction patterns in keratinocytes revealed morphologically and by FRET analysis Viral vectors based on bidirectional cell-specific mammalian promoters and transcriptional amplification strategy for use in vitro and in vivo Common mechanisms of compensatory respiratory plasticity in spinal neurological disorders Comroe Distinguished Lecture: Interdependence of neuromodulators in the control of breathing The binding of carbon dioxide by horse haemoglobin Crystal structure of the ternary complex of ribulose-1,5-bisphosphate carboxylase Insights into class D beta-lactamases are revealed by the crystal structure of the OXA10 enzyme from Pseudomonas aeruginosa Critical involvement of a carbamylated lysine in catalytic function of class D beta-lactamases Carbon-dioxide and carbamate formation - the makings of a biochemical control-system The identification of carbon dioxide mediated protein post-translational modifications Histological structures in the chemosensitive regions on the ventral surface of the cat’s medulla oblongata Highly H+-sensitive neurons in the caudal ventrolateral medulla of the rat Characterization of efferent projections of chemosensitive neurons in the caudal parapyramidal area of the rat brain Acidosis-stimulated neurons of the medullary raphe are serotonergic Chemosensitive serotonergic neurons are closely associated with large medullary arteries Quantification of the response of rat medullary raphe neurones to independent changes in pH(o) and P(CO2) Important role of carotid afferents in control of breathing Breathing without CO2 chemosensitivity in conditional Phox2b mutants Nijjar, S. et al. Opposing modulation of Cx26 gap junctions and hemichannels by CO2. Preprint at https://doi.org/10.1101/584722 (2019) Phox2b-expressing retrotrapezoid neurons are intrinsically responsive to H+ and CO2 Selective optogenetic stimulation of the retrotrapezoid nucleus in sleeping rats activates breathing without changing blood pressure or causing arousal or sighs Mechanisms of CO2/H+ sensitivity of astrocytes Chemosensitivity of Phox2b-expressing retrotrapezoid neurons is mediated in part by input from 5-HT neurons Relative contribution of central and peripheral chemoreceptors to the ventilatory response to CO2 during hyperoxia CO2 dialysis in the medullary raphe of the rat increases ventilation in sleep CO(2) microdialysis in retrotrapezoid nucleus of the rat increases breathing in wakefulness but not in sleep Astrocytes modulate brainstem respiratory rhythm-generating circuits and determine exercise capacity Effects of CO2 and H+ on the ventilatory response to peripheral chemoreceptor stimulation Chemosensitivity of serotonergic neurons in the rostral ventral medulla Task2 potassium channels set central respiratory CO2 and O2 sensitivity TASK channels contribute to the k+-dominated leak current regulating respiratory rhythm generation in vitro Separate gating mechanisms mediate the regulation of K2P potassium channel TASK-2 by intra- and extracellular pH Zebrafish and mouse TASK-2 K(+) channels are inhibited by increased CO2 and intracellular acidification Connexin26 hemichannels with a mutation that causes KID syndrome in humans lack sensitivity to CO2 Rational design of new NO and redox sensitivity into connexin26 hemichannels Automatic and quantitative measurement of protein-protein colocalization in live cells Translational efficiency of EMCV IRES in bicistronic vectors is dependent upon IRES sequence and gene location Multiple comparisons: philosophies and illustrations Download references We thank the MRC (MR/N003918/1) for support was a doctoral student supported by the MRC (MR/J003964/1) was a Royal Society Wolfson Research Merit Award Holder S.N.; immunocytochemical staining: J.V.d.W. R.H.; plethysmography: J.V.d.W.; data analysis: J.V.d.W. A.B.; all authors commented on drafts of the paper Download citation DOI: https://doi.org/10.1038/s42003-020-01248-x Volume 6 - 2015 | https://doi.org/10.3389/fimmu.2015.00365 The thymus ensures the generation of a functional and highly diverse T-cell repertoire which is mainly composed of medullary thymic epithelial cells (mTECs) and dendritic cells (DCs) provides a specialized microenvironment dedicated to the establishment of T-cell tolerance mTECs play a privileged role in this pivotal process by their unique capacity to express a broad range of peripheral self-antigens that are presented to developing T cells developing T cells control mTEC differentiation and organization These bidirectional interactions are commonly referred to as thymic crosstalk This review focuses on the relative contributions of mTEC and DC subsets to the deletion of autoreactive T cells and the generation of natural regulatory T cells We also summarize current knowledge regarding how hematopoietic cells conversely control the composition and complex three-dimensional organization of the thymic medulla we discuss our current knowledge regarding the phenotypic features of the different subsets of thymic DCs and mTECs as well as their relative contribution to the induction of T-cell tolerance We also summarize recent progress in our understanding of the thymic crosstalk that sustains the composition and complex three-dimensional (3D) organization of the medulla The thymic medulla is composed of a dense network of distinct subsets of DCs and mTECs (A) Confocal micrograph of a mouse thymic section stained with antibodies against the DC-specific marker CD11c (blue) and the mTEC-specific marker K14 (red) (B) Three distinct subsets of DCs are located mainly in the medulla: resident cDCs (CD11chiCD11b− CD8αhiSirpα−) migratory cDCs (CD11chiCD11b+CD8αloSirpα+) (C) Schematic representation of mTEC differentiation mTECs arise from a pool of self-renewing mTEC progenitors Distinct stages of mTEC maturation can be identified based on the differential expression of MHCII The end stages of maturation can lead to the emergence of post-Aire mTECs or to the development of Hassall’s corpuscle both pDCs and migratory cDCs change their phenotype shortly after entering the thymus suggesting that the medullary microenvironment provides specific factors that contribute to the functional specification of these DC subsets The identity of these factors that drive the maturation as well as the extensive proliferation of migratory DCs remains elusive further investigations are needed to clarify the relationship among these cells as well as their relative contributions to medulla formation and homeostasis within the embryonic and adult thymus The identification of specific markers that allow distinct discrimination between these cell types would be helpful to evaluate their respective regenerative capacity Such studies could aid in identifying clinical applications notably for improving thymic function in the context of elderly or cytoablative treatments these findings have revealed that the medullary epithelium is not static but is much more dynamic than previously considered although Aire-independent TRAs represent approximately 80% of the genes expressed in mTECs the mechanisms that regulate them are largely unknown The participation of other regulatory factors as well as epigenetic regulation thus remains to be identified mTECs and DCs tightly collaborate to delete autoreactive T cells and to induce the generation of nTreg cells Relevant in vivo studies are indicated in this figure Tissue-restricted self-antigens (TRAs) expressed and presented by mTECs can lead to the deletion of autoreactive T cells and the induction of nTregs These self-antigens can also be transferred to and presented by resident cDCs resulting in T-cell deletion and the induction of nTregs migratory cDCs and pDCs also reinforce the establishment of central T-cell tolerance via the presentation of antigens captured in the periphery Migratory cDCs are also involved in T-cell deletion and the induction of nTregs whereas pDCs only contribute to the deletion of autoreactive T cells in mice Thymic B cells have also been shown to participate in the deletion of autoreactive T cells and the generation of nTregs These findings suggest that there is an underlying division of labor within mTEC subsets with immature mTECs likely providing more potent induction of nTregs and mature mTECs preferentially prone to negative selection the in vivo dynamics of the interactions of CD8+ and CD4+ T cells with mTECs remain unknown to date It would be very informative to compare the interactions of medullary CD8+ and CD4+ T cells with Aire− and Aire+ mTECs to determine to what extent the frequency and duration of these interactions influence T-cell outcomes Two-photon imaging experiments assessing fresh thymic slices are expected to achieve this goal in the near future and may reveal a complex choreography between SP thymocytes and mTECs The thymic migration of pDCs could be mediated via both CCR9 and CCR2 The generation of double knockout mice for CCR9 and CCR2 should reveal whether these two chemokine receptors are sufficient for directing the thymic recruitment of pDCs it is possible that specific thymic DC subsets capture distinct sets of self-antigens and could differentially impact the TCR repertoire Additional studies performed at the polyclonal TCR level are required to elucidate this important issue these pioneer studies indicated that SP thymocytes provide instructive signals that are critical for controlling the expansion and organization of the medulla Recent advances have facilitated our understanding of the underlying molecular and cellular participants that are responsible for these crucial processes in the establishment of T-cell tolerance The addition of purified Vγ5+ thymocytes or LTi cells in reaggregate thymus organ culture (RTOC) experiments induces similar proportions of Aire+ mTEC differentiation Vγ5+ thymocytes and LTi cells are both present in individual Aire-expressing medullary environments suggesting that they act collectively to influence mTEC maturation Mice that are deficient in both LTi and γδ T cells (Rorc−/− × Tcrd−/−mice) show a further decreased number of fetal Aire+ mTECs compared with mice that are deficient in either LTi or γδ T cells alone Rorc−/− × Tcrd−/−double-deficient mice do not show a complete absence of Aire+ mTECs which suggests that other cell type(s) that remain(s) to be identified could also be involved in this differentiation process drive the emergence of Aire+ mTECs in the embryonic thymus and ligands that contribute to Aire+ mTEC differentiation and medulla patterning which is expressed by Vγ5+ T cells and LTi cells in the embryonic thymus and (B) by CD4+ thymocytes and iNKT cells in the post-natal thymus crosstalk between mTECs and CD4+ thymocytes via CCL19/21–CCR7 and CD80/86–CD28 controls medulla patterning whereas MHCII/self-antigen–TCR complexes and CD40–CD40L contribute to both the differentiation of Aire+ mTECs and patterning of the medulla Receptors and ligands involved in Aire+ mTEC differentiation are represented in green (C) Schematic representation of 3D medullary organization in the post-natal thymus Aire+ mTECs (denoted by a green nucleus) and venules are preferentially localized at the cortico-medullary junction (CMJ) these findings revealed distinct molecular and cellular mechanisms that sustain the generation of mTECs that display a mature phenotype in the embryonic and post-natal thymus the CMJ represents not only a privileged site of T-cell progenitor homing and export of mature T cells but also a privileged region that favors the encounter of SP thymocytes with Aire+ mTECs A first wave of negative selection is thus expected to occur in this region which could play a more important role in the induction of T-cell tolerance than previously thought They adopt a confined migration pattern during which they likely provide to mTECs instructive signals that would be necessary for both mTEC differentiation and organization may thus reveal a subtle compartmentalization of these specific cell types within the thymic medulla This cellular crosstalk with autoreactive CD4+ thymocytes is likely to fine-tune the homeostasis of the medulla allowing the thymus to adapt optimally for the establishment of T-cell tolerance Thymic crosstalk is the indispensable interplay between medullary APCs and developing T cells that coordinates the induction of T-cell tolerance and mTECs have all been shown to control the selection of SP thymocytes DCs reinforce the induction of T-cell tolerance by cross-presenting mTEC-derived TRAs and by displaying peripheral self-antigens captured in the periphery thymic B cells can also express Aire and act as APCs mTECs are the lead player in T-cell tolerance induction due to their constitutive expression of TRAs studies conducted over the last decade have furthered our understanding of the thymic crosstalk that sustains mTEC differentiation as well as the organization of the medulla the precise consequences of thymic crosstalk on mTEC differentiation Additional studies are needed to identify the downstream target genes induced in mTECs by crosstalk signals in both the embryonic and the post-natal thymus Future work can be expected to elucidate how thymic crosstalk shapes the T cell repertoire Such studies would be extremely informative for further delineating the mechanisms that govern the establishment of T-cell tolerance This knowledge is expected to pave the way toward novel therapeutic strategies aimed at preventing the development of autoimmunity and controlling age-associated thymic involution We gratefully thank Christin Hong (Harvard University) for constructive comments and the Swiss National Science Foundation (PZ00P3-131945 to MI) the Marie Curie Actions (Career Integration Grants the ARC Foundation (PJA 20131200238 to AS) and the Institut National de la Santé et de la Recherche Médicale (INSERM) We acknowledge American Journal Experts for editorial assistance Metrics details Dietary fasting markedly influences the distribution and function of immune cells and exerts potent immunosuppressive effects the mechanisms through which fasting regulates immunity remain obscure Here we report that catecholaminergic (CA) neurons in the ventrolateral medulla (VLM) are activated during fasting in mice and we demonstrate that the activity of these CA neurons impacts the distribution of T cells and the development of autoimmune disease in an experimental autoimmune encephalomyelitis (EAE) model Ablation of VLM CA neurons largely reversed fasting-mediated T cell redistribution Activation of these neurons drove T cell homing to bone marrow in a CXCR4/CXCL12 axis-dependent manner which may be mediated by a neural circuit that stimulates corticosterone secretion the continuous activation of VLM CA neurons suppressed T cell activation differentiation and cytokine production in autoimmune mouse models and substantially alleviated disease symptoms our study demonstrates neuronal control of inflammation and T cell distribution suggesting a neural mechanism underlying fasting-mediated immune regulation This study did not use any customized code or mathematical algorithm An evolutionary perspective on immunometabolism Dietary restriction in rhesus monkeys: lymphopenia and reduced mitogen-induced proliferation in peripheral blood mononuclear cells Long-term moderate calorie restriction inhibits inflammation without impairing cell-mediated immunity: a randomized controlled trial in non-obese humans Calorie restriction induces reversible lymphopenia and lymphoid organ atrophy due to cell redistribution The bone marrow protects and optimizes immunological memory during dietary restriction Dietary intake regulates the circulating inflammatory monocyte pool Fasting-refeeding impacts immune cell dynamics and mucosal immune responses Monocytes re-enter the bone marrow during fasting and alter the host response to infection Bone marrow: an immunometabolic refuge during energy depletion Fueling immunity: insights into metabolism and lymphocyte function Chronic calorie restriction attenuates experimental autoimmune encephalomyelitis Calorie restricted diet and urinary pentosidine in patients with rheumatoid arthritis Central nervous system control of food intake and body weight Neural control of energy balance: translating circuits to therapies Three pillars for the neural control of appetite Subgroups of hindbrain catecholamine neurons are selectively activated by 2-deoxy-d-glucose induced metabolic challenge C1 neurons mediate a stress-induced anti-inflammatory reflex in mice Permanent genetic access to transiently active neurons via TRAP: targeted recombination in active populations Sexually dimorphic neurons in the ventromedial hypothalamus govern mating in both sexes and aggression in males Hindbrain catecholamine neurons activate orexin neurons during systemic glucoprivation in male rats Chemokines and chemokine receptors in leukocyte trafficking Control of lymphocyte egress from lymph nodes through β2-adrenergic receptors Mesenchymal and haematopoietic stem cells form a unique bone marrow niche The organization of noradrenergic pathways from the brainstem to the paraventricular and supraoptic nuclei in the rat Central noradrenergic pathways for the integration of hypothalamic neuroendocrine and autonomic responses Anatomical specificity of noradrenergic inputs to the paraventricular and supraoptic nuclei of the rat hypothalamus Neural and humoral pathways of communication from the immune system to the brain: parallel or convergent Mechanisms of CNS response to systemic immune challenge: the febrile response Monosynaptic restriction of transsynaptic tracing from single Principles of Neural Science 5th edn (McGraw-Hill Mechanisms of corticosteroid action on lymphocyte subpopulations Redistribution of circulating T and b lymphocytes to the bone marrow A diet mimicking fasting promotes regeneration and reduces autoimmunity and multiple sclerosis symptoms Diet and physical exercise in psoriasis: a randomized controlled trial Stress and autoimmunity: the neuropeptides corticotropin-releasing factor and urocortin suppress encephalomyelitis via effects on both the hypothalamic–pituitary–adrenal axis and the immune system Minireview: glucocorticoids in autoimmunity: unexpected targets and mechanisms Immune cell migration in inflammation: present and future therapeutic targets The relevance of animal models in multiple sclerosis research Neural regulation of innate immunity: a coordinated nonspecific host response to pathogens IL-6-deficient mice are resistant to experimental autoimmune encephalomyelitis: roles of IL-6 in the activation and differentiation of autoreactive T cells Imiquimod-induced psoriasis-like skin inflammation in mice is mediated via the IL-23/IL-17 axis Minireview: the value of looking backward: the essential role of the hindbrain in counterregulatory responses to glucose deficit Optogenetic stimulation of adrenergic C1 neurons causes sleep state-dependent cardiorespiratory stimulation and arousal with sighs in rats biphasic CRF neuronal responses encode positive and negative valence Paraventricular nucleus CRH neurons encode stress controllability and regulate defensive behavior selection Brain motor and fear circuits regulate leukocytes during acute stress Social stress affects migration of blood T cells into lymphoid organs Molecular profiling of activated neurons by phosphorylated ribosome capture leptin-dependent increase in the intrinsic action potential frequency of orexigenic arcuate nucleus neuropeptide Y/Agouti-related protein neurons Impact of intermittent fasting on health and disease processes Extending healthy life span—from yeast to humans Activation of brainstem catecholaminergic neurons during voluntary diving in rats Thirst-associated preoptic neurons encode an aversive motivational drive Murine hind limb long bone dissection and bone marrow isolation Download references Mao for their suggestions on the manuscript Lv at the Shandong Analysis and Test Center and F Zheng at Huazhong University of Science and Technology for teaching us to establish the EAE mouse model Tang at the National Center for Protein Sciences for providing advice in immunological experiments We thank the NIBS imaging facility staff—T Chen (Chinese Institute for Brain Research flow cytometry facility) and M Dong’s laboratory at Tsinghua University)—for technical assistance is supported by grants from the National Natural Science Foundation of China (31822026 research funds of the Center for Advanced Interdisciplinary Science and Biomedicine of IHM (QYPY20220018) and the National Science and Technology Innovation 2030 Major Project of China (2021ZD0203900) is supported by a grant from the National Natural Science Foundation of China (32100821) decision to publish or preparation of the manuscript Center for Advanced Interdisciplinary Science and Biomedicine of IHM Hefei National Research Center for Physical Sciences at the Microscale University of Science and Technology of China Tsinghua Institute of Multidisciplinary Biomedical Research Institute of Metabolism & Integrative Biology conceived the study and wrote the manuscript provided intellectual expertise and helped to interpret the experimental results Gating strategy used for analyzing T-cell in the blood Starting from the upper left panel and going down following the arrows in dotted lines T cells were subdivided into CD4+ T and CD8+ T-cell subsets 123count eBeads were added to cell suspensions for absolute cell counting Absolute cell counts of T cells in the blood (T p = 0.038 CD8+ T p = 0.024) of WT mice fed ad libitum or fasted for 24 hours BM p = 0.27) in the blood and BM of WT mice fed ad libitum or fasted for 24 hours Each symbol represents an individual mouse Two-sided unpaired t-test was used in b and c Source data Three weeks after AAV viral injections into the VLM of Dbh-Cre mice mice received CNO injections once daily for six days Absolute T-cell counts in the blood (T p = 0.0001 CD8+ T p = 0.025) of DbhVLM-hM3Dq and DbhVLM-mCherrry mice after six days of CNO injections and LNs of WT mice 4 hours after CNO or saline injection Source data Percentages of dead (FVD+) T cells in the blood and BM of DbhVLM-hM3Dq and DbhVLM-mCherry mice 4 hours after CNO injection Percentages of Ki67+ cells in T cells in the blood and BM (p = 0.0012) of DbhVLM-hM3Dq and DbhVLM-mCherry mice 12 hours after CNO injection Absolute cell counts of transferred T cells in the spleen and LNs of DbhVLM-hM3Dq and DbhVLM-mCherry mice at 4 and 24 hours after CNO injections (mCherry: 4 hours n = 8; 8 hM3Dq: 4 and 12 hours n = 7; 8 and 24 hours n = 8 mice Source data Experimental flow for comparing mRNA expression by immune cells (CD45+) between DbhVLM-hM3Dq mice and DbhVLM-mCherrry Volcano plot showing 422 upregulated genes (red dots) and 198 downregulated genes (blue dots) in BM CD45+ cells of DbhVLM-hM3Dq mice compared to those of DbhVLM-mCherrry mice (n = 4 mice per group) Heatmap showing differentially expressed genes associated with cell migration Experimental schematic of VLM activation in Cxcl12fl/fl×nestin-Cre×Dbh-flpo (cxcl12−/-) mice (left panel) AAV-flpo-hM3Dq-mCherry was injected into the VLM of Nestin-Cre×Cxcl12flox/flox×Dbh-flpo mice (Cxcl12-/-) to express hM3Dq in CAVLM neurons A representative image showing that the majority (~ 90% 1741 hM3Dq+ neurons from 2 mice) of hM3Dq+ neurons (red) in the VLM of cxcl12-/- mice are TH+ (right panel) CXCR4 expression by T cells in the BM of WT mice and Cxcl12-/- mice (p < 0.0001) Source data A representative sagittal image showing VLM-derived axonal projections (green) throughout the brain Selective inhibition of the CAVLM→ARC neural circuit by bilateral infusion of CNO (0.5 µl each side 1 µg/µl dissolved in saline) into the ARC via pre-implanted cannulas A representative image shows the position of cannulas targeting the ARC Absolute cell counts of transferred T cells in blood (p = 0.022) and BM (p = 0.034) after bilateral infusion of CNO into the ARC of DbhVLM-hM4Di mice Selective inhibition of the CAVLM→DMH neural circuit by bilateral infusion of CNO (0.5 µl each side 1 µg/µl dissolved in saline) into the DMH via preimplanted cannulas A representative image shows the position of cannulas targeting the DMH Absolute cell counts of transferred T cells in blood (p = 0.0062) and BM (p = 0.039) after bilateral infusion of CNO into the DMH of DbhVLM-hM4Di mice Transsynaptic anterograde tracing of VLM neurons Schematic of transsynaptic anterograde tracing AAV1-Cre was injected into the VLM of Ai14 mice Representative images showing VLM transsynaptic labeled tdTomato+ neurons (red) and Crh+ neurons (green) in the PVN Pie graphs showing the percentages of CRHPVN neurons that received inputs from the VLM (558 double-labeled neurons among 1717 Crh+ neurons from 2 mice) CRH neurons in the PVN of Crh-Cre×Ai14 mice were activated by 24 hours of fasting Representative images show Fos expression (green) in PVN CRH neurons (red) of mice fed ad libitum (top) or fasted (bottom) Source data Corticosterone levels in the plasma of DbhVLM-hM3Dq and control mice 4 hours after CNO injection (p < 0.0001; mCherry n = 5 hM3Dq n = 6 biologically independent samples) Administration of dexamethasone drove far red dye-labeled (FR+) T-cell homing to the BM BM p = 0.013) of transferred T-cell 4 hours after administration of saline or dexamethasone (saline n = 6 dexamethasone n = 6 biologically independent samples) Source data Body weight changes in DbhVLM-hM3Dq and DbhVLM-mCherry mice after EAE induction p < 0.0001; interaction between time and mice group F(23,552) = 8.232 Levels of cytokines in the spinal cord of CAVLM neuron-activated mice and control mice fed ad libitum or on an IF diet at day 17 after EAE induction (mCherry Ad n = 11 hM3Dq Ad n = 9; ctrl IF n = 10 biologically independent samples) Longitudinal investigations of the impact of CAVLM neuronal activation on T-cell distribution in EAE mice and draining LN of DbhVLM-hM3Dq and DbhVLM-mCherrry mice on days 7 and 21 after EAE induction (blood mCherry: day 7 n = 12 day 21 n = 4; spleen mCherry: day 7 n = 14 day 21 n = 8 biologically independent samples) All mice received CNO injection once daily after EAE induction until study termination The p values in b and d are in source data files Source data Flow cytometric analysis of the activation status of CD8+ T cells in the spleen of CAVLM neuron-activated mice and control mice fed ad libitum or on an IF diet at day 17 after EAE induction Data are presented as representative plots (top panels) and quantified absolute cell numbers and percentages (bottom panels) (mCherry n = 11 hM3Dq n = 9; ctrl n = 10 biologically independent samples ctrl p = 0.012; percentage hM3Dq p = 0.023 Activation of CAVLM neurons had no impact on plasma IFNγ and IL17A levels in non-disease mice GO-BP analysis shows the most significantly enriched biological processes in CD4+T cells sorted from the spleen of CAVLM neuron-activated mice and control mice at day 7 after EAE induction Genes were considered to be significantly differentially expressed using a false discovery rate of 0.05 and a fold change of 1.5 in an R package (cluster Profiler version 3.14.3) Heatmap showing differentially expressed genes associated with the MAPK and NF-κB signaling pathways Source data IMQ-induced back skin inflammation was scored daily based on the change in skin thickness (a) and Psoriasis Area Severity Index (PASI) (d) (mCherry n = 11 Representative hematoxylin and eosin staining of skin sections The epidermis is marked with arrows and dashed lines Continuous activation of CAVLM neurons suppressed the DTH response Changes in paw thickness 24 hours after injection of mBSA or PBS mBSA was injected into the footpad of the right hind limb (R_mBSA) whereas PBS was injected into the footpad of the left hind limb (L_PBS) T-cell proliferation (h) and differentiation (i) in the spleen of DbhVLM-hM3Dq and DbhVLM-mCherry mice 24 hours after injection of mBSA Plasma levels of IFNγ and IL17A 24 hours after injection of mBSA Each symbol represents an biologically independent samples in g-i Mice received CNO injection once daily after immunization until study termination Source data Orexigenic CAVLM neurons are activated during fasting whose activation stimulates the release of glucocorticoids via the CAVLM→CRHPVN neural circuit targeting the adrenal glands thereby driving T-cell homing to the bone marrow in a CXCR4CXCL12 axis-dependent manner and suppressing autoimmune diseases Numerical raw data and statistical source data a society or other partner) holds exclusive rights to this article under a publishing agreement with the author(s) or other rightsholder(s); author self-archiving of the accepted manuscript version of this article is solely governed by the terms of such publishing agreement and applicable law Download citation DOI: https://doi.org/10.1038/s41593-023-01543-w Metrics details could help to explain the effect of vagus nerve stimulation as a treatment for headache disorders the existence of a trigeminovagal complex in humans remains unclear therefore investigated the existence of the trigeminovagal complex in humans One post-mortem human brainstem was scanned at 11.7T to obtain structural (T1-weighted) and diffusion magnetic resonance images ((d)MR images) Post-processing of dMRI data provided track density imaging (TDI) maps to investigate white matter at a smaller resolution than the imaging resolution the MR-scanned brainstem and three additional brainstems were sectioned for polarized light imaging (PLI) microscopy T1-weighted images showed hyperintense vagus medullar striae coursing towards the dorsomedial aspect of the medulla TDI- and PLI-images showed these striae to intersect the trigeminal spinal tract (sp5) in the lateral medulla PLI images showed that a minority of vagus fibers separated from the vagus trajectory and joined the trigeminal spinal nucleus (Sp5) and the sp5 The course of the vagus tract in the rostral medulla was demonstrated in this study This study shows that the trigeminal- and vagus systems interconnect anatomically at the level of the rostral medulla where the vagus fibers intersect with the Sp5 and sp5 Physiological and clinical utility of this newly identified interconnection is a topic for further research well-tolerated and safe as a treatment of primary headache disorders the exact neuroscientific underpinnings of VNS need to be further elucidated Based on the clinical observations that VNS can influence pain presentation in primary headache disorders our group hypothesized the existence of an interconnection between the two systems The aim of this study was to combine post-mortem and PLI results in order to demonstrate the existence of the trigeminovagal complex in humans Four brains were retrieved from the body donor program of the Radboud university medical center (Radboudumc All body donors in this program had signed a written informed consent during their lifetime permitting the use of their body and parts for science and teaching The body donor program of the Radboud University Medical Center was approved by the National Medical Ethical Committee of the Netherlands and was legislated under Dutch law this study and its applied methodology was performed under the approval of the Medical Ethical Committee of the Arnhem–Nijmegen region in the Netherlands all methods were performed in accordance with the Declaration of Helsinki The included donors had no known neurological diseases and none of the brains showed pathological deformities the medulla was placed for 24 hours in a 100 ml syringe Imaging was performed on an 11.7T Bruker BioSpec Avance III preclinical MR system (Bruker BioSpin Germany) equipped with an actively shielded gradient set of 600mT/m (slew rate 4570 T/m/sec) A circular polarized resonator was used for signal transmission and an actively-decoupled birdcage coil (Bruker BioSpin dMRI data were obtained using a segmented spin-echo with echo-planar imaging at 0.5 mm isotropic resolution covering a total of 256 gradient directions at a b-value of 4000 s/mm2 completed with six images with no diffusion weighting (b = 0 s/mm2) were used Parameters included: Δ = 12.5 ms; δ = 4.0 ms; TR = 13.8 s; and TE = 30.7 ms Histological sectioning of the medulla of Specimens #1–4 was performed in order to optimally visualize all intramedullar fibers originating from the vagus nerve entry zone all specimens were immersed in a 30% sucrose-solution in 0.1M PBS at 4 °C for seven days Each specimen was frozen by using dry ice and serially sectioned with a HM 450 Sliding Microtome (Thermo Fisher Scientific Inc. creating an inter-slice distance of 300 microns All mounted sections were cover-slipped using the mounting medium the sections could be used for PLI microscopy All maps of the different FOVs were stitched to provide an overview of the entire slice by in-house written software in MATLAB© (The MathWorks Overview of the transverse T1 FLASH MR images of the human medulla (Specimen #1) Anatomical orientation depicted by the anatomical anemone in the above-left corner a three-dimensional model of the medulla depicts the level of transection IOD: Dorsal inferior olivary nucleus; DMV: Dorsal motor nucleus of the vagus nerve; 12N: Hypoglossal nucleus; IOM: Medial inferior olivary nucleus; IOPr: Principal inferior olivary nucleus (A) Superior transverse section through the rostral medulla depicting vagus medullar fibers (white arrow) Various anatomical landmarks can be recognized and are depicted in the schematic drawing on the right (B) Inferior transverse section through the rostral medulla depicting vagus medullar fibers (white arrow) Series of color-coded dMR images of the rostral medulla (Specimen #1) The RGB (red–green–blue) color cross indicates the principal eigenvector orientations Anterior-posterior oriented voxels can be observed which form striae in the lateral medulla probably representing the vagus medullar fibers (white arrow) (A) Midsagittal image depicting the levels of the transverse sections displayed in the second part of this image (B) Series of transverse sections through the rostral medulla depicting the medullar fibers at different levels Anatomical orientation depicted by the anatomical anemone in the above-right corner (C) Three-dimensional model of the medulla depicting the level of transection (D) Detailed TDI map of the medullar fibers sprouting from the vagus nerve entry zone The fiber density is encoded by brightness The fiber orientation is represented by color while the fiber density is encoded by brightness (E) Detailed TDI map showing the intersecting of the vagus medullar fibers (encircled in white) with the sp5 (encircled in black) Polarized light imaging images of the vagus medullar fibers at different magnifications (specimen #2) The fiber orientation is defined by the color sphere in the upper left corner Sp5: Trigeminal spinal nucleus; sp5: Trigeminal spinal tract; Delineated area 1 contains both the Sp5 (medial portion) and sp5 (lateral portion) (A) Magnification 1x; (B) Magnification 2.5x; (C) Magnification 5x; (D) Magnification 10x At different magnifications the vagus tract can be seen (yellow) to course towards the area postrema of the brainstem fibers can be seen to change orientation (with associated color changes from yellow to orange and purple) depicting the sprouting of vagus fibers within the sp5 and Sp5 (delineated by white lines; sp5 is located lateral Merging of the vagus and trigeminal system can be seen at the asterisk (*) in Figure D Vagus trajectory (orange) can be observed within the Sp5 and sp5 The vagus fibers entwine with trigeminal fibers (yellow and purple entwinement at the asterisks) the first to report on the trigeminovagal complex in man by use of 11.7T post-mortem MRI and PLI This insight contributes to the investigation of experimental VNS as a treatment of primary headache disorders lead to inclusion of other head- and facial pain conditions like trigeminal neuralgia and neuropathic orofacial pain the authors hypothesize that the majority of vagus fibers merge with the Sp5 at the level of the caudal subnucleus Although difficult to distinguish from the interpolar subnucleus (rostral border) and cervical dorsal horn (caudal border) the caudal subnucleus has been reported to extend from the level of the obex to the third cervical cord level vagus fibers enter the lateral medulla and The limited length of the trajectory made this technique unsuitable for tracing studies in humans reported that DTI is capable of reflecting the shape and orientation of nerve pathways Another limitation of this study is that it does not investigate or elucidate different patterns of vagus fibers merging with the Sp5 and sp5 A final limitation of this study is formed by the fact that it was not proved that vagus fibers synapse within the Sp5 as these applied techniques showed entwinement of the vagus fibers with the trigeminal fibers we cannot yet confirm that the neural trigeminovagal complex observed in this study also will be found at a synaptical level although this has been proposed by various animal-based studies before focus on the synaptical connections between the trigeminal- and vagus systems These findings could aid the explanation of clinical observations and research which found a functional connection between the trigeminal system and vagus system Stovner, L. et al. The global burden of headache: a documentation of headache prevalence and disability worldwide. Cephalalgia 27, 193–210, https://doi.org/10.1111/j.1468-2982.2007.01288.x (2007) Vos, T. et al. Years lived with disability (YLDs) for 1160 sequelae of 289 diseases and injuries 1990-2010: a systematic analysis for the Global Burden of Disease Study 2010. Lancet 380, 2163–2196, https://doi.org/10.1016/S0140-6736(12)61729-2 (2012) The trigeminocervical complex and migraine: current concepts and synthesis Goadsby, P. J., Edvinsson, L. & Ekman, R. Vasoactive peptide release in the extracerebral circulation of humans during migraine headache. Ann Neurol 28, 183–187, https://doi.org/10.1002/ana.410280213 (1990) Dural headache and innervation of the dura mater Experimental studies on headache: pain-sensitive structures of the head and their significance in headache Innervation of intracranial structures: a reappraisal Physiological aspects of clinical neurology Ho, K. W. D., Przkora, R. & Kumar, S. Sphenopalatine ganglion: block, radiofrequency ablation and neurostimulation - a systematic review. J Headache Pain 18, 118, https://doi.org/10.1186/s10194-017-0826-y (2017) Schoenen, J. Sphenopalatine Ganglion Stimulation in Neurovascular Headaches. Prog Neurol Surg 29, 106–116, https://doi.org/10.1159/000434661 (2015) Schwedt, T. J. & Vargas, B. Neurostimulation for Treatment of Migraine and Cluster Headache. Pain Med 16, 1827–1834, https://doi.org/10.1111/pme.12792 (2015) Miller, S. & Matharu, M. Non-invasive Neuromodulation in Primary Headaches. Curr Pain Headache Rep 21, 14, https://doi.org/10.1007/s11916-017-0608-x (2017) Tassorelli, C. et al. Noninvasive vagus nerve stimulation as acute therapy for migraine: The randomized PRESTO study. Neurology. https://doi.org/10.1212/WNL.0000000000005857 (2018) Goadsby, P. J. et al. Non-invasive vagus nerve stimulation for the acute treatment of episodic and chronic cluster headache: A randomized, double-blind, sham-controlled ACT2 study. Cephalalgia 38, 959–969, https://doi.org/10.1177/0333102417744362 (2018) glossopharyngeal and vagus nerves: an autoradiographic study in the rat Vagal afferent C fibers projecting to the lateral descending trigeminal complex of crotaline snakes The subnuclei and primary afferents of the descending trigeminal system in the mallard (Anas platyrhynchos L.) Brahic, C. J. & Kelley, D. B. Vocal circuitry in Xenopus laevis: telencephalon to laryngeal motor neurons. The Journal of comparative neurology 464, 115–130, https://doi.org/10.1002/cne.10772 (2003) Axer, M. et al. A novel approach to the human connectome: ultra-high resolution mapping of fiber tracts in the brain. Neuroimage 54, 1091–1101, https://doi.org/10.1016/j.neuroimage.2010.08.075 (2011) Henssen, D. et al. Ex vivo visualization of the trigeminal pathways in the human brainstem using 11.7T diffusion MRI combined with microscopy polarized light imaging. Brain Struct Funct, https://doi.org/10.1007/s00429-018-1767-1 (2018) D’Arceuil, H. & de Crespigny, A. The effects of brain tissue decomposition on diffusion tensor imaging and tractography. NeuroImage 36, 64–68, https://doi.org/10.1016/j.neuroimage.2007.02.039 (2007) Schmierer, K. et al. Quantitative magnetic resonance of postmortem multiple sclerosis brain before and after fixation. Magn Reson Med 59, 268–277, https://doi.org/10.1002/mrm.21487 (2008) Dyrby, T. B. et al. Validation of in vitro probabilistic tractography. NeuroImage 37, 1267–1277, https://doi.org/10.1016/j.neuroimage.2007.06.022 (2007) Shepherd, T. M., Thelwall, P. E., Stanisz, G. J. & Blackband, S. J. Aldehyde fixative solutions alter the water relaxation and diffusion properties of nervous tissue. Magn Reson Med 62, 26–34, https://doi.org/10.1002/mrm.21977 (2009) Kleinnijenhuis, M. et al. Layer-specific diffusion weighted imaging in human primary visual cortex in vitro. Cortex 49, 2569–2582, https://doi.org/10.1016/j.cortex.2012.11.015 (2013) Calamante, F., Tournier, J. D., Jackson, G. D. & Connelly, A. Track-density imaging (TDI): super-resolution white matter imaging using whole-brain track-density mapping. NeuroImage 53, 1233–1243, https://doi.org/10.1016/j.neuroimage.2010.07.024 (2010) Calamante, F. et al. Track density imaging (TDI): Validation of super resolution property. NeuroImage 56, 1259–1266, https://doi.org/10.1016/j.neuroimage.2011.02.059 (2011) Smith, R. E., Tournier, J. D., Calamante, F. & Connelly, A. SIFT: Spherical-deconvolution informed filtering of tractograms. NeuroImage 67, 298–312, https://doi.org/10.1016/j.neuroimage.2012.11.049 (2013) Axer, M. et al. High-resolution fiber tract reconstruction in the human brain by means of three-dimensional polarized light imaging. Front Neuroinform 5, 34, https://doi.org/10.3389/fninf.2011.00034 (2011) Dammers, J. et al. Signal enhancement in polarized light imaging by means of independent component analysis. Neuroimage 49, 1241–1248, https://doi.org/10.1016/j.neuroimage.2009.08.059 (2010) Gwyn, D. G., Leslie, R. A. & Hopkins, D. A. Observations on the Afferent and Efferent Organization of the Vagus Nerve and the Innervation of the Stomach in the Squirrel-Monkey. Journal of Comparative Neurology 239, 163–175, https://doi.org/10.1002/cne.902390204 (1985) Kalia, M. & Mesulam, M. Brain-Stem Projections of Sensory and Motor Components of the Vagus Complex in the Cat.1. The Cervical Vagus and Nodose Ganglion. Journal of Comparative Neurology 193, 435–465, https://doi.org/10.1002/cne.901930210 (1980) Anderson, F. D. & Berry, C. M. An Oscillographic Study of the Central Pathways of the Vagus Nerve in the Cat. Journal of Comparative Neurology 106, 163–181, https://doi.org/10.1002/cne.901060106 (1956) Beckstead, R. M. & Norgren, R. Autoradiographic Examination of the Central Distribution of the Trigeminal, Facial, Glossopharyngeal, and Vagal Nerves in the Monkey. Journal of Comparative Neurology 184, 455–472, https://doi.org/10.1002/cne.901840303 (1979) Jacquin, M. F., Semba, K., Egger, M. D. & Rhoades, R. W. Organization of HRP-labeled trigeminal mandibular primary afferent neurons in the rat. The Journal of comparative neurology 215, 397–420, https://doi.org/10.1002/cne.902150405 (1983) Central connections of trigeminal primary afferent neurons: topographical and functional considerations Critical reviews in oral biology and medicine: an official publication of the American Association of Oral Biologists 4 The phylogenetic continuity of neural mechanisms of illustrated by the spinal tract of V and its nucleus Research publications - Association for Research in Nervous and Mental Disease 33 Functional Organization in the Main Sensory Trigeminal Nucleus and in the Rostral Subdivision of the Nucleus of the Spinal Trigeminal Tract in the Cat Sawyer, E. K., Leitch, D. B. & Catania, K. C. Organization of the spinal trigeminal nucleus in star-nosed moles. J Comp Neurol 522, 3335–3350, https://doi.org/10.1002/cne.23605 (2014) The corticotrigeminal projection in the cat A study of the organization of cortical projections to the spinal trigeminal nucleus Nord, S. G. Somatotopic organization in the spinal trigeminal nucleus, the dorsal column nuclei and related structures in the rat. J Comp Neurol 130, 343–356, https://doi.org/10.1002/cne.901300406 (1967) On the anatomical and functional organization of the spinal trigeminal nucleus Experiences with intramedullary tractotomy: II Immediate and late neurologic complications Ganchrow, D. Intratrigeminal and thalamic projections of nucleus caudalis in the squirrel monkey (Saimiri sciureus): a degeneration and autoradiographic study. The Journal of comparative neurology 178, 281–312, https://doi.org/10.1002/cne.901780206 (1978) Trigeminal projections to thalamus and subthalamus in the hedgehog tenrec Origin of ascending intratrigeminal pathways in the cat The Neurological Basis of Oral and Facial Function Henssen, D. et al. Vagus nerve stimulation for primary headache disorders: An anatomical review to explain a clinical phenomenon. Cephalalgia, 333102419833076, https://doi.org/10.1177/0333102419833076 (2019) Gieroba, Z. J. & Blessing, W. W. Fos-Containing Neurons in Medulla and Pons after Unilateral Stimulation of the Afferent Abdominal Vagus in Conscious Rabbits. Neuroscience 59, 851–858, https://doi.org/10.1016/0306-4522(94)90289-5 (1994) Yousfimalki, M. & Puizillout, J. J. Induction of Fos-Like Protein in Neurons of the Medulla-Oblongata after Electrical-Stimulation of the Vagus Nerve in Anesthetized Rabbit. Brain Research 635, 317–322, https://doi.org/10.1016/0006-8993(94)91454-0 (1994) Garcia, R. G. et al. Modulation of brainstem activity and connectivity by respiratory-gated auricular vagal afferent nerve stimulation in migraine patients. Pain 158, 1461–1472, https://doi.org/10.1097/j.pain.0000000000000930 (2017) In International Association for the Study of Pain (IASP) World Congress on Pain (Boston Hawkins, J. L., Cornelison, L. E., Blankenship, B. A. & Durham, P. L. Vagus nerve stimulation inhibits trigeminal nociception in a rodent model of episodic migraine. Pain Rep 2, e628, https://doi.org/10.1097/PR9.0000000000000628 (2017) Beaumont, E. et al. Cervical vagus nerve stimulation augments spontaneous discharge in second- and higher-order sensory neurons in the rat nucleus of the solitary tract. Am J Physiol Heart Circ Physiol 313, H354–H367, https://doi.org/10.1152/ajpheart.00070.2017 (2017) Moller, M., Schroeder, C. F. & May, A. Vagus nerve stimulation modulates the cranial trigeminal autonomic reflex. Annals of Neurology 84, 886–892, https://doi.org/10.1002/ana.25366 (2018) Vagus Nerve Stimulation Modulates the Cranial Trigeminal-Autonomic Reflex - a Comparison Trial of Different Sham-Conditions Frangos, E. & Komisaruk, B. R. Access to Vagal Projections via Cutaneous Electrical Stimulation of the Neck: fMRI Evidence in Healthy Humans. Brain Stimulation 10, 19–27, https://doi.org/10.1016/j.brs.2016.10.008 (2017) Contreras, R. J., Beckstead, R. M. & Norgren, R. The Central Projections of the Trigeminal, Facial, Glossopharyngeal and Vagus Nerves - an Autoradiographic Study in the Rat. J Autonom Nerv Syst 6, 303–322, https://doi.org/10.1016/0165-1838(82)90003-0 (1982) Involvement of Solitary Tract Nucleus in Control of Nociceptive Transmission in Cat Spinal-Cord Neurons Zerari-Mailly, F., Buisseret, P., Buisseret-Delmas, C. & Nosjean, A. Trigemino-solitarii-facial pathway in rats. Journal of Comparative Neurology 487, 176–189, https://doi.org/10.1002/cne.20554 (2005) Mercante, B. et al. Trigeminal Nerve Stimulation Induces Fos Immunoreactivity in Selected Brain Regions, Increases Hippocampal Cell Proliferation and Reduces Seizure Severity in Rats. Neuroscience 361, 69–80, https://doi.org/10.1016/j.neuroscience.2017.08.012 (2017) Catani, M., Thiebaut de Schotten, M. A diffusion tensor imaging tractography atlas for virtual in vivo dissections. Cortex 44, 1105–1132, https://doi.org/10.1016/j.cortex.2008.05.004 (2008) Maier-Hein, K. H. et al. The challenge of mapping the human connectome based on diffusion tractography. Nat Commun 8, 1349, https://doi.org/10.1038/s41467-017-01285-x (2017) Magnain, C. et al. Blockface histology with optical coherence tomography: a comparison with Nissl staining. NeuroImage 84, 524–533, https://doi.org/10.1016/j.neuroimage.2013.08.072 (2014) Seehaus, A. K. et al. Histological validation of DW-MRI tractography in human postmortem tissue. Cereb Cortex 23, 442–450, https://doi.org/10.1093/cercor/bhs036 (2013) Download references Department of Radiology and Nuclear Medicine Henssen co-developed the PLI system at the Radboud University Medical Center MR scanned the specimen and performed part of the PLI processing Henssen also wrote the body of the manuscript constructed tables and figures and corrected the content in compliance with the suggestions provided by the co-authors contributed to the systematic literature search and reviewed the retrieved papers He synthesized the found evidence and wrote the body of the text and constructed the tables Derks performed part of the PLI processing and contributed to writing the first version of the manuscript van Doorn performed part of the PLI processing and contributed to writing the first version of the manuscript Verhoogt performed part of the PLI processing and contributed to writing the first version of the manuscript Staats provided feedback on the different versions of the manuscript Vissers provided feedback on the different versions of the manuscript and helped in re-writing the body of the text Van Cappellen van Walsum provided feedback on the different versions of the manuscript Professor Peter Staats is an employee of both National Spine and Pain Centers and ElectroCore obtaining the data or interpreting the results and no funding was received for conducting this research None of the authors declare a conflict of interest in the conduction of this research Download citation DOI: https://doi.org/10.1038/s41598-019-47855-5 Get details about our clinical trials that are currently enrolling patients Renal medullary carcinoma (RMC) is a rare type of kidney cancer it is usually found in younger Black people RMC forms in a part of the kidney called the renal medulla About 70% of cases develop in the right kidney All RMC cells have lost the ability to make a protein called INI1 (also known as IN-1 This protein normally stops tumors from forming tumor tissue should be examined for the presence of INI1 it may be RMC or another cancer that also does not produce INI1 Additional tests will be needed to get a definitive diagnosis it is important that the tumor tissue be evaluated by a pathologist (a doctor who specializes in diagnosing disease) with experience diagnosing the disease RMC is also linked to genetic mutations that can cause red blood cells to become rigid with a curved shape that looks like a sickle These disorders are called sickle hemoglobinopathies The most common sickle hemoglobinopathy is the sickle cell trait People with sickle cell trait usually have no other symptoms and live normal lives Many individuals with sickle cell trait do not know they have it Patients diagnosed with RMC should undergo a special blood test to determine if they have sickle cell trait or other sickle hemoglobinopathies the sickle cell trait is most common among Black people Most cases are diagnosed in people in their teens and twenties RMC occurs in individuals who do not have any sickle hemoglobinopathies This is a rare RMC subtype that may be called renal cell carcinoma unclassified with medullary phenotype (RCCU-MP) Treatment of RCCU-MP is often like the treatment for RMC that is associated with sickle hemoglobinopathies Less than 1% of kidney cancers are diagnosed as RMC Because the disease is rare and hard to recognize RMC patients are often misdiagnosed with another condition It is critical to correctly diagnose RMC because the disease does not respond to the medications that treat most other kidney cancers Because RMC is aggressive and often diagnosed late few patients today survive more than two years Awareness of RMC has increased in recent years so the number of patients diagnosed with the disease has grown Treatment of RMC has also improved recently More patients are being diagnosed earlier and doctors have developed new ways to fight the disease less than half of patients with RMC survived more than a year from diagnosis with proper management using current therapies Some patients have even been completely cured by these new treatments Research and clinical trials are underway to continue improving care for patients with RMC MD Anderson Research helps pregnant RMC patient A risk factor is anything that increases the chance of developing a particular disease it is important to discuss any symptoms with your doctor since they may signal other health problems and it is often misdiagnosed as other kidney cancers The treatments for these other cancers do not work on RMC MD Anderson has pathologists dedicated to diagnosing kidney diseases Since MD Anderson is home to the largest RMC program in the world our pathologists are among the most experienced in recognizing this rare disease The following tests may be used to diagnose RMC and monitor the patient during treatment a small tissue sample is removed and examined under a microscope for cancer cells This is the only way to definitively diagnose RMC Doctors perform most RMC biopsies using a live ultrasound or CT image to guide a needle to the tumor The needle then takes a small sample of the suspected cancer tissue for examination Imaging exams are used to look for cancer inside the body see if the cancer has spread from its original site and track how the body is responding to treatment Learn more about imaging exams. The most common imaging exam for RMC is the CT scan CT scans use an X-ray machine to take several pictures from different angles They should also scan the abdomen and the pelvis to see if the cancer has spread to other parts of the body These tests are used to monitor patients’ health and track how they are responding to treatment The following treatments are used for people with RMC control their growth or relieve disease-related symptoms Chemotherapy may involve a single drug or a combination of two or more drugs depending on the type of cancer and how fast it is growing. Chemotherapy is the first treatment for most patients with RMC If the tumor shrinks enough from chemotherapy Learn more about chemotherapy. The entire kidney is usually removed in RMC surgery The organ is removed because RMC tumors are located deep in the kidney If the surgeon tried to remove the tumor only focused beams of energy to kill cancer cells There are several different radiation therapy techniques Doctors can use these to accurately target a tumor while minimizing damage to healthy tissue. Learn more about radiation therapy. Clinical trials are a key component of MD Anderson's mission to end cancer MD Anderson uses clinical trials to find better ways to prevent Doctors use treatment trials to learn more about how to fight cancer MD Anderson designed and conducted the first clinical trials dedicated exclusively to RMC. Your doctor may offer you a clinical trial as a treatment option Learn more about clinical trials. Renal medullary carcinoma is a rare cancer Most oncologists see only a few RMC patients in their entire careers MD Anderson treats dozens of patients with RMC every month This gives our doctors incredible expertise in this disease MD Anderson has pathologists dedicated exclusively to diagnosing kidney cancer This allows them to identify a disease that is often misdiagnosed you will work with a team of kidney experts radiation oncologist and medical oncologist They work closely together to plan and coordinate your treatment MD Anderson is also a leader in RMC research The first clinical trial dedicated to finding new treatments for the disease was conducted here Our physicians and scientists continue to research new ways to treat RMC and the newest and most promising therapies for RMC are often tested first at MD Anderson. In fact a study of recent years shows that a growing percentage of MD Anderson RMC patients are surviving for more than two years after their diagnosis